Настройки

Укажите год
-

Небесная энциклопедия

Космические корабли и станции, автоматические КА и методы их проектирования, бортовые комплексы управления, системы и средства жизнеобеспечения, особенности технологии производства ракетно-космических систем

Подробнее
-

Мониторинг СМИ

Мониторинг СМИ и социальных сетей. Сканирование интернета, новостных сайтов, специализированных контентных площадок на базе мессенджеров. Гибкие настройки фильтров и первоначальных источников.

Подробнее

Форма поиска

Поддерживает ввод нескольких поисковых фраз (по одной на строку). При поиске обеспечивает поддержку морфологии русского и английского языка
Ведите корректный номера.
Ведите корректный номера.
Ведите корректный номера.
Ведите корректный номера.
Укажите год
Укажите год
Применить Всего найдено 3296. Отображено 100.
19-01-2012 дата публикации

Dna vaccine for alzheimer's disease

Номер: US20120014987A1
Автор: Yoh Matsumoto
Принадлежит: TOKYO METROPOLITAN INSTITUTE OF MEDICAL SCIENCE

The present invention aims to provide a DNA vaccine for Alzheimer's disease. The present invention provides a recombinant vector which comprises DNA encoding amyloid β and DNA encoding a Th2 cytokine, as well as a DNA vaccine for Alzheimer's disease which comprises this vector.

Подробнее
Номер записи: 1
23-02-2012 дата публикации

Thermosensitive hepatitis b vaccine

Номер: US20120045511A1
Автор: Ho-Yuan Chou, Hsin-Hsin Shen, Mi-Hua Tao, Tsai-Yu Lin
Принадлежит: Industrial Technology Research Institute ITRI

A thermosensitive hepatitis B vaccine is provided. The thermosensitive hepatitis B vaccine includes an aqueous phase solution comprising a biodegradable thermosensitive hydrogel copolymer; a surface antigen of hepatitis B virus (HBsAg); and a bioactive substance. The thermosensitive hepatitis B vaccine of the disclosure is particularly suitable for being applied in the patients, which are low responsive or non-responsive to conventional hepatitis B vaccine, for enhancing the induction of cell-mediated immune responses and overcoming the HBsAg non-responsiveness.

Подробнее
Номер записи: 2
26-04-2012 дата публикации

Continuous Cell Programming Devices

Номер: US20120100182A1
Автор: David J. Mooney, Glenn Dranoff, Omar Ali
Принадлежит: Individual

The present invention comprises compositions, methods and devices for creating an infection-mimicking environment within a polymer scaffold to stimulate antigen-specific dendritic cell activation. Devices of the present invention are used to provide protective immunity to subjects against infection and cancer.

Подробнее
Номер записи: 3
28-06-2012 дата публикации

Interleukin-1 Alpha Antibodies and Methods of Use

Номер: US20120164665A1
Автор: John Simard
Принадлежит: Xbiotech Inc

Fully human monoclonal Abs includes (i) an antigen-binding variable region that exhibits very high binding affinity for IL-1α and (ii) a constant region that is effective at both activating the complement system though C1q binding and binding to several different Fc receptors.

Подробнее
Номер записи: 4
02-08-2012 дата публикации

Methods for up-regulating antigen expression in tumors

Номер: US20120195855A1
Автор: Ian S. Dunn, James T. Kurnick, Paul J. Durda
Принадлежит: CytoCure LLC

The invention provides methods of modulating tumor antigen associated (TAA) expression, and methods of modulating TAA expression in order to treat a tumor. More particularly, the invention provides methods of increasing an immune response against a tumor cell. Methods include administering to a subject with a tumor an amount of IFN-β receptor agonist and tumor associated antigen (TAA) sufficient to increase an immune response against the tumor cell.

Подробнее
Номер записи: 5
23-08-2012 дата публикации

Vaccines and immunotherapeutics using codon-optimized il-15 and methods for using the same

Номер: US20120213815A1
Автор: David B. Weiner, Michele Kutzler
Принадлежит: University of Pennsylvania Penn

Nucleic acid molecules that encode IL-15 or fragments thereof, which express protein at a higher level than nucleic acid molecules with native coding sequences for IL-15 are disclosed. Nucleic acid molecules with additional modifications such as the absence of coding sequences for IL-15 signal sequences and/or the absence of IL-15 untranslated sequences and/or inclusion of non-IL-15 signal sequences are also disclosed. Vectors, including plasmids and viral vectors, comprising such nucleic acid molecules; and to host cells comprising such nucleic acid molecules are disclosed as well as methods of using such nucleic acid molecules alone or in combination with nucleic acid sequences encoding immunogens which are part of the nucleic acid molecules and/or part of a different nucleic acid molecule. Recombinant vaccines and live attenuated pathogens encoding fusion proteins, and methods of using the same, are disclosed.

Подробнее
Номер записи: 6
01-11-2012 дата публикации

Nucleic acid sequences encoding and compositions comprising ige signal peptide and/or il-15 and methods for using the same

Номер: US20120276142A1
Автор: Andrew Y. Choo, David B. Weiner, Jean D. Boyer, Joo-Sung Yang, Michele Kutzler
Принадлежит: Individual

Fusion proteins and nucleic acid molecules encoding fusion proteins are disclosed. Fusion proteins comprising non-IL-15 signal peptide linked to IL-15 protein sequences and fusion proteins comprising an IgE signal peptide linked to non-IgE protein sequences are disclosed. Vectors comprising such nucleic acid molecules; and to host cells comprising such vectors are disclosed as well as recombinant vaccines and live attenuated pathogens encoding fusion proteins, and methods of using the same, are disclosed. The immunomodulatory effect following delivery of IL-15 and CD40L, with or without immunogens, is disclosed as are various nucleic acid molecules and compositions thereof used for delivering such proteins and methods of using such compositions.

Подробнее
Номер записи: 7
08-11-2012 дата публикации

Composition and Method for Treating Cancer

Номер: US20120282216A1
Автор: Jonathan F. Head, Robert L. Elliott
Принадлежит: Oncbiomune Inc

Pharmaceutical compositions useful as vaccines are described containing a purified surface or excreted protein qualitatively or quantitatively associated with a type of cancer, at least one interleukin (IL), and at least one colony stimulating factor (CSF), where the purified surface or excreted protein is provided in an amount sufficient to induce an immune response in an individual administered the composition. Such compositions can be used in methods for treating individuals having cancer, and for inducing an immunotherapeutic response in the same.

Подробнее
Номер записи: 8
14-02-2013 дата публикации

Immunogenic pote peptides and methods of use

Номер: US20130039936A1
Автор: Ira H. Pastan, Jay A. Berzofsky, Masaki Terabe, Yi-Hsiang Huang
Принадлежит: US Department of Health and Human Services

POTE has recently been identified as a tumor antigen expressed in a variety of human cancers, including colon, ovarian, breast, prostate, lung and pancreatic cancer. Described herein are immunogenic POTE polypeptides, including modified POTE polypeptides, that bind MHC class I molecules. The immunogenic POTE polypeptides are capable of inducing an immune response against POTE-expressing tumor cells. Thus, provided herein is a method of eliciting an immune response in a subject, such as a subject having a type of cancer that expresses POTE.

Подробнее
Номер записи: 9
02-05-2013 дата публикации

Recombinant tumor vaccine and method of producing such vaccine

Номер: US20130108665A1
Автор: Min Liang
Принадлежит: Tot Shanghai R&D Center Co Ltd

The present disclosure provides tumor vaccines useful for preventing and treating tumors and cancers. The tumor vaccines may contain nucleic acids encoding for antigen presenting peptides, cytokines and other factors useful for preventing and treating tumors and cancers, or expression vectors or viruses containing such nucleic acids, or host cells containing such nucleic acids or expression vectors.

Подробнее
Номер записи: 10
29-08-2013 дата публикации

Complex having tumor vaccine effect, and use thereof

Номер: US20130224145A1
Автор: Ji-Yang Wang
Принадлежит: RIKEN Institute of Physical and Chemical Research

The present invention provides a tumor cell-soluble TNF family member molecule complex containing a tumor cell and an isolated soluble TNF family member molecule, wherein the soluble TNF family member molecule is bound on a surface of the tumor cell such that it binds to a receptor of the TNF family member expressed on a surface of a cell other than the tumor cell, and stimulates the cell other than the tumor cell via the receptor, and a composition and a tumor vaccine, each containing the complex.

Подробнее
Номер записи: 11
20-03-2014 дата публикации

BI-Specific Diabodies For Masking And Targeting Vaccines

Номер: US20140079704A1
Автор: Luc Berghman, Surya Waghela, Waithaka MWANGI
Принадлежит: TEXAS A&M UNIVERSITY SYSTEM

The present invention describes compositions and methods for priming protective immunity in the presence of pre-existing maternal antibody. In some embodiments, the invention contemplates simultaneously masking vaccines to avoid antibody neutralization while targeting those vaccines to specific cell types in order to elicit an enhanced immune response. In other embodiments, vectors that recruit and activate specific antigen-presenting cells may further enhance the efficacy of those immune responses.

Подробнее
Номер записи: 12
02-01-2020 дата публикации

COMPOSITIONS AND METHODS OF TREATING ROOT AVULSION INJURY

Номер: US20200000888A1
Автор: Cregg Jared M., Lang Bradley T., Li Heng, Silver Jerry, Weng Yi-Lan, Wu Wutian
Принадлежит:

A method of treating root avulsion injury in a subject in need thereof includes administering to the subject a therapeutic agent that inhibits one or more of catalytic activity, signaling, and function of PTPσ. 1. A method of treating root avulsion injury in a subject in need thereof , the method comprising:administering to the subject a therapeutic agent that inhibits one or more of catalytic activity, signaling, and function of PTPσ.2. The method of claim 1 , the therapeutic agent comprising a therapeutic peptide claim 1 , the therapeutic peptide having an amino acid sequence that is at least about 85% homologous to about 10 to about 20 consecutive amino acids of the wedge domain of PTPσ.3. The method of claim 1 , the therapeutic agent comprising a therapeutic peptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-25 claim 1 , 32 claim 1 , 63.4. The method of claim 1 , the therapeutic agent comprising a therapeutic peptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 32 and SEQ ID NO: 63.5. The method of claim 1 , the therapeutic agent comprising a therapeutic peptide having an amino acid sequence that is at least about 85% homologous to SEQ ID NO: 32 or SEQ ID NO: 63.6. The method of claim 8 , the therapeutic peptide including a conservative substitution of at least one of residue 4 claim 8 , 5 claim 8 , 6 claim 8 , 7 claim 8 , 9 claim 8 , 10 claim 8 , 12 claim 8 , or 13 of SEQ ID NO: 32 or residue 7 claim 8 , 8 claim 8 , 9 claim 8 , 10 claim 8 , 12 claim 8 , or 13 of SEQ ID NO: 63.7. The method of claim 2 , wherein the therapeutic agent includes a transport moiety that is linked to the therapeutic peptide and facilitates uptake of the therapeutic peptide by a nerve cell being treated.8. The method of claim 7 , wherein the transport moiety is an HIV Tat transport moiety.9. The method of claim 7 , wherein the therapeutic agent is administered systemically to the subject being treated.10. The ...

Подробнее
Номер записи: 13
05-01-2017 дата публикации

COMBINATION THERAPY FOR IMMUNOSTIMULATION

Номер: US20170000870A1
Автор: Hoerr Ingmar, Pascolo Steve
Принадлежит: CureVac AG

The present invention relates to a method for immunostimulation in a mammal which comprises a. administration of at least one mRNA containing a region which codes for at least one antigen of a pathogen or at least one tumour antigen, and b. administration of at least one cytokine, at least one cytokine mRNA, at least one CpG DNA or at least one adjuvant RNA. The invention likewise relates to a product and a kit comprising the mRNA and cytokine or cytokine mRNA or CpG DNA or adjuvant RNA of the invention. 1. A method of stimulating an antitumor immune response in a subject comprising administering an effective amount of a cell-free composition comprising mRNA encoding an Survivin antigen to a subject in need thereof , thereby stimulating a T-cell mediated cytotoxic anticancer immune response in the subject.2. The method of claim 1 , wherein the subject has a cancer.3. The method of claim 2 , wherein the cancer is a lung cancer.4. The method of claim 1 , wherein the composition comprises mRNA encoding at least 2 claim 1 , 3 claim 1 , 4 or 5 different tumor antigens.5. The method of claim 1 , wherein the method further comprises administering at least 2 claim 1 , 3 claim 1 , 4 or 5 different cell-free compositions comprising mRNA encoding different tumor antigens to the subject.6. The method of claim 1 , wherein the mRNA is complexed with as least one cationic or polyocationic agent.7. The method of claim 6 , wherein the cationic or polyocationic agent is chosen from the group consisting of protamine claim 6 , poly-L-lysine claim 6 , poly-L-arginine and histones.8. The method of claim 7 , wherein the mRNA is complexed with protamine.9. The method of claim 1 , further comprising administering one or more adjuvant(s) to the subject.10. The method of claim 9 , wherein the adjuvant is chosen from the group consisting of lipopolysaccharide claim 9 , TNF-α claim 9 , CD40 ligand claim 9 , GP96 claim 9 , oligonucleotides with a CpG motif claim 9 , aluminum hydroxide claim 9 , ...

Подробнее
Номер записи: 14
05-01-2017 дата публикации

Method for the vaccination against hiv

Номер: US20170000876A1
Автор: Anker LUNDEMOSE, Arnt Ove HOVDEN, Maja Sommerfelt GRØNVOLD, Mats Okvist
Принадлежит: Bionor Immuno AS

The present invention relates to novel compositions of active agents and methods for the treatment of HIV infection and AIDS. In particular, the present invention relates to novel methods to select HIV infected patients with improved responses to HIV-specific vaccine peptides.

Подробнее
Номер записи: 15
04-01-2018 дата публикации

CIRCOVIRUS SEQUENCES ASSOCIATED WITH PIGLET WEIGHT LOSS DISEASE (PWD)

Номер: US20180000927A1
Автор: ALBINA EMMANUEL, ARNAULD CLAIRE, BLANCHARD PHILIPPE, CARIOLET ROLAND, HUTET EVELYNE, JESTIN ANDRÉ, LE CANN PIERRE, MADEC FRANÇOIS, MAHE DOMINIQUE, TRUONG CATHERINE
Принадлежит: Zoetis Services LLC

The genome sequences and the nucleotide sequences coding for the PWD circovirus polypeptides, such as the circovirus structural and non-structural polypeptides, vectors including the sequences, and cells and animals transformed by the vectors are provided. Methods for detecting the nucleic acids or polypeptides, and kits for diagnosing infection by a PWD circovirus, also are provided. Method for selecting compounds capable of modulating the viral infection are further provided. Pharmaceutical, including vaccine, compositions for preventing and/or treating viral infections caused by PWD circovirus and the use of vectors for preventing and/or treating diseases also are provided. 114.-. (canceled)15. A vaccine for protecting a pig against infection by a piglet weight loss disease circovirus comprising: an isolated ORF′2 polypeptide of porcine circovirus Type B (PCVB); and a recombinant expression vector.16. The vaccine of claim 15 , wherein the recombinant expression vector is a baculovirus expression vector.17. The vaccine of claim 15 , further comprising an adjuvant.18. The vaccine of claim 15 , further comprising a pharmaceutically or veterinarily acceptable carrier.19. The vaccine of claim 15 , wherein the ORF′2 polypeptide has at least 90% identity to the sequence of SEQ ID NO:26.20. The vaccine of claim 15 , wherein the ORF′2 polypeptide has at least 95% identity to the sequence of SEQ ID NO:26.21. The vaccine of claim 15 , wherein the ORF′2 polypeptide is encoded by a nucleic acid having at least 90% identity to the sequence of SEQ ID NO:25.22. A method for protecting a pig against infection by a piglet weight loss disease circovirus comprising: administering to the pig the vaccine of .23. The method of claim 22 , wherein the vaccine is administered to a pig 3 weeks of age or older.24. The method of claim 22 , wherein the vaccine is administered as a single dose.25. The method of claim 22 , wherein the vaccine is administered via a route selected from the group ...

Подробнее
Номер записи: 16
02-01-2020 дата публикации

DNA VECTOR AND TRANSFORMED TUMOR CELL VACCINES

Номер: US20200000901A1
Автор: GENTILINI MEGHAN, LAWMAN MICHAEL J. P., LAWMAN PATRICIA D., RAMIYA VIJAY
Принадлежит:

Customized whole cell cancer vaccines can be produced from autologous (ex vivo or in situ) or allogeneic human or veterinary patient cell lines. Cells are transformed with DNA that expresses an Emm protein on the cell surface and cytosol. Treatment of cancer patients with an Emm vector vaccine induces an immunologic response to the cancer by enhancing immunogenicity of a tumor. Emm vaccines can be used in patients where the cancer is not identified due to lower tumor burden or used to treat a specific cancer and subsequently treat for a second type that may have arisen through metastasis. 1. A method for preparing a membrane anchoring protein , comprising:{'i': 'streptococcus', 'inserting a first DNA encoding the amino acid sequence of SEQ ID NO: 7 into the N-terminal signal region of a DNA encoding an M serotype 55 group A protein;'}inserting a second DNA encoding the amino acid sequence of SEQ ID NO: 9 into the C-terminal anchor region of the DNA encoding said protein;wherein the encoded protein expressed from the modified DNA is a membrane anchoring protein.2streptococcus. The method of wherein the M serotype 55 group A protein is a gram positive bacterial cell wall protein.3Streptococcus.. The method of wherein the gram positive bacterial wall protein is from a serotype of group A4. The method of wherein the encoded protein has the amino acid sequence of SEQ ID NO: 5.5. The method of wherein the membrane anchoring protein anchors to a cell membrane.6. The cell membrane of which is a eukaryotic membrane.7. The cell membrane of which is a prokaryotic membrane. This application is a divisional of U.S. application Ser. No. 15/837,965, filed Dec. 11, 2017, now U.S. Pat. No. 10,391,158, which is a continuation-in-part of U.S. application Ser. No. 15/418,798, filed Jan. 30, 2017, now U.S. Pat. No. 9,839,680, which is a divisional of U.S. application Ser. No. 15/110,248, filed Jul. 7, 2016, now U.S. Pat. No. 9,555,088, which is the U.S. national stage application of ...

Подробнее
Номер записи: 17
05-01-2017 дата публикации

AVIAN COLONY STIMULATING FACTOR 1 RECEPTOR BINDING PROTEINS

Номер: US20170002051A1
Автор: Burt Dave, Garceau Valerie, Hume David Arthur, Paton Bob, Sester David, Smith Jacqueline
Принадлежит:

The present invention provides avian CSF1 genes encoding proteins which bind avian colony stimulating factor 1 receptor (CSF1R) and which exhibit immunomodulatory properties. 19-. (canceled)10. A method of modulating avian growth and/or organ development comprising administering an effective amount of an avian CSF1 and/or IL34 gene and/or protein to an avian subject.1115-. (canceled)16. A method of modulating the avian immune system comprising administering an immunomodulatory amount of an avian CSF1 and/or IL34 gene and/or protein to an avian subject.17. A vaccine adjuvant comprising an avian CSF1 and IL34 protein.18. The vaccine adjuvant of claim 17 , wherein the avian CSF1 protein claim 17 , comprises an amino acid sequence at least 60% identical or homologous to the amino acid sequences of SEQ ID NOS:3 or 5.19. An immunogenic composition claim 17 , comprising an avian CSF1 and/or IL34 protein.20. A method of treating conditions claim 17 , such as inflammatory diseases claim 17 , resulting from or associated with aberrant CSF1/IL34 gene/protein expression claim 17 , said method comprising an effective amount of a compound capable of inhibiting CSF1/IL34 gene expression or protein production to an avian subject.21. The method of claim 20 , wherein the compound is selected from the group consisting of: a sense or antisense nucleic acid molecule; a fragment claim 20 , portion or derivative of an avian CSF1/IL34 gene; and an antibody.22. A method of screening avian species claim 20 , particularly agriculturally significant or important avian species for potential inclusion in breeding programs said method comprising the steps of:a) providing a nucleic acid sample from an avian species; and 'wherein avian species which exhibit and increased level of CSF1 and/or IL34 gene expression relative to a that present in a reference nucleic acid sample or value, may be selected for inclusion in breeding programs.', 'b) comparing the level of expression of the CSF1 and/or IL34 ...

Подробнее
Номер записи: 18
03-01-2019 дата публикации

METHODS AND COMPOSITIONS FOR TREATING MULTIPLE SCLEROSIS

Номер: US20190002550A1
Автор: BRAMBILLA Roberta, Bramlett Helen M., De Rivero Vaccari Juan Pablo, Dietrich W. Dalton, Keane Robert W.
Принадлежит:

The compositions and methods described herein include agents that inhibit inflammasome signaling in the mammal such as antibodies directed against inflammasome components used alone or in combination with extracellular vesicle uptake inhibitor(s). Also described herein are compositions and methods of use thereof for treating multiple sclerosis. 1. (canceled)2. A monoclonal antibody or an antibody fragment thereof that binds specifically to ASC , wherein the antibody or the antibody fragment comprises a heavy chain variable (VH) region and a light chain variable (VL) region ,wherein the VH region amino acid sequence comprises HCDR1 of SEQ ID NO: 6, HCDR2 of SEQ ID NO: 7 and HCDR3 of SEQ ID NO: 8, or a variant thereof having at least one amino acid substitution in HCDR1, HCDR2, and/or HCDR3.3. A monoclonal antibody or an antibody fragment thereof that binds specifically to ASC , wherein the antibody or the antibody fragment comprises a light chain variable (VL) region and a heavy chain variable (VH) region ,wherein the VL region amino acid sequence comprises LCDR1 of SEQ ID NO: 12, LCDR2 of SEQ ID NO: 13 and LCDR3 of SEQ ID NO: 14, or a variant thereof having at least one amino acid substitution in LCDR1, LCDR2, and/or LCDR3.4. A monoclonal antibody or an antibody fragment thereof that binds specifically to ASC , wherein the antibody or the antibody fragment comprises a heavy chain variable (VH) region and a light chain variable (VL) region ,wherein the VH region amino acid sequence comprises HCDR1 of SEQ ID NO: 6, HCDR2 of SEQ ID NO: 7 and HCDR3 of SEQ ID NO: 8, or a variant thereof having at least one amino acid substitution in HCDR1, HCDR2, and/or HCDR3; andwherein the VL region amino acid sequence comprises LCDR1 of SEQ ID NO: 12, LCDR2 of SEQ ID NO: 13 and LCDR3 of SEQ ID NO: 14, or a variant thereof having at least one amino acid substitution in LCDR1, LCDR2, and/or LCDR3.5. The monoclonal antibody or the antibody fragment thereof of claim 2 , wherein the VH ...

Подробнее
Номер записи: 19
13-01-2022 дата публикации

COMPOSITIONS AND METHODS FOR MODULATING AN IMMUNE RESPONSE

Номер: US20220010275A1
Автор: Sage Peter T., Sharpe Arlene H.
Принадлежит:

The invention provides methods of modulating follicular regulatory T (TFR) cell-mediated immune responses and the use of those methods in the treatment of diseases or conditions such as viral, bacterial, pathogenic, or fungal infections or cancer. Such methods provide for boosting of antibody production through the use of IL-21 to overcome TFR cell suppression of antibody production. 135-. (canceled)36. A method of reducing immune suppressive activity of TFR cells in adoptive immunotherapy , comprising contacting TFR cells isolated from a subject with a cytokine in-vitro or ex-vivo , and wherein the reduced immune suppressive activity results in a protective antibody response , wherein the cytokine is IL-21 or IL-6.37. The method of claim 36 , wherein the reduced immune suppressive activity is characterized by a boost of antibody production as compared to native TFR cells.38. The method of claim 36 , wherein the method comprises contacting the TFR cells isolated from a subject with IL-21.39. The method of claim 36 , wherein the method comprises contacting the TFR cells isolated from a subject with IL-6.40. A composition comprising TFR cells claim 36 , TFH cells claim 36 , and a cytokine claim 36 , wherein said composition has reduced immune suppressive activity claim 36 ,wherein the reduced immune suppressive activity results in a protective antibody response, andwherein the cytokine is IL-21 or IL-6.41. The composition of claim 40 , wherein the cytokine is IL-21.42. The composition of claim 40 , wherein the cytokine is IL-6.43. A vaccine composition comprising the composition of .44. A method of treating an allergy in a subject claim 40 , the method comprising administering the composition of .45. An adjuvant comprising a composition of TFH cells and a cytokine claim 40 , wherein the TFH cells have an enhanced stimulatory capacity claim 40 , and wherein the cytokine is IL-21 or IL-6.46. The adjuvant of claim 45 , wherein the enhanced stimulatory capacity results in ...

Подробнее
Номер записи: 20
12-01-2017 дата публикации

PEPTIDE VACCINE THERAPY FOR TREATMENT OF FRa-EXPRESSING TUMORS

Номер: US20170007687A1
Автор: PEOPLES George E.
Принадлежит:

Provided are methods for inducing and maintaining protective immunity against a tumor expressing FRα in a subject, comprising the administration of one or more peptide vaccines according to a particular dosages or particular dosage regimens. 1. A method of inducing an immune response against a tumor expressing folate receptor alpha (FRα) in a subject in need thereof , the method comprising:(a) administering a first vaccine comprising a peptide comprising the amino acid sequence of SEQ ID NO:1 (E39) and an adjuvant every three to four weeks for a period of about two to about six months; and(b) subsequently administering a second vaccine comprising a peptide comprising the amino acid sequence of SEQ ID NO: 2 (E39′) and an adjuvant every three to four weeks for a period of about two to six months.2. The method of claim 1 , wherein the first vaccine is administered by injection.3. The method of claim 1 , wherein the second vaccine is administered by injection.4. The method of claim 1 , wherein the first vaccine comprises about 0.1 mg to about 2 mg of the peptide.5. The method of claim 4 , wherein the first vaccine comprises about 0.5 or about 1.0 mg of the peptide.6. The method of claim 1 , wherein the second vaccine comprises about 0.1 mg to about 2 mg of the peptide.7. The method of claim 6 , wherein the second vaccine comprises about 0.5 or about 1.0 mg of the peptide.8. The method of claim 1 , wherein the adjuvant in the first vaccine is granulocyte macrophage-colony stimulating factor (GM-CSF).9. The method of claim 1 , wherein the adjuvant in the second vaccine is GM-CSF.10. The method of claim 8 , wherein the first vaccine comprises between about 0.01 to about 0.5 mg GM-CSF.11. The method of claim 9 , wherein the second vaccine comprises between about 0.01 to about 0.5 mg GM-CSF.12. The method of claim 1 , further comprising administering to the subject a booster composition after the primary immunization schedule is completed claim 1 , wherein the booster ...

Подробнее
Номер записи: 21
10-01-2019 дата публикации

NOVEL IMMUNOTHERAPY AGAINST SEVERAL TUMORS INCLUDING NEURONAL AND BRAIN TUMORS

Номер: US20190010190A1
Автор: HILF Norbert, SCHOOR Oliver, SINGH Harpreet, TRAUTWEIN Claudia, WALTER Steffen, WEINSCHENK Toni
Принадлежит:

The present invention relates to peptides, nucleic acids and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumor-associated cytotoxic T cell (CTL) peptide epitopes, alone or in combination with other tumor-associated peptides that serve as active pharmaceutical ingredients of vaccine compositions that stimulate anti-tumor immune responses. The present invention relates to 30 peptide sequences and their variants derived from HLA class I and class II molecules of human tumor cells that can be used in vaccine compositions for eliciting anti-tumor immune responses. 1. A method of treating a patient who has cancer , comprising administering to the patient an effective amount of an antibody specifically binding to an MHC class I or II molecule complexed with a HLA-restricted antigen consisting of the amino acid sequence of KIQEILTQV (SEO ID NO: 14) , wherein the cancer is selected from the group consisting of glioblastoma , renal cell carcinoma , melanoma , endometrial cancer , esophageal squamous cell carcinoma , pancreatic cancer , and urothelial cancer.2. The method of claim 1 , wherein the antibody is a polyclonal antibody claim 1 , a monoclonal antibody claim 1 , or a chimeric antibody.3. The method of claim 1 , wherein the antibody binds to the HLA-restricted antigen with a binding affinity of below 20 nanomolar.4. The method of claim 1 , wherein the antibody binds to the MHC class I molecule complexed with the HLA-restricted antigen.5. The method of claim 1 , wherein the antibody is humanized.6. The method of claim 1 , wherein the effective amount of the antibody is from about 1 μg/kg to about 100 mg/kg of body weight per day.7. The method of claim 1 , wherein the antibody is conjugated with a toxin.8pseudomonas. The method of claim 7 , wherein the toxin is selected from the group consisting of diptheria toxin claim 7 , exotoxin A claim 7 , ...

Подробнее
Номер записи: 22
21-01-2016 дата публикации

INDIVIDUALIZED HIGH PURITY HEPATOCELLULAR CARCINOMA STEM CELLS, METHODS AND USE OF THE SAME

Номер: US20160017293A1
Автор: Cornforth Andrew N., Frederickson Craig T., Nistor Gabriel
Принадлежит: NEOSTEM ONCOLOGY, LLC

The disclosure provides cancer stem cells, for use in stimulating immune response against a cancer, such as hepatocellular carcinoma (HCC). Methods for preparing and purifying the cancer stem cells are provided. 1. An immunogenic composition comprising dendritic cells activated ex vivo by tumor antigens derived from a population of purified hepatocellular carcinoma cancer stem cells (HCC-CSCs).2. The immunogenic composition of claim 1 , wherein the tumor antigens comprise cell extracts of the HCC-CSCs.3. The immunogenic composition of claim 1 , wherein the tumor antigens comprise lysates of the HCC-CSCs.4. The immunogenic composition of claim 1 , wherein the tumor antigens comprise intact HCC-CSCs.5. The immunogenic composition of claim 4 , wherein the intact HCC-CSCs are rendered non-proliferative.6. The immunogenic composition of wherein the intact HCC-CSCs are rendered non-proliferative by irradiation.7. The immunogenic composition of claim 5 , wherein the intact HCC-CSCs are rendered non-proliferative by exposure of the HCC-CSCs to a nuclear cross-linking agent.8. The immunogenic composition of claim 1 , further comprising a pharmaceutically acceptable carrier or excipient.9. The immunogenic composition of claim 1 , further comprising an adjuvant.10. The immunogenic composition of claim 9 , wherein the adjuvant is granulocyte macrophage colony stimulating factor.11. The immunogenic composition of claim 1 , wherein the composition comprises activated dendritic cells and HCC-CSCs.12. The immunogenic composition of claim 1 , wherein the HCC-CSCs are in form of HCC-CSC spheroids.13. The immunogenic composition of claim 1 , wherein the HCC-CSCs are in form of early HCC-CSCs.14. The immunogenic composition of claim 1 , wherein the HCC-CSCs are in form of mixed HCC-CSCs.15. The immunogenic composition of claim 1 , wherein the HCC-CSCs are in form of EMT-HCC-CSCs.16. A method of treating hepatocellular carcinoma in a subject in need thereof claim 1 , comprising ...

Подробнее
Номер записи: 23
17-01-2019 дата публикации

GM-CSF and IL-4 Conjugates, Compositions, and Methods Related Thereto

Номер: US20190016772A1
Автор: Deng Jiusheng, Galipeau Jacques
Принадлежит:

In certain embodiments, this disclosure relates to conjugates comprising a polypeptide of GM-CSF and a polypeptide IL-4. Typically, the GM-CSF and IL-4 are connected by a linker, e.g., polypeptide. In certain embodiments, the disclosure relates to isolated nucleic acids encoding these polypeptide conjugates, vectors comprising nucleic acid encoding polypeptide conjugates, and protein expression systems comprising these vectors such as infectious viral particles and host cells comprising such nucleic acids. 1. A conjugate comprising a granulocyte macrophage colony stimulating factor (GM-CSF) polypeptide and an interleukin 4 (IL-4) polypeptide , wherein said GM-CSF polypeptide and said IL-4 polypeptide are connected by peptide linker consisting of amino acids selected from glycine , serine , threonine , asparagine , alanine and proline.2. The conjugate of wherein said GM-CSF polypeptide is located closer to the N-terminus of said conjugate relative to said IL-4 polypeptide.3. The conjugate of wherein said GM-CSF polypeptide comprises the amino acid sequence of SEQ ID NO: 6 and said IL-4 polypeptide comprises the amino acid sequence of SEQ ID NO: 3.4. The conjugate of wherein said GM-CSF polypeptide and said IL-4 polypeptide are connected by peptide linker consisting of amino acids selected from glycine and serine5. The conjugate of wherein the linker comprises repeats of serine or repeats of glycine.6. The conjugate of wherein the linker is 1 to 5 amino acids.7. The conjugate of wherein the linker is 5 to 50 amino acids.8. The conjugate of wherein the linker comprises GGGGS (SEQ ID NO: 5).9. The conjugate of wherein the conjugate is at least 70% identical to SEQ ID NO: 8.10. The conjugate of wherein the conjugate is at least 80% identical to SEQ ID NO: 8.11. The conjugate of wherein the conjugate is at least 90% identical to SEQ ID NO: 8.12. The conjugate of wherein the conjugate is at least 95% identical to SEQ ID NO: 8.13. The conjugate of wherein the conjugate is ...

Подробнее
Номер записи: 24
17-01-2019 дата публикации

Chimeric cytokine receptor

Номер: US20190016820A1
Автор: James Sillibourne, Martin PULÉ, Matteo Righi, Shaun CORDOBA, Shimobi ONUOHA, SIMON Thomas
Принадлежит: Autolus Ltd

The present invention provides a chimeric cytokine receptor (CCR) comprising: (i) an exodomain which binds to a ligand selected from a tumour secreted factor, a chemokine and a cell-surface antigen; and (ii) a cytokine receptor endodomain.

Подробнее
Номер записи: 25
21-01-2021 дата публикации

Anti-ccl17 antibodies

Номер: US20210017267A1
Автор: Alexey Teplyakov, Alfred Del Vecchio, Brian Whitaker, Eilyn Lacy, John Kehoe, John Wheeler, Ken Boakye, Lynne Murray, Mary Ryan, Sandra Santulli-Marotto
Принадлежит: Jannsen Biotech Inc

The present invention relates to antibodies specifically binding CCL17, polynucleotides encoding the antibodies or fragments, and methods of making and using the foregoing.

Подробнее
Номер записи: 26
28-01-2016 дата публикации

VACCINE FOR THE PREVENTION OF BREAST CANCER RECURRENCE

Номер: US20160022790A1
Автор: PEOPLES George, PONNIAH Sathibalan
Принадлежит:

Provided are methods to induce and maintain a protective cytotoxic T-lymphocyte response to a peptide of the HER2/neu oncogene, GP2, with the effect of inducing and maintaining protective or therapeutic immunity against breast cancer in a patient in clinical remission, including patients having low to intermediate levels of HER2/neu expression. The methods comprise administering to the patient an effective amount of a vaccine composition comprising a pharmaceutically acceptable carrier, an adjuvant such as GM-CSF, and the GP2 peptide. The methods may further comprise administering a periodic booster vaccine dose as needed due to declining GP2-specific T cell immunity. Also provided are vaccine compositions for use in the methods. 1. A method of preventing breast cancer recurrence in a subject , comprising administering to the subject a composition in an amount effective to prevent breast cancer recurrence ,wherein the composition comprises a pharmaceutically effective carrier, a peptide having the amino acid sequence SEQ ID NO:2, and granulocyte macrophage-colony stimulating factor, and wherein, other than the peptide having the amino acid sequence of SEQ ID NO:2, the composition does not contain any other Her2/neu-derived peptides; andwherein the subject is in remission following treatment with a standard course of therapy.2. The method of wherein the composition is administered by injection or inoculation.3. The method of claim 2 , wherein the injection is an intradermal injection.4. The method of claim 2 , wherein the composition is injected in one or more split doses.5. The method of claim 4 , wherein the injection sites on the subject are located about 5 cm apart from each other.6. The method of claim 1 , wherein the composition is administered every month for six months.7. The method of claim 1 , further comprising administering to the subject a booster comprising an effective amount of a vaccine booster composition comprising a pharmaceutically effective ...

Подробнее
Номер записи: 27
24-01-2019 дата публикации

CANCER VACCINES AND METHODS OF DELIVERY

Номер: US20190022204A1
Автор: Hartman Zachary C., Lyerly Herbert K., Osada Takuya
Принадлежит: Duke University

Disclosed are compositions, methods, and kits for treating a cancer or pre-cancer. In particular, the invention generally relates to cancer vaccines as well as methods of delivering the vaccines. Combination treatments including the vaccines in combination with immunomodulatory agents are also contemplated. 1. A polynucleotide construct comprising a heterologous promoter operably connected to a first polynucleotide encoding a first antigenic polypeptide , wherein the polynucleotide construct is circular and lacks a bacterial origin of replication and an antibiotic resistance gene.2. The polynucleotide construct of claim 1 , wherein the first antigenic polypeptide is selected from the group consisting of an ESR1 polypeptide claim 1 , mutant or portion thereof; a HER3 polypeptide claim 1 , mutant or portion thereof; a mutant HER2 polypeptide or portions thereof claim 1 , and combinations thereof.3. The polynucleotide construct of claim 2 , wherein the first antigenic polypeptide comprises a HER3 polypeptide and comprises SEQ ID NO: 1 claim 2 , SEQ ID NO: 2 claim 2 , or portions thereof.4. The polynucleotide construct of claim 2 , wherein the first antigenic polypeptide comprises a HER2 polypeptide and comprises SEQ ID NO: 3 claim 2 , SEQ ID NO: 4 claim 2 , SEQ ID NO: 5 or portions thereof comprising a deletion or mutation identified as HER2d16 (SEQ ID NO: 3).5. (canceled)6. (canceled)7. The polynucleotide construct of claim 2 , wherein the first antigenic polypeptide comprises an ESR1 polypeptide and comprises SEQ ID NO: 6 claim 2 , SEQ ID NO: 7 claim 2 , SEQ ID NO: 8 claim 2 , SEQ ID NO: 9 or portions of any of SEQ ID NOS: 6-9 comprising a mutation in ESR1.8. (canceled)9. (canceled)10. (canceled)11. (canceled)12. A method of treating a cancer or precancer or of reducing the likelihood of the cancer developing resistance to a cancer therapeutic or prevention agent in a subject comprising:administering to the subject a therapeutically effective amount of a DNA vaccine, ...

Подробнее
Номер записи: 28
28-01-2021 дата публикации

VACCINE COMPOSITIONS COMPRISING TRYPTOPHAN 2,3-DIOXYGENASE OR FRAGMENTS THEREOF

Номер: US20210023191A1
Автор: Andersen Mads Hald
Принадлежит:

The invention relates to prophylaxis and therapy of cancer. In particular there is provided a protein Tryptophan 2,3-dioxygenase (TDO) or peptide fragments here of that are capable of eliciting anti-cancer immune responses. Specifically, the invention relates to the use of TDO or peptides derived thereof or TDO specific T-cells for treatment of cancer. The invention thus relates to an anti-cancer vaccine which optionally may be used in combination with other immunotherapies and to TDO specific T-cells adoptively transferred or induced in vivo by vaccination as a treatment of cancer. It is an aspect of the invention that the medicaments herein provided may be used in combination with cancer chemotherapy treatment. A further aspect relates to the prophylaxis and therapy of infections by the same means as described above. 1. A vaccine composition comprising(i) an immunogenically active peptide fragment of tryptophan 2,3 dioxygenase (TDO) comprising a consecutive sequence of amino acids of TDO of SEQ ID NO: 1; or(ii) a nucleic acid encoding the peptide fragment of (i).215-. (canceled)16. The vaccine composition according to claim 1 , wherein the peptide fragment consists of at the most 50 amino acid residues.17. (canceled)18. The vaccine composition according to claim 1 , wherein the peptide fragment comprises or consists of a sequence selected from the group consisting of:{'sub': '200-208', 'a. SEO ID NO: 3 (TDO);'}{'sub': '123-132', 'b. SEQ ID NO: 6 (TDO);'}{'sub': '309-317', 'c. SEO ID NO: 9 (TDO);'}{'sub': '364-372', 'd. SEQ ID NO: 13 (TDO);'}{'sub': '118-137', 'e. SEQ ID NO: 17 (TDO); and'}{'sub': '303-322', 'f. SEQ ID NO: 18 (TDO).'}1920-. (canceled)21. The vaccine composition according to claim 1 , wherein said polypeptide is a polypeptide of at the most 100 amino acids and comprising a consecutive sequence of amino acids of SEQ ID NO:1.2236-. (canceled)37. The vaccine composition according to claim 1 , wherein the nucleic acid is comprised within a vector.38. ...

Подробнее
Номер записи: 29
24-04-2014 дата публикации

Injectable Preformed Macroscopic 3-Dimensional Scaffolds for Minimally Invasive Administration

Номер: US20140112990A1
Автор: David Edwards, David J. Mooney, Roger Warren Sands, Sidi A. Bencherif
Принадлежит: Harvard College

The invention provides polymer compositions for cell and drug delivery.

Подробнее
Номер записи: 30
04-02-2016 дата публикации

Method of Induction and Purification of a Cell Population Responsible for Vascular Mimicry and Use of Same

Номер: US20160030535A1
Автор: Cornforth Andrew N., Hsieh Candace Y., Poole Aleksandra J.
Принадлежит:

The disclosure provides cancer stem cells responsible for vascular mimicry, for use in stimulating immune response against a cancer. Methods for preparing and purifying the cancer stem cells are provided. 1. An immunogenic composition comprising dendritic cells activated ex vivo by tumor antigens derived from a population of purified vascular mimicry (VM) cancer stem cells (VM-CSCs).2. The immunogenic composition of claim 1 , wherein the tumor antigens comprise cell extracts of the VM-CSCs.3. The immunogenic composition of claim 1 , wherein the tumor antigens comprise lysates of the VM-CSCs.4. The immunogenic composition of claim 1 , wherein the tumor antigens comprise intact VM-CSCs.5. The immunogenic composition of claim 4 , wherein the intact VM-CSCs are rendered non-proliferative.6. The immunogenic composition of wherein the intact VM-CSCs are rendered non-proliferative by irradiation.7. The immunogenic composition of claim 5 , wherein the intact VM-CSCs are rendered non-proliferative by exposure of the cells to a nuclear cross-linking agent.8. The immunogenic composition of claim 1 , further comprising a pharmaceutically acceptable carrier or excipient.9. The immunogenic composition of claim 1 , further comprising an adjuvant.10. The immunogenic composition of claim 9 , wherein the adjuvant is granulocyte macrophage colony stimulating factor.11. The immunogenic composition of claim 1 , wherein the composition comprises activated dendritic cells and VM-CSCs.12. A method of treating a cancer in a subject in need thereof claim 1 , comprising administering an immunogenic dose of an immunogenic composition comprising dendritic cells activated ex vivo by tumor antigens derived from a population of purified VM-CSCs to the subject.13. The method of wherein the cancer is adrenocortical carcinoma claim 12 , anal cancer claim 12 , appendix cancer claim 12 , astrocytoma claim 12 , basal-cell carcinoma claim 12 , bile duct cancer claim 12 , bladder cancer claim 12 , bone ...

Подробнее
Номер записи: 31
04-02-2016 дата публикации

Cancer Vaccines And Methods Of Treatment Using The Same

Номер: US20160030536A1
Автор: Muthumani Karuppiah, Walters Jewell, Weiner David, Yan Jian
Принадлежит:

Disclosed herein are compositions and methods for treating cancer and in particular vaccines that treat and provide protection against tumor growth. 1. A vaccine comprising (i) amino acid sequence of tyrosinase (Tyr) (SEQ ID NO:2);', '(ii) amino acid sequence of tyrosinase-related protein 1 (TYRP1) (SEQ ID NO:4);', '(iii) amino acid sequence of tyrosinase-related protein 2 (TYRP2) (SEQ ID NO:6);', '(iv) amino acid sequence of melanoma-associated antigen 4 protein (MAGEA4) (SEQ ID NO:8);', '(v) amino acid sequence of growth hormone release hormone (GHRH) (SEQ ID NO:10);', '(vi) amino acid sequence of MART-1/melan-A antigen (MART-1/Melan-A) (SEQ ID NO:12);', '(vii) amino acid sequence of cancer testis antigen (NY-ESO-1) (SEQ ID NO: 14);', '(viii) amino acid sequence of cancer testis antigen II (NY-ESO-2)(SEQ ID NO:16);', '(ix) amino acid sequence of PRAME (SEQ ID NO:18)', '(x) amino acid sequence of WT1 (SEQ ID NO:20);', '(xi) amino acid sequence of WT1 (SEQ ID NO:22); and', '(xii) amino acid sequence of hTERT (SEQ ID NO:24);, '(a) a nucleic acid encoding one or more amino acid sequence(s) selected from the group consisting of (i) amino acid sequence that is 95% identical or greater to the amino acid sequence of tyrosinase (Tyr) (SEQ ID NO:2);', '(ii) amino acid sequence that is 95% identical or greater to the amino acid sequence of tyrosinase-related protein 1 (TYRP1) (SEQ ID NO: 4);', '(iii) amino acid sequence that is 95% identical or greater to the amino acid sequence of tyrosinase-related protein 2 (TYRP2) (SEQ ID NO: 6);', '(iv) amino acid sequence that is 95% identical or greater to the amino acid sequence of melanoma-associated antigen 4 protein (MAGEA4) (SEQ ID NO: 8);', '(v) amino acid sequence that is 95% identical or greater to the amino acid sequence of growth hormone release hormone (GHRH) (SEQ ID NO: 10);', '(vi) amino acid sequence that is 95% identical or greater to the amino acid sequence of MART-1/melan-A antigen (MART-1/Melan-A)(SEQ ID NO: 12);', ...

Подробнее
Номер записи: 32
29-01-2015 дата публикации

APPLICATION OF MRNA FOR USE AS A THERAPEUTIC AGAINST TUMOUR DISEASES

Номер: US20150030633A1
Автор: Hoerr Ingmar, Pascolo Steve, VON DER MÜLBE Florian
Принадлежит: CUREVAC GMBH

The present invention relates to a pharmaceutical composition comprising at least one mRNA comprising at least one coding region for at least one antigen from a tumour, in combination with an aqueous solvent and preferably a cytokine, e.g. GM-CSF, and a process for the preparation of the pharmaceutical composition. The pharmaceutical composition according to the invention is used in particular for therapy and/or prophylaxis against cancer. 127-. (canceled)28. A method of stimulating an antitumour immune response in a subject comprising administering an effective amount of a composition comprising a mRNA encoding a MUC-1 tumour antigen to a subject having a tumour , thereby stimulating a T-cell mediated cytotoxic antitumor immune response in the subject.29. The method of claim 28 , wherein the composition comprises at least one RNase inhibitor.30. The method of claim 28 , wherein the mRNA is complexed with at least one cationic or polycationic agent.31. The method of claim 30 , wherein the cationic or polycationic agent is chosen from the group consisting of protamine claim 30 , poly-L-lysine claim 30 , poly-L-arginine and histones.32. The method of claim 31 , wherein the mRNA is complexed with protamine.33. The method of claim 28 , administering one or more adjuvant(s) to the subject.34. The method of claim 33 , wherein the adjuvant is chosen from the group consisting of lipopolysaccharide claim 33 , TNF-α claim 33 , CD40 ligand claim 33 , GP96 claim 33 , oligonucleotides with aCpG motif claim 33 , aluminium hydroxide claim 33 , Freund's adjuvant claim 33 , lipopeptides and cytokines.35. The method of claim 34 , wherein the cytokine is GM-CSF.36. The method of claim 28 , wherein the wherein the mRNA encoding MUC-1 is modified compared with the wild-type mRNA encoding MUC-1 such that it has no destabilizing sequence element.37. The method of claim 28 , wherein the wherein the mRNA comprises a 5′ cap structure claim 28 , at least one IRES and/or a poly(A) tail of at ...

Подробнее
Номер записи: 33
04-02-2016 дата публикации

Vaccines Having an Antigen and Interleukin-23 As An Adjuvant

Номер: US20160030557A1
Автор: Ferraro Bernadette, Hokey David, Morrow Matthew, Weiner David, Yan Jian
Принадлежит:

Disclosed herein is a vaccine comprising an antigen and IL-23. Also disclosed herein are methods for increasing an immune response in a subject. The methods may comprise administering the vaccine to the subject in need thereof. 1. A vaccine comprising an antigen and IL-23.2. The vaccine of claim 1 , wherein a p19 subunit of IL-23 is encoded by a nucleotide sequence as set forth in SEQ ID NO:22 and a p40 subunit of IL-23 is encoded by a nucleotide sequence as set forth in SEQ ID NO:23.3. The vaccine of claim 1 , wherein the antigen is encoded by a first nucleic acid and IL-23 is encoded by a second nucleic acid.4. The vaccine of claim 1 , further comprising an antigen peptide with the same encoded nucleic acid sequence as the antigen of claim 1 , and an IL-23 peptide with the same encoded nucleic acid sequence as the IL-23 of .5Plasmodium falciparum. The vaccine of claim 1 , wherein the antigen is selected from a group consisting of a human papilloma virus (HPV) antigen claim 1 , an HIV antigen claim 1 , an influenza antigen claim 1 , a antigen and a fragment thereof.6Plasmodium falciparum. The vaccine of claim 5 , wherein the HPV antigen is selected from the group consisting of HPV16 E6 antigen claim 5 , an HPV16 E7 antigen and a combination thereof; wherein the HIV antigen is selected from the group consisting of Env A claim 5 , Env B claim 5 , Env C claim 5 , Env D claim 5 , B Nef-Rev claim 5 , Gag claim 5 , and any combination thereof wherein the influenza antigen is selected from the group consisting of H1 HA claim 5 , H2 HA claim 5 , H3 HA claim 5 , H5 HA claim 5 , BHA antigen and any combination thereof and wherein the antigen includes a circumsporozoite (CS) antigen.7. (canceled)8. (canceled)9. (canceled)10. The vaccine of claim 1 , further comprising a pharmaceutically acceptable excipient.11. The vaccine of claim 3 , wherein the second nucleic acid further comprises an expression vector.12. A method for increasing an immune response in a subject claim 1 , ...

Подробнее
Номер записи: 34
31-01-2019 дата публикации

Novel peptides and scaffolds for use in immunotherapy against head and neck squamous cell carcinoma and other cancers

Номер: US20190030075A1
Автор: Andrea MAHR, Anita WIEBE, Colette Song, Harpreet Singh, Jens FRITSCHE, Oliver Schoor, Toni Weinschenk
Принадлежит: IMMATICS BIOTECHNOLOGIES GMBH

The present invention relates to peptides, proteins, nucleic acids and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumor-associated T-cell peptide epitopes, alone or in combination with other tumor-associated peptides that can for example serve as active pharmaceutical ingredients of vaccine compositions that stimulate anti-tumor immune responses, or to stimulate T cells ex vivo and transfer into patients. Peptides bound to molecules of the major histocompatibility complex (MHC), or peptides as such, can also be targets of antibodies, soluble T-cell receptors, and other binding molecules.

Подробнее
Номер записи: 35
07-02-2019 дата публикации

Cancer vaccines and methods of treatment using the same

Номер: US20190038729A1
Автор: Jian Yan
Принадлежит: Inovio Pharmaceuticals Inc

The invention provides a vaccine comprising a nucleic acid molecule that encodes a dog telomerase reverse transcriptase (dTERT) antigen, as well as methods of using the vaccine to induce an immune response against a TERT and to treat cancer in a mammal.

Подробнее
Номер записи: 36
07-02-2019 дата публикации

IMMUNOTHERAPY AGAINST MELANOMA AND OTHER CANCERS

Номер: US20190040112A1
Автор: Fritsche Jens, MAHR Andrea, SCHOOR Oliver, SINGH Harpreet, SONNTAG Annika, WEINSCHENK Toni
Принадлежит:

A method of treating a patient who has melanoma includes administering to said patient a composition containing a population of activated T cells that selectively recognize cells in the patient that aberrantly express a peptide. A pharmaceutical composition contains activated T cells that selectively recognize cells in a patient that aberrantly express a peptide, and a pharmaceutically acceptable carrier, in which the T cells bind to the peptide in a complex with an MHC class I molecule, and the composition is for treating the patient who has melanoma. A method of treating a patient who has melanoma includes administering to said patient a composition comprising a peptide in the form of a pharmaceutically acceptable salt, thereby inducing a T-cell response to the melanoma. 1. A method for treating a patient who has cancer comprising administering to the patient a population of activated T cells that selectively recognize cancer cells that present a peptide consisting of the amino acid sequence of FVYGEPREL (SEQ ID NO: 45) ,wherein said cancer is selected from the group consisting of melanoma, acute myelogenous leukemia, breast cancer, bile duct cancer, brain cancer, chronic lymphocytic leukemia, colorectal carcinoma, esophageal cancer, gallbladder cancer, gastric cancer, hepatocellular cancer, non-Hodgkin lymphoma, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cell cancer, small cell lung cancer, urinary bladder cancer, and uterine cancer.2. The method of claim 1 , wherein the T cells are autologous to the patient.3. The method of claim 1 , wherein the T cells are obtained from a healthy donor.4. The method of claim 1 , wherein the activated T cells are produced by contacting T cells with the peptide loaded human class I or II MHC molecules expressed on the surface of an antigen-presenting cell for a period of time sufficient to activate the T cells.5. The method of claim 1 , wherein the activated T cells are expanded in vitro ...

Подробнее
Номер записи: 37
07-02-2019 дата публикации

Immunotherapy against melanoma and other cancers

Номер: US20190040113A1
Автор: Fritsche Jens, MAHR Andrea, SCHOOR Oliver, SINGH Harpreet, SONNTAG Annika, WEINSCHENK Toni
Принадлежит:

A method of treating a patient who has melanoma includes administering to said patient a composition containing a population of activated T cells that selectively recognize cells in the patient that aberrantly express a peptide. A pharmaceutical composition contains activated T cells that selectively recognize cells in a patient that aberrantly express a peptide, and a pharmaceutically acceptable carrier, in which the T cells bind to the peptide in a complex with an MHC class I molecule, and the composition is for treating the patient who has melanoma. A method of treating a patient who has melanoma includes administering to said patient a composition comprising a peptide in the form of a pharmaceutically acceptable salt, thereby inducing a T-cell response to the melanoma. 1. A method for treating a patient who has cancer comprising administering to the patient a population of activated T cells that selectively recognize cancer cells that present a peptide consisting of the amino acid sequence of ILLDRLFSV (SEQ ID NO: 91) ,wherein said cancer is selected from the group consisting of head-and-neck cancer, melanoma, acute myelogenous leukemia, breast cancer, bile duct cancer, brain cancer, chronic lymphocytic leukemia, colorectal carcinoma, esophageal cancer, gallbladder cancer, gastric cancer, hepatocellular cancer, non-Hodgkin lymphoma, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cell cancer, small cell lung cancer, urinary bladder cancer, and uterine cancer.2. The method of claim 1 , wherein the T cells are autologous to the patient.3. The method of claim 1 , wherein the T cells are obtained from a healthy donor.4. The method of claim 1 , wherein the activated T cells are produced by contacting T cells with the peptide loaded human class I or II MHC molecules expressed on the surface of an antigen-presenting cell for a period of time sufficient to activate the T cells.5. The method of claim 1 , wherein the activated T cells ...

Подробнее
Номер записи: 38
07-02-2019 дата публикации

Immunotherapy against melanoma and other cancers

Номер: US20190040114A1
Автор: Fritsche Jens, MAHR Andrea, SCHOOR Oliver, SINGH Harpreet, SONNTAG Annika, WEINSCHENK Toni
Принадлежит:

A method of treating a patient who has melanoma includes administering to said patient a composition containing a population of activated T cells that selectively recognize cells in the patient that aberrantly express a peptide. A pharmaceutical composition contains activated T cells that selectively recognize cells in a patient that aberrantly express a peptide, and a pharmaceutically acceptable carrier, in which the T cells bind to the peptide in a complex with an MHC class I molecule, and the composition is for treating the patient who has melanoma. A method of treating a patient who has melanoma includes administering to said patient a composition comprising a peptide in the form of a pharmaceutically acceptable salt, thereby inducing a T-cell response to the melanoma. 1. A method for treating a patient who has cancer comprising administering to the patient a population of activated T cells that selectively recognize cancer cells that present a peptide consisting of the amino acid sequence of SLDEVAVSL (SEQ ID NO: 71) ,wherein said cancer is selected from the group consisting of melanoma, acute myelogenous leukemia, breast cancer, bile duct cancer, brain cancer, chronic lymphocytic leukemia, colorectal carcinoma, esophageal cancer, gallbladder cancer, gastric cancer, hepatocellular cancer, non-Hodgkin lymphoma, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cell cancer, small cell lung cancer, urinary bladder cancer, and uterine cancer.2. The method of claim 1 , wherein the T cells are autologous to the patient.3. The method of claim 1 , wherein the T cells are obtained from a healthy donor.4. The method of claim 1 , wherein the activated T cells are produced by contacting T cells with the peptide loaded human class I or II MHC molecules expressed on the surface of an antigen-presenting cell for a period of time sufficient to activate the T cells.5. The method of claim 1 , wherein the activated T cells are expanded in vitro ...

Подробнее
Номер записи: 39
07-02-2019 дата публикации

Immunotherapy against melanoma and other cancers

Номер: US20190040115A1
Автор: Fritsche Jens, MAHR Andrea, SCHOOR Oliver, SINGH Harpreet, SONNTAG Annika, WEINSCHENK Toni
Принадлежит:

A method of treating a patient who has melanoma includes administering to said patient a composition containing a population of activated T cells that selectively recognize cells in the patient that aberrantly express a peptide. A pharmaceutical composition contains activated T cells that selectively recognize cells in a patient that aberrantly express a peptide, and a pharmaceutically acceptable carrier, in which the T cells bind to the peptide in a complex with an MHC class I molecule, and the composition is for treating the patient who has melanoma. A method of treating a patient who has melanoma includes administering to said patient a composition comprising a peptide in the form of a pharmaceutically acceptable salt, thereby inducing a T-cell response to the melanoma. 1. A method for treating a patient who has cancer comprising administering to the patient a population of activated T cells that selectively recognize cancer cells that present a peptide consisting of the amino acid sequence of VLKADVVLL (SEQ ID NO: 42) ,wherein said cancer is selected from the group consisting of melanoma, acute myelogenous leukemia, breast cancer, bile duct cancer, brain cancer, chronic lymphocytic leukemia, colorectal carcinoma, esophageal cancer, gallbladder cancer, gastric cancer, hepatocellular cancer, non-Hodgkin lymphoma, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cell cancer, small cell lung cancer, urinary bladder cancer, and uterine cancer.2. The method of claim 1 , wherein the T cells are autologous to the patient.3. The method of claim 1 , wherein the T cells are obtained from a healthy donor.4. The method of claim 1 , wherein the activated T cells are produced by contacting T cells with the peptide loaded human class I or II MHC molecules expressed on the surface of an antigen-presenting cell for a period of time sufficient to activate the T cells.5. The method of claim 1 , wherein the activated T cells are expanded in vitro ...

Подробнее
Номер записи: 40
16-02-2017 дата публикации

COMPOSITIONS HAVING MEANS FOR TARGETING AT LEAST ONE ANTIGEN TO DENDRITIC CELLS

Номер: US20170042994A1
Автор: Johannes Ludger, TARTOUR Eric
Принадлежит:

A composition that can be used as a vaccine containing means for targeting at least one antigen to dendritic cells and as adjuvants a granulocyte macrophage colony stimulating factor and a CpG oligodeoxynucleotide and/or a CpG-like oligodeoxynucleotide. This composition can used to treat cancers, infectious diseases caused by bacterial, viral, fungal, parasitic or protozoan infections, allergies and/or autoimmune diseases. 1. A composition comprising an agent for targeting at least one antigen to dendritic cells , said at least one antigen being combined with said agent for targeting , and an adjuvant comprising a granulocyte macrophage colony stimulating factor (GM-CSF) and a CpG oligodeoxy nucleotide and/or a CpG-like oligodeoxynucleotide.2. The composition according to claim 1 , wherein said agent for targeting is a carrier that targets dendritic cells claim 1 , said carrier being liposomes complexed with antibodies claim 1 , microparticles complexed with antibodies claim 1 , nanoparticles complexed with antibodies claim 1 , toxin carriers or monoclonal or polyclonal antibodies.3. The composition according to claim 1 , wherein said at least one antigen is combined with said agent for targeting dendritic cells via covalent bonding claim 1 , or by electrostatic interaction or by hydrophobic interaction or a fusion protein or a chimeric protein.4. The composition according to claim 1 , wherein said at least one antigen is an antigen from cancer claim 1 , an antigen from infectious diseases selected from the group consisting of a bacterial antigen claim 1 , a viral antigen claim 1 , a fungal antigen a parasitic and a protozoan antigen claim 1 , an allergy antigen or an autoimmune antigen or mixtures thereof.5. The composition according to claim 1 , wherein said at least one antigen is a HER-2/neu antigen.6. The composition according to claim 1 , wherein said CpG oligodeoxynucleotide has the sequence of TCCATGACGTTCCTGACGTT (SEQ ID NO: 5).7. The composition according ...

Подробнее
Номер записи: 41
16-02-2017 дата публикации

Combination Vaccine Devices and Methods of Killing Cancer Cells

Номер: US20170042995A1
Автор: Ali Omar Abdel-Rahman, Dranoff Glenn, Mooney David J.
Принадлежит:

The present invention comprises compositions, methods, and devices for enhancing an endogenous immune response against a cancer. Devices and methods provide therapeutic immunity to subjects against cancer. 1. A device comprising:a) an inhibitor of an immune-inhibitory protein;b) a scaffold composition;c) a cell recruitment composition; andd) a bioactive composition, wherein the bioactive composition is incorporated into or coated onto the scaffold composition, and wherein the bioactive composition causes modification of cells in or recruited to the device.2. The device of claim 1 , wherein the immune-inhibitory protein is selected from the group consisting of cytotoxic T-lymphocyte-associated antigen 4 (CTLA4) claim 1 , programmed cell death protein 1 (PD1) claim 1 , programmed cell death protein 1 ligand (PDL1) claim 1 , lymphocyte activation gene 3 (LAG3) claim 1 , B7-H3 claim 1 , B7-H4 claim 1 , and T cell membrane protein 3 (TIM3).3. The device of claim 2 , wherein the immune-inhibitory protein is CTLA4.4. The device of claim 2 , wherein the immune-inhibitory protein is PD1.5. The device of claim 1 , comprising an inhibitor of CTLA4 and an inhibitor of PD1.6. The device of claim 1 , wherein the inhibitor comprises a protein claim 1 , peptide claim 1 , or nucleic acid.7. The device of claim 2 , wherein the inhibitor comprises an antibody or fragment thereof.8. The device of wherein the antibody or fragment thereof binds to CTLA4.9. The device of claim 8 , wherein the antibody or fragment thereof is Ipilimumab claim 8 , Tremelimumab claim 8 , or a fragment thereof.10. The device of claim 2 , wherein the inhibitor binds to PD1 claim 2 , and wherein the inhibitor is a protein.11. The device of claim 10 , wherein the inhibitor is MDX-1106 claim 10 , MK3475 claim 10 , CT-011 claim 10 , AMP-224 claim 10 , or a fragment thereof.12. The device of claim 10 , wherein the inhibitor is a PDL2-immunoglobulin (Ig) fusion protein.13. The device of claim 2 , wherein the ...

Подробнее
Номер записи: 42
15-02-2018 дата публикации

DOSE SELECTION OF ADJUVANTED SYNTHETIC NANOCARRIERS

Номер: US20180043023A1
Автор: Ilyinskii Petr, Lipford Grayson B., Zepp Charles
Принадлежит: Selecta Biosciences, Inc.

Disclosed are synthetic nanocarrier compositions with coupled adjuvant compositions as well as related methods. 1. A method comprising:providing a dose of adjuvant and a dose of antigen, wherein at least a portion of the dose of adjuvant is coupled to synthetic nanocarriers,generating an antibody titer against the antigen through administration of the dose of adjuvant and the dose of antigen to a subject, andchoosing the dose of adjuvant to be less than a separate dose of adjuvant that results in an antibody titer similar to that generated through administration of the dose of adjuvant and the dose of antigen to the subject.216.-. (canceled)17. The method of claim 1 , wherein the synthetic nanocarriers comprise one or more polymers.18. (canceled)19. The method of claim 17 , wherein the one or more polymers comprise or further comprise a polyester coupled to a hydrophilic polymer.20. (canceled)21. The method of claim 19 , wherein the hydrophilic polymer comprises a polyether.22. (canceled)2325.-. (canceled)26. The method of claim 1 , wherein the subject has cancer claim 1 , an infectious disease claim 1 , a non-autoimmune metabolic disease claim 1 , a degenerative disease claim 1 , an addiction claim 1 , and atopic condition claim 1 , asthma; chronic obstructive pulmonary disease (COPD) or a chronic infection.27. (canceled)28. A method comprising:providing a dose of adjuvant, wherein at least a portion of the dose of adjuvant is coupled to synthetic nanocarriers,generating a systemic cytokine release through administration of the dose of adjuvant to a subject, andchoosing the dose of adjuvant to be greater than a separate dose of adjuvant that results in a systemic cytokine release similar to that generated through administration of the dose of adjuvant to the subject.29. The method of claim 28 , wherein the adjuvant comprises an agonist for Toll-Like Receptors 3 claim 28 , 4 claim 28 , 5 claim 28 , 7 claim 28 , 8 claim 28 , or 9 or a combination thereof.3031.-. ( ...

Подробнее
Номер записи: 43
14-02-2019 дата публикации

Hiv vaccination and immunotherapy

Номер: US20190046633A1
Автор: Charles David Pauza, Haishan Li, Tyler Lahusen
Принадлежит: American Gene Technologies International Inc

The present invention relates generally to immunotherapy for preventing HIV infection in HIV-negative individuals. In particular, the methods include in vivo and/or ex vivo enrichment of HIV-specific CD4+ T cells.

Подробнее
Номер записи: 44
25-02-2016 дата публикации

TUMOR VACCINATION IN COMBINATION WITH HEMATOPOIETIC CELL TRANSPLANTATION FOR CANCER THERAPY

Номер: US20160051653A1
Автор: Filatenkov Alexander, Strober Samuel
Принадлежит:

In one aspect, the present invention provides a method for treating cancer comprising tumor cell vaccination in combination with hematopoietic and immune cell transplantation. In some embodiments, the method involves autologous tumor cell vaccination prior to autologous hematopoietic and immune cell transplantation. In another aspect, the present invention provides a method of purifying tumor cells from a subject in preparation for vaccination. 1. A therapeutic cell composition for reducing a number of tumor cells in a recipient and formulated for administration to said recipient in need thereof , said composition comprising:a plurality of immune cells and a plurality of hematopoietic cells, said plurality of immune cells and said plurality of hematopoietic cells are purified from a donor previously vaccinated with an effective dose of purified tumor cells,wherein said donor is previously treated for a cancer.2. The composition of claim 1 , wherein said donor is vaccinated with an effective dose of purified tumor cells from said recipient.3. The composition of claim 2 , wherein said composition of cells from said recipient comprises purified tumor cells and an adjuvant.4. The composition of claim 1 , wherein said therapeutic cell composition is used for treating a cancer of said recipient.5. The composition of claim 1 , wherein said donor is previously treated for a cancer with irradiation claim 1 , chemotherapy claim 1 , or a combination thereof.6. The composition of claim 5 , wherein said irradiation comprises delivering at least one dose of total body irradiation to said donor and further comprises claim 5 , conditioning said donor with chemotherapy prior to injection.7. The composition of claim 1 , wherein said immune cells further comprise T cells.8. The composition of claim 1 , wherein said hematopoietic cells further comprise CD34 cells.9. The composition of claim 1 , wherein said immune cells and hematopoietic cells are injected intravenously into said ...

Подробнее
Номер записи: 45
25-02-2021 дата публикации

Recombinant herpes simplex virus having expression cassette expressing fused protein of cancer cell-targeting domain and extracellular domain of hvem and use thereof

Номер: US20210054052A1
Автор: Heechung KWON, Hyun Yoo JOO, Hyunjung Baek
Принадлежит: Gencellmed Inc, Korea Institute of Radiological and Medical Sciences

The present invention relates to a recombinant herpes simplex virus (HSV) containing an expression cassette capable of expressing a fused protein of a cancer-cell-targeting domain and an extracellular domain of HVEM and the use thereof. When the recombinant HSV infects and enters target cells, which are cancer cells, HSV proliferates, and an adapter, which is the fused protein, is expressed in the cells and is released to the outside of the cells along with the proliferated HSV virion upon cell lysis, or is released even before the virion is released due to cell lysis when the adapter contains a leader sequence, and the fused protein released to the outside of the cells acts to induce the HSV virion to infect surrounding cancer cells expressing a target molecule recognized by the cancer-cell-targeting domain or to increase the infection efficiency thereof.

Подробнее
Номер записи: 46
10-03-2022 дата публикации

COMPOSITIONS AND METHODS FOR METAL CONTAINING FORMULATIONS CAPABLE OF MODULATING IMMUNE RESPONSE

Номер: US20220072023A1
Автор: Moon James J., Sun Xiaoqi
Принадлежит:

This disclosure provides compositions and methods for stimulating the innate immune response in a subject with agents capable of stimulating an innate immune response in a subject upon administration to the subject (e.g., damage-associated molecular patterns (DAMPs) and pathogen-associated molecular patterns (PAMPs)). In particular, the present invention is directed to compositions of DAMPs/PAMPs and metals ions, as well as systems and methods utilizing such nanoparticles (e.g., in diagnostic and/or therapeutic settings). 1. A composition comprising one or more DAMPs or PAMPs , and eithera) calcium phosphate and copolymers of cationic poly(ethylene imine) (PEI) and polyethylene glycol (PEG), poly(histidine)-polyethylene glycol (PH-PEG), lipid-poly-histidine, poly(lysine)-polyethylene glycol PEG(PK-PEG), or anionic poly(glutamic acid)-polyethylene glycol (PGA-PEG); or{'sup': 2+', '2+', '2+', '2+', '3+', '2+', '2+', '2+', '2+', '2+', '2+', '2+', '2+', '2+', '3+', '3+', '3+', '3+', '3+', '3+', '3+', '+', '+', '+', '+', '2+', '2+', '2+', '2+', '2+', '2+', '4+', '+', '+, 'b) one or more cations selected from the group consisting of Zn, Mn, Ca, Fe, Fe, Cu, Ni, Co, Pb, Sn, Ru, Au, Mg, VO, Al, Co, Cr, Ga, Tl, Ln, MoO, Cu, Au, Tl, Ag, Hg, Pt, Pb, Hg, Cd, Pd, Pt, Na, K, and relative phosphate or carbonate salt.'}26-. (canceled)7. The composition of claim 1 , wherein the one or more DAMPs or PAMPs are selected from STING agonists claim 1 , purine containing or purine derived agents claim 1 , Toll-Like receptor (TLR) agonists claim 1 , NOD-Like receptor (NLR) agonists claim 1 , RIG-I-Like receptor (RLR) agonists claim 1 , cytosolic DNA sensor (CDS) agonists claim 1 , C-type lectin receptor (CLR) agonists claim 1 , and inflammasome inducers.911-. (canceled)12. The composition of claim 1 ,wherein the composition is associated with a nanoparticle,wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed;wherein the nanoparticle is ...

Подробнее
Номер записи: 47
10-03-2022 дата публикации

ANTIGEN SPECIFIC MULTI EPITOPE VACCINES

Номер: US20220072113A1
Автор: Carmon Lior
Принадлежит:

The presently described subject matter relates to cancer vaccines composed of the signal peptide domain of tumor associated antigens or proteins. The described peptide vaccines have multiple MHC class I and class II epitopes which are highly abundant in the population. Therefore, these vaccines induce a strong, comprehensive immune response against the target proteins in the majority of the vaccinated population, and thereby induce an immune reaction against tumors expressing such target proteins. Specifically, the presently described subject matter relates to peptide vaccines composed of the signal peptide domain of Mucin (MUC1), BAGE-1 or ARMET, and their use for the treatment of cancers which express Mucin (MUC1), BAGE-1 or ARMET. 1. A method of enriching a T cell population in vitro , the method comprising: contacting said T cell population with a polypeptide comprising a signal peptide or derivative thereof , thereby obtaining an enriched T cell population responsive to said signal peptide or derivative thereof.2. The method of claim 1 , wherein said polypeptide consists of at most 50 amino acids.3. The method of claim 1 , wherein said polypeptide consists of at most 25 amino acids.4. The method of claim 1 , wherein said signal peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1-39.5. The method of claim 1 , wherein said signal peptide is a MUC1 signal peptide.6. The method of claim 5 , wherein said MUC1 signal peptide or derivatives thereof comprise the amino acid sequence MTPGTQSPFFLLLLLTVLTVV (SEQ ID NO. 10).7. The method of claim 5 , wherein said MUC1 signal peptide or derivatives thereof comprise an amino acid sequence selected from the group consisting of SEQ ID NO: 29-39.8. The method of claim 5 , wherein said MUC1 signal peptide or derivatives thereof comprise an amino acid sequence selected from the group consisting of SEQ ID NO: 31-39.9. The method of claim 5 , wherein said MUC1 signal peptide or derivatives ...

Подробнее
Номер записи: 48
03-03-2016 дата публикации

High purity ovarian cancer stem cells for active autologous immune therapy

Номер: US20160058855A1
Автор: Andrew N. CORNFORTH, Gabriel Nistor
Принадлежит: Neostem Oncology Llc

The disclosure provides cancer stem cells, for use in stimulating immune response against a cancer, such as ovarian carcinoma. Methods for preparing and purifying the cancer stem cells are provided.

Подробнее
Номер записи: 49
03-03-2016 дата публикации

ANTI-TUMOR DNA VACCINE

Номер: US20160058856A1
Автор: Nakano Kenji
Принадлежит: Kyushu University, National University Corporation

The present invention provides a pharmaceutical composition for treating a tumor, which is a micelle encapsulating at least one tumor-associated antigen gene. The present invention also provides a method for treating a tumor, comprising administering a micelle encapsulating at least one tumor-associated antigen gene to a patient in need of such treatment. 121-. (canceled)22. A pharmaceutical composition for treating a tumor , which is a micelle encapsulating at least one tumor-associated antigen gene and at least one adjuvant gene.23. The pharmaceutical composition of claim 22 , wherein the tumor-associated antigen gene is at least one selected from the group consisting of squamous cell carcinoma antigen recognized by T cells 3 (SART3) claim 22 , Y-box binding protein 1 (YB-1) claim 22 , Mucin 1 claim 22 , cell surface associated (MUC1) and Survivin.24. The pharmaceutical composition of or claim 22 , wherein the adjuvant gene is at least one selected from the group consisting of Granulocyte-macrophage colony-stimulating factor (GM-CSF) and CD40L.25. The pharmaceutical composition according to or claim 22 , wherein the adjuvant gene is any one of polynucleotide selected from the group consisting of (a) to (e) below:(a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 13;(b) a polynucleotide encoding a protein consisting of the amino acid sequence of SEQ ID NO: 14;(c) a polynucleotide encoding a protein consisting of an amino acid sequence wherein 1 to 40 amino acids are deleted, substituted, inserted and/or added in the amino acid sequence of SEQ ID NO: 14, and having an activity of 28scFv(LH)-CD86 chimera;(d) a polynucleotide encoding a protein having an amino acid sequence having at least 85% homology to the amino acid sequence of SEQ ID NO: 14, and having an activity of 28scFv(LH)-CD86 chimera; and,(e) a polynucleotide which hybridizes to a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 13 ...

Подробнее
Номер записи: 50
21-02-2019 дата публикации

RNA CONTAINING COMPOSITION FOR TREATMENT OF TUMOR DISEASES

Номер: US20190054189A1
Автор: Baumhof Patrick, Fotin-Mleczek Mariola, HEIDENREICH Regina, Kallen Karl-Josef, KOWALCZYK Aleksandra, Probst Jochen
Принадлежит: CureVac AG

The present invention relates to RNA containing compositions for use in the treatment or prophylaxis of tumor and/or cancer diseases, to a pharmaceutical composition, to a kit and to uses of the RNA containing compositions for the treatment or prophylaxis of tumor and/or cancer diseases. 1. A RNA containing composition comprising at least one RNA encoding IL-12 , in a pharmaceutically acceptable formulation for intra-tumoral administration.261-. (canceled)62. Method of treatment of tumor and/or cancer diseases comprising administering an effective of a RNA containing composition comprising a RNA encoding IL-12 wherein the composition is administered by intratumoral application. This application is a continuation of U.S. application Ser. No. 15/136,295, filed Apr. 22, 2016, which claims the priority of European Application No. 15001191.4, filed Apr. 22, 2015, the entirety of each of which is incorporated herein by reference.The sequence listing that is contained in the file named “CRVCP0175USC2.txt”, which is 18,428 KB (as measured in Microsoft Windows) and was created on Jul. 10, 2018, is filed herewith by electronic submission and is incorporated herein by reference.The present invention relates to RNA containing compositions for use in the treatment or prophylaxis of tumor and/or cancer diseases, to a pharmaceutical composition, to a kit and to uses of the RNA containing compositions for the treatment or prophylaxis of tumor and/or cancer diseases.Cancer, also known as malignant tumor, describes a group of diseases involving abnormal cell growth with the potential to invade or spread to other parts of the body. In 2012, about 14.1 million new cases of cancer occurred globally (not including skin cancer other than melanoma).The standard treatments of cancer include chemotherapy, radiation und surgery, wherein these treatments are applied individually or in combination. Other treatments apply cancer immunotherapy which is focused on stimulating the immune system ...

Подробнее
Номер записи: 51
28-02-2019 дата публикации

VACCINE FOR THE PREVENTION OF BREAST CANCER RELAPSE

Номер: US20190060429A1
Автор: PEOPLES George E., PONNIAH Sathibalan
Принадлежит:

The invention features methods to induce and maintain a protective cytotoxic T-lymphocyte response to a peptide of the HER2/neu oncogene, E75, with the effect of inducing and maintaining protective or therapeutic immunity against breast cancer in a patient in clinical remission. The methods comprise administering to the patient an effective amount of a vaccine composition comprising a pharmaceutically acceptable carrier, an adjuvant such as recombinant human GM-CSF, and the E75 peptide at an optimized dose and schedule. The methods further comprise administering an annual or semi-annual booster vaccine dose due to declining E75-specific T cell immunity. The invention also features vaccine compositions for use in the methods. 1. A method of inducing protective or therapeutic immunity against a HER2/neu expressing tumor in a subject , comprising administering to the subject an effective amount of a composition comprising a pharmaceutically effective carrier and a peptide having the amino acid sequence SEQ ID NO:2.27-. (canceled)8. The method of claim 1 , further comprising administering to the subject a booster comprising an effective amount of a vaccine booster composition comprising a pharmaceutically effective carrier and a peptide having SEQ ID NO:2.914-. (canceled)15. The method of claim 1 , wherein the subject is a human.1618-. (canceled)19. The method of claim 1 , wherein the HER2/neu expressing tumor has an immunohistochemistry (IHC) rating of 1+ or 2+ protein expression and a fluorescence in situ hybridization (FISH) rating of greater than about 0 to less than about 2.0 for HER2/neu gene expression.20. The method of claim 1 , wherein the HER2/neu expressing tumor has an immunohistochemistry (IHC) rating of 3+ overexpression and a fluorescence in situ hybridization (FISH) rating of greater than about 2.0 for HER2/neu gene expression.2122-. (canceled)23. The method of claim 1 , wherein the composition further comprises an adjuvant.24. (canceled)25. The method ...

Подробнее
Номер записи: 52
28-02-2019 дата публикации

Vaccines Having an Antigen and Interleukin-21 As An Adjuvant

Номер: US20190060447A1
Автор: Morrow Matthew P., Weiner David B.
Принадлежит:

Disclosed herein is a vaccine comprising an antigen and IL-21. Also disclosed herein are methods for increasing an immune response in a subject. The methods may comprise administering the vaccine to the subject in need thereof. 1. A vaccine comprising an antigen and IL-21.2. The vaccine of claim 1 , wherein IL-21 is encoded by a nucleotide sequence selected from the group consisting of: a nucleotide sequence having at least about 95% identity to a nucleotide sequence as set forth in SEQ ID NO:3 and a nucleotide sequence as set forth in SEQ ID NO:3.3. The vaccine of claim 2 , wherein IL-21 is encoded by the nucleotide sequence as set forth in SEQ ID NO:3.4. The vaccine of claim 1 , wherein the antigen is encoded by a first nucleic acid and IL-21 is encoded by a second nucleic acid.5. The vaccine of claim 1 , further comprising an antigen peptide with the same encoded nucleic acid sequence as the antigen of claim 1 , and an IL-21 peptide with the same encoded nucleic acid sequence as IL-21 of .6. The vaccine of claim 4 , wherein the second nucleic acid further comprises an expression vector.7Plasmodium falciparumC. difficle. The vaccine of claim 1 , wherein the antigen is selected from the group consisting of: a human papilloma virus (HPV) antigen claim 1 , an Human Immunodeficiency Virus (HIV) antigen claim 1 , an influenza antigen claim 1 , a antigen claim 1 , a antigen claim 1 , and a fragment thereof.8. The vaccine of claim 7 , wherein the HPV antigen is selected from the group consisting of: HPV16 E6 antigen claim 7 , HPV16 E7 antigen claim 7 , and a combination thereof.9. The vaccine of claim 7 , wherein the HIV antigen is selected from the group consisting of: Env A claim 7 , Env B claim 7 , Env C claim 7 , Env D claim 7 , B Nef-Rev claim 7 , Gag claim 7 , and any combination thereof.10. The vaccine of claim 7 , wherein the influenza antigen is selected from the group consisting of: H1 HA claim 7 , H2 HA claim 7 , H3 HA claim 7 , H5 HA claim 7 , BHA antigen ...

Подробнее
Номер записи: 53
28-02-2019 дата публикации

Immunotherapy against melanoma and other cancers

Номер: US20190062401A1
Автор: Fritsche Jens, MAHR Andrea, SCHOOR Oliver, SINGH Harpreet, SONNTAG Annika, WEINSCHENK Toni
Принадлежит:

A method of treating a patient who has melanoma includes administering to said patient a composition containing a population of activated T cells that selectively recognize cells in the patient that aberrantly express a peptide. A pharmaceutical composition contains activated T cells that selectively recognize cells in a patient that aberrantly express a peptide, and a pharmaceutically acceptable carrier, in which the T cells bind to the peptide in a complex with an MHC class I molecule, and the composition is for treating the patient who has melanoma. A method of treating a patient who has melanoma includes administering to said patient a composition comprising a peptide in the form of a pharmaceutically acceptable salt, thereby inducing a T-cell response to the melanoma. 1. A method for treating a patient who has cancer comprising administering to the patient a population of activated T cells that selectively recognize cancer cells that present a peptide consisting of the amino acid sequence of SIPDTIASV (SEQ ID NO: 6) ,wherein said cancer is selected from the group consisting of melanoma, acute myelogenous leukemia, breast cancer, bile duct cancer, brain cancer, chronic lymphocytic leukemia, colorectal carcinoma, esophageal cancer, gallbladder cancer, gastric cancer, hepatocellular cancer, non-Hodgkin lymphoma, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cell cancer, small cell lung cancer, urinary bladder cancer, and uterine cancer.2. The method of claim 1 , wherein the T cells are autologous to the patient.3. The method of claim 1 , wherein the T cells are obtained from a healthy donor.4. The method of claim 1 , wherein the activated T cells are produced by contacting T cells with the peptide loaded human class I or II MHC molecules expressed on the surface of an antigen-presenting cell for a period of time sufficient to activate the T cells.5. The method of claim 1 , wherein the activated T cells are expanded in vitro. ...

Подробнее
Номер записи: 54
27-02-2020 дата публикации

IMMUNOGENIC COMPOSITION COMPRISING SURVIVIN PEPTIDES

Номер: US20200061173A1
Автор: Bouzidi Ahmed, Kerzerho Jérôme
Принадлежит: Vaxeal Research SAS

The present invention relates to immunogenic compositions, in particular, immunogenic compositions comprising at least one peptide derived from survivin, or a functional derivative thereof. Uses of the immunogenic compositions in the treatment of cancer, in particular a cancer over-expressing survivin are also disclosed. 1. An immunogenic composition comprising:(a) at least one peptide derived from the alpha-isoform of survivin, or functional derivative thereof;(b) at least one immunostimulatory adjuvant; and(c) at least one adjuvant capable of creating a depot effect.2. The immunogenic composition according to claim 1 , wherein the at least one adjuvant capable of creating a depot effect in (c) is one or more adjuvant selected from the group consisting: alum claim 1 , emulsion based formulations claim 1 , mineral oil claim 1 , non-mineral oil claim 1 , and oil-in-water emulsion.3. The immunogenic composition according to or claim 1 , wherein the at least one adjuvant capable of creating depot effect in (c) is a Montanide® adjuvant.4. The immunogenic comprising according to claim 3 , wherein the Montanide® adjuvant is one selected from the group consisting: MR-59 claim 3 , ASO3 claim 3 , ISA-51 VG and ISA-720 VG.5. The immunogenic composition according to any preceding claim wherein at least one immunostimulatory adjuvant in (b) is an immunostimulatory oligonucleotide adjuvant comprising one or more unmethylated CpG motifs.6. The immunogenic composition according to claim 5 , wherein the immunostimulatory oligonucleotide adjuvant is an oligodeoxynucleotide-containing unmethylated CpG motif (CpG-ODN).7. The immunogenic composition according to any preceding claim claim 5 , wherein at least one immunostimulatory adjuvant in (b) comprises a granulocyte macrophage colony-stimulating factor (GM-CSF) adjuvant.8. The immunogenic composition according to any preceding claim claim 5 , wherein (b) comprises an unmethylated CpG motif and a granulocyte macrophage colony- ...

Подробнее
Номер записи: 55
11-03-2021 дата публикации

Combination Immunotherapy Compositions Against Cancer and Methods

Номер: US20210069308A1
Автор: Franzusoff Alex, Hodge James, Schlom Jeffrey
Принадлежит:

Disclosed are immunotherapeutic compositions and the concurrent use of combinations of such compositions for the improved induction of therapeutic immune responses and/or for the prevention, amelioration and/or treatment of disease, including, but not limited to, cancer and infectious disease. 178-. (canceled)79. A method to reduce tumor burden or inhibit tumor growth in an individual , comprising administering two immunotherapy compositions within a dosing period , the two immunotherapy compositions comprising:a) a first immunotherapy composition comprising a recombinant Ad5 adenovirus comprising a nucleic acid sequence encoding a CEA peptide; andb) a second immunotherapy composition comprising a CEA peptide and either a whole inactivated yeast or yeast lysate.80. The method of claim 79 , wherein the whole inactivated yeast is a whole claim 79 , heat-killed yeast.81Saccharomyces.. The method of claim 79 , wherein the whole inactivated yeast is from82. The method of claim 79 , wherein the first and second immunotherapy compositions are administered to different sites in the individual.83. The method of claim 79 , wherein the first and second immunotherapy compositions are administered to the same site or to adjacent sites in the individual.84. The method of claim 79 , wherein the CEA is human CEA.85. The method of claim 84 , wherein the human CEA is full-length human CEA.86. The method of claim 79 , wherein the CEA comprises a CAP1-6D epitope.87. The method of claim 79 , further comprising boosting the individual with one or both of the immunotherapy compositions.88. The method of claim 87 , wherein boosting the individual is with both immunotherapy compositions.89. The method of claim 88 , further comprising boosting the individual with a third immunotherapy composition comprising a recombinant virus comprising the virus genome or portions thereof that is different from the first immunotherapy composition.90. The method of claim 79 , wherein the individual is ...

Подробнее
Номер записи: 56
12-03-2015 дата публикации

IMMUNOSTIMULATORY COMPOSITIONS, PARTICLES, AND USES RELATED THERETO

Номер: US20150071987A1
Автор: Selvaraj Periasamy
Принадлежит: EMORY UNIVERSITY

In some embodiments, described herein is a method of tumor treatment or tumor vaccination. The method generally comprises applying to a human being in need thereof a tumor therapeutic composition or tumor vaccine defined herein. The tumor therapeutic composition or tumor vaccine can be produced by protein transfer of glycosyl-phosphatidylinositol (GPI)-anchored immunostimulatory or costimulatory molecules. 1. A non-naturally occurring particle comprising ,a lipid membrane;a B7-1 or B7-2 molecule anchored to the lipid membrane on the exterior of the particle;andan antigen molecule anchored to the lipid membrane on the exterior of the particle.2. The particle of further comprising an adjuvant molecule anchored to the lipid membrane on the exterior of the particle wherein the adjuvant molecule and antigen molecule are not the same molecule.3. The particle of claim 2 , wherein the adjuvant molecule is selected from molecules comprising IL-2 claim 2 , IL-12 claim 2 , ICAM1 GM-CSF claim 2 , flagellin claim 2 , unmethylated claim 2 , CpG oligonucleotide claim 2 , lipopolysaccharides claim 2 , lipid A claim 2 , and heat stable antigen (HSA).4. The particle of claim 1 , wherein the lipid membrane is a phospholipid monolayer or phospholipid bilayer.5. The particle of claim 1 , wherein the particle is a cell claim 1 , allogeneic or autologous cancer cell or its membrane fragments or vesicles claim 1 , liposome claim 1 , virosome claim 1 , micelle claim 1 , polymer claim 1 , or virus like particle.6. The particle of claim 1 , wherein the B7-1 molecule is anchored to the lipid membrane on the exterior of the particle through a conjugated glycosyl-phosphatidylinositol claim 1 , phospholipid claim 1 , glycolipid claim 1 , triglyceride claim 1 , saturated or unsaturated fatty acid claim 1 , or other lipophilic molecule.7. The particle of claim 1 , wherein the antigen molecule is anchored to the lipid membrane on the exterior of the particle through a conjugated glycosyl- ...

Подробнее
Номер записи: 57
12-03-2015 дата публикации

Mesoporous Silica Compositions for Modulating Immune Responses

Номер: US20150072009A1
Автор: Kim Jaeyun, Li Weiwei Aileen, Mooney David J.
Принадлежит:

A composition comprising mesoporous silica rods comprising an immune cell recruitment compound and an immune cell activation compound, and optionally comprising an antigen such as a tumor lysate. The composition is used to elicit an immune response to a vaccine antigen. 1. A composition comprising mesoporous silica rods comprising an immune cell recruitment compound and an immune cell activation compound.2. The composition of claim 1 , wherein said rods comprise pores of between 2-50 nm in diameter.3. The composition of claim 1 , wherein said rods comprise pores of between 5-25 nm in diameter.4. The composition of claim 1 , wherein said rods comprise pores of between 5-10 nm in diameter.5. The composition of claim 1 , wherein said rods comprise pores of approximately 8 nm in diameter.6. The composition of claim 1 , wherein said rods comprise a length of 5 μm to 500 μm.7. The composition of claim 1 , wherein said rods a length of 5 μm to 25 μm.8. The composition of claim 1 , wherein said rods comprise a length of 80 μm to 120 μm.9. The composition of claim 1 , wherein said recruitment compound comprises granulocyte macrophage-colony stimulating factor (GM-CSF) claim 1 , chemokine (C-C motif) ligand 21 (CCL-21) claim 1 , chemokine (C-C motif) ligand 19 (CCl-19) claim 1 , or a FMS-like tyrosine kinase 3 (Flt-3) ligand.10. The composition of claim 1 , wherein said recruitment compound comprises GM-CSF.11. The composition of claim 1 , wherein said composition further comprises an antigen.12. The composition of claim 11 , wherein said antigen comprises a tumor antigen.13. The composition of claim 11 , wherein said antigen comprises a tumor cell lysate.14. A method of inducing a systemic antigen-specific immune response to a vaccine antigen claim 1 , comprising administering to a subject the composition of .15. Use of a composition comprising mesoporous silica rods comprising an immune cell recruitment compound claim 1 , an immune cell activation compound claim 1 , and a ...

Подробнее
Номер записи: 58
24-03-2022 дата публикации

SAMRNA VACCINE AND PREPARATION METHOD THEREFOR

Номер: US20220088186A1
Автор: CHAO Shoubai, Li Junqiang, LU Xishan, Miao Wei, XIN Chunlin, Zhu Tao
Принадлежит:

Disclosed is an SamRNA vaccine, including a recombinant viral vector which includes: i) a viral gene replication complex including nucleotide sequences encoding viral gene replication-related proteins nsP1, nsP2, nsP3, and nsP4; and ii) a nucleotide sequence encoding at least one antigen. According to the SamRNA vaccine of the present invention, in addition to that a promoter of a modified adenoviral vector itself can transcribe an antigen gene to form mRNA, the viral gene replication-related proteins nsP1-4 use RNA as a template to synthesize a large amount of mRNAs, and the immune effect of a target antigen is greatly improved. 1. An SamRNA vaccine , comprising a recombinant viral vector which comprises: i) a viral gene replication complex comprising nucleotide sequences encoding viral gene replication-related proteins nsP1 , nsP2 , nsP3 , and nsP4; and ii) a nucleotide sequence encoding at least one antigen.2. The SamRNA vaccine according to claim 1 , wherein the recombinant viral vector is a recombinant adenovirus claim 1 , a chimpanzee adenovirus claim 1 , a recombinant vesicular stomatitis virus claim 1 , a recombinant poxvirus claim 1 , a recombinant dengue virus claim 1 , a recombinant Kunjin virus claim 1 , a recombinant sendai virus claim 1 , or a recombinant canine distemper virus.3. The SamRNA vaccine according to claim 1 , wherein the antigen causes an immune response against bacteria claim 1 , viruses claim 1 , fungi or parasites.4. The SamRNA vaccine according to claim 3 , wherein the antigen is a human herpes zoster virus gE protein claim 3 , a rotavirus VP4 or VP7 claim 3 , an HPV-L1 protein claim 3 , or an Ebola virus gP protein.5. The SamRNA vaccine according to claim 1 , wherein the antigen is a tumor-specific antigen claim 1 , and is selected from NY-ESO-1 claim 1 , SSX2 claim 1 , SCP1 claim 1 , RAGE claim 1 , BAGE claim 1 , GAGE claim 1 , MAGE family polypeptides claim 1 , p53 claim 1 , p21/Ras claim 1 , CDK4 claim 1 , MUM1 claim 1 , caspase-8 ...

Подробнее
Номер записи: 59
16-03-2017 дата публикации

ANTIGEN SPECIFIC MULTI EPITOPE VACCINES

Номер: US20170072036A1
Автор: Carmon Lior
Принадлежит: VAXIL BIOTHERAPEUTICS LTD.

The presently described subject matter relates to cancer vaccines composed of the signal peptide domain of tumor associated antigens or proteins. The described peptide vaccines have multiple MHC class I and class II epitopes which are highly abundant in the population. Therefore, these vaccines induce a strong, comprehensive immune response against the target proteins in the majority of the vaccinated population, and thereby induce an immune reaction against tumors expressing such target proteins. Specifically, the presently described subject matter relates to peptide vaccines composed of the signal peptide domain of Mucin (MUC1), BAGE-1 or ARMET, and their use for the treatment of cancers which express Mucin (MUC1), BAGE-1 or ARMET. 1. A method of treating or inhibiting cancer associated with MUC1 expressing tumor cells in a subject in need thereof , comprising:administering to said subject a therapeutically effective amount of a pharmaceutical composition comprising (i) MUC1 signal peptide or derivatives thereof;', '(ii) an isolated nucleic acid molecule comprising a nucleotide sequence encoding said MUC1 signal peptide or derivatives thereof, or', '(iii) an antigen presenting cell preloaded with said MUC1 signal peptide or derivatives thereof; and, '(a) one or more of'}(b) a pharmaceutically acceptable carrier or diluent.2. The method of claim 1 , wherein said MUC1 signal peptide or derivatives thereof is administered in a combination with a GM-CSF.3. The method of claim 1 , wherein pharmaceutical composition is a vaccine.4. The method of claim 1 , wherein said MUC1 signal peptide or derivatives thereof comprises the amino acid sequence MTPGTQSPFFLLLLLTVLTVV (SEQ ID NO. 10).5. The method of claim 1 , wherein said MUC1 signal peptide or derivatives thereof comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 31-39.6. The method of any one of claim 1 , wherein said MUC1 signal peptide or derivatives thereof comprises at least two ...

Подробнее
Номер записи: 60
16-03-2017 дата публикации

Mesothelin Vaccines and Model Systems

Номер: US20170072040A1
Автор: Hruban Ralph, Hung Chien-Fu, Jaffee Elizabeth A., Wu Tzyy-Choou
Принадлежит: THE JOHNS HOPKINS UNIVERSITY

Mesothelin can be used as an immunotherapeutic target. It induces a cytolytic T cell response. Portions of mesothelin which induce such responses are identified. Vaccines can be either polynucleotide- or polypeptide-based. Carriers for raising a cytolytic T cell response include bacteria and viruses. A mouse model for testing vaccines and other anti-tumor therapeutics and prophylactics comprises a strongly mesothelin-expressing, transformed peritoneal cell line. 1. A method of inducing a T-cell response to a pancreatic tumor , said method comprising:{'i': 'Listeria monocytogenes', 'administering to a patient who has said tumor or who has had said tumor removed, a vaccine comprising bacteria that express mesothelin.'}2. The method of wherein mesothelin-specific CD8 T cells are induced by said vaccine.3. The method of wherein the vaccine is administered in sufficient amount to induce tumor regression.4. The method of wherein the vaccine is administered in sufficient amount to keep the patient tumor-free after removal of the tumor.5. A vaccine which induces a CD8 T cell or CD4 T cell response claim 1 , comprising:a polypeptide comprising mesothelin; and (a) a protein that is fused to the polypeptide, said protein selected from the group consisting of CD40, CD40 ligand, OX-40, OX-40 ligand, CTLA-4 antagonist, and GM-CSF; and', '(b) a bacterial cell that is transformed to express the polypeptide; and', '(c) an antigen presenting cell on whose surface the polypeptide is bound., 'a carrier for stimulating a CD8+ T cell or CD4+ T cell immune response, wherein the carrier is selected from the group consisting of6. The vaccine of wherein the carrier is CD40 or CD40 ligand.7. The vaccine of wherein the carrier is OX-40 or OX-40 ligand.8. The vaccine of wherein the carrier is a CTLA-4 antagonist.9. The vaccine of wherein the carrier is GM-CSF.10. The vaccine of which comprises a bacterial cell.11. The vaccine of wherein the carrier is an antigen presenting cell.12Listeria ...

Подробнее
Номер записи: 61
16-03-2017 дата публикации

SELECTIVE LOCAL INHIBITION OF TNFR1-MEDIATED FUNCTIONS AT THE SITE OF ANTIGEN/ALLERGEN PRESENTATION

Номер: US20170072048A1
Автор: Bredehorst Reinhard, Grunwald Thomas, Ollert Markus, Schmidt-Weber Carsten, Spillner Edzard
Принадлежит:

The invention relates to a pharmaceutical composition for the modulation of T cell and B cell responses made of one or more preparations and comprising a therapeutically effective dose of at least one inhibitor of TNFR1-mediated functions and of at least one antigen or allergen. 1. A pharmaceutical composition for modulation of T cell and B cell responses made of one or more preparations and comprising a therapeutically effective dose of at least one inhibitor of tumor necrosis factor receptor 1 (TNFR1)-mediated functions and at least one antigen or allergen.2. The composition of claim 1 , further comprising a therapeutically effective dose of at least one inhibitor of IL-4/IL-13-mediated effects claim 1 , and/or a therapeutically effective dose of at least one recombinant human C3-derivative.3. The composition of claim 1 , wherein at least one inhibitor of TNFR1-mediated functions and at least one antigen or allergen and claim 1 , optionally claim 1 , at least one inhibitor of IL-4/IL-13-mediated effects claim 1 , and/or at least one recombinant human C3-derivative are coated or adsorbed on or embedded in a matrix claim 1 , wherein the matrix is selected as to enable sustained release of one or more antigens or allergens and one or more inhibitors of TNFR1-mediated functions claim 1 , and claim 1 , optionally of one or more inhibitors of IL-4/IL-13-mediated effects claim 1 , and/or of one or more recombinant human C3-derivatives.4. The composition of claim 1 , wherein at least one inhibitor of TNFR1-mediated functions and claim 1 , optionally claim 1 , at least one inhibitor of IL-4/IL-13-mediated effects claim 1 , and/or at least one recombinant human C3-derivative are coated or adsorbed on or embedded in a first matrix claim 1 , wherein the first matrix is selected as to enable sustained release of one or more inhibitors of TNFR1-mediated functions claim 1 , and claim 1 , optionally of one or more inhibitors of IL-4/IL-13-mediated effects claim 1 , and/or of one ...

Подробнее
Номер записи: 62
05-03-2020 дата публикации

Combination Immunotherapy Compositions Against Cancer and Methods

Номер: US20200069784A1
Автор: Franzusoff Alex, Hodge James, Schlom Jeffrey
Принадлежит:

Disclosed are immunotherapeutic compositions and the concurrent use of combinations of such compositions for the improved induction of therapeutic immune responses and/or for the prevention, amelioration and/or treatment of disease, including, but not limited to, cancer and infectious disease. 18-. (canceled)9. A method to prevent , ameliorate or treat at least one symptom of a disease or condition in an individual , to increase survival of an individual who has the disease or condition , and/or to induce a therapeutic immune response against one or more antigens in the individual , comprising administering to the individual:a) a first immunotherapy composition comprising a recombinant virus comprising the virus genome or portions thereof; andb) a second immunotherapy composition comprising a yeast vehicle;wherein the first and second immunotherapy compositions are administered concurrently to the individual; andwherein one or both of the first and second immunotherapy compositions comprises at least one antigen or immunogenic domain thereof.10. (canceled)11. The method claim 9 , wherein the first immunotherapy composition comprises a recombinant virus comprising one or more nucleic acid sequences encoding one or more immunostimulatory molecules.12. The method of claim 9 , wherein the first immunotherapy composition comprises a recombinant virus comprising the virus genome or portions thereof and a nucleic acid sequence encoding at least one antigen or immunogenic domain thereof claim 9 , and a recombinant virus comprising one or more nucleic acid sequences encoding one or more immunostimulatory molecules.13. The method of claim 9 , wherein the first immunotherapy composition comprises a recombinant virus comprising a nucleic acid sequence encoding the at least one antigen or immunogenic domain thereof and one or more nucleic acid sequences encoding one or more immunostimulatory molecules.14. The method of claim 9 , wherein the recombinant virus or viruses in the ...

Подробнее
Номер записи: 63
05-06-2014 дата публикации

Herpes virus strains

Номер: US20140154215A1
Автор: Robert S. Coffin
Принадлежит: AMGEN INC

The present invention provides a herpes virus with improved oncolytic properties which comprises a gene encoding an immunomodulatory cytokine and which lacks a functional ICP34.5 gene and a functional ICP47 encoding gene.

Подробнее
Номер записи: 64
18-03-2021 дата публикации

COMPOSITION AND THERAPEUTIC ANTI-TUMOUR VACCINE

Номер: US20210077602A1
Автор: BANZ Alice, GODFRIN Yann
Принадлежит:

The invention relates to a composition which induces, in a host, a cytotoxic cell response directed against cells expressing an antigen, in particular tumour cells, and which comprises red blood cells containing said antigen. These red blood cells may be in the form of an immune complex with an immunoglobulin, in particular IgG, which recognizes an epitope at the surface of the red blood cells, and/or be heat-treated or chemically treated so as to promote phagocytosis of said red blood cells by dendritic cells. As a variant, the red blood cells may be xenogenic red blood cells. The invention also relates to a therapeutic especially anti-tumour vaccine containing such a composition. 137-. (canceled)38. A method for inducing an immune response against a tumour comprising administering to a patient in need thereof an effective amount of a composition comprising red blood cells containing a tumour antigen intracellularly.39. The method of claim 38 , wherein the immune response is a cytotoxic cellular response against tumour cells or a tumour.40. The method of claim 38 , wherein the composition is a vaccine composition.41. The method of claim 38 , wherein the composition further comprises an adjuvant.42. The method of claim 38 , wherein the red blood cells are in the form of an immune complex with an immunoglobulin which recognizes an epitope at the surface of the red blood cells claim 38 , wherein the immune complex promotes phagocytosis of the red blood cells by antigen presenting cells (APCs).43. The method of claim 42 , wherein the red blood cells form an immune complex with an anti-rhesus or anti-glycophorin A or anti-CR1 antibody.44. The method of claim 42 , wherein the immunoglobulin is an IgG.45. The method of claim 38 , wherein the red blood cells are heat-treated or chemically-treated claim 38 , wherein the heat- or chemical-treatment promotes phagocytosis of the red blood cells by APCs.46. The method of claim 42 , wherein the red blood cells in the form of an ...

Подробнее
Номер записи: 65
14-03-2019 дата публикации

INJECTABLE PREFORMED MACROSCOPIC 3-DIMENSIONAL SCAFFOLDS FOR MINIMALLY INVASIVE ADMINISTRATION

Номер: US20190076373A1
Автор: Bencherif Sidi A., Edwards David, Mooney David J., Sands Roger Warren
Принадлежит:

The invention provides polymer compositions for cell and drug delivery. 128-. (canceled)29. An injectable cell-compatible highly crosslinked cryogel polymer composition comprising open interconnected pores ,wherein the cryogel comprises at least 75% pores;wherein the cryogel polymer composition is characterized by shape memory following deformation by compression or dehydration; andwherein the cryogel composition comprises a crosslinked gelatin polymer or a crosslinked alginate polymer.30. The cryogel polymer composition of claim 29 , wherein the cryogel composition is characterized by shape memory following deformation by compression through a needle.31. The cryogel polymer composition of claim 29 , further comprising a biomolecule.32. The cryogel polymer composition of claim 31 , wherein the biomolecule comprises a small molecule claim 31 , a nucleic acid claim 31 , or a protein.33. The cryogel polymer composition of claim 32 , wherein the biomolecule is a protein that recruits a cell into the cryogel composition upon injection into a subject.34. The cryogel polymer composition of claim 33 , wherein the protein is GM-CSF.35. The cryogel polymer composition of claim 33 , wherein the cell is an immune cell.36. The cryogel polymer composition of claim 35 , wherein the immune cell is a dendritic cell.37. The cryogel polymer composition of claim 29 , further comprising an adjuvant.38. The cryogel polymer composition of claim 37 , wherein the adjuvant is cytosine-guanosine oligonucleotide (CpG-ODN).39. The cryogel polymer composition of claim 29 , wherein the gelatin or alginate is acrylated or methacrylated.40. The cryogel polymer composition of claim 39 , wherein the alginate is a methacrylated alginate macromonomer with a concentration of about 1% (w/v).41. The cryogel polymer composition of claim 29 , wherein the cryogel composition is characterized by at least 50% polymer crosslinking.42. The cryogel polymer composition of claim 41 , wherein the cryogel composition ...

Подробнее
Номер записи: 66
12-03-2020 дата публикации

Mosaic chimeric viral vaccine particle

Номер: US20200079838A1
Автор: Luc Berghman, Surya Waghela, Waithaka MWANGI
Принадлежит: TEXAS A&M UNIVERSITY SYSTEM

The present invention describes compositions and methods for priming protective immunity in the presence of pre-existing maternal antibody. In some embodiments, the invention contemplates simultaneously masking vaccines to avoid antibody neutralization while targeting those vaccines to specific cell types in order to elicit an enhanced immune response. In other embodiments, vectors that recruit and activate specific antigen-presenting cells may further enhance the efficacy of those immune responses.

Подробнее
Номер записи: 67
29-03-2018 дата публикации

DNA VECTOR AND TRANSFORMED TUMOR CELL VACCINES

Номер: US20180085448A1
Автор: GENTILINI MEGHAN, LAWMAN MICHAEL J. P., LAWMAN PATRICIA D., RAMIYA VIJAY
Принадлежит:

Customized whole cell cancer vaccines can be produced from autologous (ex vivo or in situ) or allogeneic human or veterinary patient cell lines. Cells are transformed with DNA that expresses an Emm protein on the cell surface and cytosol. Treatment of cancer patients with an Emm vector vaccine induces an immunologic response to the cancer by enhancing immunogenicity of a tumor. Emm vaccines can be used in patients where the cancer is not identified due to lower tumor burden or used to treat a specific cancer and subsequently treat for a second type that may have arisen through metastasis. 1. A membrane anchoring protein comprising an amino acid sequence located within the N-terminal signal sequence of a selected protein and an amino acid sequence located within the C-terminal anchor region of the protein.2. The membrane anchoring protein of wherein the selected protein is a bacterial protein.3. The membrane anchoring protein of wherein the bacterial protein is Emm55 having the amino acid sequence of SEQ ID NO: 5.4. The cell membrane anchoring protein of wherein the helical N-terminal signal peptide region of the protein orients inside to outside to provide egress to the cell membrane surface.5. The cell membrane anchoring protein of wherein the helical C-terminal anchor region is oriented outside to inside orientation on the cell membrane.6. The cell membrane anchoring protein of wherein the amino acid sequence within the N-terminal signal sequence has the amino acid sequence of SEQ ID NO: 7.7. The cell membrane anchoring protein of wherein the amino acid sequence within the C-terminal anchor region of the protein has the amino acid sequence of SEQ ID NO: 9.8. The cell membrane anchoring protein of wherein the selected protein is a bacterial protein that induces an immune response in vivo.9. The cell membrane anchoring protein of wherein the bacterial protein is a streptococcal Emm55 protein.10. A method for preparing a cell membrane anchoring protein claim 8 , ...

Подробнее
Номер записи: 68
31-03-2016 дата публикации

APPLICATION OF mRNA FOR USE AS A THERAPEUTIC AGAINST TUMOUR DISEASES

Номер: US20160089424A1
Автор: Florian VON DER MüLBE, Ingmar Hoerr, Steve Pascolo
Принадлежит: CureVac AG

The present invention relates to a pharmaceutical composition comprising at least one mRNA comprising at least one coding region for at least one antigen from a tumour, in combination with an aqueous solvent and preferably a cytokine, e.g. GM-CSF, and a process for the preparation of the pharmaceutical composition. The pharmaceutical composition according to the invention is used in particular for therapy and/or prophylaxis against cancer.

Подробнее
Номер записи: 69
31-03-2016 дата публикации

APPLICATION OF mRNA FOR USE AS A THERAPEUTIC AGAINST TUMOUR DISEASES

Номер: US20160089425A1
Автор: Hoerr Ingmar, Pascolo Steve, VON DER MÜLBE Florian
Принадлежит: CureVac AG

The present invention relates to a pharmaceutical composition comprising at least one mRNA comprising at least one coding region for at least one antigen from a tumour, in combination with an aqueous solvent and preferably a cytokine, e.g. GM-CSF, and a process for the preparation of the pharmaceutical composition. The pharmaceutical composition according to the invention is used in particular for therapy and/or prophylaxis against cancer. 1. A method of stimulating an antitumor immune response in a subject comprising administering an effective amount of a cell-free composition comprising mRNA encoding an Survivin antigen to a subject in need thereof , thereby stimulating a T-cell mediated cytotoxic anticancer immune response in the subject.2. The method of claim 1 , wherein the subject has a cancer.3. The method of claim 2 , wherein the cancer is a lung cancer.4. The method of claim 1 , wherein the composition comprises mRNA encoding at least 2 claim 1 , 3 claim 1 , 4 or 5 different tumor antigens.5. The method of claim 1 , wherein the method further comprises administering at least 2 claim 1 , 3 claim 1 , 4 or 5 different cell-free compositions comprising mRNA encoding different tumor antigens to the subject.6. The method of claim 1 , wherein the mRNA is complexed with as least one cationic or polycationic agent.7. The method of claim 6 , wherein the cationic or polycationic agent is chosen from the group consisting of protamine claim 6 , poly-L-lysine claim 6 , poly-L-arginine and histones.8. The method of claim 7 , wherein the mRNA is complexed with protamine.9. The method of claim 1 , further comprising administering one or more adjuvant(s) to the subject.10. The method of claim 9 , wherein the adjuvant is chosen from the group consisting of lipopolysaccharide claim 9 , TNF-α claim 9 , CD40 ligand claim 9 , GP96 claim 9 , oligonucleotides with a CpG motif claim 9 , aluminum hydroxide claim 9 , Freund's adjuvant claim 9 , a lipopeptide and a cytokine.11. The ...

Подробнее
Номер записи: 70
31-03-2016 дата публикации

APPLICATION OF mRNA FOR USE AS A THERAPEUTIC AGAINST TUMOUR DISEASES

Номер: US20160089426A1
Автор: Hoerr Ingmar, Pascolo Steve, VON DER MÜLBE Florian
Принадлежит: CureVac AG

The present invention relates to a pharmaceutical composition comprising at least one mRNA comprising at least one coding region for at least one antigen from a tumour, in combination with an aqueous solvent and preferably a cytokine, e.g. GM-CSF, and a process for the preparation of the pharmaceutical composition. The pharmaceutical composition according to the invention is used in particular for therapy and/or prophylaxis against cancer. 1. A method of stimulating an antitumor immune response in a subject comprising administering an effective amount of a cell-free composition comprising mRNA encoding an MAGE antigen to a subject in need thereof , thereby stimulating a T-cell mediated cytotoxic anticancer immune response in the subject.2. The method of claim 1 , wherein the subject has a cancer.3. The method of claim 2 , wherein the cancer is a lung or skin cancer.4. The method of claim 1 , wherein the composition comprises mRNA encoding at least 2 claim 1 , 3 claim 1 , 4 or 5 different tumor antigens.5. The method of claim 1 , wherein the method further comprises administering at least 2 claim 1 , 3 claim 1 , 4 or 5 different cell-free compositions comprising mRNA encoding different tumor antigens to the subject.6. The method of claim 1 , wherein the mRNA is complexed with as least one cationic or polycationic agent.7. The method of claim 6 , wherein the cationic or polycationic agent is chosen from the group consisting of protamine claim 6 , poly-L-lysine claim 6 , poly-L-arginine and histones.8. The method of claim 7 , wherein the mRNA is complexed with protamine.9. The method of claim 1 , further comprising administering one or more adjuvant(s) to the subject.10. The method of claim 9 , wherein the adjuvant is chosen from the group consisting of lipopolysaccharide claim 9 , TNF-α claim 9 , CD40 ligand claim 9 , GP96 claim 9 , oligonucleotides with a CpG motif claim 9 , aluminum hydroxide claim 9 , Freund's adjuvant claim 9 , a lipopeptide and a cytokine.11. The ...

Подробнее
Номер записи: 71
31-03-2016 дата публикации

Induction of IL-12 using immunotherapy

Номер: US20160089433A1
Автор: Har-Noy Michael
Принадлежит:

The present invention relates to compositions and methods that promote the induction of IL-12 in a patient. The composition includes activated allogeneic cells that are administered to a patient with a disease such as cancer. Administration of the composition skews the patient's immune response to a Th1 environment and produces detectable levels of IL-12 in the patient's plasma, without any IL-12 related toxicity. 1. A composition capable of causing the appearance of IL-12 in plasma , the composition essentially consisting of:a foreign antigen;at least one Th1 cytokine; anda DC maturation molecule.2. The composition of where the foreign antigen is an alloantigen.3. The composition of where the Th1 cytokine is one or more of the following: IL-1 claim 1 , IL-2 claim 1 , IL-6 claim 1 , IL-8 claim 1 , IL-15 claim 1 , Interferon-gamma claim 1 , TNF-alpha claim 1 , GM-CSF.4. The composition of where the DC maturation molecule is CD40L and/or FasL.5. The composition of where the alloantigen is on a living T-cell.6. The composition of where the T-cells are CD4+ cells or Th1 cells.7. The composition of where the Th1 cell is activated.8. The composition of where the Th1 cells are activated by cross-linking CD3 and CD28.9. The composition of where the activated Th1 cells secrete one or more of the following Th1 cytokines: IL-2 claim 8 , IFN-gamma and GM-CSF.10. The composition of where the activated Th1 cells express the DC maturation molecule CD40L and/or FasL on their surface.11. The composition of where the components are immobilized on a surface.12. The composition of where the surface is biodegradable.13. The composition of where the living T-cells are packaged in a syringe or flexible container.14. The composition of where the cells are at a concentration of 1×10cells/ml or greater.15. The composition of where the cells are suspended in a non-nutrient media.16. A method of treating a patient with a disease comprising:administering a composition comprising allogeneic ...

Подробнее
Номер записи: 72
30-03-2017 дата публикации

Vaccination with immuno-isolated cells producing an immunomodulator

Номер: US20170087234A1
Автор: Nicolas Mach
Принадлежит: MAXIVAX SA

Provided herein are vaccine compositions containing at least one retrievable biocompatible macrocapsule containing immuno-isolated allogeneic cells that secrete an immunomodulator such as GM-C SF (granulocyte-macrophage colony stimulating factor) and an antigenic component such as autologous tumor cells or infectious agents. Also provided are kits and pharmaceutical compositions containing the vaccine compositions as well as methods of use thereof for therapeutic or preventative vaccination against tumors or infectious agents.

Подробнее
Номер записи: 73
05-05-2022 дата публикации

BAFF THERAPY TO PROMOTE ANTI-TUMOR IMMUNITY

Номер: US20220133788A1
Автор: Jaffee Elizabeth A., Yarchoan Mark
Принадлежит:

Anti-tumor immune response are generated by induction of activated B cells to provide costimulatory signals necessary for T cell activation. Certain compositions are combined with anti-immune checkpoint inhibitors to generate a synergistic anti-tumor response.

Подробнее
Номер записи: 74
05-05-2022 дата публикации

TUMOR CELL VACCINES

Номер: US20220133868A1
Автор: Arndt Justin James, Bagarazzi Mark, Binder Todd Merrill, Ferraro Bernadette, Hundt Matthias, Lewis Amritha Balakrishnan, MOHLER Kendall M., Shawler Daniel Lee, Yan Jian
Принадлежит:

The present disclosure provides an allogeneic whole cell cancer vaccine platform that includes compositions and methods for treating and preventing cancer. Provided herein are compositions containing a therapeutically effective amount of cells from one or more cancer cell lines, some or all of which are modified to (i) inhibit or reduce expression of one or more immunosuppressive factors by the cells, and/or (ii) express or increase expression of one or more immunostimulatory factors by the cells, and/or (iii) express or increase expression of one or more tumor-associated antigens (TAAs), including TAAs that have been mutated, and which comprise cancer cell lines that natively express a heterogeneity of tumor associated antigens and/or neoantigens, and/or (iv) express one or more tumor fitness advantage mutations, including but not limited to acquired tyrosine kinase inhibitor (TKI) resistance mutations, EGFR activating mutations, and/or (v) express modified ALK intracellular domain(s), and/or express one or more driver mutations. Also provided herein are methods of making and preparing the vaccine compositions and methods of use thereof.

Подробнее
Номер записи: 75
05-05-2022 дата публикации

BREAST CANCER TUMOR CELL VACCINES

Номер: US20220133869A1
Автор: Arndt Justin James, Bagarazzi Mark, Binder Todd Merrill, Ferraro Bernadette, Hundt Matthias, Lewis Amritha Balakrishnan, MOHLER Kendall M., Shawler Daniel Lee, Yan Jian
Принадлежит:

The present disclosure provides an allogeneic whole cell cancer vaccine platform that includes compositions and methods for treating and preventing breast cancer. Provided herein are compositions containing a therapeutically effective amount of cells from one or more cancer cell lines, some or all of which are modified to (i) inhibit or reduce expression of one or more immunosuppressive factors by the cells, and/or (ii) express or increase expression of one or more immunostimulatory factors by the cells, and/or (iii) express or increase expression of one or more tumor-associated antigens (TAAs), including TAAs that have been mutated, and which comprise cancer cell lines that natively express a heterogeneity of tumor associated antigens and/or neoantigens, and/or (iv) express one or more tumor fitness advantage mutations, including but not limited to driver mutations. Also provided herein are methods of making and preparing the breast cancer vaccine compositions and methods of use thereof.

Подробнее
Номер записи: 76
19-03-2020 дата публикации

CD40 AGONIST ANTIBODY /TYPE 1 INTERFERON SYNERGISTIC ADJUVANT COMBINATION, CONJUGATES CONTAINING AND USE THEREOF AS A THERAPEUTIC TO ENHANCE CELLULAR IMMUNITY

Номер: US20200087370A1
Автор: Haluszczak Catherine, Kedl Ross, Sanchez Phillip J.
Принадлежит:

A synergistic adjuvant is provided comprising synergistically effective amounts of at least one type 1 interferon and at least one CD40 agonist, wherein these moieties may be in the same or separate compositions. In addition, fusion proteins and DNA conjugates which contain a type 1 interferon/CD40 agonist/antigen combination are provided. The use of these compositions, protein and DNA conjugates as immune adjuvants for treatment of various chronic diseases such as HIV infection and for enhancing the efficacy of vaccines (prophylactic and therapeutic) is also provided. 1. A nucleic acid construct comprising:at least one nucleic acid sequence encoding an agonist of CD40;(ii) optionally a nucleic acid sequence encoding a desired antigen; and(iii) a nucleic acid sequence encoding a type 1 interferon;wherein said sequences (i), (ii) (if present) and (iii) are operably linked to the same or different transcription regulatory sequences and further wherein said sequences (i), (ii) and (iii) are optionally separated by linker sequence and/or an IRES.279-. (canceled) This application is a Divisional of U.S. application Ser. No. 13/165,154 filed Jun. 21, 2011, which is a Divisional of U.S. application Ser. No. 11/743,978 filed on May 3, 2007, which claims priority to U.S. Provisional Applications No. 60/796,867 filed on May 3, 2006, 60/809,821 filed on Jun. 1, 2006 and 60/842,009 filed on Sep. 5, 2006, all of which applications are incorporated by reference in their entirety. Also, the application relates to U.S. Provisional Application 60/777,569 filed on Mar. 1, 2006 which application is also incorporated by reference herein.The invention generally relates to synergistic adjuvant combinations which may be used to enhance immunity in subjects in need thereof. More particularly, the invention relates to a specific synergistic adjuvant combination comprising (i) a type 1 interferon and (ii) a CD40 agonist, e.g., an agonistic anti-CD40 antibody or a CD40L polypeptide or CD40L ...

Подробнее
Номер записи: 77
07-04-2016 дата публикации

APPLICATION OF mRNA FOR USE AS A THERAPEUTIC AGAINST TUMOUR DISEASES

Номер: US20160095911A1
Автор: Hoerr Ingmar, Pascolo Steve, VON DER MÜLBE Florian
Принадлежит: CureVac AG

The present invention relates to a pharmaceutical composition comprising at least one mRNA comprising at least one coding region for at least one antigen from a tumour, in combination with an aqueous solvent and preferably a cytokine, e.g. GM-CSF, and a process for the preparation of the pharmaceutical composition. The pharmaceutical composition according to the invention is used in particular for therapy and/or prophylaxis against cancer. 1. A method of stimulating an antitumor immune response in a subject comprising administering an effective amount of a cell-free composition comprising mRNA encoding an PSMA antigen to a subject in need thereof , thereby stimulating a T-cell mediated cytotoxic anticancer immune response in the subject.2. The method of claim 1 , wherein the subject has a cancer.3. The method of claim 2 , wherein the cancer is a prostate cancer.4. The method of claim 1 , wherein the composition comprises mRNA encoding at least 2 claim 1 , 3 claim 1 , 4 or 5 different tumor antigens.5. The method of claim 1 , wherein the method further comprises administering at least 2 claim 1 , 3 claim 1 , 4 or 5 different cell-free compositions comprising mRNA encoding different tumor antigens to the subject.6. The method of claim 1 , wherein the mRNA is complexed with as least one cationic or polycationic agent.7. The method of claim 6 , wherein the cationic or polycationic agent is chosen from the group consisting of protamine claim 6 , poly-L-lysine claim 6 , poly-L-arginine and histones.8. The method of claim 7 , wherein the mRNA is complexed with protamine.9. The method of claim 1 , further comprising administering one or more adjuvant(s) to the subject.10. The method of claim 9 , wherein the adjuvant is chosen from the group consisting of lipopolysaccharide claim 9 , TNF-α claim 9 , CD40 ligand claim 9 , GP96 claim 9 , oligonucleotides with a CpG motif claim 9 , aluminum hydroxide claim 9 , Freund's adjuvant claim 9 , a lipopeptide and a cytokine.11. The ...

Подробнее
Номер записи: 78
07-04-2016 дата публикации

APPLICATION OF mRNA FOR USE AS A THERAPEUTIC AGAINST TUMOUR DISEASES

Номер: US20160095912A1
Автор: Hoerr Ingmar, Pascolo Steve, VON DER MÜLBE Florian
Принадлежит: CureVac AG

The present invention relates to a pharmaceutical composition comprising at least one mRNA comprising at least one coding region for at least one antigen from a tumour, in combination with an aqueous solvent and preferably a cytokine, e.g. GM-CSF, and a process for the preparation of the pharmaceutical composition. The pharmaceutical composition according to the invention is used in particular for therapy and/or prophylaxis against cancer. 1. A method of stimulating an antitumor immune response in a subject comprising administering an effective amount of a cell-free composition comprising mRNA encoding an GP100 antigen to a subject in need thereof , thereby stimulating a T-cell mediated cytotoxic anticancer immune response in the subject.2. The method of claim 1 , wherein the subject has a cancer.3. The method of claim 2 , wherein the cancer is a skin cancer.4. The method of claim 1 , wherein the composition comprises mRNA encoding at least 2 claim 1 , 3 claim 1 , 4 or 5 different tumor antigens.5. The method of claim 1 , wherein the method further comprises administering at least 2 claim 1 , 3 claim 1 , 4 or 5 different cell-free compositions comprising mRNA encoding different tumor antigens to the subject.6. The method of claim 1 , wherein the mRNA is complexed with as least one cationic or polycationic agent.7. The method of claim 6 , wherein the cationic or polycationic agent is chosen from the group consisting of protamine claim 6 , poly-L-lysine claim 6 , poly-L-arginine and histones.8. The method of claim 7 , wherein the mRNA is complexed with protamine.9. The method of claim 1 , further comprising administering one or more adjuvant(s) to the subject.10. The method of claim 9 , wherein the adjuvant is chosen from the group consisting of lipopolysaccharide claim 9 , TNF-α claim 9 , CD40 ligand claim 9 , GP96 claim 9 , oligonucleotides with a CpG motif claim 9 , aluminum hydroxide claim 9 , Freund's adjuvant claim 9 , a lipopeptide and a cytokine.11. The method ...

Подробнее
Номер записи: 79
01-04-2021 дата публикации

Cancer Stem Cell Targeted Cancer Vaccines

Номер: US20210093701A1
Автор: Bergstein Ivan, BROOKS Christopher, Cirrito Thomas P.
Принадлежит: Stemline Therapeutics, Inc.

Provided herein are cancer stem cell targeted cancer vaccines and methods for treating and vaccinating against cancer. Also contained herein are regimens by which cancer stem cell targeted cancer vaccines are administered, such regimens comprising peptides, compositions, immunomodulatory agents, and emulsifiers. Also provided are the patient populations to which the regimens are to be administered, and the dosages, schedules, route of administration for the regimens. 161.-. (canceled)62. A method for treating brain cancer in a human subject in need thereof comprising administering to said subject a pharmaceutical composition comprising an IL-13Rα2 peptide having an amino acid sequence chosen from SEQ ID NOs:1-4 , an EphA2 peptide having the amino acid sequence set forth in SEQ ID NO:5 , a survivin peptide having the amino acid sequence set forth in SEQ ID NO:9 , and a Tetanus toxoid peptide having the amino acid sequence set forth in SEQ ID NO:10 , wherein said composition is formulated as an emulsion , wherein the method does not comprise administering a peptide consisting of SEQ ID NO:7 , and wherein the pharmaceutical composition is co-administered with bevacizumab.63. The method of claim 62 , wherein the pharmaceutical composition is administered to the subject subcutaneously.64. A method for treating brain cancer in a subject in need thereof comprising administering to said subject:(i) a pharmaceutical composition comprising an IL-13Rα2 peptide having an amino acid sequence chosen from SEQ ID NOs:1-4, an EphA2 peptide having the amino acid sequence set forth in SEQ ID NO:5, a survivin peptide having the amino acid sequence set forth in SEQ ID NO:9, and a Tetanus toxoid peptide having the amino acid sequence set forth in SEQ ID NO:10, wherein said composition is formulated as an emulsion; and(ii) one or more immunomodulatory agents;wherein the method does not comprise administering a peptide consisting of SEQ ID NO:7; and wherein the pharmaceutical composition ...

Подробнее
Номер записи: 80
28-03-2019 дата публикации

IMMUNOGENIC WT-1 PEPTIDES AND METHODS OF USE THEREOF

Номер: US20190092813A1
Автор: "OREILLY Richard", Doubrovina Ekaterina, Selvakumar Annamalai
Принадлежит: Memorial Sloan Kettering Cancer Center

This invention provides peptides, immunogenic compositions and vaccines, and methods of treating, reducing the incidence of, and inducing immune responses to a WT-1-expressing cancer, comprising peptides derived from the WT-1 protein. 1. A composition comprising WT1-specific cytotoxic T lymphocytes (CTLs) prepared by contacting a lymphocyte population in vitro or ex vivo with one or more peptides selected from AILDFLLLQ (SEQ ID NO:147) , RQRPHPGAL (SEQ ID NO:142) , GALRNPTAC (SEQ ID NO:143) , THSPTHPPR (SEQ ID NO:146) , WNQMNLGATLK (SEQ ID NO:173) , PGCLQQPEQQG (SEQ ID NO:149) , LDFAPPGASAY (SEQ ID NO:156) , PLPHFPPSL (SEQ ID NO:144) , HFPPSLPPT (SEQ ID NO:145) , LLAAILDFL (SEQ ID NO:184) , ALRNPTACPL (SEQ ID NO:191) , GGCALPVSGA (SEQ ID NO:153) , LGATLKGVAA (SEQ ID NO:176) , TLGVAAGS (SEQ ID NO:177) , KRPFMCAYPGC (SEQ ID NO:180) LKTHTRTHT (SEQ ID NO:182) , SEQ ID NOS:1-15 , an isolated WT1 peptide consisting of 8-30 amino acids comprising an amino acid sequence selected from SEQ ID NO: 142 , 143 , 144 , 145 , 146 , 147 , 149 , 184 , and an isolated WT1 peptide consisting of 16-30 amino acids comprising an amino acid sequence selected from SEQ ID NOS:1-15.23.-. (canceled)4. The composition of wherein the peptides are a pool of peptides having SEQ ID NO:1-141.510.-. (canceled)11. A method of treating a subject with a WT-1-expressing cancer or reducing an incidence of a WT-1-expressing cancer claim 1 , or its relapse claim 1 , the method comprising administering to said subject the composition of claim 1 , thereby treating a subject with a WT-1-expressing cancer claim 1 , reducing an incidence of a WT-1-expressing cancer or its relapse therein.12. The method of claim 11 , wherein said WT-1-expressing cancer is a leukemia claim 11 , a desmoplastic small round cell tumor claim 11 , a gastric cancer claim 11 , a colon cancer claim 11 , a lung cancer claim 11 , a breast cancer claim 11 , a germ cell tumor claim 11 , an ovarian cancer claim 11 , a uterine cancer claim 11 , ...

Подробнее
Номер записи: 81
06-04-2017 дата публикации

VACCINATION WITH IMMUNO-ISOLATED CELLS PRODUCING AN IMMUNOMODULATOR

Номер: US20170095546A1
Автор: Mach Nicolas
Принадлежит:

Provided herein are vaccine compositions containing at least one retrievable biocompatible macrocapsule containing immuno-isolated allogeneic cells that secrete an immunomodulator such as GM-CSF (granulocyte-macrophage colony stimulating factor) and an antigenic component such as autologous tumor cells or infectious agents. Also provided are kits and pharmaceutical compositions containing the vaccine compositions as well as methods of use thereof for therapeutic or preventative vaccination against tumors or infectious agents. 26.-. (canceled)7. The vaccine composition according to claim 1 , wherein the at least one biocompatible macrocapsule is secured to a retrieval tube.89.-.10. The vaccine composition according to claim 7 , wherein the retrieval tube further comprises a retrieval hook to facilitate retrieval of the at least one biocompatible macrocapsule after implantation.1114.-. (canceled)15. The vaccine composition according to claim 7 , wherein the retrieval tube is secured to the membrane of the at least one biocompatible macrocapsule with a connector.16. (canceled)17. The vaccine composition according to claim 15 , wherein the end of the connector that is inserted into the membrane has a truncated conical shape.18. The vaccine composition according to claim 7 , wherein the at least one biocompatible macrocapsule further comprises a loading hub to facilitate the loading of cells.19. The vaccine composition according to claim 18 , wherein the loading hub has a truncated conical end that is friction fitted into the membrane.20. (canceled)21. The vaccine composition according to claim 1 , wherein the at least one biocompatible macrocapsule is contained within a transport tube comprising a tube body and a tube cap.2238.-. (canceled)39. The vaccine composition according to claim 1 , wherein the immuno-isolated allogeneic cells further secrete at least one additional immunomodulatory agent claim 1 , wherein the at least one additional immunomodulatory agent is ...

Подробнее
Номер записи: 82
16-04-2015 дата публикации

IMMUNOGENIC WT-1 PEPTIDES AND METHODS OF USE THEREOF

Номер: US20150104413A1
Автор: "OReilly Richard J.", Doubrovina Ekaterina, Selvakumar Annamalai
Принадлежит: Memorial Sloan Kettering Cancer Center

This invention provides peptides, immunogenic compositions and vaccines, and methods of treating, reducing the incidence of, and inducing immune responses to a WT-1-expressing cancer, comprising peptides derived from the WT-1 protein. 1. An isolated WT-1 peptide consisting ofan amino acid sequence selected from among AILDFLLLQ (SEQ ID NO:147) , RQRPHPGAL (SEQ ID NO:142) , GALRNPTAC (SEQ ID NO:143) , THSPTHPPR (SEQ ID NO:146) , ASGSEPQQM (SEQ ID NO:151) , WNQMNLGATLK (SEQ ID NO:173) , PGCLQQPEQQG (SEQ ID NO:149) , and LDFAPPGASAY (SEQ ID NO:156).2. An isolated WT-1 peptide consisting ofan amino acid sequence selected from among PLPHFPPSL (SEQ ID NO:144) , HFPPSLPPT (SEQ ID NO:145) , PGCLQQPEQ (SEQ ID NO:148) , KLGAAEASA (SEQ ID NO:150) , LLAAILDFL (SEQ ID NO:184) , CLQQPEQQGV (SEQ ID NO:185) and ALRNPTACPL (SEQ ID NO:191).3. An isolated WT-1 peptide consisting of an amino acid sequence selected from amongRDLNALLPAV (SEQ ID NO:152) , GGCALPVSGA (SEQ ID NO:153) , GAAQWAPVL (SEQ ID NO:154) , LDFAPPGAS (SEQ ID NO:155) , SAYGSLGGP (SEQ ID NO:157) , PAPPPPPPP (SEQ ID NO:158) , ACRYGPFGP (SEQ ID NO:159) , SGQARMFPN (SEQ ID NO:160) , PSCLESQPA (SEQ ID NO:162) , NQGYSTVTF (SEQ ID NO:163) , HHAAQFPNH (SEQ ID NO:164) , HSFKHEDPM (SEQ ID NO:165) , CHTPTDSCT (SEQ ID NO:166) , CTGSQALLL (SEQ ID NO:167) , TDSCTGSQA (SEQ ID NO:168) , RTPYSSDNL (SEQ ID NO:169) , NLYQMTSQLE (SEQ ID NO:170) , WNQMNLGAT (SEQ ID NO:171) , WNQMNLGATLK (SEQ ID NO:173) , CMTWNQMNLGATLKG (SEQ ID NO:174) , NLGATLKGV (SEQ ID NO:175) , LGATLKGVAA (SEQ ID NO:176) , TLGVAAGS (SEQ ID NO:177) , GYESDNHTT (SEQ ID NO:178) , FMCAYPGCNK (SEQ ID NO:179) , KRPFMCAYPGC (SEQ ID NO:180) , RKFSRSDHL (SEQ ID NO:181) , LKTHTTRTHT (SEQ ID NO:182) , NMHQRNHTKL (SEQ ID NO:183) , QARMFPNAPY (SEQ ID NO:190) , ALRNPTACPL (SEQ ID NO:191) and APVLDFAPPGASAYG (SEQ ID NO:193).4. An isolated WT-1 peptide consisting ofan amino acid sequence selected from among SEQ ID NO:1-141.5. An isolated WT-1 peptide consisting of 8-30 amino acids ...

Подробнее
Номер записи: 83
16-04-2015 дата публикации

CYTOKINES AND NEUROANTIGENS FOR TREATMENT OF IMMUNE DISORDERS

Номер: US20150104414A1
Автор: Mannie Mark D.
Принадлежит:

The present invention provides methods of regulating an immunological disorder comprising administering to a subject an effective amount of (i) an autoimmune antigen in conjunction with (ii) an anti-inflammatory cytokine. Compositions including the same are also provided. 135-. (canceled)36. A composition comprising:{'sub': '4', '(a) at least one fusion protein comprising (i) an autoimmune antigen selected from the group consisting of myelin basic protein (MBP), proteolipid protein (PLP), myelin oligodendrocyte glycoprotein (MOG) and myelin-associated oligodendrocytic basic protein, or portions thereof; (ii) optionally an enterokinase linking moiety, wherein the enterokinase linking moiety is (1) an amino acid sequence of SEQ ID NO:1, (2) an amino acid sequence having at least 80% identity or homology with the amino acid sequence of SEQ ID NO:1, (3) an amino acid sequence encoded by a nucleic acid sequence encoding an enterokinase recognition site, or (4) an amino acid sequence encoded by a nucleic acid sequence that hybridizes with the complement of the nucleic acid sequence of (3) under stringent conditions as represented by hybridization conditions of 0.5M NaHPO, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C. and wash conditions of 0.1×SSC/0.1% SDS at 68° C.; and (iii) an anti-inflammatory cytokine;'}(b) an anti-inflammatory cytokine; and(c) a pharmaceutically acceptable carrier, excipient or diluent.37. The composition of claim 36 , wherein at least one of the anti-inflammatory cytokines is macrophage colony-stimulating factor (M-CSF) claim 36 , granulocyte-macrophage colony stimulating factor (GM-CSF) claim 36 , granulocyte colony stimulating factor (G-CSF) claim 36 , or IFN-β.38. The composition of claim 36 , wherein the autoimmune antigen or portion thereof is selected from the group consisting of myelin basic protein (MBP) claim 36 , proteolipid protein (PLP) claim 36 , and myelin oligodendrocyte glycoprotein (MOG) claim 36 , or portions thereof.39. ...

Подробнее
Номер записи: 84
26-03-2020 дата публикации

MESOTHELIN VACCINES AND MODEL SYSTEMS

Номер: US20200093911A1
Автор: Hruban Ralph, Hung Chien-Fu, Jaffee Elizabeth A., Wu Tzyy-Choou
Принадлежит: JOHNS HOPKINS UNIVERSITY

Mesothelin can be used as an immunotherapeutic target. It induces a cytolytic T cell response. Portions of mesothelin which induce such responses are identified. Vaccines can be either polynucleotide- or polypeptide-based. Carriers for raising a cytolytic T cell response include bacteria and viruses. A mouse model for testing vaccines and other anti-tumor therapeutics and prophylactics comprises a strongly mesothelin-expressing, transformed peritoneal cell line. 1. A method of inducing a T-cell response to a pancreatic tumor , said method comprising:{'i': 'Listeria monocytogenes', 'administering to a patient who has said tumor or who has had said tumor removed, a vaccine comprising bacteria that express mesothelin.'}2. The method of wherein mesothelin-specific CD8 T cells are induced by said vaccine.3. The method of wherein the vaccine is administered in sufficient amount to induce tumor regression.4. The method of wherein the vaccine is administered in sufficient amount to keep the patient tumor-free after removal of the tumor.5. A vaccine which induces a CD8 T cell or CD4 T cell response claim 1 , comprising:a polypeptide comprising mesothelin; and (a) a protein that is fused to the polypeptide, said protein selected from the group consisting of CD40, CD40 ligand, OX-40, OX-40 ligand, CTLA-4 antagonist, and GM-CSF; and', '(b) a bacterial cell that is transformed to express the polypeptide; and', '(c) an antigen presenting cell on whose surface the polypeptide is bound., 'a carrier for stimulating a CD8+ T cell or CD4+ T cell immune response, wherein the carrier is selected from the group consisting of6. The vaccine of wherein the carrier is CD40 or CD40 ligand.7. The vaccine of wherein the carrier is OX-40 or OX-40 ligand.8. The vaccine of wherein the carrier is a CTLA-4 antagonist.9. The vaccine of wherein the carrier is GM-CSF.10. The vaccine of which comprises a bacterial cell.11. The vaccine of wherein the carrier is an antigen presenting cell.12Listeria ...

Подробнее
Номер записи: 85
12-04-2018 дата публикации

LYMPH NODE-TARGETING NANOPARTICLES

Номер: US20180099044A1
Автор: Abraham Soman, Leong Kam, St. John Ashley, Staats Herman
Принадлежит:

Provided are nanoparticles comprising heparin, chitosan, and at least one immunomodulatory agent, e.g. a cytokine. The cytokine can be selected from the group consisting of TNF, IL-12, IL-2, IL-23, IL-1α, IL-10, IL-18, and combinations thereof. Further provided are methods of making a nanoparticle comprising mixing a first composition comprising heparin with a second composition comprising chitosan in the presence of at least one cytokine to form a third composition. Further provided are methods of modulating an immune response comprising co-administering to a subject an antigen or vaccine with nanoparticles comprising heparin, chitosan, and at least one cytokine. 137-. (canceled)3933. The method of claim , wherein the nanoparticle further comprises an antigen , wherein the antigen comprises at least one of a protein , peptide , polysaccharide , lipid , glycoprotein , glycolipid , glycoprotein , lipoprotein , lipopolysaccharide , or a combination thereof.4033. The method of claim , wherein the nanoparticle further comprises at least one immunomodulatory agent selected from the group consisting of TNF , IL-1α , IL-2 , IL-23 , IL-18 , IL-10 , and IFN.41. The method of claim 38 , wherein the antigen provoked the asthma. This application is a continuation of and claims priority to U.S. patent application Ser. No. 14/336,411, filed Jul. 21, 2014, which is a divisional of and claims priority to U.S. patent application Ser. No. 13/252,516, filed Oct. 4, 2011, which claims the benefit of U.S. Provisional Patent Application No. 61/389,457, filed Oct. 4, 2010, and are incorporated herein by reference in their entireties.This invention was made with government support under federal grant number R21 DK 077307-01 from the NIH. The U.S. Government has certain rights to this invention.The sequence listing is filed with the application in electronic format only and is incorporated by reference herein. The sequence listing text file “028193-9102-US03_As_Filed_Sequence_Listing” was ...

Подробнее
Номер записи: 86
08-04-2021 дата публикации

CATIONIC LIPID VACCINE COMPOSITIONS AND METHODS OF USE

Номер: US20210100898A1
Автор: Bedu-Addo Frank, Jacobson Eric, Johnson Kenya, KHLEIF Samir N., MKRTICHYAN Mikayel
Принадлежит:

The present disclosure provides vaccine compositions comprising at least one adjuvant and at least one therapeutic factor. The disclosure also provides methods of reducing an immune suppressor cell population in a mammal, methods of argumenting an immune response in a mammal, and methods of treating a diseases in a mammal utilizing the vaccine compositions. 1. A method of reducing an immune suppressor cell population in a mammal , said method comprising the step of administering an effective amount of a composition to the mammal , wherein the composition comprises an adjuvant and a therapeutic factor , and wherein the adjuvant is a cationic lipid.2. The method of claim 1 , wherein the immune suppressor cell is MDSC.3. The method of claim 1 , wherein the cationic lipid is selected from the group consisting of DOTAP claim 1 , DOTMA claim 1 , DOEPC claim 1 , and combinations thereof.4. The method of claim 1 , wherein the cationic lipid is DOTAP.5. The method of claim 1 , wherein the adjuvant is an enantiomer of the cationic lipid.6. The method of claim 5 , wherein the enantiomer is R-DOTAP.7. The method of claim 1 , wherein the therapeutic factor is a cytokine claim 1 , and wherein the cytokine is GM-CSF.8. The method of claim 1 , wherein the composition further comprises one or more antigens.9. The method of claim 8 , wherein at least one antigen is an HPV protein or peptide.10. The method of claim 9 , wherein the antigens comprise one or more of the gp100 sequence (KVPRNQDWL [SEQ. ID. No. 8]) and the TRP2 sequence (SYVDFFVWL [SEQ. ID. No. 9]).11. A method of augmenting an immune response in a mammal claim 9 , said method comprising the step of administering an effective amount of a vaccine composition to the mammal claim 9 , wherein the vaccine composition comprises an adjuvant and a therapeutic factor claim 9 , and wherein the adjuvant is a cationic lipid.12. The method of claim 11 , wherein the reduction results in an increase in T-cell response in the mammal.13. ...

Подробнее
Номер записи: 87
13-04-2017 дата публикации

Induction of mucosal tolerance to antigens

Номер: US20170100475A1
Автор: Pieter Rottiers, Veerle Snoeck
Принадлежит: INTREXON ACTOBIOTICS NV

The present invention relates to the induction of tolerance to antigens, by mucosal, preferably oral delivery of the antigen in combination with an immunomodulating compound producing micro-organism. More specifically, the invention relates to the induction of Foxp3 + and/or IL-10 and/or TGF-β producing regulatory T-cells, capable of suppressing undesired immune responses toward an antigen, by oral delivery of said antigen in combination with an immunosuppressing cytokine secreting micro-organism.

Подробнее
Номер записи: 88
08-04-2021 дата публикации

Mosaic Chimeric Viral Vaccine Particle

Номер: US20210101962A1
Автор: Berghman Luc, Mwangi Waithaka, Waghela Surya
Принадлежит:

The present invention describes compositions and methods for priming protective immunity in the presence of pre-existing maternal antibody. In some embodiments, the invention contemplates simultaneously masking vaccines to avoid antibody neutralization while targeting those vaccines to specific cell types in order to elicit an enhanced immune response. In other embodiments, vectors that recruit and activate specific antigen-presenting cells may further enhance the efficacy of those immune responses. 1. A modified live vaccine particle coated with a bi-specific diabody , wherein said bi-specific diabody comprises a virus-masking motif having affinity to at least one of a plurality of antigenic sites on said vaccine particle , said plurality of antigenic sites derived from two or more of the BVDV 1 or BVDV 2 proteins selected from the group consisting of N , capsid , Ems , E1 , E2 , NS2 and NS3.2. The modified live vaccine of claim 1 , wherein said at least one of said bi-specific diabody further comprises a cell surface antigen binding moiety fused in-frame with said plurality of antigenic sites.3. The modified viral vaccine of claim 2 , wherein said cell surface antigen binding moiety is a dendritic cell surface antigen binding moiety.4. The modified live vaccine particle of claim 1 , further comprising a single chain antibody having specific affinity for CD205.5. The modified live vaccine particle of claim 1 , wherein said particle is a modified live vectored vaccine.6. The modified live vaccine particle of claim 1 , wherein said bi-specific diabody comprises a CD205-BVDV 1 & 2-specific antibody conjugate.7. The modified live vaccine of claim 3 , wherein said dendritic cell surface antigen binding moiety is a bovine CD205 antigen receptor binding moiety.8. The modifed live vaccine of claim 2 , wherein said viral antigen binding moiety binds to at least one of said plurality of antigenic sites.9. The modified live vaccine of claim 1 , wherein said at least one of ...

Подробнее
Номер записи: 89
08-04-2021 дата публикации

TISSUE FACTOR PATHWAY INHIBITOR ANTIBODIES AND USES THEREOF

Номер: US20210101998A1
Автор: APGAR JAMES R., Benard Susan, Carven Gregory J., Hett Sunita R., Holsti Matthew, Jasuja Reema, Jin Macy, Juo Zong Sean, Pittman Debra, STAHL MARK
Принадлежит:

The invention relates to antibodies, and antigen-binding fragments thereof, that specifically bind TFPI and inhibit an activity thereof. Such antibodies and fragments are useful for treating bleeding disorders and shortening clotting time. 112-. (canceled)13. An isolated nucleic acid molecule comprising a nucleotide sequence encoding an antibody or antigen-binding fragment thereof that specifically binds to an epitope in Kunitz Domain 2 (K2) of Tissue Pathway Factor Inhibitor (TFPI) , wherein the antibody is selected from the group consisting of an antibody comprising:(a) a heavy chain variable region (VH) comprising a VH complementarity determining region one (CDR-H1) comprising the amino acid sequence of SEQ ID NO:38, a CDR-H2 comprising the amino acid sequence of SEQ ID NO:39, and a CDR-H3 comprising the amino acid sequence of SEQ ID NO:40, and a light chain variable region (VL) comprising a VL complementarity determining region one (CDR-L1) comprising the amino acid sequence of SEQ ID NO:33, a CDR-L2 comprising the amino acid sequence of SEQ ID NO:34, and a CDR-L3 comprising the amino acid sequence of SEQ ID NO:35;(b) a VH comprising the amino acid sequence of SEQ ID NO:63 and a VL comprising the amino acid sequence of SEQ ID NO:36;(c) a heavy chain consisting of the amino acid sequence of SEQ ID NO:64 and a light chain consisting of the amino acid sequence of SEQ ID NO:37;(d) a VH comprising the amino acid sequence of SEQ ID NO:41 and a VL comprising the amino acid sequence of SEQ ID NO: 36; and(e) a heavy chain consisting of the amino acid sequence of SEQ ID NO: 42 and a light chain consisting of the amino acid sequence of SEQ ID NO: 37.14. (canceled)15. The nucleic acid molecule of claim 13 , wherein the nucleotide sequence encodes a VH comprising a CDR-H1 comprising the amino acid sequence of SEQ ID NO:38 claim 13 , a CDR-H2 comprising the amino acid sequence of SEQ ID NO:39 claim 13 , and a CDR-H3 comprising the amino acid sequence of SEQ ID NO:40 claim 13 ...

Подробнее
Номер записи: 90
04-04-2019 дата публикации

METHODS OF USING INTERLEUKIN-10 FOR TREATING DISEASES AND DISORDERS

Номер: US20190099487A1
Автор: Chan Ivan Ho, Mumm John Brian
Принадлежит:

Methods of modulating immune responses in subjects having oncology- and immune-related diseases, disorders and conditions by the administration of an IL-10 agent, including pegylated IL-10. 1123-. (canceled)124. A genetically modified T-cell transformed with a first nucleic acid sequence encoding a chimeric antigen receptor (CAR) , wherein the CAR comprises:a) at least one antigen-specific targeting region that specifically binds a cell surface antigen present on the target cell population,b) a transmembrane domain, andc) an intracellular signaling domain,and a second nucleic acid sequence, wherein the second nucleic acid sequence comprises:a) a nucleic acid encoding a signal peptide (SP); andb) a nucleic acid encoding an IL-10 polypeptidethe nucleic acid encoding the signal peptide being in frame with the nucleic acid sequence encoding the IL-10 polypeptide;wherein said first and second nucleic acid sequences are operably linked to at least one transcriptional and translational regulatory sequence capable of directing the transcription and translation of a nucleic acid sequence in the genetically modified T-cell, such that the genetically modified T-cell expresses the CAR and the IL-10 polypeptide encoded by said first and second nucleic acid sequences respectively.125. The genetically modified T-cell of wherein the first nucleic acid sequence and the second nucleic acid sequence are provided on a single vector.126. The genetically modified T-cell of wherein the vector is a plasmid.127. The genetically modified T-cell of wherein the vector is a viral vector.128. The genetically modified T-cell of wherein the first nucleic acid sequence and the second nucleic acid sequence are each operably linked to a transcriptional and translational regulatory sequence capable of directing the transcription and translation of the operably linked nucleic acid sequence in the genetically modified T-cell.129. The genetically modified T-cell of wherein the first nucleic acid sequence ...

Подробнее
Номер записи: 91
02-06-2022 дата публикации

MULTI-VALENT IMMUNOTHERAPY COMPOSITION AND METHODS OF USE FOR TREATING WT1-POSITIVE CANCERS

Номер: US20220168408A1
Автор: Dao Tao, SARLIS NICHOLAS J., Scheinberg David A., STERGIOU ANGELOS M.
Принадлежит:

This invention provides methods of treating, reducing the incidence of, and inducing immune responses to a WT1-expressing cancer, by administering a combination of WT1 peptides including each of: YMFPNAPYL, RSDELVRHHNMHQRNMTKL, PGCNKRYFKLSHLQMHSRKHTG, SGQAYMFPNAPYLPSCLES, NLMNLGATL, WNLMNLGATLKGVAA, and WNYMNLGATLKGVAA, or cytotoxic T cells induced by the combination of WT1 peptides. The combination of WT1 peptides may be administered to the subject via a WT1 delivery agent, i.e., in peptide form, or in the form of nucleic acids encoding the WT1 peptides, or in the form of immune cells comprising nucleic acids encoding the WT1 peptides, and/or comprising or presenting the WT1 peptides. The WT1 delivery agents or CTLs can be administered to the subject in a single composition (as a heptavalent immunotherapy composition), or multiple compositions, resulting in delivery of all seven WT1 peptides and induction of an immune response against the WT1-expressing cancer. 4. The immunotherapy composition of claim 1 , wherein the nucleic acid of (b) is in claim 1 , or otherwise associated with claim 1 , a viral or non-viral vector.6. The immunotherapy composition of claim 1 , wherein the composition comprises (d) CTLs induced by the combination of at least seven isolated peptides of (a) claim 1 , and wherein the CTLs are produced in vitro claim 1 , or produced ex vivo claim 1 , or produced in vivo and obtained from a donor.7. The immunotherapy composition of claim 1 , wherein the composition comprises (e) a combination of two claim 1 , three claim 1 , or all four from among (a) claim 1 , (b) claim 1 , (c) claim 1 , and (d).8. (canceled)9. The immunotherapy composition of claim 1 , wherein the combination of peptides consists of only the seven isolated peptides.10. The immunotherapy composition of claim 1 , further comprising an antigen presenting cell claim 1 , carrier claim 1 , vehicle claim 1 , diluent claim 1 , or adjuvant.11. The immunotherapy composition of claim 10 , ...

Подробнее
Номер записи: 92
03-07-2014 дата публикации

Codon-optimized polynucleotide-based vaccines against human cytomegalovirus infection

Номер: US20140186382A1
Автор: Andrew J. Geall, Gary G. Hermanson, Mary Kopke Wloch
Принадлежит: Vical Inc

The invention is related to polynucleotide-based cytomegalovirus vaccines. In particular, the invention is plasmids operably encoding HCMV antigens, in which the naturally-occurring coding regions for the HCMV antigens have been modified for improved translation in human or other mammalian cells through codon optimization. HCMV antigens which are useful in the invention include, but are not limited to pp65, glycoprotein B (gB), IE1, and fragments, variants or derivatives of either of these antigens. In certain embodiments, sequences have been deleted, e.g., the Arg435-Lys438 putative kinase in pp65 and the membrane anchor and endocellular domains in gB. The invention is further directed to methods to induce an immune response to HCMV in a mammal, for example, a human, comprising delivering a plasmid encoding a codon-optimized HCMV antigen as described above. The invention is also directed to pharmaceutical compositions comprising plasmids encoding a codon-optimized HCMV antigen as described above, and further comprising adjuvants, excipients, or immune modulators.

Подробнее
Номер записи: 93
11-04-2019 дата публикации

CONJUGATE VACCINE TARGETING A DISEASE-CAUSING BIOLOGICAL PROTEIN

Номер: US20190105388A1
Автор: MORISHITA Ryuichi, Nakagami Hironori, TENMA Akiko
Принадлежит:

The present invention provides a vaccine containing a complex of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 and an epitope of a disease-causing biological protein such as DPP4, IL-17A, IgE, S100A9 or PCSK9, which vaccine uses a less antigenic carrier protein and is capable of inducing antibody production to serve as an effective vaccine. 1. A vaccine comprising a complex of a peptide consisting of an amino acid sequence that is the same or substantially the same as the amino acid sequence of SEQ ID NO: 1 and an epitope of a disease-causing biological protein.2. The vaccine according to claim 1 , wherein the biological protein is one kind selected from the group consisting of DPP4 claim 1 , IL-17A claim 1 , IgE claim 1 , S100A9 and PCSK9.3. The vaccine according to claim 2 , wherein the epitope of IL-17A is a peptide consisting of the amino acid sequence of any of SEQ ID NOs: 10 claim 2 , 11 and 29 to 36 claim 2 , or a peptide consisting of an amino acid sequence that is the same as the amino acid sequence of any of SEQ ID NOs: 10 claim 2 , 11 and 29 to 36 except for 1 or 2 amino acid deletions claim 2 , substitutions or additions.4. The vaccine according to claim 2 , wherein the epitope of DPP4 is a peptide consisting of the amino acid sequence of any of SEQ ID NOs: 2 to 9 claim 2 , or a peptide consisting of an amino acid sequence that is the same as the amino acid sequence of any of SEQ ID NOs: 2 to 9 except for 1 or 2 amino acid deletions claim 2 , substitutions or additions.5. The vaccine according to claim 2 , wherein the epitope of IgE is a peptide consisting of the amino acid sequence of SEQ ID NO: 12 claim 2 , or a peptide consisting of an amino acid sequence that is the same as the amino acid sequence of SEQ ID NO: 12 except for 1 or 2 amino acid deletions claim 2 , substitutions or additions.6. The vaccine according to claim 2 , wherein the epitope of S100A9 is a peptide consisting of the amino acid sequence of SEQ ID NO: 13 claim 2 , ...

Подробнее
Номер записи: 94
11-04-2019 дата публикации

Cytotoxic T Lymphocyte Inducing Immunogens For Prevention Treatment and Diagnosis of Dengue Virus Infection

Номер: US20190106462A1
Автор: Ramila Philip
Принадлежит: Emergex Vaccines Holding Ltd

Dengue Fever (DF) and Dengue Hemorrhagic Fever (DHR) are significant global public health problems and understanding the overall immune response to infection will contribute to appropriate management of the disease and its potentially severe complications. Live attenuated and subunit vaccine candidates, which are under clinical evaluation, induce primarily an antibody response to the virus and minimal cross-reactive T cell responses. Currently, there are no available tools to assess protective T cell responses during infection or post vaccination. The present invention incorporates immunoproteomics to uncover novel HLA-A2 specific epitopes derived from Dengue Virus (DV)-infected cells. These epitopes are conserved with epitope-specific CTLs cross-reacting against all four DV serotypes. These epitopes have potential as new informational and diagnostic tools to characterize T cell immunity in Dengue virus (DV) infection, and serves as a universal vaccine candidate complementary to current vaccines.

Подробнее
Номер записи: 95
09-06-2022 дата публикации

IMMUNOPOTENTIATOR, IMMUNOTHERAPEUTIC PHARMACEUTICAL COMPOSITION AND ITS PREPARATION AND USE

Номер: US20220175912A1
Автор: Wang Bin, ZHAO Gan, Zhao Weidong, ZHONG YIWEI
Принадлежит:

The present invention provides an immune enhancer comprising at least an interferon and a granulocyte-macrophage colony-stimulating factor, and an immunotherapeutic pharmaceutical composition comprising at least an antigen and the above-mentioned immune enhancers. The present invention further discloses a preparation method of the immunotherapeutic pharmaceutical composition, the use of the immune enhancer and the immunotherapeutic pharmaceutical composition. The immune enhancer can be applied to disease and tumor treatments caused by viruses, bacteria, and other microorganisms. 1. An immune enhancer comprising at least a recombinant interferon and a granulocyte-macrophage colony-stimulating factor.2. The immune enhancer of claim 1 , wherein the ratio of the content of the recombinant interferon to the content of the recombinant granulocyte-macrophage colony-stimulating factor is (about 0.1×10IU-about 5×10IU) to (about 1 μg-about 200 μg).3. The immune enhancers of claim 1 , wherein the ratio of the content of the recombinant interferon to the content of the recombinant granulocyte-macrophage colony-stimulating factor is (about 0.5×10IU-about 1×10IU) to (about 5 μg-about 50 μg).4. The immune enhancers of and claim 1 , wherein the recombinant interferon is interferon alpha.5. An immunotherapeutic pharmaceutical composition comprises at least an antigen and an immune enhancer of -.6. The immunotherapeutic pharmaceutical composition of claim 5 , wherein the recombinant interferon is interferon alpha-2a.7. The immunotherapeutic pharmaceutical composition of claim 5 , wherein the antigen comprises a recombinant protein antigen.8. The immunotherapeutic pharmaceutical composition of claim 5 , wherein the ratio of the content of the recombinant interferon to the content of the recombinant granulocyte-macrophage colony-stimulating factor is (about 0.5×10IU-about 1×10IU) to (about 5 μg-about 20 μg).9. The immunotherapeutic pharmaceutical composition of claim 5 , wherein the ...

Подробнее
Номер записи: 96
27-04-2017 дата публикации

HER2 ANTIGENIC POLYPEPTIDE COMPOSITIONS, AND METHODS FOR THEIR USE IN TREATMENT AND PREVENTION OF CARCINOMAS

Номер: US20170112909A1
Автор: GIBSON Heather, Jones Richard, REYES Joyce, WEI Wei-Zen
Принадлежит:

Antigenic polypeptides of the growth factor receptor HER2, for breaking the tolerance of a host against self HER2. The antigenic polypeptides include HER2 polypeptides with single amino acid substitutions of lysine for glutamine, arginine for glutamine, or aspartic acid for asparagine. Gene expression constructs, vaccine compositions, and immunization methods including the substituted HER2 polypeptides. Methods for immunizing mammalian subjects with heterologous unsubstituted HER2 antigenic polypeptides, including polypeptides of feline and bear HER2. A diagnostic method of determining whether a mammalian subject is sufficiently immunocompetent to respond to immunotherapies directed at breaking tolerance to self HER2. 1. Antigenic polypeptides of HER2 , for breaking tolerance to the self HER2 of an animal subject , said antigenic polypeptides including at least one point mutation in the extracellular domain of HER2.2. The antigenic peptides according to claim 1 , wherein said point mutation induces the substitution of glutamine with lysine with (Q-K) in the amino acid sequence QLRSLTEILKGGVLI (SEQ ID NO: 109) of HER2 domain I claim 1 , rendering said amino acid sequence KLRSLTEILKGGVLI (SEQ ID NO: 110).3. Isolated antigenic polypeptides for inducing immune response against HER2 in a subject of a mammalian species claim 1 , said polypeptides comprising at least the extracellular domain of the HER2 of an animal species claim 1 , said extracellular domain including an amino acid substitution of glutamine with lysine (Q-K) claim 1 , or with a conservative amino acid of lysine claim 1 , said substitution being at position 119 of mature feline HER2 claim 1 , or at a homologous position of the mature HER2 of another animal species.4. The antigenic polypeptides according to claim 3 , selected from the group consisting of mature feline HER2 having a Q-K substitution at position 119 (mfeHER2-Q119K); mature bear HER2 having a Q-K substitution at position 119 (mbearHER2-Q119K); ...

Подробнее
Номер записи: 97
17-07-2014 дата публикации

Compositions having means for targeting at least one antigen to dendritic cells

Номер: US20140199379A1
Автор: Eric Tartour, LUDGER Johannes
Принадлежит: Assistance Publique Hopitaux de Paris APHP, CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE CNRS, INSTITUT CURIE, Institut National de la Sante et de la Recherche Medicale INSERM, Universite Paris 5 Rene Descartes

A composition that can be used as a vaccine containing means for targeting at least one antigen to dendritic cells and as adjuvants a granulocyte macrophage colony stimulating factor and a CpG oligodeoxynucleotide and/or a CpG-like oligodeoxynucleotide. This composition can used to treat cancers, infectious diseases caused by bacterial, viral, fungal, parasitic or protozoan infections, allergies and/or autoimmune diseases.

Подробнее
Номер записи: 98
03-05-2018 дата публикации

Tolerogenic DNA Vaccine

Номер: US20180117133A1
Автор: Chaplin Jay, Wijaranakula Michael
Принадлежит:

The present invention relates to plasmids useful for prevention and/or delay of e.g. type 1 diabetes. 162. A vector comprising a nucleic acid sequence encoding an insulin antigen , a nucleic acid sequence encoding TGF-β and a nucleic acid sequence encoding IL-10 , wherein said vector expresses the insulin antigen , TGF- and IL-10.2. The vector according to claim 1 , wherein the vector is a multi-cistronic plasmid.3. The plasmid according to claim 2 , wherein said insulin antigen is selected from the group consisting of: proinsulin claim 2 , pre-proinsulin claim 2 , and a functional or immuno-dominant peptide fragment thereof.4. The plasmid according to claim 2 , wherein said insulin antigen is endosomally targeted insulin.5. The plasmid according to claim 2 , wherein said plasmid expresses insulin antigen and TGF-β in an amount of at least 2 fold lower than IL-10.6. The plasmid according to claim 2 , further comprising a nucleic acid sequence encoding Interleukin-2 (IL-2) and expresses IL-2.7. The plasmid according to claim 6 , wherein said plasmid comprises: (i) an FMDV 2A element separating the insulin antigen encoding sequence and the TGF-β encoding sequence claim 6 , (ii) an EMCV IRES element separating the TGF-β encoding sequence and the IL-10 encoding sequence claim 6 , and (iii) a 2A element separating the IL-10 encoding sequence and the IL-2 encoding sequence.8. The plasmid according to claim 1 , wherein the TGF-β encoding sequence encodes a constitutively active TGF-β.9. The plasmid according to claim 6 , comprising (i) an endosomally targeted pre-pro-insulin encoding sequence claim 6 , (ii) an FMDV 2A element claim 6 , (iii) a TGF-β encoding sequence claim 6 , (iv) an EMCV IRES element claim 6 , (v) an IL-10 encoding sequence claim 6 , (vi) a P 2A element claim 6 , (vii) an IL-2 encoding sequence claim 6 , (viii) a polyadenylation/termination element claim 6 , (ix) a selection gene claim 6 , (x) an origin of replication claim 6 , (xi) a eukaryotic promoter ...

Подробнее
Номер записи: 99
03-05-2018 дата публикации

Immunostimulatory Compositions, Particles, and Uses Related Thereto

Номер: US20180117145A1
Автор: Selvaraj Periasamy
Принадлежит:

In some embodiments, described herein is a method of tumor treatment or tumor vaccination. The method generally comprises applying to a human being in need thereof a tumor therapeutic composition or tumor vaccine defined herein. The tumor therapeutic composition or tumor vaccine can be produced by protein transfer of glycosyl-phosphatidylinositol (GPI)-anchored immunostimulatory or costimulatory molecules 1. A method of treating breast cancer comprises administering an effective amount of cells in combination with an anti-PD-1 antibody to a subject in need thereof , wherein the cells comprise:a B7-1 molecule anchored to a lipid membrane on the exterior of the cells;a HER-2 molecule on the exterior of the cells;andan IL-12 anchored to the lipid membrane on the exterior of the cells.2. The method of claim 1 , wherein cells are breast tumor cells.3. The method of claim 2 , wherein the breast tumor cells are irradiated.4. The method of claim 1 , wherein the anti-PD1 antibody is nivolumab.5. The method of claim 1 , wherein the cells are transfected with a vector comprising a nucleic acid encoding HER-2.6. The method of claim 5 , wherein the nucleic acid comprises SEQ ID NO: 7. This application is a continuation of U.S. application Ser. No. 14/374,729 filed Jul. 25, 2014, which is the National Stage of International Application No. PCT/US2013/024355 filed Feb. 1, 2013, which claims the benefit of U.S. Provisional Application No. 61/594,754 filed Feb. 3, 2012. The entirety of each of these applications is hereby incorporated by reference for all purposes.This invention was made with government support under Grant RO1CA138993 awarded by the National Institutes of Health. The government has certain rights in the invention.The Sequence Listing associated with this application is provided in text format in lieu of a paper copy, and is hereby incorporated by reference into the specification. The name of the text file containing the Sequence Listing is 12011USCON_ST25.txt. The ...

Подробнее
Номер записи: 100