СПОСОБ УЛУЧШЕНИЯ ФУНКЦИИ МОЧЕВОГО ПУЗЫРЯ

Группа изобретений относится к медицине и фармации. Предложено применение i) уридина и/или эквивалента, выбранного из группы, состоящей из дезоксиуридина, уридин фосфатов, нуклеинового основания урацила и/или ацилированных производных уридина и/или сложных эфиров и (ii) n-3 полиненасыщенных жирных кислот (PUFA) для производства композиции для восстановления или улучшения функции мочевого пузыря у субъекта, имеющего нарушенную функцию мочевого пузыря и где субъектом является пациент, который страдает, выздоравливает от, и/или страдал неврологическим нарушением и соответствующий способ лечения указанного нарушения. Технический результат состоит в сокращении (с 12 до 2 дней) сроков восстановления рефлекторной способности мочевого пузыря к опорожнению на модели статистического сдавливания спинного мозга на уровне Т12 грудного отдела позвоночника. 2 н. и 19 з.п. ф-лы, 2 табл., 2 пр.

СРЕДСТВО И ПРОДУКТ ПИТАНИЯ ДЛЯ ПРОФИЛАКТИКИ/УМЕНЬШЕНИЯ ПРОЯВЛЕНИЙ ФУНКЦИОНАЛЬНОГО РАССТРОЙСТВА ПИЩЕВАРЕНИЯ

... 1. Средство для профилактики или уменьшения проявлений функционального расстройства желудочно-кишечного тракта, содержащее в качестве активного ингредиента, по меньшей мере, один компонент, выбранный из группы, включающей глутаминовую кислоту, 5'-нуклеотид и их соль.2. Средство по п.1, где вышеуказанный 5'-нуклеотид выбран из группы, включающей 5'-инозиновую кислоту, 5'-гуаниловую кислоту, 5'-адениловую кислоту, 5'-цитидиловую кислоту, 5'-уридиловую кислоту и 5'-ксантиловую кислоту.3. Средство по п.1, где вышеуказанный 5'-нуклеотид выбран из 5'-инозиновой кислоты и 5'-гуаниловой кислоты.4. Средство по п.1, где вышеуказанная соль представляет собой соль основной аминокислоты.5. Средство по п.4, где основная аминокислота выбрана из группы, включающей аргинин, лизин и орнитин.6. Средство по п.4, где основная аминокислота представляет собой аргинин.7. Средство по п.1, где вышеуказанный активный ингредиент представляет собой аргининовую соль с глутаминовой кислотой.8. Средство по п.1, где вышеуказанное ...

НУТРИТИВНАЯ КОМПОЗИЦИЯ ДЛЯ УЛУЧШЕНИЯ ФУНКЦИИ МОЗГА ПРИ ФЕНИЛКЕТОНУРИИ

СПОСОБ УЛУЧШЕНИЯ ФУНКЦИИ МОЧЕВОГО ПУЗЫРЯ

СПОСОБ УЛУЧШЕНИЯ УПРАВЛЯЮЩИХ ФУНКЦИЙ

... 1. Применение композиции для изготовления продукта для улучшения управляющих функций у субъекта, нуждающегося в этом, причем указанная композиция содержит:i) один или несколько из уридина и цитидина или их солей, фосфатов, ацильных производных или сложных эфиров; иii) липидную фракцию, содержащую по меньшей мере одну из докозагексаеновой кислоты (22:6; DHA), эйкозапентаеновой кислоты (20:5; ЕРА) и докозапентаеновой кислоты (22:5; DPA) или их сложных эфиров.2. Применение композиции для изготовления продукта для лечения субъекта, нуждающегося в этом, причем указанная композиция содержит:i) один или несколько из уридина и цитидина или их солей, фосфатов, ацильных производных или сложных эфиров; иii) липидную фракцию, содержащую по меньшей мере одну из докозагексаеновой кислоты (22:6; DHA), эйкозапентаеновой кислоты (20:5; ЕРА) и докозапентаеновой кислоты (22:5; DPA) или их сложных эфиров,причем указанный субъект проходит тестирование на управляющие функции.3. Применение по п. 2, в котором ...

НОВЫЕ ГЕНЫ АЦИЛТРАНСФЕРАЗЫ ЛИЗОФОСФАТИДНОЙ КИСЛОТЫ

... 1. Нуклеиновая кислота, содержащая нуклеотидную последовательность, указанную в любом из пп. (a)-(e) ниже: ! (a) нуклеотидную последовательность, которая кодирует белок, состоящий из аминокислотной последовательности с делецией, заменой или добавлением одной или нескольких аминокислот в аминокислотной последовательности, показанной в SEQ ID NO: 2 или 4, и обладающий активностью ацилтрансферазы лизофосфатидной кислоты; ! (b) нуклеотидную последовательность, которая может гибридизоваться в жестких условиях с нуклеиновой кислотой, состоящей из нуклеотидной последовательности, комплементарной нуклеотидной последовательности, состоящей из последовательности SEQ ID NO: 36 или 37, и которая кодирует белок, обладающий активностью ацилтрансферазы лизофосфатидной кислоты; ! (c) нуклеотидную последовательность, которая состоит из нуклеотидной последовательности, на 67% или более идентичной нуклеотидной последовательности, состоящей из последовательности SEQ ID NO: 36 или 37, и которая кодирует белок ...

ENTERAL ZU VERABREICHENDES SUPPLEMENT ZUR PARENTERALEN ERNÄHRUNG ODER PARTIELLEN ENTERALEN/ORALEN ERNÄHRUNG BEI KRITISCH KRANKEN, CHRONISCH KRANKEN UND MANGELERNÄHRTEN

IMPROVEMENTS IN OR RELATING TO ORGANIC COMPOUNDS

Infant formula containing nucleotides.

NUTRIENT COMPOSITION AND COMPOSITION TO PRÄVENTION/MITIGATION OF DIGESTIVE TRACT DEPRESSION

NADH AND NADPH AS ENERGY SUBSTITUTES.

FUMARIC ACID DOUBLE SALTS WITH CARNITIN AND A AMINO ACID AND FOOD AND FOOD ADDITIVES AND MEDICINES THIS CONTAINING

AMINO ACID COMPOSITIONS AND USE THE SAME CLINICAL APPROACHING

Compositions and methods for inhibiting the activation of dsRNA-dependent protein kinase and tumor growth inhibition

Product and method for control of obesity

Improving recognition

The invention relates to a composition for use in the treatment or prevention of recognition dysfunction, and/or for improving recognition, in a (prodromal) Alzheimer's patient, in particular in a drug-naive (prodromal) Alzheimer's patient, more particularly in a subject with a mini-mental state examination of 20–30.

Method for treating neurotrauma

The invention relates to a composition comprising: i) one or more of uridine and cytidine, or salts, phosphates, acyl derivatives or esters thereof; ii) a lipid fraction comprising at least one of docosahexaenoic acid (22:6; DHA), eicosapentaenoic acid (20:5; EPA) and docosapentaenoic acid (22:5; DPA), or esters thereof, in which the lipid fraction comprises less than 2 weight% of - linolenic acid (ALA), calculated on the weight of all fatty acids; iii) choline, or salts or esters thereof; for use in the prevention or treatment of neurotrauma, traumatic brain injury, cerebral palsyand spinal cord injury.

Composition for improving neuropsychological test battery score

The invention relates to a composition comprising: (i) one or more of uridine and cytidine, or salts, phosphates, acyl derivatives or esters thereof; and (ii) a lipid fraction comprising at least one of docosahexaenoic acid (22:6; DHA), eicosapentaenoic acid (20:5; EPA) and docosapentaenoic acid (22:5; DPA),or esters thereof, for use in the improvement of the composite NTB score. The invention also provides an improved NTB method comprising an optimized set of individualized tests, in particular for a (prodromal or mild) Alzheimer's or dementia patient.

Method for treating neurotrauma

Abstract The invention relates to a composition comprising: i) one or more of uridine and cytidine, or salts, phosphates, acyl derivatives or esters thereof; ii) a lipid fraction comprising at least one of docosahexaenoic acid (22:6; DHA), eicosapentaenoic acid (20:5; EPA) and docosapentaenoic acid (22:5; DPA), or esters thereof, in which the lipid fraction comprises less than 2 weight% of a linolenic acid (ALA), calculated on the weight of all fatty acids; iii) choline, or salts or esters thereof; for use in the prevention or treatment of neurotrauma, traumatic brain injury, cerebral palsy and spinal cord injury.

A nutritive composition containing milt

AGENT AND PROCESS FOR OPTIMIZING THE TISSUE MASS OF ORGANS WITHIN THE RANGE OF GENETIC VARIATION IN HUMANS AND ANIMALS

... of the disclosure The following can be used as active compounds to optimize the tissue mass of organs within the range of genetic variation of humans and animals: a) oligonucleotides, the terminal bases of which differ from adenine, and/or b) nucleic acid bases, with the exception of adenine, and/or c) carboxyl derivatives of nucleic acid bases, with the exception of adenine, and/or d) amino derivatives of nucleic acid bases, with the exception of adenine.

NOURISHING PRODUCTS ENRICHED WITH NUCLEOSIDES AND/OR NUCLEOTIDES FOR INFANTS AND ADULTS AND PROCESSES FOR THEIR PREPARATION

Nourishing products enriched with nucleosides and/or nucleotides for infants and adults and processes for their preparation. The invention relates to milk and non-milk infant formulas, and nourishing products for adults, in which the addition of nucleosides and/or nucleotides provides enhanced effects and properties. Also the processes for the preparation of these products are described.

RESETTING BIOLOGICAL PATHWAYS FOR DEFENDING AGAINST AND REPAIRING DETERIORATION FROM HUMAN AGING

Compositions for addressing one or more of the effects of aging are described. The compositions comprise a first component comprising repair system activator(s) such as nicotinamide adenine dinucleotide (NAD+), nicotinamide mononucleotide (NMN), nicotinamide riboside (NR), nicotinic acid adenine mononucleotide (NaMN), nicotinic acid adenine dinucleotide (NaAD), nicotinic acid riboside (NAR), 1-methylnicotinamide (MNM), cyclic adenosine monophosphate (cAMP) and combinations thereof; a second component comprising methyl donor(s) such as S-5'-adenosyl-L-methionine (SAM), methionine, betaine, choline, folate, vitamin B12, or combinations thereof; and a third component comprising antioxidant defense activators such as H2O2, N2S, NaSH, Na2S, and several others, including combinations thereof. Methods of administering the disclosed compositions or separate formulations of repair system activator, methyl donors, and antioxidant defense activators are also disclosed.

COMPOSITION

The present invention relates to compositions, in particular dietary compositions,that comprise a combination of choline cation and succinate anion (2-) and nicotinamide, and use of these compositions for maintaining and enhancing the brain energy metabolism in a human, and for preventing and treating symptoms and physiological conditions associated with an imbalanced, damaged or slowed brain energy metabolism in a human subject.

PEDIATRIC NUTRITIONAL COMPOSITION WITH MILK PEPTIDES FOR HEALTHY GROWTH AND DEVELOPMENT

The present disclosure generally provides pediatric nutritional compositions comprising a protein source comprising an intact milk protein and a partially hydrolyzed milk protein, wherein about 5% to about 25% of total nitrogen content of the composition is non-protein nitrogen. The pediatric nutritional compositions described herein also comprise a fat source and a carbohydrate source. The partially hydrolyzed protein source, in certain embodiments, provides peptides that have similar structure and function to the peptides found in human milk.

NUTRITIONAL COMPOSITIONS COMPRISING HUMAN MILK OLIGOSACCHARIDES AND NUCLEOTIDES AND USES THEREOF FOR TREATING AND/OR PREVENTING ENTERIC VIRAL INFECTION

Disclosed are nutritional compositions including human milk oligosaccharides and nucleotides that can be administered to preterm infants, term infants, toddlers, and children for reducing inflammation and the incidence of inflammatory diseases.

USE OF A REDUCED CALORIE INFANT FORMULA CONTAINING NUCLEOTIDES AND/OR CAROTENOIDS FOR REDUCING ADVERSE HEALTH EFFECTS LATER IN LIFE

The present disclosure is directed to reduced calorie infant formulas, and in particular, reduced calorie infant formulas that have at least one nucleotide and/or at least one carotenoid for reducing inflammation-related diseases later in life. Particularly, the reduced calorie infant formulas reduce the risk of obesity later in life.

FAT MIXTURE FOR INFANT AND ADULT NUTRITION

Fat mixture for infant and adult nutrition, basically comprising a mixture of phospholipids from the cerebrum of domestic animals, at least one vegetable oil, and/or at least an animal fat, and/or at least a fish oil, and/or medium chain triglycerides, in which the ratios between oleic/linoleic/alpha- linolenic fatty acids, between arachidonic/docosahexaenoic fatty acids, and its phospholipids content are similar to those of human milk and mediterranean diet.

ORALLY-INGESTIBLE NUTRITION COMPOSITIONS HAVING IMPROVED PALATABILITY

An orally-ingestible nutrition composition having improved taste comprises a low pH (< 7.0) form of an amino acid selected from arginine, valine and compounds associated with the synthesis of polyamines. Preferred low pH forms are salts such as arginine phosphate and mixtures thereof with arginine citrate. Preferred nutrition compositions also comprise encapsulated polyunsaturated fatty acid.

Nutrient liq fermentation prods. contg. enzymes - obtd. by fermenting edible plants with wine and fruit juice

Liq. fermentation prods. contg. enzymes are produced by finely slurrying parts of edible plants by mechanical means, and fermenting, with addn. of sugar, juice from berries, wine and water. Nucleic acids, which are reqd. by man and animals, but cannot be synthesised in some states of disease or infection, are provided by these liq. fermentation prods. The acid reaction (pH 2.5-3.5) of the prods. promotes the activity of the intestinal flora (Escherichia coli) in their action against the septic bacterial flora with pH is not 7-7.8. (Proteus vulgaris, Pseudomonas pyocyanea, etc.) and makes it possible to inhibit the sources of prim. and sec. infection, e.g. Stphylococcus, Meningococcus, the bacilli of influenza, diphtheria and tatanus, and many viruses.

Procédé de préparation d'aliments nourrissants et fortifiants pour l'homme et les animaux

Composition for optimising the tissue biomass of organs within the genetic range of variation in humans and animals

The composition for optimising the tissue biomass of organs within the genetic range of variation in humans and animals contains a) at least one oligonucleotide whose terminal bases are other than adenine, and/or b) at least one nucleic base with the exception of adenine and/or c) at least one carboxylated nucleic base with the exception of carboxylated adenine, as active substances in combination with a carrier. To optimise the tissue biomass of organs within the genetic range of variation in animals, such a composition is introduced into the animal body.

A method for removing the natural bitterness of the treated fruit and vegetables, as well as the bitterness of the artificial sweetening agents

DIETARY SUPPLEMENT COMPRISING A MIXTURE OF MAGNESIUM OXIDE AND MAGNESIUM CARBONATE

Nutritive milk additive - to simulate mother's milk contains a high content of nucleic acids

Pharmaceutical composition for preventing or treating infertility or abortion comprising inhibitors of mSIN1 protein as an active ingredient

“formula for babies”.

LDL-CHOLESTEROL-LOWERING CELL EXTRACT AND FOOD SUPPLEMENT

NUCLEOTIDE COMPOSITION AND APPLICATION IN FOOD THEREOF

NUCLEOTIDE COMPOSITION AND APPLICATION IN FOOD THEREOF A nucleotide composition used as a food additive consists of 58-72% CMP, 6-14% AMP, 10-18% UMP and 8-14% GMP, or consists of 58-70% CMP, 7.5-12.5% AMP, 12-16.5% UMP, 10-13% GMP and 0-2.5% IMP. The composition is used to prepare foods, such as an infant food and a dairy product, and achieves the following effects: improving immunostimulation, promoting growth and development, facilitating repair after intestinal injury, promoting the growth of intestinal beneficial microorganisms, and/or any combination thereof. Fig. 1 ...

INFANT FORMULA CONTAINING NUCLEOTIDES

Infant formula compositions are provided which comprise 3.2mg/L to 15.4 mg/L of CMP; 1.8 mg/L to 11.0 mg/L of UMP; 1.8 mg/L to 8.0 mg/L of GMP; 0.1 mg/L to 2.2 mg/L of IMP; and 2.5 mg/L to 13.2 mg/L of AMP.

КОМПОЗИЦИЯ ДЛЯ ДЕТСКОГО ПИТАНИЯ (ВАРИАНТЫ) И СПОСОБ ПОЛУЧЕНИЯ БЕЛКОВОГО ГИДРОЛИЗАТА

Изобретение относится к улучшенным композициям для детского питания. Композиция для детского питания включает белковый компонент с содержанием фосфора менее 0,75 г на 100 г белка и легко перевариваемый ребенком липидный компонент, в котором остатки пальмитиновой кислоты составляют более 10% от всех остатков жирных кислот, присутствующих в триглицеридах, а триглицериды с остатком пальмитиновой кислоты в Sn2 положении составляют, по меньшей мере, 30% указанных остатков пальмитиновой кислоты. Способ получения белкового гидролизата предусматривает гидролиз белкового исходного материала, имеющего содержание фосфора менее 0,75 на 100 г белка, комбинацией трипсина, по меньшей мере, одной эндопротеиназы и, по меньшей мере, одной экзопротеиназы. Изобретение позволяет получить композицию для детского питания, обеспечивающую уменьшение запоров, дискомфорта в области желудка и желудочно-кишечных расстройств. 3 с. и 20 з.п. ф-лы, 4 табл.

СПОСОБ ЛЕЧЕНИЯ НЕЙРОТРАВМЫ

Изобретение относится к фармацевтической промышленности и представляет собой применение композиции для получения продукта для лечения повреждения спинного мозга, где указанная композиция содержит: один или более из по меньшей мере одного уридина или его эквивалента, выбранного из группы, состоящей из следующих: уридин, т.е. рибозилурацил, дезоксиуридин, уридинфосфаты, выбранные из UMP, dUMP, UDP или UTP, или нуклеиновое основание урацила, липидную фракцию, содержащую по меньшей мере одну из докозагексаеновой кислоты (22:6; DHA), эйкозапентаеновой кислоты (20:5; ЕРА) и докозапентаеновой кислоты (22:5; DPA) или их сложные эфиры, где липидная фракция содержит менее чем 2 масс. % α-линоленовой кислоты (ALA), в пересчете на массу всех жирных кислот и холин или его соли и сложные эфиры, где указанная композиция дополнительно содержит по меньшей мере один витамин комплекса В, выбранный из витамина В6, витамина В12 и витамина В9 или их эквивалентов. Изобретение обеспечивает значительное меньший ...

НУТРИТИВНАЯ КОМПОЗИЦИЯ ДЛЯ УЛУЧШЕНИЯ ФУНКЦИИ МОЗГА ПРИ ФЕНИЛКЕТОНУРИИ

Группа изобретений относится композициям, содержащим нутритивную композицию для применения в лечении или диетотерапии фенилкетонурии или гиперфенилаланинемии. Применение нутритивной композиции для сохранения и улучшения когнитивной функции и снижения нарушений когнитивной функции у пациентов с фенилкетонурией или гиперфенилаланинемией, причем указанная композиция содержит: белковую фракцию, при этом белковая фракция содержит менее чем 0,1 вес.% фенилаланина от общего содержания белка; уридин или его эквивалент; докозагексаеновую кислоту (ДГК) и эйкозапентаеновую кислоту (ЭПК) или их сложные эфиры; холин, соль холина и/или сложный эфир холина, взятые в определенном соотношении. Применение композиции при получении добавки для применения в диетотерапии. Композиция для применения в пищевой добавке при диетотерапии при фенилкетонурии или гиперфенилаланинемии. Вышеописанные композиции позволяют расширить арсенал средств для применения в лечении или диетотерапии фенилкетонурии или гиперфенилаланинемии ...

МОЛОЧНАЯ СМЕСЬ, СОДЕРЖАЩАЯ ОЛИГОСАХАРИДЫ ГРУДНОГО МОЛОКА, ПОЛИНЕНАСЫЩЕННЫЕ ЖИРНЫЕ КИСЛОТЫ, НУКЛЕОТИДЫ И ЛЮТЕИН

Изобретение относится к пищевой промышленности, а именно к молочной смеси для ребенка грудного возраста. Молочная смесь содержит по меньшей мере один олигосахарид грудного молока, выбранный из 2'-фукозиллактозы (2'-ФЛ) и лакто-N-неотетраозы (LNnT), полиненасыщенные жирные кислоты (ПНЖК): докозагексаеновую кислоту (ДГК) и арахидоновую кислоту (АК), при этом АК и ДГК присутствуют в соотношении n-6/n-3, составляющем от 1 до 1,8, по меньшей мере 30 мг/л нуклеотидов, при этом нуклеотиды включают инозинмонофосфат, а также по меньшей мере 30 мкг/л лютеина. Изобретение также относится к способу улучшения и к композиции, которые предназначены для улучшения познавательной способности у ребенка грудного возраста, путем введения ребенку грудного возраста вышеуказанной молочной смеси. 3 н. и 16 з.п. ф-лы, 2 табл.

ПРИЯТНАЯ НА ВКУС ПИТАТЕЛЬНАЯ КОМПОЗИЦИЯ, СОДЕРЖАЩАЯ НУКЛЕОТИД И/ИЛИ НУКЛЕОЗИД И МАСКИРУЮЩИЙ ВКУС АГЕНТ

Настоящее изобретение относится к пищевой промышленности. Предложено применение маскирующего вкус агента для улучшения одной или нескольких характеристик, выбранных из ощущения во рту, вкуса, послевкусия и запаха жидкой водной питательной композиции, содержащей нуклеозид(ы) уридин, цитидин и/или их производное(ые), и/или их нуклеотид(ы), а также неприятное на вкус пищевое масло. При этом маскирующий вкус агент выбран из группы целлюлозы; крахмала; ксантановой камеди; геллановой камеди; альгината; галактоманнанов, таких как галактоманнаны из семян пажитника, гуаровая камедь, камедь тары, камедь плодов рожкового дерева и камедь кассии; камеди карайи; камеди трагаканта; каррагинана; и их смеси. Предложена также жидкая композиция, содержащая (i) рыбий жир, (ii) уридин, цитидин и/или их нуклеотиды, и (iii) маскирующий вкус агент. Жидкую композицию применяют для профилактики и/или лечения нейродегенеративных расстройств. Изобретение позволяет получить композицию, содержащую неприятное на вкус ...

ЭНТЕРАЛЬНО ВВОДИМАЯ ДОБАВКА ДЛЯ ПАРЕНТЕРАЛЬНОГО ПИТАНИЯ ИЛИ ЧАСТИЧНОГО ЭНТЕРАЛЬНОГО/ОРАЛЬНОГО ПИТАНИЯ В СЛУЧАЕ КРИТИЧЕСКИХ БОЛЬНЫХ, ХРОНИЧЕСКИХ БОЛЬНЫХ И БОЛЬНЫХ С НЕДОСТАТОЧНЫМ ПИТАНИЕМ

Изобретение относится к медицине, в частности к энтерально вводимой добавке для сохранения или восстановления интестинального кишечного барьера критических или хронических больных, а также пациентов с неполноценным питанием. Она содержит в виде раствора соответственно в расчете на суточную дозу а) глутамин и/или предшественник глутамина в количестве в пределах от 15 г до 70 г; b) по меньшей мере два представителя из группы действующих как антиоксиданты веществ и с) жирные кислоты с короткой цепью и/или предшественники жирных кислот с короткой цепью в количестве 0,5-10 г. Изобретение обеспечивает повышение сохранения или восстановления функции кишечного барьера. 3 н. и 21 з.п. ф-лы, 1 табл.

НОВЫЕ ГЕНЫ АЦИЛТРАНСФЕРАЗЫ ЛИЗОФОСФАТИДНОЙ КИСЛОТЫ

Настоящее изобретение относится к области молекулярной биологии и генетической инженерии и может быть использовано в пищевой промышленности. Из нитчатого гриба Mortierella alpina получены новые гены ацилтрансферазы лизофосфатидной кислоты (АТЛК). Определена кодирующая фермент нуклеотидная последовательность, описано конструирование содержащих ее экспрессионных векторов и включающих векторные конструкции по изобретению клеток-хозяев, а также получение рекомбинантных форм АТЛК, кодируемых новыми генами. 4 н.п. ф-лы, 14 табл., 6 ил., 9 пр.

СПОСОБ ЛЕЧЕНИЯ НЕЙРОТРАВМЫ

Группа изобретений относится к лечению травматического повреждения мозга и церебрального паралича. Раскрыто применение композиции для получения продукта для лечения травматического повреждения головного мозга и церебрального паралича, содержащей i) фосфаты уридина и/или цитидина; ii) липидную фракцию, содержащую докозагексаеновую кислоту (22:6; DHA) и эйкозапентаеновую кислоту (20:5; EPA), где липидная фракция содержит менее чем 2 масс.% α-линоленовой кислоты (ALA) в пересчете на массу всех жирных кислот; iii) холин или его соли; где указанная композиция дополнительно содержит по меньшей мере один витамин группы B. Также раскрыто применение набора для получения продукта для лечения травматического повреждения головного мозга и церебрального паралича. Группа изобретений обеспечивает лечение травматического повреждения мозга и церебрального паралича. 2 н. и 11 з.п. ф-лы, 6 ил., 1 табл., 3 пр.

СПОСОБ УЛУЧШЕНИЯ УПРАВЛЯЮЩИХ ФУНКЦИЙ

Предложено применение в течение 24 недель композиции для улучшения управляющих функций у субъекта с болезнью Альцгеймера или деменцией, включая их продромальные формы, причем управляющие функции включают скорость обработки информации, когнитивную и психическую гибкость, сканирование и/или смену когнитивных задач, указанная композиция содержит в суточной дозе, равной 125 мл: 300 мг эйкозапентаеновой кислоты, 1200 мг докозагексаеновой кислоты, 106 мг фосфолипидов, 400 мг холина, 625 мг UMP (монофосфата уридина), 40 мг витамина Е (альфа-ТЕ), 80 мг витамина С, 60 мкг селена, 3 мкг витамина В12, 1 мг витамина В6 и 400 мкг фолиевой кислоты. Технический результат: композиция улучшает все перечисленные нарушенные когнитивные функции при болезни Альцгеймера. 3 з.п. ф-лы, 2 ил., 1 табл., 2 пр.

КОМБИНАЦИЯ КОМПОНЕНТОВ ДЛЯ ПРОФИЛАКТИКИ И ЛЕЧЕНИЯ НЕМОЩНОСТИ

... 1. Композиция для профилактики или лечения немощности у млекопитающего, содержащая по меньшей мере два компонента, выбранных из группы (i) нуклеозидного аналога, выбранного из группы уридина, дезоксиуридина, фосфатов уридина (UMP, dUMP, UDP, UTP), урацила и ацилированных производных уридина, (ii) ω-3 полиненасыщенной жирной кислоты, выбранной из группы DHA, DPA и ЕРА, (iii) витамина В, выбранного из группы витамина В6, витамина В12 и витамина В9, (iv) фосфолипида, (v) антиоксиданта, выбранного из группы витамина С, витамина Е и селена, и (vi) холина, при условии присутствия по меньшей мере компонента (i), при этом данная композиция предназначена для введения человеку, страдающему расстройством, выбранным из группы деменции и болезни Альцгеймера, при этом такой человек имеет BMI ниже 26.2. Композиция для профилактики или лечения немощности у млекопитающего, содержащая по меньшей мере три компонента, выбранных из группы (i) нуклеозидного аналога, выбранного из группы уридина, дезоксиуридина ...

КОМПОЗИЦИЯ ДЛЯ ДЕТСКОГО ПИТАНИЯ С УЛУЧШЕННЫМ БЕЛКОВЫМ СОДЕРЖАНИЕМ

... 1. Композиция для детского питания, включающая a) белковый компонент с содержанием фосфора менее 0,75 г Р на 100 г белка, и b) липидный компонент, который легко переваривается ребенком, включающий триглицерид жирной кислоты, в котором остатки пальмитиновой кислоты составляют более 10% от всех остатков жирных кислот, присутствующих в триглицериде. 2. Композиция для детского питания по п.1, в которой белковый компонент а) содержит фосфора менее 0,72 г Р на 100 г белка, более предпочтительно менее 0,69 г Р на 100 г белка. 3. Композиция для детского питания по п.1 или 2, в которой триглицериды липидного компонента b), в котором остаток пальмитиновой кислоты находится в Sn1 или Sn3 положении, составляет не более 16% от всех присутствующих триглицеридов. 4. Композиция для детского питания по пп.1-3, в которой по меньшей мере один белковый компонент а) представляет собой гидролизат, полученный в результате гидролиза исходного материала, включающего белки из молока млекопитающих, или дефосфорилированный ...

ДЕГИДРАТИРОВАННЫЙ Na2-IMP В КАЧЕСТВЕ АГЕНТА, ПРЕПЯТСТВУЮЩЕГО СЛЕЖИВАНИЮ

КОМПОЗИЦИЯ ДЛЯ УЛУЧШЕНИЯ ОЦЕНКИ БАТАРЕИ НЕЙРОПСИХОЛОГИЧЕСКИХ ТЕСТОВ

... 1. Применение композиции для изготовления продукта для улучшения суммарной оценки батареи нейропсихологических тестов [NTB] у субъекта, нуждающегося в этом, причем указанная композиция содержит:i) один или несколько из уридина и цитидина или их солей, фосфатов, ацильных производных или сложных эфиров; иii) липидную фракцию, содержащую по меньшей мере одно из докозагексаеновой кислоты (22:6; DHA), эйкозапентаеновой кислоты (20:5; ЕРА) и докозапентаеновой кислоты (22:5; DPA) или их сложных эфиров.2. Применение композиции для изготовления продукта для лечения субъекта, нуждающегося в этом, причем указанная композиция содержит:i) один или несколько из уридина и цитидина или их солей, фосфатов, ацильных производных или сложных эфиров; иii) липидную фракцию, содержащую по меньшей мере одно из докозагексаеновой кислоты (22:6; DHA), эйкозапентаеновой кислоты (20:5; ЕРА) и докозапентаеновой кислоты (22:5; DPA) или их сложных эфиров,причем указанный субъект подвергается тестированию с использованием ...

ПРИЯТНАЯ НА ВКУС ПИТАТЕЛЬНАЯ КОМПОЗИЦИЯ, СОДЕРЖАЩАЯ НУКЛЕОТИД И/ИЛИ НУКЛЕОЗИД И МАСКИРУЮЩИЙ ВКУС АГЕНТ

... 1. Применение маскирующего вкус агента, выбранного из группы целлюлозы; крахмала; ксантановой камеди; геллановой камеди; альгината; галактоманнанов, таких как галактоманнаны из семян пажитника, гуаровая камедь, камедь тары, камедь плодов рожкового дерева и камедь кассии; камеди карайи; камеди трагаканта; каррагинана; и их смеси, для улучшения одной или нескольких характеристик, выбранных из ощущения во рту, послевкусия и запаха жидкой водной питательной композиции, содержащей нуклеозид(ы) уридин, цитидин и/или их производное(ые), и/или их нуклеотид(ы), причем указанная композиция дополнительно содержит неприятное на вкус пищевое масло. ! 2. Применение по п.1, в котором указанным нуклеозидом является уридин и/или и его производное(ые). ! 3. Применение по п.1, в котором указанным нуклеотидом является монофосфат уридина (УМФ), дифосфат уридина (УДФ) и/или трифосфат уридина (УТФ). ! 4. Применение по п.1, в котором жидкая водная питательная композиция содержит по меньшей мере 50 мг указанного ...

Therapeutic use of activators of zinc finger protein gli3

PROCEDURE FOR THE TRANSFORMATION FROM OXIMEN TO AMIDES

PHARMAKOLOGI FOOD COMPOSITION TO NAHRUNGSERGÄNGZUNG AND FEEDING INCREASE IN VALUE

ENTERALE COMPOSITION WITH RIBO NUCLEOTIDEN

BABY FOOD KIT FOR THE ADJUSTMENT OF THE SLEEP AWAKE CYCLE

BABY FEEDING PREPARATION WITH IMPROVED FAT COMPOSITION

BABY FEEDING PREPARATION CONTAINING A PRAEBIOTI MATERIAL

FISH FODDER WITH INCREASED CONTENT OF NUCLEOTIDES

FOOD, ENRICHED WITH A CONTENT OF NUCLEOSIDES AND/OR NUCLEOTIDES AND YOUR PRODUCTION.

HUMAN DELTA 5-DESATURASE-GEN

Fat mixture for infant and adult nutrition

Method for production of dry yeast containing S-adenosyl-L-methionine and having excellent storage stability, product produced by the method, and molded composition of the dry yeast

IMPROVING RECOGNITION

The invention relates to a composition for use in the treatment or prevention of recognition dysfunction, and/or for improving recognition, in a (prodromal) Alzheimer's patient, in particular in a drug-naive (prodromal) Alzheimer's patient, more particularly in a subject with a mini-mental state examination of 2030.

PRENATAL AND LACTATION SUPPLEMENTS TO ENHANCE CENTRAL NERVOUS SYSTEM DEVELOPMENT OF OFFSPRING

Disclosed are prenatal and lactation supplements for pregnant women and lactating women, which include a combination of RRR-alpha-tocopherol, docosahexaenoic acid (DHA), trans-lutein, phospholipids, and at least one nuclear receptor activating ligand other than RRR-alpha-tocopherol, DHA, and trans-lutein. The supplements may enhance central nervous system development in a fetus or breast-feeding newborn infant.

NUTRITIONAL COMPOSITIONS COMPRISING HUMAN MILK OLIGOSACCHARIDES AND NUCLEOTIDES AND USES THEREOF FOR TREATING AND/OR PREVENTING ENTERIC VIRAL INFECTION

Disclosed are nutritional compositions including human milk oligosaccharides and nucleotides that can be administered to preterm infants, term infants, toddlers, and children for reducing inflammation and the incidence of inflammatory diseases.

NUTRITIONAL COMPOSITIONS INCLUDING BRANCHED CHAIN FATTY ACIDS FOR IMPROVING GUT BARRIER FUNCTION

Nutritional compositions for improving, treating and/or preventing various medical conditions and methods of using same are provided. Such medical conditions include infection, sepsis, malabsorption, allergy, inflammatory bowel disease, and diarrhea among others. The nutritional compositions include branched chain fatty acids and may include other functional ingredients such as, but not limited to probiotics, nucleotides and amino acids. Methods of administering such nutritional products to individuals in need of same are also provided.

COMPOSITIONS AND METHODS FOR NEUTRALIZATION OF MYCOTOXINS, OF NUCLEOTIDES, PROTEIN AND VITAMINS AND FOR IMPROVEMENT OF TASTE OF FOOD AND FEED WITH USE OF MICRONIZED YEAST BIOMASS

METHOD FOR PRODUCTION OF DRY YEAST CONTAINING S-ADENOSYL-L-METHIONINE AND HAVING EXCELLENT STORAGE STABILITY, PRODUCT PRODUCED BY THE METHOD, AND MOLDED COMPOSITION OF THE DRY YEAST

... 본 발명은 S-아데노실-L-메티오닌 생산능을 갖는 효모를 이용하여 S-아데노실-L-메티오닌을 함유하는 건조 효모를 제조하는 방법에 있어서, 효모의 균체 배양액으로부터 얻어지는 효모 균체 농축물에 시클로덱스트린류를 첨가한 후에 건조하는 것을 특징으로 하는 S-아데노실-L-메티오닌 함유 건조 효모의 제조 방법, 상기 제조 방법으로 얻어진 SAMe 함유 건조 효모, 및 상기 건조 효모를 이용하여 성형된 조성물에 관한 것이다. 본 발명에 의해 수용성 생리 활성 물질로서 유용한 S-아데노실-L-메티오닌을 고농도로 포함하는 보존 안정성이 뛰어난 건조 효모 및 상기 건조 효모를 이용하여 성형된 조성물을 간편하고 경제적으로 제조하여 시장에 제공하는 것이 가능해 진다.

세레브론 단백질 또는 이를 코딩하는 유전자를 포함하는 근육 손상으로 유도된 근육 질환의 예방 또는 치료용 조성물

... 본 발명은 세레브론 단백질 또는 이를 코딩하는 유전자를 유효성분으로 포함하는 근육 손상으로 유도된 근육 질환의 예방 또는 치료용 조성물에 관한 것으로, 상기 세레브론 단백질은 근육 재생 과정에서 근육 분화 인자인 MyoD, PAX7의 발현을 증가시키고 근육 성장 억제 인자인 미오스타틴의 발현은 억제시키며, 손상된 근원 세포 또는 근육 조직의 분화 및 재생을 유도하므로, 근육 손상으로 유도된 근육 질환의 예방 또는 치료용 조성물로 유용하게 사용될 수 있다.

COMPOSITION FOR PREVENTING, IMPROVING OR TREATING ACUTE KIDNEY DISEASE

The present invention provides a composition for preventing, improving or treating an acute kidney disease which checks a molecular mechanism of peroxisome proliferator activated receptor γ coactivator 1α (PGC-1α) over-expressed in a renal tubular cell on a cell death signaling system due to oxidative stress in a renal tubular cell and identifies an action point as a cell death inhibitor, thereby preventing or treating an acute kidney disease by using the PGC-1α inhibiting cell death in a kidney. More specifically, a pharmaceutical composition for preventing, improving or treating an acute kidney disease includes a PGC-1α protein or a drug inducing over-expression of the protein as an active ingredient. COPYRIGHT KIPO 2018 ...

COMPOSITION FOR PREVENTING, IMPROVING OR TREATING RENAL FIBROSIS

The present invention provides a composition for preventing, improving or treating a renal fibrosis which checks a molecular mechanism of peroxisome proliferator activated receptor γ coactivator 1α (PGC-1α) over-expressed in a renal tubular cell on a renal fibrosis signaling system and identifies an action point of a renal fibrosis inhibitor, thereby preventing or treating the renal fibrosis by using the PGC-1α. More specifically, a pharmaceutical composition for preventing, improving or treating a renal fibrosis includes a PGC-1α protein or a drug inducing over-expression of the protein as an active ingredient. COPYRIGHT KIPO 2018 (AA) PGC-1 α overexpression ...

uso de uma composição para a fabricação de um produto para melhorar a pontuação na bateria de testes neuropsicológicos, método para avaliar a cognição de um indivíduo e uso de uma composição para a fabricação de um produto para tratar um indivíduo em necessidade da mesma

ISOTOPICALLY MODIFIED COMPOUNDS AND THEIR USE AS FOOD SUPPLEMENTS

A nutrient composition comprises an essential nutrient in which at least one exchangeable H atom is 2H and/or at least one C atom is 13C. The nutrient is thus protected from, inter alia, reactive oxygen species.

Method and compositions for promotion of wound treatment

The present invention comprises compositions and preparations for the promotion of wound healing in an animal. Methods for preparing the compositions as well as methods for using the compositions to achieve the promotion of wound healing, are also provided. The composition may comprise a dietary regimen or a therapeutic agent. These compositions include a wound healing promoting concentration of nucleotides. By way of example, such nucleotides may comprise RNA, adenine, uracil or a mixture thereof. The compositions can be prepared as suitable for oral, parenteral, intravenous or topical administration. Methods for using the preparation as a treatment to enhance the healing of an already existing wound or for use as a pretreatment regimen for animals in anticipation of surgery, are also disclosed.

Nutrient composition and composition for prevention/mitigation of digestive tract depression

As a nutritional composition and a composition for the prophylaxis or improvement of lower gastrointestinal function, which improve lower gastrointestinal function and are effective for the prophylaxis or improvement of diarrhea, gastroesophageal reflux or misswallowing caused by administration of a liquid nutritional supplement, the present invention provides a nutritional composition and a composition for the prophylaxis or improvement of lower gastrointestinal function, which comprise at least one kind selected from glutamic acid, 5-nucleotide and a salt thereof, wherein, when glutamic acid alone is contained, the content thereof on administration is 0.0013-1.3 w/v % as free glutamic acid.

NUTRITIONAL COMPOSITION FOR PROVIDING RELIEF FROM WINE INDUCED HEADACHES

A dietary nutritional supplement that provides relief for light to moderate wine consumers who experience headaches triggered by light to moderate wine consumption. The nutritional composition consists of at least one member selected from the group of ingredients consisting of: Molybdenum, Selenium, Vitamin B1, Vitamin B2, Vitamin B3, Vitamin B6, Folic acid, Quercetin, and Vitamin E. Alternative embodiments may include nitrogreens. The ingredients for the composition form a synergy with each other to improve metabolism of wine constituents. A method of use requires six sequential weeks of administering the composition in pill form and in predetermined quantities with predetermined amounts of wine. A survey questionnaire is given to experimental subjects to help assess the efficacy of the nutritional composition.

Composition for preventing or treating fibrosis including an inhibitor of CDK17 expression or activity

The present disclosure relates to a composition for preventing or treating fibrosis including an inhibitor of cyclin-dependent kinase 17 (CDK17) expression or activity. According to the present disclosure, the inhibitor of CDK17 expression or activity significantly reduces collagen production and cell activity and viability in activated hepatic stellate cells (liver fibrosis cell model), renal tubular epithelial cells (renal fibrosis cell model) in which fibrosis is induced by TGF-β treatment, and alveolar epithelial cells (lung fibrosis cell model) in which fibrosis is induced by TGF-β treatment, indicating that the composition of the present disclosure has an excellent effect in preventing or treating fibrosis.

БЕЛОК, ОБЛАДАЮЩИЙ АКТИВНОСТЬЮ В ОТНОШЕНИИ СТИМУЛЯЦИИ ЭЛОНГАЦИИ ЦЕПЕЙ ЖИРНЫХ КИСЛОТ, КОДИРУЮЩИЙ ЕГО ГЕН И ИХ ПРИМЕНЕНИЕ

Группа изобретений относится к биотехнологии, в частности к белку, обладающему активностью в отношении стимуляции элонгации цепей жирных кислот, и полинуклеотиду, кодирующему этот белок. Предложены также вектор экспрессии, содержащий полинуклеотид, и трансформант, полученный из S. cerevisiae, для продукции указанного белка, содержащий полинуклеотид либо вектор. Группа изобретений обеспечивает эффективное продуцирование жирных кислот с длинной цепью, имеющих 18 атомов углерода. 5 н. и 4 з.п. ф-лы, 3 ил., 3 табл.

ПЕРОРАЛЬНЫЕ ОСНОВА И ПРЕПАРАТ В ФОРМЕ ПЛЕНКИ

ПИТАТЕЛЬНАЯ ДОБАВКА

Способ стимулирования иммунной системы ВИЧ-инфицированных пациентов путем введения питательной добавки и применение омега-3 полиненасыщенных кислот и соединения, связанного с синтезом полиаминов, при производстве такой добавки.

КОМПОЗИЦИИ И СПОСОБЫ ДЛЯ ИНГИБИРОВАНИЯ АКТИВАЦИИ ПРОТЕИНКИНАЗЫ, ЗАВИСИМОЙ ОТ ДВУХЦЕПОЧЕЧНОЙ РНК, И ДЛЯ ПОДАВЛЕНИЯ ОПУХОЛЕВОГО РОСТА

... 1. Композиция по меньшей мере одного ингибитора протеинкиназы, зависимой от двухцепочечной РНК (PKR), для усиления лечения. ! 2. Композиция по п.1, в которой указанный по меньшей мере один ингибитор протеинкиназы, зависимой от двухцепочечной РНК (PKR), является ингибитором фосфорилирования. ! 3. Композиция по п.1, где указанное усиление является усилением указанного лечения. ! 4. Композиция по п.1, где указанное усиление является снижением частоты и/или тяжести по меньшей мере одного побочного эффекта указанного лечения. ! 5. Композиция по п.1, где указанный ингибитор предназначен для энтерального или парентерального введения. ! 6. Композиция по п.1, где указанный ингибитор является пищевой композицией. ! 7. Композиция по п.1, где указанный ингибитор является ингибитором клеточного роста. ! 8. Композиция по п.1, где указанный ингибитор является ингибитором репликации клетки. !9. Композиция по п.1, дополнительно содержащая, по меньшей мере, один модификатор протеинфосфатазы 1 альфа (PP1a ...

КОМПОЗИЦИЯ ДЛЯ УЛУЧШЕНИЯ УМСТВЕННЫХ СПОСОБНОСТЕЙ

УЛУЧШЕНИЕ УЗНАВАНИЯ

... 1. Применение композиции, содержащей:a. одну или несколько омега-3 жирных кислот, выбранных из группы, состоящей из докозагексаеновой кислоты (DHA), эйкозапентаеновой кислоты (EPA) и докозапентаеновой кислоты (DPA); иb. источник уридина, выбранный из уридина, дезоксиуридина, фосфатов уридина, урацила, ацилированногоуридина и цитидина;в изготовлении продукта для улучшения узнавания и/или для лечения или предупреждения нарушенной функции узнавания у субъекта.2. Применение по п. 1, в котором указанный субъект имеет один или несколько симптомов болезни Альцгеймера, умеренное когнитивное нарушение, возрастное ухудшение памяти, рассеянный склероз, сосудистую деменцию, лобновисочную деменцию, семантическую деменцию или деменцию с тельцами Леви.3. Применение по п. 1 или 2, в котором субъект представляет собой пациента с продромальной формой деменции и/или продромальной формой болезни Альцгеймера.4. Применение по п. 1 или 2, в котором композиция содержит в суточной дозе или, предпочтительно, на ...

2-Phasen-Präparat für Reisen

Zirkadianes Nahrungsergänzungsmittel zur Vorbeugung vor und Linderung von reisebedingten Beschwerden, bestehend aus einem 2-Phasen-Präparat, wobei die erste Phase D-Biotin und Vitamin C enthält,die zweite Phase Magnesium und Tryptophan enthält undmindestens eine der beiden Phasen weiterhin Folgendes enthält:- Laktobakterien und Bifidobakterien- Zink- Vitamin D.

PROCEDURE FOR THE DRYING PROCESS OF A MSG FREE PRODUCT OF VEGETABLE ONE ORIGIN, AND PRODUCT

Composition for improving neuropsychological test battery score

The invention relates to a composition comprising: (i) one or more of uridine and cytidine, or salts, phosphates, acyl derivatives or esters thereof; and (ii) a lipid fraction comprising at least one of docosahexaenoic acid (22:6; DHA), eicosapentaenoic acid (20:5; EPA) and docosapentaenoic acid (22:5; DPA),or esters thereof, for use in the improvement of the composite NTB score. The invention also provides an improved NTB method comprising an optimized set of individualized tests, in particular for a (prodromal or mild) Alzheimer's or dementia patient.

Novel compounds for the treatment of inflammatory bowel disease

The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5' to 3' (a) a first part whose sequence is between 50% and 100% complementary to the sequence AAAAGCUGGGUUGAGAGGGCGA; (b) a second part capable of forming a loop between the first and the third part; and (c) a third part comprising or consisting of the sequence AAAAGCUGGGUUGAGAGGGCGA; for use as a medicament. The present invention further relates to a nucleic acid molecule of up to 25 nucleotides comprising the sequence AAAAGCUGGGUUGAGAGGGCGA, for use as a medicament. In another aspect, the present invention relates to a composition comprising at least one mature miRNA selected from the group consisting of hsa-miR-320a, ptr-miR-320a, ppy-miR-320a, bta-miR-320, cfa-miR-320, mmu-miR-320, rno-miR-320, and mml-miR-320, and/or one or more mir-RNA precursor(s) thereof, for use as a medicament.

Method for improving bladder function

The invention pertains to the use of uridine and/or an equivalent thereof and n3-PUFA in the manufacture of a product for restoring or improving bladder function in a subject, in particular in a patient suffering from spinal cord injury.

Treatment or prevention of surgery-induced cachexia and/or expression of myeloid-derived suppressor cells and pro-inflammatory cytokines

A specialized immunonutrition supplement can be administered to a surgical patient to reduce post-operative complications by restraining the expansion of myeloid-derived suppressor cells. The supplement includes one or more of L-arginine, omega-3 fatty acids, vitamin A, and dietary nucleotides, preferably all four of these compounds. The supplement is administered to the patient at least once per day for a time period extending from a pre-operative day that is three to seven days prior to a bladder surgery of the patient to a post-operative day that is three to seven days after the bladder surgery. The supplement can be administered to treat or prevent post-operative paralytic ileus in a bladder cancer patient; treat or prevent surgery-induced, inflammation-induced or cancer-induced cachexia; reduce the incidence of chronic infections resulting from expansion of myeloid-derived suppressor cells in a patient; and/or reduce mRNA expression of pro-inflammatory cytokines in a patient.

Composition for improving efficacy of L-DOPA treatment

The invention pertains to a composition for use in (a) treatment of impaired motor skills in a mammal suffering from Parkinson's Disease; (b) improving the efficacy of levodopa (L-DOPA) in treatment of impaired motor skills in a mammal suffering from Parkinson's Disease; and/or (c) reducing L-DOPA associated side effects, preferably involuntary movements selected from the group consisting of choreiform, dystonic and dyskinetic movements, in the treatment of impaired motor skills in a mammal suffering from Parkinson's Disease, comprising co-administering to the subject L-DOPA and a composition comprising therapeutically effective amounts of: (i) at least one of uridine, cytidine, or salts, phosphates, acyl derivatives or esters thereof; (ii) at least one of docosahexaenoic acid (22:6; DHA), eicosapentaenoic acid (20:5; EPA) and docosapentaenoic acid (22:5; DPA); (iii) choline, or salts or esters thereof; and (iv) at least one vitamin B selected from vitamins B6, B9 and B12.

A nutritive composition containing milt

Nucleotide composition and application in food thereof

A nucleotide composition used as a food additive consists of 58-72% CMP, 6-14% AMP, 10-18% UMP and 8-14% GMP, or consists of 58-70% CMP, 7.5-12.5% AMP, 12-16.5% UMP, 10-13% GMP and 0-2.5% IMP. The composition is used to prepare foods, such as an infant food and a dairy product, and achieves the following effects: improving immunostimulation, promoting growth and development, facilitating repair after intestinal injury, promoting the growth of intestinal beneficial microorganisms, and/or any combination thereof.

bile resistant bacillus composition secreting high levels of essential amino acids

A bacillus composition characterized by fast germination and outgrowth in bile salts (simulated gut environment) and by high-level secretion of essential amino acid. The bacillus composition may be used as supplement in animal feed where it has a probiotic (health promoting) effect and increases the digestion and availability of nutrients from animal feeds.

Infant or follow-on formula

The formula of the invention, intended both for infants and young children, comprises modified sweet whey proteins free or almost free of CGMP, and at least one probiotic. The invention also pertains to methods for promoting physical development, improving gastro intestinal comfort and developing a healthy gut microflora in infants or young children by fully or partly feeding them with the said formula.

Chocolate flavoured probiotic supplement

The present invention refers to a food product. In particular, the present invention refers to a form of administration of a high and stable load of probiotic bacteria preferentially to persons of paediatric age. The present invention furthermore refers to a chocolate flavoured probiotic supplement, in particular to a probiotic tablet comprising an inner part, represented by a core of chocolate containing coated probiotic bacteria, and an outer part, represented by an outer coating. In particular, the present invention refers to a form of administration of a high and stable load of probiotic bacteria.

Low calorie dairy products

The present invention pertains to fermented dairy products with reduced caloric values, in particular to low-fat, milkshakes and smoothies having reduced amounts in sugar. The dairy products of the invention comprise gelatine. They have high foaming rates and are stable over time. Further, the present invention also relates to processes and kits-of-parts for obtaining said dairy products.

Synbiotic Product

The present invention relates to a synbiotic product composition comprising a blend or mixture of a prebiotic carbohydrate and a probiotic spore-forming Bacillus bacteria. Examples of prebiotic carbohydrates useful in synbiotic product include arabinoxylan, arabinoxylan oligosaccharides, xylose, soluble fiber dextrin, soluble corn fiber, and polydextrose. The present invention also relates to human foodstuffs and animal feed comprising such synbiotic products and methods of increasing the titer of spore-forming bacteria in the intestinal tracts of mammals by administration of symbiotic products.

Active plastic material in oil

A method is provided of prolonging the shelf life of probiotic lactic-acid producing bacteria formulated in oil, by using a specific moisture absorbing technology.

Extruded food products comprising probiotic micro-organisms

The present invention relates to a vacuum infused synbiotic human extruded food product having 1) a density of 1 g/L to 1000 g/L at RT, 2) a sugar content of less than 10 wt %, 3) a total content of at least one of inulin and/or FOS ranging from 2.5-10 wt %, 4) a ratio between saturated to unsaturated fatty acids in total fat content of less than 20/1, and wherein at least one strain of probiotics is evenly distributed in said food product in an oil vehicle and wherein the food product has a probiotic count of at least 10 6 CFU/kg of dry matter. The invention furthermore relates to methods for obatining the product and production plants for producing the product.

Dry whole milk preparations containing probiotic micro-organisms

The present invention relates to the field of nutrition for young children. In particular, the present invention relates to dry whole milk preparations comprising probiotic micro-organisms to be administered to young children older than 12 months. These probiotic micro-organisms may be non-replicating probiotic micro-organisms such as bioactive heat treated probiotic micro-organisms, for example.

Infant feeding formulas comprising probiotic micro-organisms

The present invention relates to the field of infant nutrition. In particular, the present invention relates to infant feeding formulas comprising probiotic micro-organisms. These probiotic micro-organisms may be non-replicating probiotic micro-organisms such as bioactive heat treated probiotic micro-organisms, for example.

Instant thickener comprising probiotics for hot or cold foods and beverages to be administered to dysphagic patients

The present invention relates to the fields of hydration and nutrition for dysphagic patients. In particular, the present invention relates to thickeners comprising probiotic microorganisms and to compositions comprising such thickeners. The probiotic micro-organisms may be non-replicating probiotic micro-organisms such as bioactive heat treated probiotic microorganisms.

Nutritional supplement composition

New dietary supplement composition comprising, as active ingredients: NADH and/or NAD + Coenzyme Q10 Vitamin C (Ascorbic Acid) Serine and/or Phosphoserine to be used for stimulating/improving/increasing the production of naturally occurring adrenaline, thus reducing sleepiness caused by particular drugs intake. The dietary supplement according to the present invention is particularly advantageous for professional drivers and persons who usually take drugs having sleepiness as major side effect.

Nutritional compositions comprising lactoferrin and probiotics and kits of parts thereof

The present invention relates to nutritional composition for infants and/or children comprising lactoferrin and probiotics. These compositions have been found to be useful in providing health benefits in infants and/or children. A method of manufacture of these compositions is also part of the invention. These compositions may be in the form of a kit of parts wherein a first composition according to the invention and a second composition according to the invention are each adapted to fulfil the nutritional requirements in two different age groups.

Probiotic composition useful for dietary augmentation and/or combating disease states and adverse physiological conditions

A method of combating rheumatoid arthritis, comprising administering to a human subject in need thereof, an effective oral dose of a probiotic composition in an oral dose form including, as the only bacterial species therein, the bacterial species of Bacillus subtilis, Bacillus coagulans , and Enterococcus faecium . The initial occurrence, and progress of remission of the rheumatoid arthritis condition incident to such probiotic therapy, may be established and monitored by assay of rheumatoid factor and/or anti-CCP antibodies present in a blood sample of the human subject.

Probiotic Compositions, Methods and Apparatus for Their Administration

A probiotic composition including a probiotic microorganism embedded within a matrix, the matrix substantially maintaining the viability of said microorganisms. The matrix releases said microorganisms into and upon contact with a liquid carrier. The invention includes methods for manufacturing the composition, particular forms of the composition ( 2 ) and as apparatus for administration.

Composition having strains of lactobacillus fermentum

The invention relates to a pharmaceutical and/or dietetic composition for increasing the impact of the immune defense of higher living beings, wherein bacteria of the species Lactobacillus fermentum from at least one of the strains K1-Lb1 or K1-Lb6 or K2-Lb4 or K6-Lb4 or K7-Lb1 or K8-Lb1 or K9-Lb6 are contained in order to control the adaptive and natural immune defense by means of T helper 1 and T helper 2 cells and/or bacteria of the species Lactobacillus fermentum from at least one of the strains K2-Lb6 or K11-Lb3 are contained in order to strengthen the native immune defense.

Growing up milks containing probiotic micro-organisms

The present invention relates to the field of nutrition for infants and young children. In particular, the present invention relates to growing-up milks comprising probiotic micro-organisms to be administered to infants and young children older than 10 months. These probiotic micro-organisms may be non-replicating probiotic micro-organisms such as bioactive heat treated probiotic micro-organisms, for example.

Nutritional compositions including theanine and exogenous nucleotides

Nutritional compositions and methods of making and using the nutritional compositions are provided. In a general embodiment, the present disclosure provides a nutritional composition including theanine and one or more exogenous nucleotides. The nutritional compositions can be specifically used to treat functional bowel disorders, including inflammatory bowel syndrome.

Nutritional compositions including a high protein component and exogenous nucleotides

Nutritional compositions and methods of making and using the nutritional compositions are provided. In a general embodiment, the present disclosure provides a nutritional composition including a high protein component and one or more exogenous nucleotides. The nutritional compositions can be specifically used to accelerate and improve wound healing in a mammal.

Dry glassy composition comprising a bioactive material

The present invention relates to formulations and methods for stabilizing and protecting of biologic materials during harsh storing and use conditions, wherein the formulations relate to embedded bioactive materials and biologics, including live bacteria, in a protective glassy matrix.

Metabolically Active Micro-Organisms and Methods for Their Production

The invention relates to a preparation of metabolically active bacteria, compositions comprising such a preparation, e.g., probiotic supplements or animal feeds, and to uses thereof, for example in the treatment of diseases affecting the intestinal microbial balance. Also described are a growth substrate for microorganisms comprising a mixture of complex and simple sugars and a process for the manufacture of preparations of metabolically active microorganisms using this growth substrate.

Dried fermented dairy product containing a high density of living bifidobacteria

The present invention concerns a dried fermented dairy product containing living bifidobacteria at a minimal concentration of about 8·10 7 cfu/g, preferably for at least 3 months at room temperature. The invention also relates to a method for preparing same, and to uses of such a product in the food industry.

Use

The present invention relates to the use of one or more cas genes for modulating resistance in a cell against a target nucleic acid or a transcription product thereof.

Aldehyde-removing composition

An object of the present invention is to provide a composition for removing aldehyde. Specifically, the present invention relates to an aldehyde-removing composition comprising a microorganism belonging to the genus Gluconobacter having aldehyde-degrading activity, or extracts thereof or disrupted cells thereof, wherein the microorganism belonging to the genus Gluconobacter has higher aldehyde-degrading activity than aldehyde-generating activity.

Agent for improving lipid metabolism

This invention provides an effective means or method for improving lipid metabolism, and a means or method for treatment or prevention of diseases or disorders associated with the lipid metabolism disorder. Specifically, this invention relates to an agent for improving the lipid metabolism comprising, as active ingredients, broken cells of a lactic acid bacterium, and to a method for enhancing an effect of a lactic acid bacterium for improving the lipid metabolism comprising a step of breaking the lactic acid bacterium.

Compositions Comprising Maltotriose And Methods Of Using Same To Inhibit Damage Caused By Dehydration Processes

Compositions comprising maltotriose are disclosed herein. In certain embodiments, the compositions comprise maltotriose and at least one component whose function is subject to impairment by a dehydration process, such as a live microorganism. Methods for inhibiting damage caused by dehydration are also disclosed herein. In particular embodiments, the method includes preparing a composition comprising maltotriose and at least one component whose function is subject to impairment by a dehydration process and removing water from the composition by one or more dehydration processes.

Anti-microbial agent from paenibacillus sp. and methods and uses thereof

The present invention provides, in part, a Paenibacillus sp. isolate, designated Paenibacillus polymyxa JB05-01-1, as well as an anti-microbial agent obtained from the bacterium or cell culture supernatant thereof. Compositions, methods and uses are also provided.

Lactic Acid-Fermented Egg Having Reduced Egg Protein Antigenicity Through Addition Of Sodium Citrate, Heating Treatment, And Lactic Acid Fermentation, And Method For Preparing Same

The present invention relates to a lactic acid-fermented egg having reduced egg protein antigenicity and improved organoleptic quality through the addition of sodium citrate, heating treatment, and lactic acid bacteria fermentation, and more specifically, to a lactic acid-fermented egg having reduced egg protein antigenicity, which comprises a series of steps of adding to whole egg liquid a fixed amount of filtered water, sugar, and sodium citrate, heating treating and lactic acid-fermenting same, and a method for preparing same. The present invention reduces the antigenicity of ovomucoid and ovalbumin, which are allergy inducing factors existing inside an egg, has excellent solubility, and excellent organoleptic quality.

Compositions for the vaginal and oral administration of lactobacillus and uses thereof

The present invention relates to compositions for the oral and vaginal administration of human Lactobacilli and uses thereof for physiologic restoration of the vaginal flora, physiologic maintenance of Lactobacillus flora in pathologic deficiency to produce Lactobacilli, treatment of asymptomatic bacterial vaginosis and prevention of preterm delivery caused through bacterial vaginosis.

Methods for Reducing Cholesteron Using Bacillus Coagulans Spores, Systems and Compositions

The invention describes therapeutic compositions including a lactic acid-producing bacteria, such as isolated Bacillus coagulans, in combination with a cholesterol-reducing agent for use in reducing LDL cholesterol and serum triglycerides. Also described are therapeutic methods using the compositions and systems containing the therapeutic compositions.

Treatment of IBD and IBS Using Both Probiotic Bacteria and Fermented Cereal as Treatment Effectors

The invention covers a novel treatment strategy that considerably improves conventional probiotic treatments of inflammatory bowel diseases, irritable bowel syndrome and other gastrointestinal disorders. Both probiotic microorganisms and the carrier of the probiotic microorganisms in form of a fermented cereal gruel are used as treatment effectors. Phospholipids may also be an effector. The novel treatment strategy is capable of removing the symptoms of inflammatory bowel diseases regardless of a mild, moderate or severe stage of the disease.

Powdered cereal compositions comprising non-replicating probiotic microorganisms

The present invention relates to the field of powdered cereal compositions to be reconstituted in milk, infant formula or water. In particular, the present invention relates to powdered cereal compositions to be administered to infants or young children. The powdered cereal compositions may be used to strengthen the immune system and/or to treat or prevent inflammatory disorders. For example these benefits can be provided by probiotic micro-organisms. An embodiment of the present invention relates to a powdered cereal composition comprising non-replicating probiotic-micro-organisms, for example bioactive heat treated probiotic micro-organisms.

Non-replicating probiotic bacteria and prevention or treatment of infections to reduce absence from school or daycare

The present invention relates to non-replicating probiotic micro-organisms and their health benefits. In particular, the present invention provides a means to help parents to protect their children from infections. The subject matter of the present inventions allows it to reduce absence from school or daycare. One embodiment of the present invention relates to a composition comprising non-replicating probiotic micro-organisms for use in the prevention or treatment of infections in children to reduce absence from school or daycare.

Compositions and methods for the delivery of therapeutic peptides

Methods and compositions for targeted delivery of biotherapeutics are provided. The compositions comprise bile-sensitive St. thermophilus bacteria modified to release a biotherapeutic agent following bile exposure. Biotherapeutic agents released by the St. thermophilus bacteria disclosed herein include AQ and AQR rich peptides. Methods of the invention comprise administering to a subject a St. thermophilus bacterium modified to release a biotherapeutic agent following bile exposure. Administration of the St. thermophilus bacterium promotes a desired therapeutic response. The bacterium may be modified to express and release AQ or AQR rich peptides which subsequently inhibit cellular apoptosis or reduce mucosal damage. Thus, methods of the invention find use in treating or preventing a variety of gastrointestinal disorders including C. difficile infection and antibiotic-associated diarrhea.

Exopolysaccharide

An isolated polysaccharide has the structure [-β(1,3)-D-GaIpNAc-β(1,4)-D-Glcp-] n . The polysaccharide may be from a Bifidobacterium strain NCIMB 41003. The polysaccharide exhibits immunomodulatory activity.

Probiotics in fruit beverages

The present invention relates to a method of producing a probiotic fruit beverage comprising a high viable count of acid-adapted probiotic bacteria, such as strains of Lactobacillus paracasei subsp. paracasei , and to probiotic fruit beverage obtainable by such method.

Composition for preventing inflammations

The purpose of the present invention is to provide a probiotic(s) which can activate an aromatic hydrocarbon receptor (AhR) and can consequently prevent inflammatory damage in the digestive tract. The present invention relates to; a probiotic(s) capable of activating an AhR; an anti-inflammatory agent comprising the probiotic(s); an orally ingestible composition containing the anti-inflammatory agent; and a method for screening for the probiotic(s).

Synbiotic compositions for restoration and reconstitution of gut microbiota

The present invention relates to synbiotic compositions comprising probiotic bacterial strains and prebiotic substances that, when combined exhibit synergistic behavior. The synergetic compositions will stimulate the indigenous microflora to restore and reconstitute in vivo gut like conditions after antibiotic associated diarrhea (AAD), and/or other gut infections caused by gastrointestinal pathogens, and relapses thereof, as well as the prevention of said disorders.

Administration of Enzyme and Prebiotic Combinations that Enhance Probiotic Growth and Efficacy

This disclosure relates to enhancing growth and/or activity of lactobacilli using a prebiotic formulation which includes iso-malto oligosaccharides and α-galactosidase; and to enhancing growth and/or activity of bifidobacteria using a prebiotic formulation which includes iso-malto oligosaccharides and β-glucanase. Other combinations of fibers and enzymes are described below which also stimulate growth and activity of lactobacilli or bifidobacteria. These combinations of enzymes and prebiotics can be taken separately or added to foods, including desserts.

Nutritional compositions including branched chain fatty acids and methods of using same

Nutritional compositions for improving, treating and/or preventing various medical conditions and methods of using same are provided. The medical conditions may include allergies, autoimmune diseases, among others. The nutritional compositions include branched chain fatty acids and may include other functional ingredients such as, but not limited to probiotics, nucleotides and amino acids. Methods of administering such nutritional products to individuals in need of same are also provided.

Lactobacillus paracasei ncc2461 (st11) for use by perinatal maternal administration in the reduction and prevention of allergies in progeny

The present invention provides a probiotic, Lactobacillus paracasei NCC 2461, i.e. ST11, for use by administration to expectant females and/or lactating mothers, and to their progeny for the reduction or prevention of the development of allergic immune responses in progeny. A daily dose of ST11 is administered to a pregnant woman for at least two weeks before delivery and, after delivery, the daily dose of ST11, is administered to the lactating mother or the newborn infant for at least two months, either directly or via the mother's milk. The infant immune responses to allergens are thus reduced, resulting in a “dampened” allergic response. Thus allergy, including atopy, may be prevented in the progeny.

Use of uridine and deoxyuridine to treat folate-responsive pathologies

The present invention relates to a pharmaceutical or dietary composition comprising deoxyuridine and a pharmaceutically or dietetically suitable carrier. Another aspect of the present invention relates to a method of supplementing the dietary needs of a subject. This method includes administering to the subject a dietary supplementing effective amount of deoxyuridine. Yet another aspect of the present invention relates to a method of treating cancer in a subject. This method includes selecting a subject having cancer and administering to the selected subject a therapeutically effective amount of uridine, thereby treating the cancer in the selected subject.

Modulating bacterial mam polypeptides in pathogenic disease

The disclosure relates to methods and compositions for preventing or inhibiting pathogenic bacterial infections in a subject caused by pathogenic bacteria expressing a multivalent adhesion molecule (MAM) polypeptide by administering to a subject a composition comprising a MAM polypeptide or a non-pathogenic bacterium expressing a MAM polypeptide, or a combination thereof.

Probiotic stabilization

An ingestible composition including a probiotic contained in a mixture of a phospholipid and a glyceride, useful for nutrition of infants and children.

BAKED GOODS

The present invention describes compositions and methods comprising lactic acid-producing bacteria in baked goods. 1. A composition comprising a baked composition of an edible starch and an isolated Bacillus coagulans bacterium.2. The composition of claim 1 , wherein said baked composition is selected from the group consisting of a bread claim 1 , a cake claim 1 , a pie claim 1 , a tart claim 1 , a pastry claim 1 , a candy bar claim 1 , an energy bar claim 1 , a granola bar claim 1 , a quiche claim 1 , a cookie claim 1 , and a treat for companion animals.3. The composition of claim 2 , wherein said cake is a muffin.4. The composition of claim 3 , wherein said muffin is a blueberry bran muffin.5Bacillus coagulans. The composition of claim 1 , wherein said isolated comprise between 0.01% and 10% by weight of said baked good.6Bacillus coagulansBacillus coagulans. The composition of claim 1 , wherein said isolated is hammer strain Accession No. ATCC 31284.7Bacillus coagulans. The composition of claim 1 , wherein said isolated is GBI-30 strain (ATCC Designation Number PTA-6086).8Bacillus coagulans. The composition of claim 1 , wherein said isolated is GBI-20 strain (ATCC Designation Number PTA-6085).9Bacillus coagulans. The composition of claim 1 , wherein said isolated is GBI-40 strain (ATCC Designation Number PTA-6087).10Bacillus coagulans. The composition of claim 1 , wherein said isolated is in the form of a spore.11Bacillus coagulans. The composition of claim 1 , wherein said isolated is in the form of a vegetative cell.12Bacillus coagulans. The composition of claim 1 , wherein said isolated is in the form of a mixture of vegetative cells and spores.13. A method of making a baked good comprising:providing a flour containing base mix and a liquid portion of water; mixing said flour containing base mix and said water to form a batter or dough;{'i': 'Bacillus coagulans', 'applying an isolated bacterium to said batter or dough; and'}heat processing said batter or dough ...

THRAUSTOCHYTRIDS, FATTY ACID COMPOSITIONS, AND METHODS OF MAKING AND USES THEREOF

The present invention is directed to isolated thraustochytrid microorganisms as well as strains and mutants thereof The invention is further directed to biomasses, microbial oils, compositions, cultures, methods of producing microbial oils, and methods of using the isolated thraustochytrids, biomasses, and microbial oils. 150-. (canceled)51. A microbial oil comprising a triglyceride fraction of at least 70% by weight , wherein the docosahexaenoic acid content of the triglyceride fraction is at least 50% by weight , and wherein the oil comprises 5% by weight or less of heptadecanoic acid.52. The microbial oil of claim 51 , wherein said docosahexaenoic acid content of the triglyceride fraction is at least 60% by weight.53. The microbial oil of claim 51 , wherein said docosahexaenoic acid content of the triglyceride fraction is at least 80% by weight.54. The microbial oil of claim 51 , wherein said docosahexaenoic acid content of the triglyceride fraction is at least 90% by weight.55. The microbial oil of claim 51 , further comprising an arachidonic acid content of the triglyceride fraction of 1.5% or less by weight.56. The microbial oil of any one of to claim 51 , wherein said microbial oil further comprising an effective amount of at least one added antioxidant to provide oxidative stability57. A food product claim 51 , cosmetic claim 51 , or pharmaceutical composition for animals or humans claim 51 , comprising the microbial oil of any one of to .58. The food product of claim 57 , wherein the food product is an infant formula.59. The food product of claim 57 , wherein the food product is milk claim 57 , a beverage claim 57 , a therapeutic drink claim 57 , a nutritional drink claim 57 , or a combination thereof.60. The food product of claim 57 , wherein the food product is an additive for animal or human food.61. The food product of claim 57 , wherein the food product is a nutritional supplement.62. The food product of claim 57 , wherein the food product is an animal ...

Novel Microbial Biomass Based Feed Products

Aquafeed, animal feed, and other food products, as well as nutritional and pharmaceutical compounds, chemicals and biomaterials are important commodities that can be produced at commercial scale by fermentation of microorganisms. The present invention provides a method for producing these valuable multi-carbon compounds from simple gas feedstocks, such as carbon dioxide, hydrogen and oxygen, by cultivating a consortium of microbial cells specially selected for this purpose in an aqueous culture medium. In addition to exploiting inexpensive feedstocks, such as waste industrial gas for this cultivation, the platform described herein also provides the advantage of removing carbon dioxide and other waste gases from industrial emissions, which would otherwise contribute to global climate change. Furthermore, the cultivation of a microbial consortium can provide highly nutritious components to a feed blend that might not be available from a monoculture. 1. A food or feed additive product comprising:a consortium of chemoautotrophic and photoautotrophic bacteria and heterotrophic microbes, the consortium including{'i': Cupriavidus, Methylococcus,', 'Rhodococcus,, 'chemoautotrophic bacteria from the genera or'}{'i': Rhodobacter, Rhodospirillum, Rhodopseudomonas,', 'Arthrospira, and, 'photoautotrophic bacteria from the genera or'}{'i': Bacillus, Bacteroides, Lactococcus, Leuconostoc, Pediococcus, Acidilactici, Pediococcus, Propionibacterium, Streptococcus, Bifidobacterium,', 'Lactobacillus., 'heterotrophic microbes from the genera or'}2. A method comprising:providing a consortium of chemoautotrophic and photoautotrophic bacteria and heterotrophic microbes within a system, the system including a fermentation vessel filled with an aqueous medium comprising the consortium, the fermentation vessel having an input port into which gaseous substrates are introduced into the aqueous medium, the fermentation vessel further having an exhaust port through which gases exit the ...

VERTICAL PLUG-FLOW PROCESS FOR BIO-CONVERSION EMPLOYING MICROORGANISMS

The invention relates to a method for producing a solid transformation product of a substrate comprising the following steps: • preparing a substrate of biomass comprising carbohydrates and proteinaceous matter that originates from soya bean, rape seed, or mixtures thereof, optionally in further mixture with carbohydrates and proteinaceous matter originating from fava beans, peas, sunflower seeds, lupine, cereals, and/or grasses, • mixing said substrate with a live microorganism or a combination of live microorganisms, which live microorganism or mixture of live microorganisms is not live yeast, and adding water in an amount which provides an initial incubation mixture having a water content from 30 to 70% by weight, and a ratio of wet bulk density to dry bulk density from 0.60 to 1.45 in the resulting mixture; • incubating said initial incubation mixture for 1-240 hours at a temperature of 15-70° C.; and thereafter recovering wet solid transformation product from the incubation mixture; further comprising that the incubating step is performed as a continuous plug-flow process in a vertical, non-agitated incubation tank with inlet means for said mixture and additives and outlet means for said solid transformation product. 134-. (canceled)35. A method for producing a solid transformation product of a biomass substrate , wherein the solid transformation product is a product of the transformation of one or more of proteinaceous matter and carbohydrates originating from a biomass substrate , comprising:(a) preparing a substrate of a biomass comprising carbohydrates and proteinaceous matter that originate from soya bean seed, rape seed, or mixtures thereof, wherein at least 20% by weight of said biomass comprises carbohydrates and proteinaceous matter originating from soya bean seeds, rape seeds, or mixtures thereof, optionally in further mixture with carbohydrates and proteinaceous matter originating from one or more of seeds of fava beans, seeds of peas, sunflower ...

Probiotic Bacterial Molecules and their Use in Methods to Treat/Prevent Infection by Harmful Bacteria and to Provide Nutritional Health

This invention provides isolated and characterized secreted molecules from probiotic bacteria for use in compositions and methods for the treatment and/or prevention of infection by harmful pathogenic bacteria. The isolated secreted molecules can also be used in nutritional or medical food products which provide probiotics to the gastrointestinal tract of a mammal. 124-. (canceled)25Escherichia coliSalmonelaLactobacillus acidophilusLactobacillus fermentum, Lactobacillus rhamnosus, Lactococcus Lactis, Streptococcus thermophilus, Bifidobacterium longum, Bifidobacterium bifidum, Bifidobacterium infantis, Bifidobacterium crudilactis, Streptococcus thermophilus. A method for preventing and/or therapeutically treating infections by O157:H7 and/or in a mammal , the method comprising administering to said mammal an effective amount of a composition comprising one or more secreted molecules from a probiotic bacterium selected from (La-5) , and combinations thereof.2656-. (canceled) This application is a continuation application of U.S. application Ser. No. 13/001,328, filed Mar. 28, 2011, which is a 35 U.S.C. §371 national phase application of International Application Serial No. PCT/CA2009/00901, filed Jun. 26, 2009, which claims the benefit, under 35 U.S.C. §119 (a) of U.S. Provisional Patent Application No. 61/076,581, filed Jun. 27, 2008, the entire contents of each of which are incorporated by reference herein.This invention relates generally to the control of pathogenic bacteria in mammals. More particularly, the invention relates to the isolation and identification of molecules secreted/derived from probiotic bacteria for use in compositions and methods for the treatment and/or prevention of infection by harmful pathogenic bacteria. The isolated molecules are useful in nutritional and medical food products which provide probiotics to the gastrointestinal tract of a mammal.Enterohaemorrhagic O157:H7 (EHEC O157) is a member of the attaching and effacing (AEEC) (3) that ...

INFANT NUTRITIONAL COMPOSITION FOR USE IN THE ENHANCEMENT OF PANCREATIC MATURATION AND INSULIN BIOSYNTHESIS

This invention relates to nutritional compositions comprising at least one fucosylated oligosaccharide, preferably 2FL, for use in enhancing the pancreatic development and/or pancreatic maturation of infants, and/or the enhancement of the insulin biosynthesis and/or the prevention of metabolic disorder or associated diseases and/or glucose management during the nutritional intervention or later in life. The composition can be an infant formula. The composition can also comprise at least one N-acetylated oligosaccharide, preferably LnNT. 1. A method for enhancing the pancreatic development and/or pancreatic maturation of infants or young children comprising the step of administering a nutritional composition comprising at least one fucosylated oligosaccharide to an infant or child in need of same.2. The method of wherein the at least one fucosylated oligosaccharide is present in a total amount of between 0.05-3 g/L of the composition.3. The method of wherein the fucosylated oligosaccharide is 2FL.4. The method of wherein the composition comprises a N-acetylated oligosaccharide.5. The method of wherein the N-acetylated oligosaccharide is lacto-N-neotetraose (LNnT) claim 1 , lacto-N-tetraose (LNT) claim 1 , para-lacto-N-neohexaose (para-LNnH) claim 1 , disialyllacto-N-tetraose (DSLNT) and any combination thereof.6. The method of wherein the N-acetylated oligosaccharide is present in a total amount of between 0.025-1.5 g/L of the composition.7. The method of wherein the infants are between 0 and 12 months.8. The method of wherein the enhancement of pancreatic development or maturation further comprises or is mediated or is accompanied by the enhancement of the level of biosynthesis of insulin by the pancreatic cells of the infant or young child.9. The method of for further use in improving the glucose management of the infants during the administration period and/or during infancy and/or later in life claim 1 , preferably reducing the risk of type-2 diabetes and/or ...

CHRISTENSENELLACEAE BACTERIA INCLUDING CHRISTENSENELLA MINUTA AND USES THEREOF

The present invention relates to Christensenellaceae bacteria including strain DSM 32891, to the cellular components, metabolites and secreted molecules thereof, and to compositions that comprise the above products, and also to the use of said strain for the prevention and/or treatment of mood or affective disorders, such as depression, stress disorders, anxiety disorders and migraine. 1Christensenella minuta. A strain of with the deposit number DSM 32891.2. A strain derived from the strain according to .3. The strain according to in which the strain is a genetically modified mutant.4. The strain according to claim 1 , wherein said strain is in the form of a viable or a non-viable cell.5. A cellular component claim 1 , metabolite claim 1 , secreted molecule or any combination thereof obtained from the strain according to .6Christensenella minuta. A composition which comprises a strain of according to or a cellular component claim 1 , metabolite claim 1 , secreted molecule or any combination thereof obtained from the strain.7. The composition according to claim 6 , wherein the composition also comprises at least one bioactive component.8. The composition according to claim 6 , wherein the composition also comprises at least one microorganism that is of a different strain than the bacterium according to .9. The composition according to claim 8 , wherein the microorganism is a gut bacterium or a lactic bacterium.10. The composition according to claim 6 , wherein said composition is a pharmaceutical composition.11. The composition according to claim 10 , wherein the composition also comprises at least one pharmaceutically acceptable vehicle and/or excipient.12. The composition according to claim 10 , wherein said composition is presented in a form suitable for oral claim 10 , sublingual claim 10 , nasal claim 10 , bronchial claim 10 , lymphatic claim 10 , rectal claim 10 , transdermal claim 10 , inhaled or parenteral administration.13. The composition according to claim ...

Lactobacillus Crispatus KBL693 Strain and Use Thereof

A strain of Lactobacillus crispatus KBL693 and the use thereof are disclosed. The strain of Lactobacillus crispatus KBL693 (Accession No. KCTC 13519BP) attenuates allergic reactions of cells, significantly improves symptoms of atopic dermatitis, and exhibits anti-inflammatory and anti-fungal effects. Thus, the single strain alone can achieve all the purposes of alleviating atopic dermatitis and other allergic diseases and improving inflammatory diseases and autoimmune diseases, thereby finding advantageous applications as a probiotic substance. In addition, the strain, based on the anti-fungal activity thereof, can be advantageously utilized in a skin external preparation against various skin diseases caused by fungi, and in a cosmetic composition and a functional patch for alleviating sensitive skin.

Method of preparing an individual probiotic composition according to analysis of the microbiome and medical history for human or veterinary use

The invention relates to a method of preparation an individually prepared probiotic composition and a food, pharmaceutical or veterinary preparation containing this composition designed to supplement the friendly microflora in the gastrointestinal tract for human or veterinary use. The composition contains a mixture of at least two different probiotic cultures mixed on the basis of analysis of the microbiome and with a view to the individual's medical history. Preparations containing a probiotic composition encompass food supplements, products for special nutrition, foodstuffs, drinks, medicines, pharmaceuticals, cosmetic and hygiene products and veterinary feeds.

METHODS FOR PROGNOSING AND TREATING METABOLIC DISEASES

The present invention relates to methods for prognosing and treating metabolic diseases. The inventors demonstrated the association of obesity with the increase of intestinal IDO activity, which shifts tryptophan (Trp) metabolism from indole derivative but also IL-22 production towards kynurenine (Kyn) production. The inventors showed that the rewiring of Tip metabolism is possible towards a microbiota-dependent production of IL-22. In particular, the present invention relates to a method of treating metabolic diseases in a subject in need thereof comprising administering to the subject a therapeutically effective amount of probiotics 1. A method of treating metabolic diseases , improving insulin sensitivity , controlling weight gain or stimulating weight loss in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a probiotic.2. The method of wherein the metabolic disease is selected from the group consisting of diabetes claim 1 , obesity claim 1 , hypertension claim 1 , elevated plasma insulin concentrations and insulin resistance claim 1 , dyslipidemia claim 1 , and hyperlipidemia.34-. (canceled)5. The method according to claim 1 , wherein the probiotic comprises Bacteroidetes.6. The method according to claim 1 , wherein the probiotic comprises Rikenellaceae.7. The method according to claim 1 , wherein the metabolic disease is obesity.8. A composition comprising Bacteroidetes probiotics.9. A composition comprising Rikenellaceae probiotics.10. The method according to claim 1 , wherein the probiotic is administered to the subject in the form of a dietary supplement or in the form of pharmaceutical composition.11. A method of treating a metabolic disease claim 1 , improving insulin sensitivity claim 1 , controlling weight gain or stimulating weight loss in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one ligand of aryl hydrocarbon receptor (AHR). ...

Anti-Stress Composition

An object is to provide an anti-stress composition that can be administered for a long period of time and is highly safe. Provided is an anti-stress composition including Lactobacillus helveticus as an active ingredient. The stress may be mental stress. Furthermore, the composition may be used for treatment or prevention of anxiety disorder, anthropophobia, a decline in sociality, or adjustment disorder. Furthermore, the Lactobacillus helveticus may be Lactobacillus helveticus NITE BP-01671. Furthermore, the composition may be a pharmaceutical composition or a food or drink composition.

Probiotic Strains for Treating and/or Preventing Diarrhea

The present invention relates to a method of selecting or identifying probiotic strains capable of acting on the absorption of water in the colon, and use thereof as medicinal products in the treatment and/or prevention of diarrhea. The invention relates in particular to the strain of Bacillus subtilis CU1 for use in the treatment and/or prevention of diarrhea.

Human disease mitigation with food formulation

A method of administering a food containing at least transfer factor and lactic acid generating bacteria to mitigate the symptoms of a specific human disease prior to medical or drug intervention. Another food formulation consists of transfer factor, lactic acid generating bacteria, and glucans in appropriate combinations. Other components may be added. The food, administered correctly, reduces cortisol levels, builds the immune system, and balances the endocrine system. Dosage amounts are adjusted for client weight. The method may be used with other treatment options. 1. A method for reducing the symptoms of human disease , comprising: said transfer factor includes polypeptides with a molecular weight below 10,000 Daltons, and', 'said transfer factor is derived from avian, ova or colostrum sources;, 'combining transfer factor and lactic acid generating bacteria to create a food, wherein'} ["a dosage level is chosen based on the human's weight,", 'feeding begins 3-90 days before medical or drug intervention, and', 'the frequency of the feeding ranges between five times per day and once per week; and, 'feeding the food to said human, wherein'}continuing said feeding until medical or drug intervention begins.2. The method of wherein said human disease includes any one selected from a group consisting of (a) early stage Alzheimers claim 1 , (b) upper respiratory infections claim 1 , (c) lower respiratory infections claim 1 , (d) osteoarthritis claim 1 , (e) osteopenia claim 1 , (f) osteoporosis and bone weakness (g) proteolysis claim 1 , (h) muscle wasting claim 1 , (i) early stage adrenal fatigue claim 1 , (j) early stage chronic fatigue syndrome claim 1 , (k) psychological stress claim 1 , (l) addiction claim 1 , (m) arthropenia claim 1 , (n) diarrheal disease claim 1 , (o) cognitive deficits due to the brain's ability to utilize glucose claim 1 , (p) skin aging claim 1 , (q) hypertension claim 1 , (r) viral infections claim 1 , (s) irritable bowel syndrome claim 1 , ...

COMPOSITIONS COMPRISING BACTERIAL STRAINS

The invention provides compositions comprising bacterial strains for treating and preventing inflammatory and autoimmune diseases. 1Enterococcus faecium;. A pharmaceutical composition that comprises an amount of a bacteria strain of the species{'i': 'Enterococcus faecium', 'sup': '6', 'claim-text': {'i': 'Enterococcus faecium', 'wherein the bacteria strain is live and lyophilized; and'}, 'wherein said is the sole species present in the pharmaceutical composition in an amount that is greater than 1×10CFU/g with respect to a total weight of the pharmaceutical composition;'}{'i': 'Enterococcus faecium', 'wherein the bacteria strain has an enzyme profile as determined by a Rapid ID 32A analysis that ispositive for at least one of: arginine dihydrolase, β-glucosidase, mannose fermentation, glutamic acid decarboxylase, arginine arylamidase, phenylalanine arylamidase, leucine arylamidase, pyroglutamic acid arylamidase, tyrosine arylamidase, glycine arylamidase, histidine arylamidase and serine arylamidase; and(ii) intermediate for N-acetyl-β-glucosaminidase.2. The pharmaceutical composition of claim 1 , further comprising a lyoprotectant which is a pharmaceutically acceptable excipient claim 1 , diluent claim 1 , or carrier.3Enterococcus faecium. The pharmaceutical composition of claim 1 , wherein the bacteria strain comprises a polynucleotide sequence that is a 16s rRNA gene sequence with at least 95% sequence identity to the polynucleotide of SEQ ID NO:2 as determined by the Smith-Waterman homology search algorithm using an affine gap search with a gap open penalty of 12 and a gap extension penalty of 2 claim 1 , and a BLOSUM matrix of 62.4Enterococcus faecium. The pharmaceutical composition of claim 1 , wherein the bacteria strain that comprises a polynucleotide sequence that is the 16s rRNA gene sequence of SEQ ID NO:2.5Enterococcus faeciumEnterococcus faecium. The pharmaceutical composition of claim 1 , wherein said bacterial strain is the bacteria strain deposited ...

COMPOSITIONS AND METHODS FOR INCREASING OR MAINTAINING FAECALIBACTERIUM PRAUSNITZII POPULATIONS

The present invention relates to the use of at least one lactic acid bacterium, or a composition comprising thereof or conditioned thereby, for increasing or maintaining a population. 1Faecalibacterium prausnitzii. A method for increasing or maintaining a intestinal population in an individual comprising providing the individual at least one lactic acid bacterium , or a composition comprising at least one lactic acid bacterium.2. A method for increasing or maintaining butyrate production in an individual comprising providing the individual at least one lactic acid bacterium , or a composition comprising at least one lactic acid bacterium.3StreptococcusLactococcus.. The method according to claim 1 , wherein the at least one lactic acid bacterium is of the genus or4Streptococcus thermophilusLactococcus lactis.. The method according to claim 1 , wherein the lactic acid bacterium is or5Streptococcus thermophilus. The method according to claim 1 , wherein the lactic acid bacterium is CNCM I-3862.6Lactococcus lactislactis. The method according to claim 1 , wherein the lactic acid bacterium is subsp. CNCM I-1631.7. The method according to claim 1 , wherein the composition is a fermented dairy product.8. (canceled)9. (canceled)10. (canceled)11Streptococcus thermophilus. A strain deposited at the CNCM under reference number I-3862.12Streptococcus thermophilus. A fermented dairy product comprising the strain of . The present invention relates to compositions and methods for increasing or maintaining populations.() is the most abundant bacterium in the human intestine of healthy adults, representing more than 5% of the total bacterial population. Over the past years, an increasing number of studies have described the importance of this metabolically active commensal bacterium as a component of the healthy human microbiota. The major end products of glucose fermentation by strains are formate, small amounts of D-lactate and substantial quantities of butyrate. Indeed, is one of ...

COMPOSITIONS COMPRISING BACTERIAL STRAINS

The invention provides compositions comprising bacterial strains for treating and preventing inflammatory and autoimmune diseases. 130.-. (canceled)31Eubacterium contortum. A method of treating a condition characterized by elevated levels of IL-17 in a subject as compared to a healthy subject , comprising administering to the subject a pharmaceutical composition that comprises at least 1×10CFU/g of a bacteria strain of the species with respect to total weight of the pharmaceutical composition; and wherein the bacteria strain comprises a 16S rRNA gene polynucleotide , wherein the 16S rRNA gene polynucleotide comprises a polynucleotide sequence with at least 99% sequence identity to the polynucleotide sequence of SEQ ID NO:4 , as determined by a Smith-Waterman homology search algorithm using an affine gap search with a gap open penalty of 12 , a gap extension penalty of 2 , and a Blocks Substitution Matrix (BLOSUM) of 62 , and wherein the bacteria strain is present in an amount sufficient to reduce the levels of the IL-17 in the subject , thereby treating the condition.32. The method of claim 31 , wherein the bacteria strain is lyophilized.33. The method of claim 31 , wherein the condition is selected from the group consisting of: uveitis; multiple sclerosis; a cancer; an arthritis; neuromyelitis optica; psoriasis; systemic lupus erythematosus; an inflammatory bowel disease; celiac disease; an asthma; allergic asthma; neutrophilic asthma; chronic obstructive pulmonary disease (COPD); scleritis; vasculitis; Behcet's disease; atherosclerosis; atopic dermatitis; emphysema; periodontitis; allergic rhinitis; and allograft rejection.34. The method of claim 33 , wherein the condition is uveitis claim 33 , and wherein the treating comprises reducing retinal damage in uveitis.35. The method of claim 33 , wherein the condition is an arthritis.36. The method of claim 35 , wherein the arthritis is rheumatoid arthritis claim 35 , osteoarthritis claim 35 , psoriatic arthritis claim ...

BIFIDOBACTERIUM LONGUM ABLE TO BENEFICIALLY MODULATE IMMUNE RESPONSE TO RESPIRATORY VIRUS INFECTION

An isolated strain of NCIMB 42020 is useful for the treatment of viral infections, especially viral respiratory infections such as influenza, rhinovirus and RSV. NCIMB 42020 is also useful for clearing secondary bacterial infections. 165-. (canceled)66Bifidobacterium longum. A formulation comprising a strain having the accession number NCIMB 42020.67Bifidobacterium longum. The formulation of claim 66 , wherein the strain is in the form of a biologically pure culture.68Bifidobacterium longum. The formulation of claim 66 , wherein the strain is in the form of viable cells claim 66 , non-viable cells claim 66 , or both viable cells and non-viable cells.69Bifidobacterium longum. The formulation of claim 66 , wherein the strain is in the form of a bacterial broth or a freeze-dried powder.70Bifidobacterium longumBifidobacterium longum. The formulation of claim 66 , further comprising a probiotic material other than the strain claim 66 , a prebiotic material claim 66 , or both a probiotic material other than the strain and a prebiotic material.71. The formulation of claim 66 , further comprising an ingestible carrier.72. The formulation of claim 71 , wherein the ingestible carrier is a pharmaceutically acceptable carrier chosen from a capsule claim 71 , a tablet claim 71 , or a powder.73. The formulation of claim 71 , wherein the ingestible carrier is a food product chosen from acidified milk claim 71 , yoghurt claim 71 , frozen yoghurt claim 71 , ice-cream claim 71 , milk powder claim 71 , milk concentrate claim 71 , ice cream claim 71 , cheese spread claim 71 , dressing claim 71 , or a beverage.74. The formulation of claim 66 , further comprising a protein claim 66 , a peptide claim 66 , or both a peptide and a protein.75. The formulation of claim 74 , wherein the protein claim 74 , the peptide claim 74 , or both the protein and the peptide is rich in glutamine/glutamate claim 74 , a lipid claim 74 , a carbohydrate claim 74 , a vitamin claim 74 , a mineral a trace ...

STABLE DRY POWDERS AND EMULSIONS CONTAINING PROBIOTICS

Compositions and methods for mucosal delivery of agents are provided. The emulsion compositions are intended for administration to a mucosal surface, such as oral, gastrointestinal and nasal mucosa. The emulsion compositions provided contain one or more mucoadhesive proteins and an agent to be delivered. Methods for delivery of agents using the compositions provided herein are also provided. 1. A powder composition , comprising , by weight % of the composition:5%-25% probiotic; and wherein:', 'the total of probiotic and mucoadhesive protein is 20%-35%;, '5%-25% mucoadhesive protein,'}30%-50% ingestible oil;5%-15% surfactant other than a vitamin E derivative;10%-20% binder; and4%-12% stabilizer.2. The powder composition of claim 1 , wherein the mucoadhesive protein is a lactoferrin; the oil is MCT oil; the surfactant is a sucrose fatty acid ester; the binder is a dextrin or maltodextrin; and the stabilizer is a carbonate or bicarbonate.3. A powder composition claim 1 , comprising a probiotic claim 1 , and a mucoadhesive protein claim 1 , wherein:the total amount of the probiotic and mucoadhesive protein is up to at or about 15-35%, wherein the ratio thereof is between 1:5 and 5:1;the powder contains at least 5% by weight of probiotic; andthe probiotic and mucoadhesive protein are associated via physical or chemical bonds with probiotic surface proteins.4. The powder composition of claim 3 , wherein the mucoadhesive protein is a lactoferrin.5. The powder composition of claim 3 , further comprising the total amount of sugar fatty acid ester and binder is between 5% and 60%, or 20% and 55%, or 30% and 60%, by weight, of the powder; and', 'the mixture of sugar fatty acid ester and binder contains at least 5% sugar fatty acid ester., 'a mixture of sugar fatty acid ester and a binder, wherein6. A powder composition claim 3 , comprising a probiotic and a mucoadhesive protein claim 3 , wherein:the amount of sucrose fatty acid ester (SFAE) surfactant is 5%-15%, by weight;the ...

NUTRITIONAL COMPOSITION TO REDUCE METABOLIC STRESS IN INFANTS

The present invention relates to a nutritional composition comprising an oligosaccharide mixture, said oligosaccharide mixture comprising at least one N-acetylated oligosaccharide, one galacto-oligosaccharide and one sialylated oligosaccharide for use in reducing the metabolic stress in an infant in the first twelve months of life and/or decreasing gut permeability in an infant in the first twelve months of life and/or promoting a rate of growth in an infant fed with said nutritional composition in the first twelve months of life which approximates to the rate of growth of a breast-fed infant at the same age. 1. A method for reducing the metabolic stress in an infant in the first twelve months of life comprising administering to the infant a nutritional composition comprising an oligosaccharide mixture , the oligosaccharide mixture comprising at least one N-acetylated oligosaccharide , one galacto-oligosaccharide and one sialylated oligosaccharide.2. A method for decreasing the gut permeability in an infant in the first twelve months of life comprising administering to the infant a nutritional composition comprising an oligosaccharide mixture , the oligosaccharide mixture comprising at least one N-acetylated oligosaccharide , one galacto-oligosaccharide and one sialylated oligosaccharide.3. A method for promoting a rate of growth in the first twelve months of life in an infant fed with said nutritional composition which approximates to the rate of growth of a breast-fed infant at the same age comprising administering to the infant a nutritional composition comprising an oligosaccharide mixture , the oligosaccharide mixture comprising at least one N-acetylated oligosaccharide , one galacto-oligosaccharide and one sialylated oligosaccharide.4. The method of claim 1 , wherein the N-acetylated oligosaccharide is selected from the group consisting of GalNAcα1 claim 1 ,3Galβ1 claim 1 ,4Glc claim 1 , Galβ1 claim 1 ,6GalNAcα1 claim 1 ,3Galβ1 claim 1 ,4Glc and mixtures ...

PREBIOTIC OLIGOSACCHARIDES

The present invention provides galacto-oligosaccharide compositions that preferentially stimulate growth of specific species and subspecies. 1Bifidobacterium. A method for stimulating beneficial microflora in an animal , the method comprising ,{'i': 'Bifidobacterium', 'administering a sufficient amount of the composition of galacto-oligosaccharides, wherein at least 45% of the galacto-oligosaccharides by weight are tetra or penta galacto-oligosaccharides or wherein at least 25% of the galacto-oligosaccharides by weight are tetra galacto-oligosaccharides, to the animal to stimulate colonization of the gut of the animal by at least one beneficial strain.'}2Bifidobacterium breveBifidobacterium longuminfantis.. The method of claim 1 , wherein the composition further comprises or bv.3. The method of claim 1 , wherein the composition has less than 20% by weight of dimeric galacto-oligosaccharides claim 1 , based on weight of the total oligosaccharides.4. The method of claim 1 , wherein the composition has less than 10% by weight of dimeric galacto-oligosaccharides claim 1 , based on weight of the total oligosaccharides.5. The method of claim 1 , wherein the composition has less than 5% by weight of monomeric sugars based on total sugar and oligosaccharide solids.6. The method of claim 1 , wherein the composition has less than 5% by weight of lactose claim 1 , based on weight of the total oligosaccharides.7. The method of claim 1 , wherein the composition comprises a lactase enzyme.8. The method of claim 1 , wherein the composition is a food product or dietary supplement product.9. The method of claim 1 , wherein the food product is selected from the group consisting of an infant formula claim 1 , a follow-on formula claim 1 , and a toddler beverage.10. The method of claim 1 , wherein less than 10% of the galacto-oligosaccharides by weight have a degree of polymerization of 6 or greater.11. The method of claim 1 , wherein less than 10% of the galacto-oligosaccharides by ...

STABILIZING COMPOSITION FOR BIOLOGICAL MATERIALS

Dry stabilizing compositions for bioactive materials include sugars and hydrolyzed proteins, and may be formed into tablets or other forms providing enhanced stability for the bioactive material. Compositions containing the bioactive materials may be produced by a method that includes (a) combining the bioactive material with other ingredients in an aqueous solvent to form a viscous slurry; (b) snap-freezing the slurry in liquid nitrogen to form solid frozen particles, beads, droplets or strings; (c) primary drying by water removal under vacuum of the product of step (b) while maintaining it at a temperature above its freezing temperature; and (d) secondary drying of the product of step (c) at maximum vacuum and a temperature of 20° C. or higher for a time sufficient to reduce the water activity to below 0.3 Aw. 1. A dry stabilizing composition , comprising a bioactive material , one or more disaccharides at 10-50% , one or more oligosaccharides at 10-80% , one or more polysaccharides at 0.1-10% , one or more hydrolyzed proteins at 0.5-40% , and one or more carboxylic acid salts , each percentage based on the total weight of the composition.2. The dry stabilizing composition of claim 1 , wherein the bioactive material comprises a cell claim 1 , a virus claim 1 , a bacterium claim 1 , a yeast claim 1 , a protein claim 1 , a hormone claim 1 , a vaccine claim 1 , a drug or a mixture thereof.3. The dry stabilizing composition of claim 2 , wherein the bacterium is a probiotic bacterium.4. The dry stabilizing composition of claim 2 , wherein the virus is an attenuated virus.5. The dry stabilizing composition of claim 1 , further comprising vitamin E.6. The dry stabilizing composition of claim 1 , wherein the one or more oligosaccharides comprise cyclodextrin.7. The dry stabilizing composition of claim 1 , wherein the one or more oligosaccharides comprise cyclodextrin and inulin.8. The dry stabilizing composition of claim 1 , wherein the one or more carboxylic acid salts ...

ANTIMICROBIAL STRAIN

The present invention belongs to the field of the biotechnology, and relates to novel Streptococcusbacteria which are useful as antimicrobial agents, particularly against caries and periodontal disease. The invention relates to compositions and functional food comprising the novel bacteria. In particular, the present invention relates to a novel bacterial strain, deposited at the Colección Española de Cultivos Tipo, with accession number CECT 9174, which has proven to be useful in the prevention and treatment of caries and periodontal disease. 1. A bacterial strain deposited at the Colección Española de Cultivos Tipo (CECT) by Servicio Galego de Saúde (SERGAS) , on Jul. 20 , 2016 , with accession number CECT 9174.2. The bacterial strain of claim 1 , for use as a medicament.3. The bacterial strain of claim 1 , for use as an anti-microbial medicament.4. The bacterial strain of claim 1 , for use in the prevention or therapeutic treatment of infectious diseases of the oral cavity.5. The bacterial strain of claim 1 , for the use of claim 1 , wherein the infectious disease of the oral cavity is caused by Gram positive and/or Gram negative bacteria.6. The bacterial strain of claim 1 , for the use of any one of - claim 1 , wherein the infectious disease of the oral cavity is caries and/or periodontal disease.7. The bacterial strain of claim 1 , for use as a probiotic claim 1 , medical food composition or functional food to improve oral health.8. A probiotic or medical food composition or a functional food that comprises the bacterial strain as defined in .9. A pharmaceutical composition that comprises the bacterial strain as defined in .10. An oral health composition that comprises the bacterial strain as defined in .11. The compositions or functional food as defined in claim 1 , pharmaceutical composition as defined in claim 1 , or the oral health composition as defined in claim 1 , for use in the prevention and/or therapeutic treatment of infectious diseases of the oral ...

NANOVESICLES DERIVED FROM RHIZOBIUM SP. BACTERIA, AND USE THEREOF

The present invention relates to vesicles derived from bacteria of the genus and a use thereof, and the inventors experimentally confirmed that the vesicles were significantly reduced in clinical samples obtained from patients with stomach cancer, colon cancer, breast cancer, ovarian cancer, bladder cancer, prostate cancer, asthma, diabetes, Parkinson's disease and dementia, compared with a normal individual, and that when vesicles isolated from the strain were administered, the secretion of inflammatory mediators caused by pathogenic vesicles, such as -derived vesicles, was significantly inhibited. Therefore, it is expected that the vesicles derived from bacteria of the genus according to the present invention can be effectively used for a method of diagnosing stomach cancer, colon cancer, breast cancer, ovarian cancer, bladder cancer, prostate cancer, asthma, diabetes, Parkinson's disease or dementia, and for developing a composition for preventing, alleviating or treating the diseases. 1. A method of diagnosing one or more diseases selected from the group consisting of stomach cancer , colon cancer , breast cancer , ovarian cancer , bladder cancer , prostate cancer , asthma , diabetes , Parkinson's disease and dementia , the method comprising the following steps:(a) extracting DNAs from extracellular vesicles isolated from samples of a normal individual and a subject;(b) performing polymerase chain reaction (PCR) on the extracted DNA using a pair of primers prepared based on a gene sequence present in 16S rDNA to obtain each PCR product; and{'i': 'Rhizobium', "(c) determining a case in which a content of extracellular vesicles derived from bacteria of the genus is lower than that of the normal individual sample, as one or more diseases selected from the group consisting of stomach cancer, colon cancer, breast cancer, ovarian cancer, bladder cancer, prostate cancer, asthma, diabetes, Parkinson's disease and dementia, through quantitative analysis of the PCR ...

NANOVESICLES DERIVED FROM BLAUTIA BACTERIA AND USE THEREOF

Provided are vesicles derived from bacteria of the genus and a use thereof for diagnosing colon cancer, liver cancer, pancreatic cancer, cholangiocarcinoma, ovarian cancer, bladder cancer, myocardial infarction, atrial fibrillation or variant angina pectoris, and for developing a composition for preventing, alleviating or treating a colorectal disease, a liver disease, a pancreatic disease, cholangiocarcinoma, ovarian cancer, bladder cancer, myocardial infarction, atrial fibrillation, variant angina pectoris or a graft-versus-host disease. 1. A method of diagnosing one or more diseases selected from the group consisting of colon cancer , liver cancer , pancreatic cancer , cholangiocarcinoma , ovarian cancer , bladder cancer , myocardial infarction , atrial fibrillation and variant angina pectoris , the method comprising the following steps:(a) extracting DNAs from extracellular vesicles isolated from a biological samples of a normal individual and a subject;(b) performing polymerase chain reaction (PCR) on the extracted DNA using a pair of primers prepared based on a gene sequence present in 16S rDNA to obtain each PCR product; and{'i': 'Blautia', '(c) determining a case in which a content of extracellular vesicles derived from bacteria of the genus is lower than that of the normal individual sample, as one or more diseases selected from the group consisting of colon cancer, liver cancer, pancreatic cancer, cholangiocarcinoma, ovarian cancer, bladder cancer, myocardial infarction, atrial fibrillation and variant angina pectoris, through quantitative analysis of the PCR product.'}2. The method of claim 1 , wherein the biological sample in Step (a) is a blood or stool sample.3Blautia.. A method of treating one or more diseases selected from the group consisting of a colorectal disease claim 1 , a liver disease claim 1 , a pancreatic disease claim 1 , cholangiocarcinoma claim 1 , ovarian cancer claim 1 , bladder cancer claim 1 , myocardial infarction claim 1 , atrial ...

COMPOSITIONS FOR USE IN THE PREVENTION OR TREATMENT OF NECROTIZING ENTEROCOLITIS IN INFANTS AND YOUNG CHILDREN

The invention discloses a composition comprising LNT and at least another human milk oligosaccharide or precursor thereof, for use in preventing and/or treating necrotizing enterocolitis in infants and young children. 1. (canceled)2. A method of improving gut protection from microbial and pathogen overgrowth , promoting gut development and maturation , decreasing gut inflammation , promoting enteral feeding tolerance and/or preventing a disease or complication associated thereof in an infant or young child in need thereof , the method comprising administering a composition to the infant or young child in need thereof , the composition comprising lacto-N-tetraose (LNT) and at least another human milk oligosaccharide and/or precursor thereof.3. (canceled)4. The method according to claim 2 , wherein the at least another human milk oligosaccharide and/or precursor thereof is selected from the group consisting of N-acetylated oligosaccharide claim 2 , sialylated oligosaccharide claim 2 , fucosylated oligosaccharide claim 2 , sialic acid claim 2 , fucose and combinations thereof.5. The method according to claim 4 , wherein the N-acetylated oligosaccharide is lacto-N-neotetraose (LNnT).6. The method according to claim 2 , wherein the composition comprises the lacto-N-tetraose (LNT) and the lacto-N-neotetraose (LNnT) in a ratio LNT:LNnT between 5:1 and 1:2.7. The method according to claim 4 , wherein the sialylated oligosaccharide is selected from the group consisting of 3′ sialyllactose (3-SL) claim 4 , 6′ sialyllactose (6-SL) claim 4 , and a combination of 3′ sialyllactose (3-SL) and 6′ sialyllactose (6-SL).8. The method according to claim 4 , wherein the fucosylated oligosaccharide is selected from the group consisting of 2′-fucosyllactose (2-FL) claim 4 , 3-fucosyllactose claim 4 , difucosyllactose claim 4 , lacto-N-fucopentaose I claim 4 , lacto-N-fucopentaose II claim 4 , lacto-N-fucopentaose III claim 4 , lacto-N-fucopentaose V claim 4 , lacto-N-difucohexaose I claim ...

MULTI-NUTRIENT SUPPLEMENT COMPOSITION AND USES THEREOF

Various embodiments of the invention relate to compositions comprising vitamins, minerals and trace elements, antioxidants, amino acids, probiotics, and other components and methods for using such compositions to treat or prevent diseases associated with oxidative stress, including cardiovascular disease. 1. (canceled)2. A method of delaying or preventing the onset of a disease and/or condition associated with oxidative stress comprising administering to a human subject a therapeutically effective amount of a composition comprising:(i) vitamin A, vitamin B1 vitamin B2, vitamin B3, vitamin B5, vitamin B6, vitamin B12, vitamin C, vitamin D, vitamin E, vitamin K, folic acid, calcium source, potassium source, magnesium source, phosphate source, iodine, copper source, chromium source, manganese source, molybdenum source, selenium source, zinc source, lycopene, one or more carotenoids, one or more flavonoids, biotin, inositol, choline, one or more amino acids,(ii) a probiotic composition comprising the powder of one or more dried fruits and pollen extract or Terminalia arjuna or an extract thereof,(iii) fish oil, and(iv) one or more pharmaceutically acceptable excipients;wherein the composition delays or prevents the onset of a disease and/or condition associated with oxidative stress.3. The method of claim 2 , wherein the composition comprises vitamin A (0.01-10 mg) claim 2 , vitamin B(1-50 mg) claim 2 , vitamin B(1-50 mg) claim 2 , vitamin B(1-100 mg) claim 2 , vitamin B(1-100 mg) claim 2 , vitamin B(0.5-50 mg) claim 2 , vitamin B(0.0001-2 mg) claim 2 , vitamin C (0.1-1000 mg) claim 2 , vitamin D (0.0001-1 mg) claim 2 , vitamin E (1-500 mg) claim 2 , vitamin K (0.001-5 mg) claim 2 , folic acid (0.0001-5 mg) claim 2 , calcium source (0.1-1000 mg) claim 2 , potassium source (0.1-1000 mg) claim 2 , magnesium source (0.1-1000 mg) claim 2 , phosphate source (1-500 mg) iodine source (0.0001-5 mg) claim 2 , copper source (0.0001-10 mg) claim 2 , chromium source (0.0001-10 rug) ...

MODIFIED STRAINS OF CHLORELLA VULGARIS AND METHOD OF PRODUCTION

Disclosed are modified strains of having a very low chlorophyll content. Also disclosed is a method for producing them. The method involves performing mutagenesis of a parental strain of . Furthermore, disclosed is a composition comprising algae biomass derived from the modified strains of and their use in food and/or cosmetics amongst other applications. 138.-. (canceled)39Chlorella vulgaris. A modified strain of having a chlorophyll content in a range of 0.001 to 0.5 mg/g dry cell weight.40Chlorella vulgarisChlorella vulgaris. A modified strain of of claim 39 , wherein the modified strain of is a heterotroph.41Chlorella vulgaris. A modified strain of of claim 39 , wherein{'i': 'Chlorella vulgaris', 'the modified strain of has a chlorophyll content in a range of 0.25 to 0.50 mg/g dry cell weight, 0.10 to 0.25 mg/g dry cell weight or 0.001 to 0.1 mg/g dry cell weight.'}42Chlorella vulgaris. A modified strain of of claim 39 ,{'i': 'Chlorella vulgaris', 'wherein the modified strain of has at least one of a white, cream, pale yellow, yellow, pale green, golden, caramel, orange, red or lime colour.'}43Chlorella vulgaris. A modified strain of of claim 39 ,{'i': Chlorella vulgaris', 'Chlorella vulgaris, 'wherein the modified strain of is obtained from a wild-type strain of , by performing mutagenesis.'}44Chlorella vulgarisChlorella vulgarisChlorella vulgaris. A modified strain of of claim 39 , wherein the modified strain of is obtained from a variation of the wild type strain of claim 39 , by performing mutagenesis.45Chlorella vulgaris. A modified strain of of claim 39 ,{'i': Chlorella vulgaris', 'Chlorella vulgaris, 'wherein the mutagenesis is performed by exposure of the wild-type strain of or a variation of the wild-type strain of , to a non-lethal quantity of a mutagenic chemical, preferably wherein the mutagenic chemical is ethyl methanesulphonate.'}46Chlorella vulgaris. A modified strain of of claim 45 , wherein the non-lethal quantity of the mutagenic chemical is ...

Weissella bacteria-derived nanovesicle and use thereof

Provided are vesicles derived from bacteria of the genus Weissella and a use thereof. The present inventors experimentally identified that vesicles derived from bacteria of the genus Weissella effectively suppress the secretion of inflammatory mediators from pathogenic vesicles inducing inflammation. Thus, it is expected that the vesicles derived from bacteria of the genus Weissella according to the presently claimed subject matter will be advantageously used for the purpose of developing a composition for preventing, alleviating, or treating inflammatory diseases.

NOVEL LEUCONOSTOC CITREUM AND FERMENTED FOODS USING THE SAME AS A STARTER, AND COMPOSITIONS THEREOF

The present invention relates to CJGN34 KCTC 10974BP lactic acid bacteria, fermented foods including kimchi manufactured using the lactic acid bacteria as a starter, and lactic acid bacteria composition comprising of the lactic acid bacteria. The novel CJGN34 of the present invention enhances the general taste quality of kimchi; increases the intrinsic complex sour taste and carbonated taste of kimchi manufactured by traditional manufacturing method in wintertime; and regularly sustains the fermentation quality during the year; particularly, has an effect for controlling the deterioration of fermentation quality in the summer in which the taste quality deteriorates. Thus, the lactic acid bacteria of the present invention can be used as a starter in fermented foods including kimchi, or as a drug medicine in the form of a tablet or capsule mixed with carriers or additives, or a s probiotics for foods; or applied in cosmetic ingredients by mixing in a certain amount. Therefore, the lactic acid bacteria of the present invention can be used in a manner commonly applied in various fields of technology such as medicine, food, feed, cosmetics or the like. 1. A method for preparing fermented foods , comprising:{'i': 'Leuconostoc citreum', 'adding CJGN34 KCTC 10974BP to a vegetable to form a vegetable preparation; and'}fermenting and aging the vegetable preparation.2. The method of claim 1 , wherein the vegetable is at least one selected from the group consisting of cucumber claim 1 , radish claim 1 , carrot claim 1 , onion claim 1 , garlic claim 1 , pepper and Korean cabbage.3. The method of claim 1 , wherein the fermenting and aging occurs at least in the summer.4Leuconostoc citreum. The method of claim 1 , wherein an amount of the CJGN34 KCTC 10974BP is 0.001% to 3% based on a weight of the vegetable.5. A method for preparing fermented foods claim 1 , comprising:{'i': 'Leuconostoc citreum', 'adding CJGN34 KCTC 10974BP to Kimchi to form a Kimchi preparation; and'}fermenting ...

Probiotics for use in expecting female mammals for enhancing the immunity of their offspring

The present invention relates to the use of probiotic on expecting female mammals to boost the immune status of an offspring. The use can induce an enhanced response of the offspring after birth to an infectious antigenic exposure. Ultimately the use of probiotic in expecting females can induce a better protection of their offspring against infectious diseases.

LACTIC ACID BACTERIUM, DRUG, FOOD OR DRINK, AND FEED WHICH CONTAIN THE LACTIC ACID BACTERIUM

The MCC1849 (NITE BP-01633) strain, which has a high IL-12 production-promoting action, is used as an ingredient of a drug, food or drink, or feed used for promotion of IL-12 production, immunostimulation, antivirus, or the like. 1Lactobacillus paracasei. A method for promoting IL-12 production in a subject in need thereof , comprising administering an agent which comprises cells of MCC1849 (NITE BP-01633) to the subject in an amount effective to increase IL-12 levels in the subject.2. The method according to claim 1 , wherein immunostimulation is provided by the increased IL-12 levels in the subject.3. The method according to claim 1 , wherein the agent is in the form of drug claim 1 , food or drink claim 1 , or feed.4. The method according to claim 1 , wherein the cells are live cells.5. The method according to claim 1 , wherein the cells are heat-treated cells and/or enzyme-treated cells.6. The method according to claim 5 , wherein the heat-treated cells and/or the enzyme-treated cells are dead cells.7. The method according to claim 1 , wherein the cells are administered at a dose of 10to 10cfu/g. The present invention relates to a novel lactic acid bacterium belonging to a drug, food or drink, and feed which contain the lactic acid bacterium.It has been reported that some lactic acid bacteria show prophylactic action and defensive action against various infectious diseases (Non-patent document 1). It has also been reported that these actions of lactic acid bacteria are based on activation of cell-mediated host immunity, promotion of IgA secretion from mucosae, such as those of intestinal tract and respiratory organs (Non-patent document 1), and so forth. For example, it has been reported that lactic acid bacteria belonging to induce production of cytokines such as IL-12 (interleukin-12) and IFN-γ (interferon-γ) by immunocompetent cells of hosts to activate cell-mediated host immunity and thereby defend the hosts from infection by influenza virus, and so forth ( ...

Probiotic fermented fruit and vegetable pulp product

The present invention belongs to the technical field of beverages, and relates to a probiotic fermented fruit and vegetable puree product. The probiotic fermented fruit and vegetable puree product is obtained by fermenting fruit and vegetable puree with NCU215. The probiotic fermented fruit and vegetable puree provided by the present invention has the following characteristics: the probiotic fermented fruit and vegetable puree may generate a natural mellow sour, effectively remove an astringency in fruit and a wild artemisia flavor in vegetable, and neutralize an unpleasant sour in the fruit; with probiotic fermentation, the present invention may improve a content of amino acid in the fruit and vegetable by 20% or more, generate multiple aromatic substances, improve a flavor substance by 30% or more, and effectively improve a taste and a mouthfeel of the product; the present invention prolongs a shelf life of the product and prevents rot. 1. A probiotic fermented fruit and vegetable pulp product , wherein the product is prepared by fermenting the following raw materials: 80-99.8 parts of fruit and vegetable puree , and 0-19.8 parts of syrup or sugar substitute; and{'i': 'Lactobacillus casei', 'the probiotic is NCU215 with a preservation number of CGMCC No. 18702.'}2. The probiotic fermented fruit and vegetable puip product according to claim 1 , wherein the raw materials further comprise 0.01-0.5 parts of D-sodium isoascorbiate or vitamin C.3. The probiotic fermented fruit and vegetable pulp product according to claim 1 , wherein the syrup or the sugar substitute is selected from white granulated sugar claim 1 , glucose claim 1 , starch syrup claim 1 , malt syrup claim 1 , glucose syrup claim 1 , maltitol claim 1 , xylitol claim 1 , erythritol or isomaltooligosaccharide.4. The probiotic fermented fruit and vegetable pulp product according to claim 1 , wherein prepared by the following steps:(1) selecting unrotten and fresh fruit and vegetable as raw materials, ...

GEL-LIKE FOOD COMPOSITION

Provided is a novel gel-like food composition. The gel-like food composition contains 0.1 to 10 wt % of a free branched-chain amino acid, 1 to 12 wt % of a protein, and 10/g to 10/g of a probiotic. 1. A gel-like food composition comprising 0.1 to 10 wt % of a free branched-chain amino acid , 1 to 12 wt % of a protein , and 10/g to 10/g of a probiotic.2. The gel-like food composition according to claim 1 , further comprising 5 to 20 wt % of a saccharide.3. The gel-like food composition according to claim 1 , further comprising 0.1 to 2.5 wt % of a free non-branched-chain amino acid.4. The gel-like food composition according to claim 1 , wherein the protein is whey protein.5. The gel-like food composition according to claim 1 , wherein the saccharide is at least one member selected from the group consisting of sucrose claim 1 , glucose claim 1 , and dextrin.6. The gel-like food composition according to claim 1 , wherein the free branched-chain amino acid is at least one member selected from the group consisting of valine claim 1 , leucine claim 1 , and isoleucine.7. The gel-like food composition according to claim 3 , wherein the free non-branched-chain amino acid is arginine.8. The gel-like food composition according to claim 1 , further comprising a soybean polysaccharide.9. The gel-like food composition according to claim 8 , wherein the soybean polysaccharide is present in an amount of 0.2 to 1.7 wt %.10. The gel-like food composition according to claim 1 , wherein the probiotic is a lactic acid bacterium.11. The gel-like food composition according to claim 1 , which is in a single-serve package form.12. The gel-like food composition according to claim 1 , wherein the single-serve package form is 50 to 400 g.13. The gel-like food composition according to claim 1 , which is in a single-serve package form claim 1 , the gel-like food composition being a degradation inhibitor of muscle protein claim 1 , a fatigue recovery agent claim 1 , and/or an immunostimulant. An ...

MICROBIAL COMPOSITIONS COMPRISING ELLAGITANNIN AND METHODS OF USE

A combination is provided comprising an ellagitannin composition, and an enzymatic composition comprising one or more ellagitannin enzymes, where the one or more ellagitannin enzymes comprise a tannin acyl hydrolase enzyme, a gallate decarboxylase enzyme, or a combination thereof. Methods of making and using combinations disclosed herein are also provided. 126.-. (canceled)27. A method comprising administering to a subject:(i) an ellagitannin composition,(ii) an enzymatic composition comprising an ellagitannin-enzyme-synthesizing (EES) microbe or an extract thereof, or(iii) a combination thereof,so that the subject is receiving:(a) the ellagitannin composition, and(b) the enzymatic composition comprising the EES microbe or an extract thereof; and{'i': 'Lactobacillus plantarum', 'wherein the EES microbe is MBT501.'}28. The method of claim 27 , wherein the one or more ellagitannin enzymes comprises a tannin acyl hydrolase enzyme.29. The method of claim 28 , wherein the tannin acyl hydrolase enzyme is a tanB tannase enzyme.30. The method of claim 27 , wherein the one or more ellagitannin enzymes comprises a gallate decarboxylase enzyme.31. The method of claim 30 , wherein the gallate decarboxylase enzyme is an lpdB gallate decarboxylase enzyme.32. The method of claim 30 , wherein the gallate decarboxylase enzyme is an lpdC gallate decarboxylase enzyme.33. The method of claim 27 , wherein the one or more ellagitannin enzymes comprises an lpdB gallate decarboxylase enzyme and an lpdC gallate decarboxylase enzyme.34. The method of claim 27 , wherein the one or more ellagitannin enzymes comprises a tanB tannase enzyme claim 27 , an lpdB gallate decarboxylase enzyme claim 27 , and an lpdC gallate decarboxylase enzyme.35. The method of claim 27 , wherein the EES microbe is found in nature.36. The method of claim 27 , wherein the EES microbe is viable or alive.37. The method of claim 36 , wherein the enzymatic composition includes a sufficient amount of the EES microbe to ...

Composition for Suppressing Norovirus Infection

An object of this present invention is to provide a composition for inhibiting norovirus infection which can inhibit norovirus from infecting a human, and the object is achieved by a composition for inhibiting norovirus infection containing one or more kinds of bacteria selected from the group consisting of subsp. subsp. and as an active ingredient. 1. (canceled)2. (canceled)3. (canceled)4. (canceled)5. (canceled)6. (canceled)7. (canceled)8Bifidobacterium breve, Bifidobacterium longuminfantis, Bifidobacterium animalis, Bifidobacterium bifidum, Bifidobacterium catenulatum, Lactobacillus gasseri, Lactobacillus helveticus, Lactobacillus delbrueckiibulgaricusLactobacillus paracasei. A method manufacturing a composition that is able to inhibit norovirus infection , comprising a step of formulating a bacterium selected from the group consisting of subsp. subsp. and , and combinations thereof into a composition in the manufacture of a composition for inhibiting norovirus infection.9. (canceled)10. (canceled)11. (canceled)12Bifidobacterium breve, Bifidobacterium longuminfantis, Bifidobacterium animalis, Bifidobacterium bifidum, Bifidobacterium catenulatum, Lactobacillus gasseri, Lactobacillus helveticus, Lactobacillus delbrueckiibulgaricusLactobacillus paracasei. A method for inhibiting norovirus from infecting a human , including comprising a step of administering to the human one or more kinds of bacteria a bacterium selected from the group consisting of subsp. subsp. and , and combinations thereof to a human.13Bifidobacterium breve, Bifidobacterium longuminfantis, Bifidobacterium animalis, Bifidobacterium bifidum, Bifidobacterium catenulatum, Lactobacillus gasseri, Lactobacillus helveticus, Lactobacillus delbrueckiibulgaricusLactobacillus paracasei. A method for preventing or a method for treating a syndrome or a symptom which can be prevented or treated by inhibiting norovirus infection , including comprising a step of administering to a human one or more kinds of ...

STARTER CULTURE CONTAINING MIXTURE OF LACTIC ACID BACTERIA STRAINS, AND FERMENTED PRODUCT PREPARED USING SUCH STARTER CULTURE AND USE OF THIS FERMENTED PRODUCT

Disclosed herein are a starter culture and a fermented product prepared using such starter culture. The starter culture comprises a mixture of strain LF26, strain LH43, strain LPC12, strain LRH10, and strain ST30. Also disclosed herein are methods for reducing fatigue, improving exercise performance, and/or modifying gut microbiota. Each of these methods includes administering to a subject the fermented product. 1. A starter culture for preparing a fermented product , comprising:{'i': Lactobacillus fermentum', 'Lactobacillus helveticus', 'Lactobacillus paracasei', 'Lactobacillus rhamnosus', 'Streptococcus thermophilus, 'a mixture of the following five lactic acid bacteria strains deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH: strain LF26 with Accession No. DSM 32784, strain LH43 with Accession No. DSM 32787, strain LPC12 with Accession No. DSM 32785, strain LRH10 with Accession No. DSM 32786, and strain ST30 with Accession No. DSM 32788.'}2. The starter culture as claimed in claim 1 , which is in a state selected from the group consisting of a liquid claim 1 , a paste claim 1 , a semi-solid claim 1 , a solid claim 1 , and combinations thereof.3. A process for preparing a fermented product claim 1 , comprising:{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, 'subjecting a fermentable material to a fermentation treatment with a starter culture as claimed in .'}4. The process as claimed in claim 3 , wherein the fermentable material is selected from the group consisting of a dairy material claim 3 , a soybean material claim 3 , a rice material claim 3 , a nut material claim 3 , a coconut material claim 3 , a fruit material claim 3 , a beer wort material claim 3 , a ginger material claim 3 , and combinations thereof.5. The process as claimed in claim 4 , wherein the fermentable material is a dairy material.6. The process as claimed in claim 5 , wherein the fermentable material is selected from the group consisting of milk claim 5 , whey claim ...

NUTRITIONAL COMPOSITIONS COMPRISING HUMAN MILK OLIGOSACCHARIDES AND NUCLEOTIDES AND USES THEREOF FOR TREATING AND/OR PREVENTING ENTERIC VIRAL INFECTION

Disclosed are nutritional compositions including human milk oligosaccharides and nucleotides that can be administered to preterm infants, term infants, toddlers, and children for reducing inflammation and the incidence of inflammatory diseases. 120-. (canceled)21. A synthetic pediatric formula comprising from about 0.01 mg/mL to about 10 mg/mL of a human milk oligosaccharide and from about 40 mg/L to about 320 mg/L of a nucleotide.22. The synthetic pediatric formula of claim 21 , wherein the human milk oligosaccharide is selected from 3′-fucosyllactose claim 21 , lacto-N-neotetraose claim 21 , 6′-sialyllactose claim 21 , 3′-sialyllactose claim 21 , sialic acid claim 21 , and combinations thereof.23. The synthetic pediatric formula of claim 22 , wherein the human milk oligosaccharide is lacto-N-neotetraose.24. The synthetic pediatric formula of claim 22 , wherein the human milk oligosaccharide is 3′-fucosyllactose.25. The synthetic pediatric formula of claim 22 , wherein the human milk oligosaccharide is selected from the group consisting of 3′-sialyllactose claim 22 , 6′-sialyllactose claim 22 , sialic acid claim 22 , and combinations thereof.26. The synthetic pediatric formula of claim 25 , wherein the human milk oligosaccharide comprises about 40 wt % 6′-sialyllactose claim 25 , about 10 wt % 3′-sialyllactose claim 25 , and about 50 wt % sialic acid.27. The synthetic pediatric formula of claim 21 , wherein the nucleotide is selected from the group consisting of cytidine 5′-monophosphate claim 21 , uridine 5′-monophosphate claim 21 , adenosine 5′-monophosphate claim 21 , guanosine 5′-monophosphate claim 21 , and combinations thereof.28. The synthetic pediatric formula of claim 27 , wherein the nucleotide comprises about 43% cytidine 5′-monophosphate claim 27 , about 18.5% uridine 5′-monophosphate claim 27 , about 16.5% adenosine 5′-monophosphate claim 27 , and about 22% guanosine 5′-monophosphate.29. The synthetic pediatric formula of claim 28 , wherein the ...

Compositions for use in the promotion of intestinal muscle growth and development and associated intestinal motility

This invention relates to nutritional compositions comprising at least one N-acetylated oligosaccharide for use in the promotion of the development and/or of the growth of the intestinal muscles, in the promotion of contractile capacity and/or the motility in the intestine, in the promotion of enteral feeding tolerance and in prevention and/or treatment of small intestinal bacterial overgrowth (SIBO) in an infant, a young child or, when the composition is a growing-up milk, in a child.

PROBIOTIC FOR INFANTILE COLIC

The invention provides a bacterial composition which comprises from 10to 10cfu/g of cells which have the ability to induce the production of interleukin-10 to reduce inflammation in the intestinal tract among other features. Thus, the bacterial composition is useful in the amelioration of excessive crying in infants. Particularly, cells are from the strain deposited as CECT 8330. The bacterial composition can be in the form of a food supplement, a medicament, an infant formula, an edible product and a food product. Particularly, the composition is in the form of an infant food supplement in the form of oily suspension. 1Pediococcus pentosaceusPediococcus pentosaceusPediococcus pentosaceus. A freeze-dried bacterial composition which comprises from 10to 10cfu/g of viable cells which induce the production of interleukin-10 , wherein the production of interleukin-10 by THP-1 macrophages in the presence of cells as expressed as normalized increase is higher than the production of interleukin-10 by the negative control , which are THP-1 macrophages in the absence of cells , when the normalized increase is determined by the following steps:(a) differentiating THP-1 monocytes into macrophages by growing the THP-1 monocyte cell line obtained from the cell collection of the Public Health England, catalogue number 88081201, in Roswell Park Memorial Institute (RPMI) 1640 medium with 10% Fetal Bovine Serum (FBS), and with phorbol 12-myristate 13-acetate (PMA) to a final concentration of 0.16 μM;{'sup': '6', '(b) growing the THP-1 macrophages in RPMI 1640 medium with 10% FBS in 24-wells ELISA plates to a final concentration of 10macrophages/well;'}(c) incubating for 2.5 hours the THP-1 macrophages with lipopolysaccharide (LPS) at a final concentration of 10 ng/ml, and washing the THP-1 macrophages with Dulbecco's Phosphate Buffered Saline medium (D-PBS);{'i': 'Pediococcus pentosaceus', 'sub': '2', '(d) getting a culture of cells ready by having grown it overnight in Man, Rogosa ...

Hafnia alvei impact on regulation of appetite and metabolic syndrome aspects

The present invention relates to method of preventing, treating or attenuating obesity-related manifestations in a human or non-human mammal subject in need thereof, said method comprising orally administering to the subject a composition comprising an effective amount probiotics; wherein said obesity-related parameters are selected from the group of hyperphagia, increased fat mass on lean mass ratio, increased waist circumference, postprandial hyperglycemia, fasting hyperglycemia and hypercholesterolemia. 1Hafnia alvei. A method of preventing , treating or attenuating obesity-related manifestations in a human or non-human mammal subject in need thereof , said method comprising orally administering to the subject a composition comprising an effective amount probiotics; wherein said obesity-related parameters are selected from the group of hyperphagia , increased fat mass on lean mass ratio , increased waist circumference , postprandial hyperglycemia , fasting hyperglycemia and hypercholesterolemia.2. The method according to claim 1 , wherein the subject is obese.3. The method according to claim 1 , wherein the subject is overweight.4. The method according to claim 1 , wherein the subject has at least 180 or at least 200 mg/dL of total cholesterol and/or at least 100 or at least 130 mg/dL of LDL cholesterol.5. The method according to claim 1 , wherein the subject has at least 80 or at least 100 mg/dL of glucose at a fasting state.6. The method according to claim 1 , wherein the subject has at least 80 or at least 90 waist-to-hip ratio.7Hafnia alvei. The method according to claim 1 , wherein probiotics are administered at a dose between 1000 million and 10000 million UFC.day-1.8Hafnia alvei. The method according to claim 1 , wherein the probiotic is administered to the subject in the form of a pharmaceutical composition.9Hafnia alvei. The method according to claim 1 , wherein the probiotic is administered to the subject in the form of companion composition to be ...

Composition for Promoting the Secretion of FGF21

An object of the present invention is to provide a novel composition for promoting the secretion of FGF21. The object is achieved by a composition for promoting the secretion of FGF21, including a bacterium as an active ingredient. 112.-. (canceled)13Bifidobacterium. A method for preventing or improving a disease , a symptom , a condition , or a disorder attributable to a failure of FGF21 production and/or a failure of FGF21 secretion , the method comprising a step of administering a bacterium to a subject who has a need to prevent or improve a disease , a symptom , a condition , or a disorder attributable to a failure of FGF21 production and/or a failure of FGF21 secretion.14Bifidobacterium. A method for promoting the secretion of FGF21 , comprising administering a bacterium to a subject.15. The method according to claim 14 , the method comprising an ability to modulate palatability claim 14 , maintain body temperature claim 14 , or protect a blood vessel.16. The method according to claim 14 , the method comprising an ability to prevent or treat an unbalanced diet claim 14 , a feeling of cold claim 14 , hypothermia claim 14 , myocardial infarction claim 14 , ischemia-reperfusion injury claim 14 , cardiac hypertrophy claim 14 , diabetic cardiomyopathy claim 14 , arteriosclerosis claim 14 , or vascular plaque formation.17Bifidobacterium. The method according to claim 14 , the method comprising administering a prebiotic in addition to the bacterium claim 14 , to the subject claim 14 , wherein the prebiotic is lactulose claim 14 , raffinose claim 14 , and galactooligosaccharide.18BifidobacteriumBifidobacterium breve.. The method according to claim 14 , wherein the bacterium is19Bifidobacterium breveBifidobacterium. The method according to claim 14 , wherein the is breve M-16V (NITE BP-02622).20Bifidobacterium. The method according to claim 14 , wherein the bacterium is comprised in a food or drink composition.21Bifidobacterium. The method according to claim 14 , ...

METHODS AND COMPOSITIONS USING BIFIDOBACTERIUM LONGUM TO TREAT OR PREVENT DEPRESSIVE SYMPTOMS

Compositions and methods use NCC3001 (ATCC BAA-999) to treat or prevent a depressive symptom. Prolonged anti-depressive effects can continue after administration of the compositions is ended. Non-limiting examples of a depressive symptom which can be treated or prevented include depressed mood; sadness; anxiety; “empty” feelings; loss of interest or pleasure; irritability; restlessness; changes in appetite or weight; sleep disturbances; lack of or decreased energy; feelings of worthlessness; guilt; helplessness; anger and hostility; difficulty in thinking, concentrating, or making decisions; hopelessness; tiredness; fatigue; memory difficulties; tearfulness; brooding; phobias; excessive worry over physical health; sexual dysfunction; persistent physical symptoms that do not respond to treatment; and combinations thereof. These depressive symptoms can be associated with a depressive state or depressive disorder or can be found sub-clinically or not associated with these depressive states/disorders (e.g., not part of a syndrome or psychiatric disorder). 124.-. (canceled)25Bifidobacterium longum. A method of treating a depressive symptom , the method comprising administering an edible composition comprising a therapeutically effective amount of ATCC BAA-999 to an individual having the depressive symptom , wherein the depressive symptom is a secondary condition caused by an underlying medical condition selected from the group consisting of an endocrine disease , a cardiovascular disease , a pulmonary disease , a cancer , an autoimmune disease and combinations thereof.26. The method of claim 25 , wherein the depressive symptom is selected from the group consisting of depressed mood; sadness; anxiety; loss of interest or pleasure; irritability; restlessness; changes in appetite or weight; sleep disturbances; lack of or decreased energy; guilt; helplessness; anger and hostility; difficulty in thinking claim 25 , concentrating claim 25 , or making decisions; hopelessness; ...

Probiotic Delivery Systems

Suppository compositions are provided combining a pharmaceutically acceptable matrix material that is solid outside of the human body and in a dry environment, but which melts at body temperature; and apple cider vinegar and one or more species of probiotic bacteria dispersed within the matrix material; wherein the matrix material contains a mixture of fatty acids that are solid at room temperature. Methods for supplementing and nourishing the microbiome of the rectum of a male or female and the microbiome of the vagina of a female are also disclosed. Oral dosage forms of the compositions of the present invention are also provided.

Probiotic or symbiotic gelled products and method for the production thereof

The invention relates to gelled products such as gelatins for food consumption or wine gums, comprising probiotic microorganisms and, in some of the variants thereof, prebiotic microorganisms, said products being developed from drinks of plant origin such as juices made from fruit, vegetables and cereals, which are subjected to a lactic fermentation process with at least one probiotic strain. The invention also relates to the method for producing such products, consisting of the following basic steps: a) production of a pasteurised or sterilised substrate; b) fermentation of the substrate; c) hydration of the gelatin and dissolution thereof in hot water; d) cooling of the hydrated gelatin; e) mixing of the fermented plant drink with the selected prebiotic and additives; h) homogenisation of the mixture; and g) packaging of the product.

COMPOSITIONS COMPRISING BACTERIAL STRAINS

The invention provides compositions comprising one or more bacterial strains for use in a method of reducing the level of Enterobacteriaceae in the gastrointestinal tract. 1Blautia. A composition comprising a bacterial strain of the genus , for use in a method of reducing the level of Enterobacteriaceae in the gastrointestinal tract.2E. coli.. The composition of claim 1 , wherein the Enterobacteriaceae is3. The composition of claim 1 , wherein the composition is for use in a method of reducing the level of Enterobacteriaceae in the gastrointestinal tract in the treatment or prevention of IBS claim 1 , Crohn's disease claim 1 , ulcerative colitis claim 1 , functional dyspepsia claim 1 , diarrhoea claim 1 , gastroenteritis claim 1 , urinary tract infection or neonatal meningitis.4. The composition of claim 1 , wherein the composition is for use in treating or preventing diarrhoea claim 1 , gastroenteritis claim 1 , urinary tract infection or neonatal meningitis.5. (canceled)6. (canceled)7Blautia hydrogenotrophica.. The composition of claim 1 , wherein the bacterial strain is of8. (canceled)9. (canceled)10Blautia hydrogenotrophica.. The composition of claim 1 , wherein the bacterial strain has a 16s rRNA sequence that is at least 95% claim 1 , 96% claim 1 , 97% claim 1 , 98% claim 1 , 99% claim 1 , 99.5% or 99.9% identical to the 16s rRNA sequence of a bacterial strain of11. The composition of claim 10 , wherein the bacterial strain has a 16s rRNA sequence that is at least 97% claim 10 , 98% claim 10 , 99% claim 10 , 99.5% or 99.9% identical to SEQ ID NO: 5 or which has the 16s rRNA sequence of SEQ ID NO:5.12. (canceled)13. (canceled)14Blautia hydrogenotrophica. The composition of claim 1 , wherein the composition comprises a bacterial strain of the species claim 1 , for use in a method of reducing the level of Enterobacteriaceae in the gastrointestinal tract in a subject diagnosed with IBS.15. (canceled)16. (canceled)17. The composition of claim 1 , wherein the ...

LACTIC ACID BACTERIA, AND FEED, FERTILIZERS, AND LIVE BACTERIAL PREPARATIONS CONTAINING THE SAME

An object is to provide lactic acid bacteria that can be applicable to feed, fertilizers, live bacterial preparations, probiotics, etc. The lactic acid bacteria are identified and deposited under the accession numbers of NITE (National Institute of Technology and Evaluation) P-02313, NITE P-02314, NITE P-02490, NITE P-02491, and NITE P-02492. In addition, another object is to provide feed, fertilizers and live bacterial preparations containing the lactic acid bacterium/bacteria of the invention. According to studies, it is confirmed that the lactic acid bacteria are proliferated in animals including human, plants, etc. without being destroyed. According to studies, it is also confirmed that the lactic acid bacteria are proliferated in water, soil, etc. without being destroyed. Therefore, the lactic acid bacteria can be widely applicable in feed, fertilizers, live bacterial preparations, etc. 1. A lactic acid bacterium deposited under an accession number of NITE (National Institute of Technology and Evaluation) P-02313 ,wherein said lactic acid bacterium is cultured with MRS agar at 30° C. and isolated with a dilution plate method.2. Feed containing the lactic acid bacterium according to .3. A fertilizer containing the lactic acid bacterium according to .4. A live bacterial preparation or probiotic containing the lactic acid bacterium according to . This is a divisional application of a prior application Ser. No. 16/332,977, filed on Mar. 13, 2019, allowed.The present invention relates to lactic acid bacteria. The present inventio also relates to feed, fertilizers and live bacterial preparations (or probiotics) containing the lactic acid bacterium.Lactic acid bacteria are generally referred to bacteria that produce lactic acid through metabolic activities thereof. It has been known that each of lactic acid bacteria tends to exhibit a different characteristic.Conventionally, bacteria with specific characteristics such as lactic acid bacteria have been extracted so ...

Systems and methods for growing a biofilm of probiotic bacteria on solid particles for colonization of bacteria in the gut

The present invention provides a method, wherein the method forms a biofilm, wherein the biofilm comprises a population of at least one bacterial strain attached to particles, wherein the biofilm is configured to colonize a gut of a subject in need thereof for at least five days, when ingested by the subject, the method comprising: a. obtaining a population comprising at least one strain of bacteria; b. inoculating a growth medium containing particles with the population comprising at least one strain of bacteria; c. incubating the particles with the population comprising at least one bacterial strain for a time sufficient for the population of at least one strain of bacteria to attach to the particles; and d. culturing the population comprising at least one strain of bacteria attached to the particles in a growth medium, for a time sufficient to form a biofilm.

BIOPROTECTION USING LACTOBACILLUS PARACASEI STRAINS

The present invention is related to the field of bioprotection, in particular to the strain of CHCC14676 with accession no. DSM25612. Furthermore, the present invention concerns an antifungal composition comprising the strain, an antifungal composition comprising the strain and at least one strain of , food, feed and pharmaceutical products comprising such an antifungal composition, a method of manufacturing such food, feed and pharmaceutical products, a method for reducing the content of yeasts and molds of such food, feed and pharmaceutical products and uses of the antifungal composition. 116-. (canceled)17Lactobacillus paracaseiLactobacillus paracaseiLactobacillus paracaseiMucorLactobacillus paracasei. An antifungal composition comprising at least one strain selected from strain CHCC14676 (DSM25612) and mutant strains derived therefrom , wherein the mutant strains have substantially the same or improved antifungal properties as CHCC14676 (DSM25612) , wherein the strain is capable of inhibiting or preventing the growth of spp , and the composition comprises an amount of the at least one strain effective to inhibit growth of yeasts and molds in the composition.18Lactobacillus paracasei. The composition according to claim 17 , wherein the composition comprises at least 10colony forming units of the strains per gram of the composition.19. The composition according to claim 17 , further comprising a cryoprotectant.20. The composition according to claim 19 , wherein the cryoprotectant is selected from one or more of mannitol claim 19 , sorbitol claim 19 , sodium tripolyphosphate claim 19 , xylitol claim 19 , glycerol claim 19 , raffinose claim 19 , maltodextrin claim 19 , erythritol claim 19 , threitol claim 19 , trehalose claim 19 , glucose and fructose.21. The composition according to claim 17 , further comprising an additive selected from one or more of yeast extracts claim 17 , sugars claim 17 , vitamins claim 17 , carbohydrates claim 17 , flavors claim 17 , ...

Vegan fermented soft cheese

The present invention relates to a food product composed of vegetable ingredients having visual, textural and flavour properties of a soft fermented cheese.

Intact Pea Protein-Based Nutrient Composition

The present invention discloses a nutritional composition and method of using and making the nutritional composition. The nutritional composition is an intact pea protein based nutrient composition for use in both enteral and oral feeding, and provides a nonallergenic diet for providing optimal nutrition to users. The nutritional composition is made from organic and plant-based ingredients. The nutritional composition has pea protein, phytochemical extracts, fatty acids, organic ingredients free of the top eight allergens and corn, and prebiotic fiber. The nutritional composition is provided in liquid form for enteral and/or oral feeding. 1. A nutrient composition , comprising:at least one protein source comprising pea protein;one or more phytochemical extracts;one or more fatty acids;one or more organic ingredients; andone or more prebiotic fibers.2. The composition of claim 1 , wherein at least one protein source constitutes 5.50 wt % to 6.20 wt % of the total composition claim 1 , and at least one protein is 100 wt. % pea proteins based on total protein of the mixture.3. The composition of claim 1 , wherein the phytochemical extracts is a blend of fruits claim 1 , vegetables claim 1 , herbs and spices.4. The composition of claim 1 , wherein the phytochemical extracts comprises rosemary extract claim 1 , blend of phytochemical extracts from fruits claim 1 , vegetables claim 1 , herbs claim 1 , and spices claim 1 , potassium citrate claim 1 , and potassium chloride.5arabica. The composition of claim 4 , wherein the blend of phytochemical extracts from fruits claim 4 , vegetables claim 4 , herbs claim 4 , and spices comprises one or more concentrates of broccoli sprouts claim 4 , camu camu claim 4 , tomato claim 4 , acai claim 4 , turmeric claim 4 , garlic claim 4 , basil claim 4 , oregano claim 4 , cinnamon claim 4 , elderberry claim 4 , chokeberry claim 4 , raspberry claim 4 , spinach claim 4 , kale claim 4 , brussels sprouts claim 4 , extracts of green coffee ...

COMPOSITIONS COMPRISING BACTERIAL STRAINS

The invention provides compositions comprising bacterial strains for treating and preventing cancer. 130.-. (canceled)31Enterococcus gallinarum. A method of treating a non-immunogenic cancer in a subject in need thereof , comprising administering to the subject a pharmaceutical composition that comprises a bacterial strain of the species comprising a plasmid with at least 93% sequence identity to the sequence of SEQ ID NO: 4 , wherein said administering is sufficient to treat the non-immunogenic cancer.32. The method of claim 31 , wherein said non-immunogenic cancer is a lung cancer.33. The method of claim 32 , wherein said lung cancer is non-small-cell lung carcinoma or small-cell lung carcinoma.34. The method of claim 31 , wherein said non-immunogenic cancer is a breast cancer.35. The method of claim 34 , wherein said breast cancer is mammary carcinoma or stage IV breast cancer.36. The method of claim 31 , wherein said non-immunogenic cancer is a liver cancer.37. The method of claim 36 , wherein said liver cancer is hepatocellular carcinoma.38. The method of claim 31 , wherein said non-immunogenic cancer is a colon cancer.39. The method of claim 38 , wherein said colon cancer is colorectal adenocarcinoma.40. The method of claim 31 , wherein said pharmaceutical composition comprises from about 1×10to about 1×10colony forming units (CFU) of said bacterial strain.41. The method of claim 31 , wherein said pharmaceutical composition comprises from about 1×10to about 1×10colony forming units per gram (CFU/g) of said bacterial strain with respect to a total weight of said pharmaceutical composition.42. The method of claim 31 , wherein said subject is human.43. The method of claim 31 , wherein said a bacterial strain comprises a plasmid with at least 95% sequence identity to the sequence of SEQ ID NO: 4.44. The method of claim 31 , wherein said a bacterial strain comprises a plasmid with at least 98% sequence identity to the sequence of SEQ ID NO: 445. The method of claim ...

PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING CANCER, COMPRISING WEISSELLA CIBARIA WIKIM28 AS ACTIVE INGREDIENT

The present invention relates to a novel WIKIM28 (Accession No. KCCM11879P) isolated from kimchi and a composition comprising the same as an active ingredient. WIKIM28 according to the present invention shows excellent anti-cancer activity in animal models in which a cancer cell is transplanted, and therefore it can be usefully used as a composition in use of treatment, prevention or improvement of cancer of humans or animals. 113-. (canceled)14Weissella cibaria. A method of treating or preventing cancer by administering a composition comprising WIKIM28 deposited under accession number KCCM11879P or its culture as an active ingredient to a subject in need thereof.15Weissella cibaria. The method of claim 14 , wherein the WIKIM28 deposited under accession number KCCM11879P has the nucleic acid sequence of SEQ ID NO: 1.16. The method of claim 14 , wherein the cancer is selected from the group consisting of bladder cancer claim 14 , breast cancer claim 14 , melanoma claim 14 , thyroid cancer claim 14 , parathyroid cancer claim 14 , rectal cancer claim 14 , throat cancer claim 14 , laryngeal cancer claim 14 , esophageal cancer claim 14 , pancreatic cancer claim 14 , stomach cancer claim 14 , tongue cancer claim 14 , skin cancer claim 14 , brain tumor claim 14 , uterine cancer claim 14 , gallbladder cancer claim 14 , oral cancer claim 14 , colon cancer claim 14 , anal region cancer claim 14 , liver cancer claim 14 , lung cancer and colorectal cancer.17. The method of claim 14 , wherein the composition is administered by an oral administration or a parenteral administration.18. The method of claim 17 , wherein the parenteral administration is intravenous injection administration.19. The method of claim 14 , wherein the composition is in a living cell form. The present invention relates to a composition for prevention or treatment of cancer comprising WIKIM28 (Accession No. KCCM11879P) isolated from kimchi as an active ingredient.Cancer shows a high mortality rate worldwide ...

NOVEL HALOPHILIC BACILLUS AMYLOLIQUEFACIENS KMUS1 WHICH PRODUCES THROMBOLYTIC ENZYME NATTOKINASE

The present invention relates to a novel halophilic KMUS1 strain (KCTC13635BP) producing thrombolytic enzyme nattokinase, and the halophilic KMUS1 strain according to the present invention produces highly active nattokinase. When food is fermented using the above strain, it can also be used in foods with high salt concentration. In addition, it can be used in the food industry through the role of dissolving and preventing blood clots by nattokinase produced by the strain. 1Bacillus amyloliquefaciens. Halophilic KMUS1 strain which is deposited as KCTC13635BP and produces thrombolytic enzyme nattokinase.2Bacillus amyloliquefaciens. The halophilic KMUS1 strain of claim 1 , wherein the strain is isolated from salted kimchi.3Bacillus amyloliquefaciens. The halophilic KMUS1 strain of claim 1 , wherein the strain is grown at a concentration of 0.5 to 10% NaCl and a temperature of 30 to 40° C.4Bacillus amyloliquefaciens. The halophilic KMUS1 strain of claim 3 , wherein the strain is optimally grown at a concentration of 5% NaCl and a temperature of 40° C.5Bacillus amyloliquefaciens. A method of producing thrombolytic enzyme nattokinase culturing the halophilic KMUS1 strain of .6Bacillus amyloliquefaciens. A method of preparing a food composition comprising a bacterial body claim 1 , comprising culturing the halophilic KMUS1 strain of to prepare the enzyme isolated and purified therefrom claim 1 , wherein the food compositing contains the enzyme as an active ingredient.7. The method of preparing the food composition of claim 6 , wherein the enzyme is a thrombolytic enzyme nattokinase.89-. (canceled) The present invention relates to a novel halophilic KMUS1 strain (KCTC13635BP) that produces thrombolytic enzyme nattokinase.Nattokinase is an enzyme extracted and purified from the traditional Japanese food called “natto”. Natto is a food produced by fermenting boiled soybeans by natto, but during this fermentation process, various nutrients including nattokinase are produced. ...

INCREASED BIOACTIVITY OF BIOPROTECTIVE CULTURES AGAINST PATHOGENIC BACTERIA

The present invention relates to a process for obtaining a biomass composition of a bacterium strain with bactericidal activity which inhibits or kills various pathogenic bacteria. 1. A process for obtaining a biomass with one or both of bactericidal and fungicidal activity , comprising:a) cultivating a bacteriocin-producing strain in a growth medium to obtain a biomass in a culture medium,b) adjusting the pH of the culture medium to below 5, andc) separating the biomass from the culture medium.2. The process of claim 1 , wherein step (b) is performed after the end of cultivation.3. The process according to claim 2 , wherein the pH is kept below 5 for at least 1 hour.4. The process according to claim 1 , wherein step (b) comprises adjusting the pH of the culture medium to below 4.8.5. The process according to claim 1 , wherein step (b) comprises adjusting the pH of the culture medium to between 2.0 and 5.0.6. The process according to claim 1 , wherein step (c) comprises one or both of centrifugation and filtration.7LactobacillusPediococcus. The process according to claim 1 , wherein the bacterial strain belongs to a species or a species.8Leuconostoc carnosum, Lactobacillus curvatus, Lactobacillus reuteri, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus plantarum, Lactococcus lactis, Pediococcus pentosaceus,Pediococcus acidilactici.. The process according to claim 7 , wherein the bacterial strain is of a species selected from the group consisting of and9. The process according to claim 1 , further comprising adding a flocculant to the culture medium after step (b) of adjusting the pH of the culture medium to below 5.10. The process according to claim 1 , further comprising adding an excipient to the biomass after step (c) of separating the biomass from the culture medium.11. The process according to claim 1 , further comprising adjusting the pH of the biomass to between 5.5 and 8.0.12. The process according to any claim 1 , further comprising ...

COMPOSITIONS COMPRISING BACTERIAL STRAINS

The invention provides compositions comprising bacterial strains for treating and preventing inflammatory and autoimmune diseases. 150-. (canceled)51Bacteroides. A method of reducing inflammation associated with Th17 cell differentiation in a subject having a disorder mediated by the Th17 pathway , comprising administering to the subject a pharmaceutical composition that comprises a bacteria strain of the genus , wherein the administering reduces inflammation associated with Th17 cell differentiation in the subject , andwherein the bacteria strain comprises a polynucleotide sequence of a 16S rRNA gene that has at least 95% sequence identity to the polynucleotide sequence of SEQ ID NO:4, as determined by a Smith-Waterman homology search algorithm using an affine gap search with a gap open penalty of 12, a gap extension penalty of 2, and a Blocks Substitution Matrix (BLOSUM) of 62.52. The method of claim 51 , wherein the administering decreases production of at least one pro-inflammatory cytokine in the subject.53. The method of claim 52 , wherein the at least one pro-inflammatory cytokine comprises an IL-17 cytokine selected from the group consisting of: IL-17A claim 52 , IL-17B claim 52 , IL-17C claim 52 , IL-17D claim 52 , IL-17E claim 52 , and IL-17F.54. The method of claim 52 , wherein the at least one pro-inflammatory cytokine comprises a cytokine selected from the group consisting of: IFN-γ claim 52 , IL-1β claim 52 , RANTES claim 52 , MIP-1α claim 52 , IL-8 claim 52 , and IL-6.55. The method of claim 51 , wherein the disorder mediated by the Th17 pathway is selected from the group consisting of: uveitis claim 51 , multiple sclerosis claim 51 , arthritis claim 51 , neuromyelitis optica claim 51 , psoriasis claim 51 , systemic lupus erythematosus claim 51 , an inflammatory bowel disease claim 51 , celiac disease claim 51 , asthma claim 51 , chronic obstructive pulmonary disease (COPD) claim 51 , scleritis claim 51 , vasculitis claim 51 , Behcet's disease claim ...

PROBIOTIC ANHYDROUS FATTY FOODSTUFFS AND METHODS OF MAKING SAME

The present technology relates to foodstuffs that contain a substantially anhydrous fatty food that is solid at room temperature and comprises a substantially anhydrous probiotic bacterial preparation dispersed therein. Methods of making such substantially anhydrous fatty foods are also disclosed 1. A foodstuff comprising a substantially anhydrous fatty food , wherein the substantially anhydrous fatty food is solid at room temperature and comprises a substantially anhydrous probiotic bacterial preparation dispersed therein.2. The foodstuff according to claim 1 , wherein the fatty food has a water activity (a) at room temperature of less than about 0.8.3. The foodstuff according to claim 1 , wherein the fatty food is selected from the group consisting of culinary nut butters claim 1 , culinary seed butters claim 1 , culinary bean butters claim 1 , anhydrous animal fats claim 1 , anhydrous vegetable fats claim 1 , anhydrous vegetable oils claim 1 , and mixtures thereof.4. The foodstuff according to claim 3 , wherein the fatty food comprises a culinary nut claim 3 , seed claim 3 , or bean butter selected from the group consisting of peanut butter claim 3 , almond butter claim 3 , hazelnut butter claim 3 , cashew butter claim 3 , pecan butter claim 3 , pistachio butter claim 3 , walnut butter claim 3 , macadamia butter claim 3 , Brazil nut butter claim 3 , pumpkin seed butter claim 3 , sesame seed butter claim 3 , soybean butter claim 3 , sunflower seed butter claim 3 , safflower seed butter claim 3 , chia seed butter claim 3 , and combinations thereof.5. The foodstuff according to claim 4 , wherein the fatty food is peanut butter.6. The foodstuff according to claim 1 , wherein the fatty food comprises a structuring fat selected from the group consisting of fully hydrogenated vegetable oil claim 1 , natural predominantly saturated fat claim 1 , and mixtures thereof.7. The foodstuff according to claim 1 , wherein the depth of penetration into the fatty food of a steel ...

Use of microbial communities for human and animal health

The present disclosure relates to a mixture of bacteria belonging to at least six or seven different and specific bacterial species preferably for use in preventing or treating gastro-intestinal disorders. Preferably, the mixture of bacteria are grown together in a fermenter prior to administering the mixture to a subject in order to prevent or treat the disorder.