АРГИНИНДЕИМИНАЗА, ИНКАПСУЛИРОВАННАЯ В ЭРИТРОЦИТЫ, И ИХ ПРИМЕНЕНИЕ ПРИ ЛЕЧЕНИИ РАКА И НЕДОСТАТОЧНОСТИ АРГИНАЗЫ-1

Группа изобретений относится к области медицины и фармацевтики. Первое изобретение – применение фармацевтической композиции, включающей инкапсулированную в эритроциты аргининдеиминазу, независимую от ко-фактора, и фармацевтически приемлемый носитель, для лечения недостаточности аргиназы-1. Второе изобретение – применение суспензии эритроцитов, в которые инкапсулирована кофактор-независимая аргининдеиминаза, в лечении недостаточности аргиназы-1 для снижения уровней аргинина в плазме или крови пациента, страдающего от дефицита аргиназы-1, по крайней мере на 50, 60, 70 или 80% в течение по крайней мере 6, 7, 8, 9, 10 или 11 дней после введения. Третье изобретение – способ лечения недостаточности аргиназы-1, включающий введение фармацевтической композиции, включающей аргининдеиминазу, инкапсулированную в эритроциты, и фармацевтически приемлемый носитель. Четвертое изобретение – применение эритроцитов, в которые инкапсулирована аргининдеиминаза, для получения лекарственного средства для лечения ...

БЕТА-ЛАКТАМАЗЫ С УЛУЧШЕННЫМИ СВОЙСТВАМИ ДЛЯ ЛЕЧЕНИЯ

БЕТА-ЛАКТАМАЗА, СПОСОБ ЕЕ МОДИФИКАЦИИ, ПОЛУЧЕНИЯ И ПРИМЕНЕНИЕ

... 1. Бета-лактамаза, имеющая аминокислотную последовательность, которая, по крайней мере, на 68% идентична SEQ ID NO:1, или вариант, или фрагмент указанной бета-лактамазы, обладающие бета-лактамазной активностью, имеющие гидрофильный аминокислотный остаток, любой кроме аспарагиновой кислоты (D), в положении, соответствующем положению 276, согласно классификацией Ambler.2. Способ модификации бета-лактамазы, имеющей аминокислотную последовательность, которая, по крайней мере, на 68% идентична SEQ ID NO:1, содержащий замещение аминокислоты бета-лактамазы в положении SEQ ID NO:1, соответствующем положению 276, согласно классификации Ambler, гидрофильной аминокислотой, кроме аспарагиновой кислоты (D).3. Бета-лактамаза по п.1, где бета-лактамаза имеет аминокислотную последовательность, которая, по крайней мере, на 68% идентична SEQ ID NO:1.4. Бета-лактамаза по п.1, отличающаяся тем, что гидрофильная аминокислота выбрана из группы полярных и положительно заряженных гидрофильных аминокислот, включающей ...

СПОСОБ ЛЕЧЕНИЯ РАКА У МЛЕКОПИТАЮЩЕГО, ВКЛЮЧАЯ ЧЕЛОВЕКА, С ПРИМЕНЕНИМ ДЕПЛЕЦИИ МЕТИОНИНА И АСПАРАГИНА

ПОКСВИРУСНЫЕ ОНКОЛИТИЧЕСКИЕ ВЕКТОРЫ

... 1. Поксвирус, включающий дефектный I4L и/или F4L ген и целевую нуклеиновую кислоту, включающую суицидальный ген. ! 2. Поксвирус по п.1, где указанный поксвирус дополнительно включает дефектный ген J2R. ! 3. Поксвирус по п.1 или 2, где указанный поксвирус дополнительно включает дефектный ген F2L. ! 4. Поксвирус по п.1, где указанный поксвирус принадлежит к подсемейству Chordopoxvirinae. ! 5. Поксвирус по п.4, где указанный поксвирус принадлежит к виду вируса Vaccinia. ! 6. Поксвирус по п.5, где указанный поксвирус представляет собой штамм Copenhagen вируса Vaccinia. ! 7. Поксвирус по п.5, где указанный поксвирус представляет собой штамм WR вируса Vaccinia. ! 8. Поксвирус по п.1 или 5, в котором указанный суицидальный ген кодирует белок, имеющий по крайней мере активность цитозиндезаминазы. ! 9. Поксвирус по п.8, в котором указанный суицидальный ген представляет собой FCY1, FCA1 или CodA или их аналог. ! 10. Поксвирус по п.8, в котором указанный белок, имеющий по крайней мере активность цитозиндезаминазы ...

ИСПОЛЬЗОВАНИЕ УРЕАЗЫ ДЛЯ УГНЕТЕНИЯ РОСТА РАКОВЫХ КЛЕТОК

... 1. Фармацевтическая композиция, предназначенная для использования при ингибировании роста опухолевых клеток у млекопитающего-субъекта, включающая фермент уреазу химический фрагмент, ассоциированный с ферментом уреазой и эффективно усиливающий доставку фермента к опухолевым клеткам при введении композиции субъекту, и фармацевтический носитель. 2. Композиция по п.1, в которой указанный химический фрагмент включает гидрофильный полимер, (i) конъюгированный с ферментом уреазой, (ii) выбранный из группы, состоящей из полиэтиленгликоля, поливинилпирролидона, поливинилметилового эфира, полигидроксипропилметакриламида, полигидроксипропилметакрилата, полигидроксиэтилакрилата, полиметакриламида, полидиметилакриламида, полиметилоксазолина, полиэтилоксазолина, гидроксиэтилоксазолина, полигидроксипропилоксазолина, полиаспартамида и гидрофильных производных целлюлозы, и (iii) присутствующий в количестве, позволяющем эффективно увеличить время нахождения в кровообращении или уменьшить антигенность указанной ...

Liposomale Mittel sowie Verfahren zu deren Herstellung

VERWENDUNG VON WOLINELLA SUCCINOGENES ASPARAGINASE ZUR BEHANDLUNG VON ASPARAGIN-ABHÄNGIGER KRANKHEITEN

Viral vectors

D-acid aspartic b-hydroxamate as a drug

PROCEDURE FOR THE PRODUCTION OF MICRO CAPS

USE OF SYNERGISTIC LYTI ENZYMES FROM BACTERIOPHAGES FOR THE PREVENTION AND TREATMENT OF BACTERIAL INFECTIONS

COMPOSITIONS FOR THE STIMULATION OF THE REGENERATION AND THE RE-ESTABLISHMENT OF THE NERVOUS SYSTEM BY ADJUSTMENT THE ARGINASE 1 - AND POLYAMINE SYNTHESIS

METHOD FOR THE PROTECTION OF THERAPEUTIC COMPOSITIONS OF HOST-CONCILIATORY INACTIVATING

P53-BINDENDES POLYPEPTID

D-ASPARAGINSÄURE-BETA-HYDROXAMAT FOR TREATMENT VIRALER INFECTIONS AND TUMORS.

ANTI-TUMOR COMPOSITIONS CONTAINING TAXANDERIVATE

PHARMACEUTICAL PREPARATION CONTAINING A BETA LACTAM ANTIBIOTIC A REDUCING CONNECTION, AND THEIR USE

GENE THERAPY FOR SOLID TUMORS, PAPILLOME AND WARTS

Procedure for the production of a crystalline product of L-Asparaginase and a metal, a NH4<+>-oder N2H5<+>-ion

ANTI-TUMOR COMPOSITIONS CONTAINING TAXANDERIVATE

Composition and methods for treatment of HIV infection

Gene sequence construct used for treatment of central nervous system diseases

A gene sequence construct used for the treatment of central nervous system diseases: by means of the construction of an auto-processing expression vector, tyrosine hydroxylase (TH), GTP-cyclohydrolase I (GCH1), aromatic amino acid dopa decarboxylase (AADC), and so on may be simultaneously expressed; proteins are connected by means of an auto-processing unit (APU); the use of a viral vector to introduce the construct into a target cell may ultimately result in the high-efficiency expression of tyrosine hydroxylase (TH), GTP-cyclohydrolase I (GCH1), aromatic amino acid dopa decarboxylase ( AADC), and so on having independent functions, being used in the prevention or treatment of Parkinson's disease, Alzheimer's disease and other neurodegenerative diseases.

USE OF SYNERGISTIC BACTERIOPHAGE LYTIC ENZYMES FOR PREVENTION AND TREATMENT OF BACTERIAL INFECTIONS

METHODS FOR INHIBITING VIRAL REPLICATION IN VIVO

Erythrocytes containing arginine deiminase

Powder formulation for inhalation

Polypeptide mixes with antibacterial activity

The invention relates to the field of microbiology, specifically to a combination of a source of a first enzymatic active domain and a source of a second enzymatic active domain and to a composition comprising said combination. The invention further relates to a composition comprising said combination for use as a medicament, to the use of said composition as an antimicrobial agent and to a method for controlling microbial contamination in a food-or feed product, on and/or in food-or feed processing equipment, on and/or in food-or feed containers.

Functionalized tissue matrices

Disclosed herein are tissue treatment products that have been bound to at least one chelating agent. Also disclosed are tissue treatment products that have been functionalized with at least one metal and/or at least one metal-binding protein. The tissue treatment products can have antimicrobial properties and/or factors that promote or enhance native ceil migration, proliferation, and/or revascularization after implantation into a subject. Also disclosed are methods of making and using the tissue treatment products. The tissue treatment products can be implanted into a tissue in need of repair, regeneration, healing, treatment, and/or alteration and can promote or enhance native cell migration, proliferation, and/or revascularization.

Functionalized tissue matrices

Disclosed herein are tissue treatment products that have been bound to at least one chelating agent. Also disclosed are tissue treatment products that have been functionalized with at least one metal and/or at least one metal-binding protein. The tissue treatment products can have antimicrobial properties and/or factors that promote or enhance native ceil migration, proliferation, and/or revascularization after implantation into a subject. Also disclosed are methods of making and using the tissue treatment products. The tissue treatment products can be implanted into a tissue in need of repair, regeneration, healing, treatment, and/or alteration and can promote or enhance native cell migration, proliferation, and/or revascularization.

Methods and compositions for enhancing CD4+ regulatory T cells

Tolerogenic synthetic nanocarriers to reduce or prevent anaphylaxis in response to a non-allergenic antigen

Cas variants for gene editing

Some aspects of this disclosure provide strategies, systems, reagents, methods, and kits that are useful for the targeted editing of nucleic acids, including editing a single site within the genome of a cell or subject, ...

Targeting peptides for directing adeno-associated viruses (AAVs)

Disclosed herein are peptide sequences capable of directing adeno-associated viruses (AAV) to target specific environments, for example the nervous system and the heart, in a subject. Also disclosed are AAVs having non-naturally occurring capsid proteins comprising the disclosed peptide sequences, and methods of using the AAVs to treat diseases.

Pharmaceutical compositions for treatment of diseased tissues

Pharmaceutical compositions comprising peg-asparaginase for the treatment of hivinfections

METHODS AND COMPOSITIONS FOR INHIBITING ADHESION BY MICROORGANISMS

The present invention is directed generally to compositions and methods for enzymatic reduction of adhesion by a microorganism to cells, tissues, extracellular matrix, teeth, and/or dental prostheses. The compositions of the invention include pharmaceutical compositions and oral care compositions containing an enzyme that can reduce binding of a microbe to a cell, a tissue, or a surface. Suitable enzymes include a polyphenol oxidase and an asparaginase.

ANGIOGENESIS INHIBITORS

FARBER DISEASE MARKERS AND USES THEREOF

Immune-phenotype markers for Farber disease and their uses are disclosed, as are methods of diagnosing and treating Farber disease based on these markers.

CNS TARGETING AAV VECTORS AND METHODS OF USE THEREOF

METHOD OF TREATING A MAMMAL, INCLUDING HUMAN, AGAINST CANCER USING METHIONINE AND ASPARAGINE DEPLETION

The invention is related to a new method for treating liquid and solid cancers, in a mammal, including human, wherein methioninase is administered before asparaginase. The invention also encompasses the use of a dietary methionine deprivation, possibly combined with methioninase administration, in advance of asparaginase treatment. Methioninase and asparaginase may be used in particular under free form, pegylated form or encapsulated into erythrocytes.

MICROBIOME PROTECTION FROM ORAL ANTIBIOTICS

This invention provides, in part, various compositions and methods for protecting the gastrointestinal microbiome from antibiotic disruption from orally administered antibiotics.

POLYPEPTIDE WITH ASPARAGINASE ACTIVITY, EXPRESSION CASSETTE, EXPRESSION VECTOR, HOST CELL, PHARMACEUTICAL COMPOSITION, METHODS FOR PRODUCING A POLYPEPTIDE WITH ASPARAGINASE ACTIVITY AND FOR PREVENTING OR TREATING CANCER, AND USE OF A POLYPEPTIDE

The present invention relates to polypeptides with asparaginase activity, which have an increased self-processing rate in comparison to wild-type human L-asparaginase (ASRGL1), said polypeptides having a mutation in the glycine-rich loop of ASRGL1, denominated the HGG (Histidine 8-Glycine 9-Glycine 10) loop. Polynucleotides encoding the polypeptides of the invention, expression cassettes comprising said polynucleotides, expression vectors, host cells, pharmaceutical compositions, uses of the polypeptide of the invention in manufacturing a medication for preventing or treating cancer, and methods for producing the polypeptide of the invention and for preventing or treating cancer are also described herein.

SYNERGISTIC COMBINATIONS OF AMINO ACID DEPLETION AGENT SENSITIZERS (AADAS) AND AMINO ACID DEPLETION AGENTS (AADA), AND THERAPEUTIC METHODS OF USE THEREOF

Disclosed herein are synergistically effective combinations of Amino Acid Depletion Agents (AADA) and Amino Acid Depletion Agent Sensitizers (AADAS). Also disclosed are methods of using the disclosed combinations to treat subjects with a disease treatable by amino acid depletion-induced cell death (e.g. apoptosis). For example, the disclosed combinations are useful in the treatment or the manufacture of a medicament for use in the treatment of adult and pediatric cancers, in particular, acute lymphoblastic leukemia (ALL), as well as other conditions where amino acid depletion-induced apoptosis is expected to have a therapeutically useful effect. The synergistic combinations are also effective against solid tumors and lymphomas, including gastric cancer, pancreatic cancer, NK lymphoma, DLBCL, colorectal cancer, bladder cancer, hepatic cancer and glioblastoma.

NOVEL CRISPR ENZYMES AND SYSTEMS

The present disclosure provides for systems, methods, and compositions for targeting nucleic acids. In particular, the invention provides mutated Cas13 proteins and their use in modifying target sequences as well as mutated Cas13 nucleic acid sequences and vectors encoding mutated Cas13 proteins and vector systems or CRISPR-Cas13 systems.

METHODS AND COMPOSITIONS FOR TREATING TUMORS

This disclosure provides for methods of treating tumors.

ARGININE DEIMINASE WITH REDUCED CROSS-REACTIVITY TOWARD ADI - PEG 20 ANTIBODIES FOR CANCER TREATMENT

The present invention relates generally to isolated to arginine deiminase (ADI) proteins that have reduced cross-reactivity with anti-ADI-PEG 20 antibodies as compared to ADI-PEG 20, but which can have functional characteristics comparable to or better than ADI-PEG 20, compositions comprising the ADI proteins, and related methods of treating arginine-dependent diseases or related diseases such as cancer.

SEA LICE TREATMENT

The present invention provides methods for treating or preventing a sea lice infestation on a fish in which a composition containing one or more chitinolytic enzymes is administered to the fish, and methods for killing or damaging a sea louse in which the sea louse is contacted with the composition. Compositions for use in treating or preventing a sea lice infestation are also provided, as is the use of one or more chitinolytic enzymes in the preparation of a medicament for the same.

FORMULATIONS OF 5-FLUOROCYTOSINE AND USES THEREOF

The disclosure provides an extended release formulation of 5- f luorocytosine. In another aspect, a method of treating a fungal disease is provided. The method comprises administering to a subject in need thereof a fungus-treating effective amount of a composition comprising 5-f luorocytosine. In yet another aspect, a method of treating a cancer is provided. The method comprises administering to a subject in need thereof a sufficient amount of an expression vector to induce expression of cytosine deaminase which is capable of converting 5-f luorocytosine to 5-f luorourcail in cells of the cancer and a cancer-treating effective amount of a composition comprising 5-f luorocytosine.

FORMULATIONS OF 5-FLUOROCYTOSINE AND USES THEREOF

The disclosure provides an extended release formulation of 5- fluorocytosine. In another aspect, a method of treating a fungal disease is provided. The method comprises administering to a subject in need thereof a fungus-treating effective amount of a composition comprising 5-fluorocytosine. In yet another aspect, a method of treating a cancer is provided. The method comprises administering to a subject in need thereof a sufficient amount of an expression vector to induce expression of cytosine deaminase which is capable of converting 5-fluorocytosine to 5-fluorourcail in cells of the cancer and a cancer-treating effective amount of a composition comprising 5-fluorocytosine.

CLEAVABLE LIPIDS

Disclosed herein are novel compounds, pharmaceutical compositions comprising such compounds and related methods of their use. The compounds described herein are useful, e.g., as liposomal delivery vehicles to facilitate the delivery of encapsulated polynucleotides to target cells and subsequent iransfection of said target cells, and in certain embodiments are characterized as having one or more properties that afford such compounds advantages relative to other similarly classified lipids.

ACTIVE CARBONATES OF POLYALKYLENE OXIDES FOR MODIFICATION OF POLYPEPTIDES

ANTITUMORAL COMPOSITIONS CONTAINING TAXAN DERIVATIVES

Combinaisons antitumorales constituées de taxol ou de Taxotère ou de leurs analogues associés à au moins une substance thérapeutiquement utile dans le traitement des maladies néoplastiques. ...

GENE THERAPY FOR SOLID TUMORS, PAPILLOMAS AND WARTS

The present invention provides a novel method of treating localized solid tumors and papillomas in an individual, as well as metastatic carcinomas. The method comprises delivering a suicide gene, by way of a recombinant adenoviral vector or other DNA transport system, into the tumor, papilloma or wart of an individual. Subsequently, a prodrug, such as the drug gaciclovirTM, is administered to the individual. Additionally, the present invention provides a method for treating solid tumors, papillomas, warts and metastatic carcinomas, said method comprising introducing both a suicide gene and one or more cytokine genes into the tumor, papilloma or wart of an individual, and subsequently administering a prodrug to the individual. The methods of the present invention may be used to treat several different types of cancers and papillomas, including colon carcinoma, prostate cancer, breast cancer, lung cancer, melanoma, hepatoma, brain lymphoma and head and neck cancer.

SKIN CARE METHOD AND COMPOSITION

A composition for topical application the skin for alleviation or prevention of dry flaky skin conditions, dandruff or acne comprising one or more stratum corneum trypsin-like enzymes. The composition may further comprise an additional enzyme selected from gycosidases, other proteases, lipases and mixtures thereof. Optional additional active ingredients include sunscreens, lipids, hydroxy carboxylic acids and ketocarboxylic acids.

SKIN CARE METHOD AND COMPOSITION

A composition for topical application to the skin alleviation or prevention of dry skin conditions, dandruff or acne comprising one or more stratum corneum cathepsin-D-like enzymes. The composition may further comprise an additional enzyme selected from glycosidases, other proteases, lipases and mixtures thereof. Optional additional active ingredients include sunscreens, lipids, hydroxy carboxylic acids and ketocarboxylic acids.

EXTRACELLULAR MATRIX PROTEIN ADHERENT T CELLS

... 2066208 9105037 PCTABS00004 Substantially purified mature T cells, including .alpha..beta. T cells and .gamma..delta. T cells, are capable of binding to an extracellular matrix protein, particularly to one or more of a collagen, a fibronectin, a laminin, a fibrinogen, or a proteoglycan. Also, compositions including the substantially purified ECM binding mature T cells, for use in adoptive immunotherapy in a subject. Also, methods for treating a condition in a mammal, including administering to the mammal an effective quantity of the substantially purified ECM binding mature T cells, and treatment methods using the compositions. Also, methods for increasing the proportion, in a cell population, of substantially purified ECM binding mature T cells. Also, a method for assessing the likelihood that a mixture of cells contains activated T cells capable of localizing to a site in vivo, wherein an extracellular matrix protein is present at the site, in which greater binding of T cells to an extracellular ...

Process for encapsulation of a material in a semipermeable membrane

It is known to use interfacial copolymerisation of an emulsion 1) whose disperse phase is a solution of a material and of a first monomer in a first solvent, and 2) whose dispersant is a solution of a second monomer in a hydrophobic solvent to form a membrane around the constituents of the disperse phase, where a) the first solvent is selected from water, hydrophilic solvents and mixtures thereof, b) the first monomer has low solubility in the hydrophobic solvent, and c) the second monomer has very high solubility in the hydrophobic solvent. The process gives stronger membranes if alpha ) the polymerisation is terminated by separating off the hydrophobic solvent, beta ) the capsules are re-suspended in a liquid in which i) the second monomer has very high solubility, and ii) the first monomer is less soluble than in the hydrophobic solvent, gamma ) a second portion of the second monomer is added to the suspension, delta ) the capsule membranes are reinforced by further polymerisation and ...

AGAINST TUMORE WORKING MEANS.

PROCEDURE FOR THE PRODUCTION FROM IMMOBILIZED L-ASPARAGINASEPRAEPARATEN TO THE TREATMENT OF LEUKAEMIA.

METHOD OF INTRODUCING ACTIVE SUBSTANCES IN BRAIN

THERAPEUTIC CONJUGATES WITH SULFATED DENDRIMERS FOR INTRACELLULAR TARGETING OF

PHARMACEUTICAL COMPOSITION WITH ACTIVE ACTION WITH RESPECT TO CHRONIC BACTERIAL INFECTIONS

METHODS AND COMPOSITIONS FOR MODULATING LEVEL TAU-POLYPEPTIDE

Reducing or preventing non-allergenic antigen in response to the allergic reaction of the tolerogenic synthetic nano-carrier

A pharmaceutical composition containing N-phosphonoglycine derivatives for inhibiting the growth of viruses and cancers

COSMETIC USE OF PROTEINS OF THE ACID TYPE CERAMIDASE

Composition for treatment of tumors and the immunization of organisms against tumors.

A CRYSTALLINE L-ASPARAGINASE PREPARATION

Synergistic compsn for treating, and immunising against, tumours - comprises a cell transiently expressing immunomodulator and virus which infects and kills dividing cells

Composition destinée à traiter les tumeurs d'organismes humains ou animaux et à immuniser ces organismes à l'encontre des tumeurs, ladite composition comprenant en association synergique: - des cellules, des virus, ou des bactéries exprimant de manière transitoire dans l'organisme au moins un gène leur permettant de produire in vivo un ou plusieurs immunomodulateurs, et - des virus, ou des cellules produisant des virus, lesdits virus infectant préférentiellement les cellules en division de l'organisme traité et portant dans leur génome au moins un gène dont l'expression dans les cellules en division va entraîner leur mort.

PREDICTIVE TEST OF THE NEUTRALIZATION OF ACTIVITY ASPARAGINASE

composições bifuncionais para o tratamento de câncer

Virüslerin ve kanserlerin gelişmesini önlemeye mahsus, N-fosfonoglisin türevlerini içeren bir farmasötik bileşim.

METHOD FOR TREATMENT OF CANCERS OR INFLAMMATORY DISEASES

The invention concerns a glycosylasparaginase polypeptide with L-asparaginase activity or its precursor for use in the treatment or prevention of cancers or inflammatory diseases. The invention concerns also a novel pharmaceutical composition comprising either i) the glycosylasparaginase polypeptide or its precursor, or ii) an expression vector encompassing a nucleic acid sequence encoding the glycosylasparaginase polypeptide or its precursor for use in the treatment or prevention of cancers or inflammatory diseases.

CLEAVABLE LIPIDS

Disclosed herein are novel compounds, pharmaceutical compositions comprising such compounds and related methods of their use. The compounds described herein are useful, e.g., as liposomal delivery vehicles to facilitate the delivery of encapsulated polynucleotides to target cells and subsequent iransfection of said target cells, and in certain embodiments are characterized as having one or more properties that afford such compounds advantages relative to other similarly classified lipids.

DISEASE ASSOCIATED GENES

The present invention relates to genes whose expression is correlated to diseases related to how the eye focuses light. In particular, the invention relates to methods for the treatment, diagnosing and methods of monitoring diseases disturbing emmetropia, such as myopia or hyperopia using the genes provided by the present invention. In addition, the present invention relates to methods of screening compounds for use in treatment of diseases disturbing emmetropia, such as myopia or hyperopia as well as kits and arrays for use in identifying such diseases.

CYTIDINE DEAMINASE cDNA AS A POSITIVE SELECTABLE MARKER FOR GENE TRANSFER, GENE THERAPY AND PROTEIN SYNTHESIS

The present invention relates to a DNA sequence for the human cytidine deaminase that has been engineered into an eukaryotic expression vector, thereby permitting cytidine deaminase expression in mammalian cells. Cytidine deaminase expression confers resistance to cytosine nucleoside analogs, such as cytosine arabinoside, and can be used as a positive selectable marker. The expression of cytidine deaminase in cells protects them from the toxic effects of cytosine nucleoside analogs. Such a resistance provides applications for gene therapy of malignant, immune and viral diseases. A bacterial expression vector containing the gene can be used to produce cytidine deaminase in large quantities.

Pharmaceutical composition comprising arginine deiminase for inhibiting angiogenesis

The present invention relates to a pharmaceutical composition for inhibiting angiogenesis which comprises arginine deiminase as an active ingredient, where the arginine deiminase, obtained from Mycoplasma arginini or prepared by a genetic recombination technique, may be conjugated to an activated polymer to lower its immunogenecity and increase its life time. The pharmaceutical composition of the present invention exhibits an excellent inhibitory activity against angiogenesis.

METHOD OF TREATING A MAMMAL, INCLUDING HUMAN, AGAINST CANCER USING METHIONINE AND ASPARAGINE DEPLETION

The invention is related to a new method for treating liquid and solid cancers, in a mammal, including human, wherein methioninase is administered before asparaginase. The invention also encompasses the use of a dietary methionine deprivation, possibly combined with methioninase administration, in advance of asparaginase treatment. Methioninase and asparaginase may be used in particular under free form, pegylated form or encapsulated into erythrocytes. 125-. (canceled)26. A pharmaceutical composition or kit for use in treating cancer in a mammal comprising an asparagine-reducing means and a methionine-reducing means , wherein the methionine-reducing means is administered before the asparagine-reducing means and wherein there is a delay between the administration of the methionine-reducing means and the asparagine-reducing means.27. The composition or kit of claim 26 , wherein when the methionine-reducing means comprises or consists essentially of a methioninase and/or when the asparagine-reducing means comprises or consists essentially of an asparaginase claim 26 , the methioninase and/or the asparaginase are under free form claim 26 , pegylated form or encapsulated inside erythrocytes.28. The composition or kit of claim 27 , wherein the methioninase is under free form or is pegylated and the delay between the end of the methioninase administration and the initiation of the asparaginase administration is between about 1 h and about 7 days claim 27 , between about 3 h and about 6 days claim 27 , or between about 1 day and about 5 days.29. The composition or kit of claim 27 , wherein the methioninase is encapsulated into erythrocytes and the delay between the end of methioninase administration and the initiation of the asparaginase administration is between about 1 h and about 30 days claim 27 , between about 1 day and about 20 days claim 27 , or between about 1 day and about 10 days.30. The composition or kit claim 29 , wherein the methioninase is administered once ...

Antitumor agent

An antitumor agent comprising a combination of 5-fluorocytosine and cytosinedeaminase has been developed. As to the practical administration procedure of the agent, it is preferable to carry out in such a manner that 5-fluorocytosine is first administered in any portion of the body, and cytosinedeaminase is then administered into the topically suffered portion. The administered 5-fluorocytosine is transferred into the suffered portion, and the 5-fluorocytosine is affected with the action of cytosinedeaminase to convert the former compound into 5-fluorouracil, resulting in that the necrosis of the tumor tissue is caused.

Compositions of engineered human arginases and methods for treating cancer

Compositions and methods for the treatment of cancer are described, and, more preferably, to the treatment of cancers that do not express, or are otherwise deficient in, argininosuccinate synthetase, with enzymes that deplete L-Arginine in serum. In one embodiment, the present invention contemplates an arginase protein, such as a human Arginase I protein, comprising at least one amino acid substitution and a metal cofactor, said protein comprising an increased catalytic activity when compared with a native human Arginase I.

ONCOLYTIC ADENOVIRUS ARMED WITH THERAPEUTIC GENES

The present invention involves compositions and methods for treating cancer using a mutant adenovirus comprising a polynucleotide encoding a therapeutic polypeptide that is targeted to cells with a mutant retinoblastoma pathway. The mutant adenovirus is able to kill the tumor cells without harming cells with a wild type retinoblastoma pathway.

ENGINEERED CHIMERIC PEGYLATED ADI AND METHODS OF USE

Provided are chimeric arginine deiminases, including pegylated chimeric arginine deiminases, and related compositions and methods of use thereof, including methods of treating cancer.

Histone Deacytlase 6 Modulation of Titin Protein Mediated Cardiac Tissue Stiffness and Method for Same

Compositions, methods and kits for treating active or passive titin-induced cardiac muscle stiffness by administering an HDAC6 specific inhibitor or an HDAC6 activator.

ASPARAGINASE PROTEINS

The disclosure provides, in various embodiments, polypeptides that upon administration to a mammalian subject, elicit a reduced immunogenicity in the subject, relative to a bacterial asparaginase. The disclosure also provides, in various embodiments, fusion proteins comprising one or more of the polypeptides, polynucleotides encoding the polypeptides, vectors and host cells suitable for expressing the polypeptides, methods for treating a disease (e.g., cancer) in mammalian subject (e.g., a human), and methods for reducing a level of asparagine or asparagine-containing product in a biological fluid from a mammalian subject.

CAS VARIANTS FOR GENE EDITING

Some aspects of this disclosure provide strategies, systems, reagents, methods, and kits that are useful for the targeted editing of nucleic acids, including editing a single site within the genome of a cell or subject, e.g., within the human genome. In some embodiments, fusion proteins of Cas9 and nucleic acid editing enzymes or enzyme domains, e.g., deaminase domains, are provided. In some embodiments, methods for targeted nucleic acid editing are provided. In some embodiments, reagents and kits for the generation of targeted nucleic acid editing proteins, e.g., fusion proteins of Cas9 and nucleic acid editing enzymes or domains, are provided.

COMPOSITIONS AND METHODS FOR TREATING CANCER

Antitumour compositions containing taxan derivatives

A kit to alleviate tobacco-smoking withdrawal symptoms in a patient is disclosed which comprises: (a) a therapeutically effective amount of nicotine, at least one active nicotine metabolite, a combination of nicotine and an active nicotine metabolite, or an azapirone, or a pharmaceutically acceptable salt thereof; (b) a transdermal delivery system consisting essentially of a bupropion base in a therapeutically effective amount; and (c) a packaging material surrounding (a) and (b).

КОМБИНИРОВАННЫЙ ИММУНОТЕРАПЕВТИЧЕСКИЙ ПОДХОД К ЛЕЧЕНИЮ РАКА

Группа изобретений относится к медицине, а именно к онкологии, и может быть использована для лечения рака. Для этого способ лечения рака, включающего солидную опухоль или гемобластоз у субъекта, вводят композицию, содержащую модифицированные стволовые клетки, где модифицированные стволовые клетки являются стромальными стволовыми клетками жировой ткани. При этом модифицированные стволовые клетки содержат цитотоксическую полезную нагрузку; цитотоксическая полезная нагрузка содержит литический вирус, а литический вирус представляет собой вирус осповакцины. Проводят назначение субъекту лечения, которое активирует Т-клеточный ответ внутри субъекта, где лечение включает введение блокирующего антитела против отрицательной костимулирующей молекулы или ингибитора отрицательной костимулирующей молекулы или включает введение агонистического антитела, направленного против костимулирующей молекулы. Группа изобретений относится также к комбинации для лечения рака. Использование данной группы изобретений ...

КОМПОЗИЦИЯ И ПРИМЕНЕНИЕ ИСТОЩАЮЩИХ ЗАПАСЫ АРГИНИНА СРЕДСТВ ПРИ РАКЕ, ОЖИРЕНИИ, МЕТАБОЛИЧЕСКИХ НАРУШЕНИЯХ И СВЯЗАННЫХ С НИМИ ОСЛОЖНЕНИЯХ И СОПУТСТВУЮЩИХ ЗАБОЛЕВАНИЯХ

Изобретение относится к области биотехнологии, конкретно к терапевтическому применению истощающего запасы аргинина средства, и может быть использовано в медицине для лечения по меньшей мере одного заболевания или патологического состояния, при котором истощение запасов аргинина приводит к терапевтическому эффекту. Предложено применение истощающего запасы аргинина средства, представляющего собой катаболизирующий аргинин фермент, выбранный из белка аргиназы, аргининдезиминазы или аргининдекарбоксилазы. Изобретение обеспечивает эффективное лечение ожирения, а также метаболического нарушения, выбранного из непереносимости глюкозы, гипергликемии, сахарного диабета, стеатоза печени, стеатоза почек, стеатоза поджелудочной железы, стеатоза сердца и инсулинорезистентности, и связанного с ним осложнения, которое представляет собой одно или несколько патологических состояний, выбранных из диабетической нефропатии, диабетической васкулопатии, диабетической невропатии, гиперхолестеринемии, дислипидемии ...

Слитые молекулы, происходящие от Cholix-токсина, для пероральной доставки биологически активных нагрузок

НАЦЕЛИВАЮЩИЕ ПЕПТИДЫ ДЛЯ НАПРАВЛЕННОЙ ДОСТАВКИ АДЕНОАССОЦИИРОВАННЫХ ВИРУСОВ (AAV)

АРГИНИНДЕИМИНАЗА С ПОНИЖЕННОЙ ПЕРЕКРЕСТНОЙ РЕАКТИВНОСТЬЮ К АНТИТЕЛАМ ADI-PEG 20 ДЛЯ ЛЕЧЕНИЯ РАКА

Films and particles

Described herein are compounds and processes that can be used to prepare polymer-based films, particles, gels and related compositions, and processes for delivery of agents, and other uses.

Superoxide dismutase variants and methods of use thereof

The present disclosure provides variant superoxide dismutase polypeptides, compositions comprising the polypeptides, and nucleic acids comprising nucleotide sequences encoding the polypeptides. The present disclosure provides methods of reducing oxidative damage in a cell, tissue, or organ. The present disclosure provides methods of identifying agents that increase superoxide dismutase activity.

Test for Predicting Neutralization of Asparaginase Activity

Method of in vitro measurement of the presence of factors that are able to neutralize asparaginase activity in a sample of blood, plasma, serum or derived medium that may contain asparaginase neutralizing factors, obtained from a patient, comprising mixing of said sample with asparaginase, incubation of said mixture, then measurement of the residual asparaginase activity in the mixture and determination or quantification of the presence of said neutralizing factors. Method for predicting the efficacy of a treatment with asparaginase.

CITRULLINATION OF HUMAN PEPTIDYLARGININE DEIMINASE 4 (PAD-4) REGULATES ITS FUNCTION AND IMMUNOGENICITY

The present invention provides peptidylarginine deiminase 4 (PAD-4) polypeptides comprising one or more citrullinated Arginine sites. In one embodiment, a PAD-4 polypeptide comprises a citrulline residue at the following sites: Arg-205, Arg-212, Arg-218, Arg-372, Arg-374, Arg-383, Arg-394, Arg-495, Arg-536, and Arg-544. The present invention also provides methods for detecting the presence of autoantibodies to citrullinated PAD-4. The methods of the present invention may also be used to qualify Rheumatoid Arthritis status in a subject. In other embodiments, the present invention provides methods for inducing tolerance to citrullinated PAD-4. 1. A peptidylarginine deiminase 4 (PAD-4) polypeptide comprising one or more citrullinated Arginine sites.2. The PAD-4 polypeptide of claim 1 , wherein the one or more citrullinated Arginine sites are selected from the group consisting of Arg-8 claim 1 , Arg-123 claim 1 , Arg-131 claim 1 , Arg-137 claim 1 , Arg-156 Arg-205 claim 1 , Arg-212 claim 1 , Arg-218 claim 1 , Arg-292 claim 1 , Arg-372 claim 1 , Arg-374 claim 1 , Arg-383 claim 1 , Arg-394 claim 1 , Arg-419 claim 1 , Arg-427 claim 1 , Arg-441 claim 1 , Arg-484 claim 1 , Arg-488 claim 1 , Arg-495 claim 1 , Arg-536 claim 1 , and Arg-544 claim 1 , Arg-550 claim 1 , Arg-555 claim 1 , Arg-609 claim 1 , Arg-639 claim 1 , Arg-650 claim 1 , and Arg-651.3. The PAD-4 polypeptide of claim 1 , wherein the one or more citrullinated Arginine sites are selected from the group consisting of Arg-205 claim 1 , Arg-212 claim 1 , Arg-218 claim 1 , Arg-372 claim 1 , Arg-374 claim 1 , Arg-383 claim 1 , Arg-394 claim 1 , Arg-495 claim 1 , Arg-536 claim 1 , and Arg-544.4. The PAD-4 polypeptide of claim 1 , wherein the citrullinated Arginine sites comprise Arg-205 claim 1 , Arg-212 claim 1 , Arg-218 claim 1 , Arg-372 claim 1 , Arg-374 claim 1 , Arg-383 claim 1 , Arg-394 claim 1 , Arg-495 claim 1 , Arg-536 claim 1 , and Arg-544.5. The PAD-4 polypeptide of claim 1 , wherein the citrullinated ...

NITROGENATED DERIVATIVES OF PANCRATISTATIN

The present invention concerns nitrogenated derivatives of narciclasine and pancratistatin of the following general formula (I) as well as their pharmaceutically acceptable salts. The present invention also concerns the use of these compounds in cancer therapy as well as a method for their preparation. 2. The compound according to claim 1 , wherein the mixture of isomers is a mixture of enantiomers.3. The compound of claim 1 , wherein the mixture of enantiomers is a racemate mixture.5. The method according to claim 1 , wherein Rrepresents a hydrogen atom.6. The method according to claim 1 , wherein Rrepresents a group —C(O)R′ with R′ representing an aryl group optionally substituted.7. The method according to claim 1 , wherein Rrepresents a group —C(O)R′ with R′ representing a phenyl group optionally substituted.8. The method according to claim 1 , wherein R claim 1 , R claim 1 , R claim 1 , Rand Reach represent a hydrogen atom.9. The compound according to claim 1 , wherein Rand Rrepresent claim 1 , independently of each other claim 1 , a hydrogen atom or a methyl group.11. A method of treating cancer comprising the administration to a person in need thereof of an effective amount of a pharmaceutical composition comprising at least one compound according to and at least one pharmaceutically acceptable excipient.12. The method according to claim 11 , wherein the pharmaceutical composition comprises at least one other active principle chosen from among anti-cancer agents including 6-mercaptopurine claim 11 , fludarabine claim 11 , cladribine claim 11 , pentostatin claim 11 , cytarabine claim 11 , 5-fluorouracile claim 11 , gemcitabine claim 11 , methotrexate claim 11 , raltitrexed claim 11 , irinotecan claim 11 , topotecan claim 11 , etoposide claim 11 , daunorubicin claim 11 , doxorubicin claim 11 , epirubicin claim 11 , idarubicin claim 11 , pirarubicin claim 11 , mitoxantrone claim 11 , chlormethine claim 11 , cyclophosphamide claim 11 , ifosfamide claim 11 , ...

Antibody induced cell membrane wounding

Compositions and methods for inducing cell membrane wounding, cell permeabilization and cell killing are provided. The composition comprises a polyvalent agent that binds to a highly expressed cell surface antigen present on the surface of a cell. Preferably, the cell surface antigen is associated with the cytoskeleton of the cell. A preferred polyvalent agent is an IgM, and enhanced cell wounding and killing can be provided by the addition of a crosslinking agent. At sublethal concentrations in vivo, the cell wounding antibodies permeabilize cells and dramatically enhance response to chemotherapeutic agents, even in patients refractory to the chemotherapeutic agents. 184-. (canceled)85. A method of treating a mammal suffering from a condition characterized by hyperproliferation of B cells , wherein said hyperproliferating B-cells are cancer cells , comprising administering a cell membrane-wounding VH4-34 antibody that binds to the CDIM epitope on the surface of B cells , in combination with a cytotoxic agent , wherein said cell membrane wounding VH4-34 antibody is administered at a dosage that was determined to cause membrane pores that allow the second cytotoxic agent to enter said hyperproliferating B-cells to synergistically reduce viability of said hyperproliferating B cells.86. The method of claim 85 , wherein the VH4-34 antibody is an IgM.87. The method of claim 85 , wherein the cytotoxic agent is an agent that interferes with the polymerization or depolymerization of microtubules.88. The method of claim 87 , wherein the cytotoxic agent that interferes with the polymerization or depolymerization of microtubules is a taxane claim 87 , vinca alkaloid or colchicine claim 87 , or mixtures thereof.89. The method of claim 88 , wherein the vinca alkaloid is vinblastine claim 88 , vincristine claim 88 , vindesine claim 88 , or vinorelbine claim 88 , or mixtures thereof.90. The method of claim 89 , wherein the taxane is paclitaxel claim 89 , or docetaxel claim 89 , or ...

CNS TARGETING AAV VECTORS AND METHODS OF USE THEREOF

The invention in some aspects relates to recombinant adeno-associated viruses useful for targeting transgenes to CNS tissue, and compositions comprising the same, and methods of use thereof. In some aspects, the invention provides methods and compositions for treating CNS-related disorders. 1. A method for delivering a transgene to CNS tissue in a subject , the method comprising:administering an effective amount of a rAAV by intrathecal administration, wherein the rAAV comprises (i) a capsid protein comprising a sequence as set forth in SEQ ID NO: 9 and (ii) a nucleic acid comprising a promoter operably linked with a transgene.2. The method of further comprising administering an effective amount of the rAAV by intracerebral administration.3. A method for delivering a transgene to central nervous system (CNS) tissue in a subject claim 1 , the method comprising:administering an effective amount of a rAAV by intrathecal administration and by intracerebral administration, wherein the rAAV infects cells of CNS tissue in the subject and comprises a nucleic acid comprising a promoter operably linked with a transgene.4. The method of claim 2 , wherein the intracerebral administration is an intraventricular administration.5. The method of claim 1 , wherein the intrathecal administration is in the lumbar region of the subject6. The method of claim 4 , wherein the intraventricular administration is an administration into a ventricular region of the forebrain of the subject.7. The method of claim 1 , wherein the dose of the rAAV for intrathecal administration is in a range of 10genome copies to 10genome copies.8. The method of claim 2 , wherein the dose of the rAAV for intracerebral administration is in a range of 10genome copies to 10genome copies.9. The method of claim 1 , wherein the transgene is a CNS-associated gene.10. The method of claim 9 , wherein the CNS-associated gene is neuronal apoptosis inhibitory protein (NAIP) claim 9 , nerve growth factor (NGF) claim 9 , glial ...

NOVEL MODULATORS OF TRAIL SIGNALLING

The present invention relates to an agent for use as a modulator of apoptosis-factor-associated cell death, apoptosis, cell survival, migration and/or proliferation, a method of diagnosing or monitoring apoptosis-factor-associated conditions or disorders as well as a method of identifying a modulator of apoptosis-factor-associated cell death, apoptosis, cell survival, migration and/or proliferation. Preferably, the invention relates to TRAIL-induced cell death and/or TRAIL-induced apoptosis. Preferably the agents are used to stimulate and/or enable TRAIL-induced cell death or to inhibit TRAIL-induced cell death. The preferable use of the diagnostic tools is to diagnose sensitivity or resistance to TRAIL-induced cell death or induction of sensitivity or resistance to TRAIL-induced cell death by an agent. 1. A method of modulating apoptosis-factor-associated cell death and/or apoptosis in a patient in need of such modulation , comprising administering to said patient an effective amount of an agent selected from a nucleic acid molecule as identified in Table 1 , a homologue thereof , a polypeptide encoded by said nucleic acid molecule or homologue thereof or an effector of said nucleic acid molecule or of said polypeptide.2. The method according to claim 1 , wherein the modulator of apoptosis-factor-associated cell-death modulates apoptosis-factor-induced apoptotic cell death and/or apoptosis-factor-induced non-apoptotic cell death.3. The method according to claim 1 , wherein apoptosis-factor-associated cell death and/or apoptosis is TRAIL-induced cell death claim 1 , in particular TRAIL-induced non-apoptotic cell death and/or TRAIL-induced apoptosis.4. Agent selected from a nucleic acid molecule as identified in Table 1 claim 1 , a homologue thereof claim 1 , a polypeptide encoded by said nucleic acid molecule or homologue thereof or an effector of said nucleic acid molecule or of said polypeptide for use as a modulator of apoptosis-factor-associated cell survival ...

Modified beta-lactamases and methods and uses related thereto

The present invention relates to pharmaceuticals and modified beta-lactamases. Specifically, the invention relates to novel recombinant beta-lactamases and pharmaceutical compositions comprising the beta-lactamases. Also, the present invention relates to methods for modifying a beta-lactamase, producing the beta-lactamase and treating or preventing beta-lactam antibiotic induced adverse effects. Furthermore, the present invention relates to the beta-lactamase for use as a medicament and to the use of the beta-lactamase in the manufacture of a medicament for treating or preventing beta-lactam antibiotics induced adverse effects. Still further, the invention relates to a polynucleotide and a host cell comprising the polynucleotide.

Epidermal Growth Factor Composition, A Process Therefor and Its Application

A composition for treating a wound, wherein the composition can comprise therapeutically effective amount of an epidermal growth factor and a physiologically acceptable agent, wherein the physiologically acceptable agent comprises at least one of a stabilizer, a preservative, a thickening agent, carrier/diluent, and optionally pH regulating agent and humectant. 1. A composition comprising recombinant human epidermal growth factor present in a range of about 0.001% to about 0.9% (w/w); L-lysine hydrochloric acid present in the range of about 0.2% to about 0.5% (w/w) and mannitol present in the range of about 1% to about 10% (w/w) as stabilizers; sodium methyl paraben present in the range of about 0.016% to about 0.18% (w/w) and sodium propyl paraben present in the range of about 0.01% to about 0.02% (w/w) as preservatives; poly acrylic acid present in the range of about 0.25% to about 1% (w/w) as a thickening agent; water present in the range of about 50% to about 99.5% (w/v) as a carrier; triethanol amine present in an effective amount to maintain the pH of the composition between 6.3 to 6.4 as a pH regulating agent; glycerol present in the range of about 1% to about 2.5% (w/w) as a humectant; and a therapeutic agent present in a range of about 0.005% to about 0.5% (w/w).2. The composition of claim 1 , wherein the recombinant human epidermal growth factor is in a topical formulation in the form of gel claim 1 , spray claim 1 , ointment claim 1 , cream and lotion claim 1 , in oral formulation in the form of tablet and capsule claim 1 , or in parenteral formulation in the form of injections.3. The composition of claim 1 , wherein the therapeutic agent is an antiinfective agent silver sulphadiazine present in a range of about 0.005% to about 0.5% (w/w).4. The composition of claim 1 , wherein the therapeutic agent is a recombinant antibiotic lysostaphin present in the range of about 0.01% to about 0.1% (w/w).5. The composition of claim 1 , wherein the therapeutic agent ...

COMPOSITIONS OF ENGINEERED HUMAN ARGINASES AND METHODS FOR TREATING CANCER

Compositions and methods for the treatment of cancer are described, and, more preferably, to the treatment of cancers that do not express, or are otherwise deficient in, argininosuccinate synthetase, with enzymes that deplete L-Arginine in serum. In one embodiment, the present invention contemplates an arginase protein, such as a human Arginase I protein, comprising at least one amino acid substitution and a metal cofactor, said protein comprising an increased catalytic activity when compared with a native human Arginase I. 145.-. (canceled)46. A composition comprising an isolated human Arginase I mutant and a cobalt metal cofactor , mutant having at least one amino acid substitution that is Asp181Ser , Ser230Cys , Ser230Gly , Cys303Phe , Cys303Ile , Glu256Gln , or Asp181Glu/Ser230Ala , the composition being at physiological pH.47. The composition of claim 46 , wherein the at least one amino acid substitution is Asp181Ser.48. The composition of claim 46 , wherein the at least one amino acid substitution is Ser230Cys.49. The composition of claim 46 , wherein the at least one amino acid substitution is Ser230Gly.50. The composition of claim 46 , wherein the at least one amino acid substitution is Cys303Phe.51. The composition of claim 46 , wherein the at least one amino acid substitution is Cys303Ile.52. The composition of claim 46 , wherein the at least one amino acid substitution is Gly256Gln.53. The composition of claim 46 , wherein the at least one amino acid substitution is Asp181Glu and Ser230Ala54. The composition of claim 46 , wherein the amino acid sequence lacks an N-terminal methionine.55. The composition of claim 46 , wherein the human Arginase I mutant is covalently linked to polyethylene glycol.56. The composition of claim 46 , further defined as a pharmaceutically acceptable composition comprising a pharmaceutically acceptable excipient.5745. The composition of claim claim 46 , wherein the human Arginase I mutant is covalently linked to polyethylene ...

METHODS FOR REGULATING CELL MITOSIS BY INHIBITING SERINE/THREONINE PHOSPHATASE

Disclosed herein are methods of inhibiting proliferation of a cancer cell or inducing apoptosis of a cancer cell, which does not overexpress N—CoR. Also disclosed herein are methods of inhibiting proliferation or inducing apoptosis of a cancer cell that overexpresses TCTP and methods for determining whether a compound is effective in inducing cell death. 3. The method of claim 2 , wherein the cancer cell does not overexpress N—CoR.5. The method of claim 4 , wherein the cancer cell does not overexpress N—CoR.6. The method of claim 1 , wherein the cancer is selected from adrenocortical cancer claim 1 , bladder cancer claim 1 , osteosarcoma claim 1 , cercial cancer claim 1 , esophageal claim 1 , gallbladder claim 1 , head and neck cancer claim 1 , Hodgkin lymphoma claim 1 , non-Hodgkin lymphoma claim 1 , renal cancer claim 1 , melanoma claim 1 , pancreatic cancer claim 1 , rectal cancer claim 1 , thyroid cancer and throat cancer.7. The method of claim 1 , wherein the cancer is selected from breast cancer claim 1 , lung cancer claim 1 , prostate cancer claim 1 , and head and neck cancer.8. The method of claim 1 , wherein the anti-cancer agent is selected from x-radiation claim 1 , ionizing radiation claim 1 , a DNA damaging agent claim 1 , a DNA intercalating agent claim 1 , a microtubule stabilizing agent claim 1 , a microtubule destabilizing agent claim 1 , a spindle toxin claim 1 , abarelix claim 1 , aldesleukin claim 1 , alemtuzumab claim 1 , alitertinoin claim 1 , allopurinol claim 1 , altretamine claim 1 , amifostin claim 1 , anakinra claim 1 , anastrozole claim 1 , arsenic trioxide claim 1 , asparaginase claim 1 , azacitidine claim 1 , bevacizumab claim 1 , bexarotene claim 1 , bleomycin claim 1 , bortezomib claim 1 , busulfan claim 1 , calusterone claim 1 , capecitabine claim 1 , carboplatin claim 1 , carmustine claim 1 , celecoxib claim 1 , cetuximab claim 1 , chlorambucil claim 1 , cisplatin claim 1 , cladribine claim 1 , clofarabine claim 1 , cyclophosphamide ...

FUNCTIONALIZED TISSUE MATRICES

Disclosed herein are tissue treatment products that have been bound to at least one chelating agent. Also disclosed are tissue treatment products that have been functionalized with at least one metal and/or at least one metal-binding protein. The tissue treatment products can have antimicrobial properties and/or factors that promote or enhance native cell migration, proliferation, and/or revascularization after implantation into a subject. Also disclosed are methods of making and using the tissue treatment products. The tissue treatment products can be implanted into a tissue in need of repair, regeneration, healing, treatment, and/or alteration and can promote or enhance native cell migration, proliferation, and/or revascularization. 1. A tissue treatment product comprising:a porous material comprising a natural or artificial scaffold, wherein the porous material comprises at least one of an extracellular matrix of a partially decellularized tissue, an extracellular matrix of a completely decellularized tissue, and a porous synthetic scaffold material; andat least one chelating agent that is covalently bound to the porous material; andwherein the tissue treatment product is functionalized with at least one metal that is bound to the at least one chelating agent on the tissue treatment product.2. The tissue treatment product of claim 1 , wherein the tissue treatment product comprises a porous synthetic scaffold material.3. The tissue treatment product of claim 1 , wherein the tissue treatment product comprises at least one of a hyaluronic acid derivative claim 1 , chitosan claim 1 , polycaprolactone claim 1 , polyglycolide claim 1 , polylactide claim 1 , polydioxane claim 1 , a polyether ester claim 1 , poly(lactide-co-glycolide) claim 1 , or polyhydroxyalkonate.4. The tissue treatment product of claim 1 , wherein the tissue treatment product comprises a polyurethane material.5. The tissue treatment product of claim 1 , wherein the tissue treatment product comprises ...

CBP/CATENIN ANTAGONISTS FOR ENHANCING ASYMMETRIC DIVISION OF SOMATIC STEM CELLS

Provided are: methods for treating aging or an age-related condition, symptom or disease; methods for stimulating hair growth, regrowth or pigmentation (or preventing hair loss); methods for increasing the expression of an adenosine receptor in dermal cells (in combination with hair growth); methods for treating a condition or disease of the skin or at least one symptom thereof, including cosmetic treatment (e.g., wrinkles, hyperpigmentation, redness, rosacea, dryness, cracking, loss of firmness, loss of elasticity, thinning, and loss of vibrance). The methods comprise administering a sufficient amount of a CBP/catenin (e.g., CBP/β-catenin) antagonist as disclosed, and particularly wherein administration is in an amount and manner sufficient to provide for increasing the number of asymmetric renewing divisions relative to, or at the expense of symmetric divisions in relevant somatic stem cell population. In particular aspects, the CBP/catenin (e.g., CBP/β-catenin) antagonist comprises an alkyl and/or fatty acid ester derivative thereof as disclosed herein. 1. A method for treating aging or an age-related condition , symptom or disease , comprising:identifying a mammalian subject having somatic stem cells for least one tissue compartment or type having an age-related condition, symptom or disease; andadministering to the subject a CBP/catenin antagonist in a manner and amount sufficient to provide for increasing the number of asymmetric renewing divisions relative to, or at the expense of symmetric divisions of the somatic stem cells for the at least one tissue compartment or type, wherein the age related condition, symptom or disease of the tissue compartment or type is decreased or ameliorated, wherein a method for treating aging or an age-related condition, symptom or disease is afforded.2. The method of claim 1 , wherein the somatic stem cells for the at least one tissue compartment or type comprise quiescent somatic stem cells claim 1 , and wherein administering ...

Poxviral Oncolytic Vectors

The present invention relates to a poxvirus comprising a defective F4L and/or I4L gene, to composition comprising such poxvirus and to the methods and use of such compositions and poxviruses for therapeutic purposes, and more particularly for the treatment of cancer.

Use of pegylated recombinant human arginase for treatment of leukemia

The present invention provides a method for treatment of leukemia comprising administration of arginase to a subject in need thereof. In one embodiment, the leukemia is lymphocytic or myeloid. In another embodiment, the leukemia is arsenic resistant. In a further embodiment, the arginase is pegylated recombinant human arginase. In another embodiment, the arginase can be administrated in combination with a second therapeutic agent such as Doxorubicin in the treatment of leukemia.

MATERIALS AND METHODS FOR THE PROPHYLACTIC TREATMENT OF A PRE-MALIGNANT CONDITION

Described herein are materials and methods for the prophylactic treatment of a pre-malignant condition, comprising administering a SIRT1 agonist to an individual whose genotype comprises one defective BRCA1 allele and one functional BRCA1 allele. 1. A method for prophylactically treating an individual at risk for breast cancer or ovarian cancer , comprising identifying the individual as comprising a genotype that comprises one copy of a defective BRCA1 allele and one copy of a functional BRCA1 allele , and administering a prophylactically effective amount of a SIRT1 agonist to the individual.2. The method of claim 1 , wherein the prophylactic treatment prevents or ameliorates a pre-malignant condition associated with breast cancer or ovarian cancer.3. The method of claim 1 , wherein the SIRT1 agonist is selected from the group consisting of: a small molecule agonist claim 1 , an activating antibody and an enzymatic agonist.4. The method of claim 5 , wherein the SIRT1 agonist is selected from the group consisting of: butein claim 5 , fisetin claim 5 , isonicotinamide claim 5 , piceatannol claim 5 , quercetin and resveratrol.5. A method for prophylactically treating an individual at risk for breast cancer or ovarian cancer claim 5 , comprising identifying the individual as comprising a genotype that comprises one copy of a defective BRCA1 allele and one copy of a functional BRCA1 allele claim 5 , and administering a prophylactically effective amount of a deacetylase that deacetylates Rb.6. The method of claim 5 , further comprising administering a prophylactically effective amount of a Rb phosphorylase. This application claims the benefit of U.S. provisional application No. 61/637,578, filed Apr. 24, 2012, the entire contents of each of which are herein incorporated by reference.Individuals with inherited mutations in BRCA1 have a ˜50-85% chance of developing breast and/or ovarian cancer within their lifetimes. Although BRCA1 function appears to be essential in all ...

METABOLIC THERAPY FOR OXIDATIVE STRESS IN THE BRAIN THROUGH TARGETED NEURONAL CATABOLISM OF N-ACETYL-ASPARTIC ACID

The present invention provides a novel method of treatment for treating brain disorders that manifest oxidative stress by providing targeted populations of neurons with the ability to catabolize the acetylated amino acid derivative, N-acetylaspatic acid (NAA) and further supply extraphysiological levels of ATP to neurons via the targeted expression of the NAA catabolic enzyme aspartoacylase (ASPA) in neurons and astrocytes. 1. A method of expressing aspartoacylase (ASPA) in a cell of a subject in need thereof , the method comprising administering to a cell of the subject an effective amount of an isolated nucleic acid encoding ASPA or a functional fragment thereof.2. The method of claim 1 , wherein said cell is a mammalian cell.3. The method of claim 2 , wherein the mammalian cell is a nerve cell selected from the group consisting of oligodendrocytes claim 2 , neurons claim 2 , astrocytes and any combinations thereof.4. The method of claim 1 , wherein the nucleic acid encoding ASPA comprises the nucleic acid sequence identified as SEQ ID NO: 1.5. The method of claim 1 , wherein said amino acid sequence or the functional fraction thereof comprises a sequence identified as SEQ ID NO: 2.6. The method of claim 1 , wherein the nucleic acid is administered in a delivery construct.7. The method of claim 6 , wherein the delivery construct comprises a viral vector or a non-viral vector.8. The method of wherein the viral vector contains a nucleic acid comprising a sequence identified as SEQ ID NO: 1.9. The method of claim 8 , wherein the viral vector is selected from the group consisting of an AAV1 vector claim 8 , an AAV2 vector claim 8 , an AAV3 vector claim 8 , an AAV4 vector claim 8 , an AAV5 vector claim 8 , an AAV6 vector claim 8 , an AAV7 vector claim 8 , an AAV8 vector claim 8 , an AAV9 vector claim 8 , an AAV10 vector claim 8 , an AAV 11 vector claim 8 , a retroviral vector claim 8 , an alphaviral vector; a vaccinia viral vector; an adenoviral vector claim 8 , and an ...

METHODS FOR TREATMENT OF OCULAR DISEASES

Methods and therapeutic treatments of ocular diseases are provided including applying peg-Arginase I to affected eyes. Methods are provided that simultaneously treat inflammation and neovascularization of eyes while promoting healing. Methods are provided to treat lesions or infections of an eye. 1. A method of simultaneously inhibiting inflammation and neovascularization of corneal tissue of an eye and promoting healing of the eye , comprising: applying peg-Arginase I to the eye;wherein the peg-Arginase I is applied exogenously.2. The method of claim 1 , wherein the eye has been infected with an infectious agent.3. The method of claim 2 , wherein the infectious agent is a virus.4. The method of claim 3 , wherein the peg-Arginase I inhibits replication of the virus.5. The method of claim 2 , wherein the infectious agent is a bacteria.6. The method of claim 1 , wherein the eye has been traumatized.7. The method of claim 6 , wherein the trauma is from a medical procedure.8. The method of claim 6 , wherein the trauma is from an accidental injury of the eye.9. The method of claim 1 , wherein the peg-Arginase I is part of an ophthalmic formulation.10. The method of claim 9 , wherein the ophthalmic formulation comprises peg-Arginase I and free peg molecules.11. The method of claim 10 , wherein the ophthalmic formulation further comprises pH buffers.12. The method of claim 9 , wherein the ophthalmic formulation is an eye drop.13. The method of claim 1 , wherein the eye is a mammalian eye.14. The method of claim 13 , wherein the mammalian eye is a human eye.15. A therapeutic method to treat an ocular disease claim 13 , comprising: applying peg-Arginase I to an affected eye;wherein the peg-Arginase I is part of an ophthalmic formulation.16. The therapeutic method of claim 15 , wherein the affected eye presents at least one of inflammation and neovascularization.17. The therapeutic method of claim 15 , wherein the ocular disease is caused by an infection by an infectious ...

Superoxide Dismutase Variants and Methods of Use Thereof

The present disclosure provides variant superoxide dismutase polypeptides, compositions comprising the polypeptides, and nucleic acids comprising nucleotide sequences encoding the polypeptides. The present disclosure provides methods of reducing oxidative damage in a cell, tissue, or organ. The present disclosure provides methods of identifying agents that increase superoxide dismutase activity.

MULTILAMELLAR LIPID VESICLE COMPOSITIONS INCLUDING A CONJUGATED ANAPLASTIC LYMPHOMA KINASE (ALK) VARIANT AND USES THEREOF

The invention provides compositions including stabilized multilamellar lipid vesicles having crosslinked lipid bilayers (referred to herein as interbilayer-crosslinked multilamellar vesicles or ICMV) and including an ALK variant, pharmaceutical compositions containing vesicles (e.g., ICMV) including an ALK variant, and methods of treatment using such compositions. The invention provides compositions including stabilized multilamellar lipid vesicles with crosslinked lipid bilayers (e.g., an interbilayer-crosslinked multilamellar vesicle or ICMV) containing an Anaplastic lymphoma kinase (ALK) variant as an antigen that is associated with solid tumor cancers. 1. A composition comprising:(a) a multilamellar lipid vesicle having crosslinks between lipid bilayers; and(b) an anaplastic lymphoma kinase (ALK) variant.2. The composition of claim 1 , wherein said ALK variant is conjugated to a lipid.3. The composition of or claim 1 , wherein said composition further comprises a nucleophosmin (NPM) protein or a fragment thereof.4. The composition of claim 3 , wherein said fragment of said NPM protein is an extracellular domain of said NPM protein.5. The composition of or claim 3 , wherein said NPM protein is fused to said ALK variant.6. The composition of or claim 3 , wherein said composition further comprises a tropomyosin (TMP3) protein or a fragment thereof.7. The composition of claim 6 , wherein said fragment of said TMP3 protein is an extracellular domain of said TMP3 protein.8. The composition of or claim 6 , wherein said TMP3 protein is fused to said ALK variant.9. The composition of or claim 6 , wherein said composition further comprises a 5-Aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (ATIC) protein or a fragment thereof.10. The composition of claim 9 , wherein said fragment of said ATIC protein is an extracellular domain of said ATIC protein.11. The composition of or claim 9 , wherein said ATIC protein is fused to said ALK variant. ...

COMPOSITIONS OF ENGINEERED HUMAN ARGINASES AND METHODS FOR TREATING CANCER

Compositions and methods for the treatment of cancer are described, and, more preferably, to the treatment of cancers that do not express, or are otherwise deficient in, argininosuccinate synthetase, with enzymes that deplete L-Arginine in serum. In one embodiment, the present invention contemplates an arginase protein, such as a human Arginase I protein, comprising at least one amino acid substitution and a metal cofactor, said protein comprising an increased catalytic activity when compared with a native human Arginase I. 1. A protein comprising an amino acid sequence of human Arginase I or an amino acid sequence of human Arginase II and a non-native metal cofactor , wherein the non-native metal cofactor is cobalt.2. The protein of claim 1 , wherein the amino acid sequence is further defined as Arginase I.3. The protein of claim 2 , wherein the human Arginase I comprises SEQ ID NO:1.4. The protein of claim 1 , wherein the amino acid sequence is further defined as Arginase II.5. The protein of claim 4 , wherein the Arginase II comprises SEQ ID NO:2.6. The protein of claim 1 , wherein the amino acid sequence comprises a truncated Arginase I or Arginase II sequence.7. The protein of claim 6 , wherein the amino acid sequence lacks an N-terminal methionine.8. The protein of claim 6 , wherein the amino acid sequence lacks the first 21 amino acids of the wild-type sequence.9. The protein of claim 1 , wherein the protein displays a k/Kbetween 400 mMsand 4 claim 1 ,000 mMsat pH 7.4.10. The protein of claim 9 , wherein the protein displays a k/Kbetween 400 mMsand 2 claim 9 ,500 mMsat pH 7.4.11. The protein of claim 1 , further comprising at least one amino acid substitution at the metal binding site.12. The protein of claim 11 , wherein the at least one amino acid substitution is at His101 claim 11 , Asp124 claim 11 , His126 claim 11 , Asp128 claim 11 , Asp232 claim 11 , Asp234 claim 11 , Trp122 claim 11 , Asp181 claim 11 , Ser230 claim 11 , His120 claim 11 , Asp143 claim ...

METHOD OF TREATING A MAMMAL, INCLUDING HUMAN, AGAINST CANCER USING METHIONINE AND ASPARAGINE DEPLETION

The invention is related to a new method for treating liquid and solid cancers, in a mammal, including human, wherein methioninase is administered before asparaginase. The invention also encompasses the use of a dietary methionine deprivation, possibly combined with methioninase administration, in advance of asparaginase treatment. Methioninase and asparaginase may be used in particular under free form, pegylated form or encapsulated into erythrocytes. 125-. (canceled)26. A pharmaceutical composition or kit for use in treating cancer in a mammal comprising asparaginase and methioninase for at least one sequential administration with methioninase being administered before asparaginase.27. The composition of claim 26 , wherein the methioninase and the asparaginase are under free form claim 26 , pegylated form or encapsulated inside erythrocytes.28. The composition of claim 26 , wherein the methioninase is under free form or is pegylated and the delay between the end of the methioninase administration and the initiation of the asparaginase administration is between about 1 h and about 7 days claim 26 , between about 3 h and about 6 days claim 26 , or between about 1 day and about 5 days.29. The composition of claim 26 , wherein the methioninase is encapsulated into erythrocytes and the delay between the end of methioninase administration and the initiation of the asparaginase administration is between about 1 h and about 30 days claim 26 , between about 1 day and about 20 days claim 26 , or between about 1 day and about 10 days.30. The composition claim 29 , wherein the methioninase is administered once or more in an amount of between about 100 and about 100 claim 29 ,000 IU claim 29 , between about 500 and about 50 claim 29 ,000 IU claim 29 , or between about 500 and about 5 claim 29 ,000 IU; and wherein the asparaginase is administered once or more in an amount of between about 500 and about 100 claim 29 ,000 IU claim 29 , between about 1 claim 29 ,000 and about 50 ...

STREPTOCOCCUS BACTERIOPHAGE LYSINS FOR DETECTION AND TREATMENT OF GRAM POSITIVE BACTERIA

The present invention provides methods, compositions and articles of manufacture useful for the prophylactic and therapeutic amelioration and treatment of gram-positive bacteria, including and , and related conditions. The invention provides compositions and methods incorporating and utilizing derived bacteriophage lysins, particularly PlySs2 and/or PlySs1 lytic enzymes and variants thereof, including truncations thereof. Methods for treatment of humans are provided. 143-. (canceled)44StaphylococcusStreptococcusStaphylococcusStreptococcus. A chimeric protein comprising the catalytic domain of the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:3 or variants thereof having at least 80 identity to the polypeptide of SEQ ID NO:3 and effective to kill and bacteria , said catalytic domain operably linked or covalently attached to a heterologous protein or polypeptide , wherein the chimeric protein is biologically active to kill and bacteria.45StaphylococcusStreptococcus. The chimeric protein of wherein the catalytic domain comprises SEQ ID NO:4 or variants thereof having at least 80% identity to the polypeptide of SEQ ID NO:4 and biologically active to kill and bacteria.46StaphylococcusStreptococcus. The chimeric protein of which is a chimeric lytic enzyme comprising the catalytic domain of the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:3 or variants thereof having at least 80% identity to the polypeptide of SEQ ID NO:3 and effective to kill and bacteria claim 44 , wherein said catalytic domain is operably linked to a binding domain of another lysin.47Staphylococcus. The chimeric protein of wherein the catalytic domain is operably linked to a binding domain of a -specific lysin.48Streptococcus. The chimeric protein of wherein the catalytic domain is operably linked to a binding domain of a -specific lysin.49StaphylococcusStreptococcus. The chimeric protein of wherein the chimeric protein is effective to kill or ...

Functionalized Enzyme-Powered Nanomotors

The present invention provides an enzyme-powered nanomotor, comprising a particle with a surface, an enzyme, and a heterologous molecule; characterized in that the enzyme and the heterologous molecule are discontinuously attached over the whole surface of the particle. The invention also provides the nanomotor for use in therapy, diagnosis and prognosis, in particular, for the treatment of cancer. Additionally, the invention provides the use of the nanomotor for detecting an analyte in an isolated sample.

Cleavable Lipids

Disclosed herein are novel compounds, pharmaceutical compositions comprising such compounds and related methods of their use. The compounds described herein are useful, e.g., as liposomal delivery vehicles to facilitate the delivery of encapsulated polynucleotides to target cells and subsequent iransfection of said target cells, and in certain embodiments are characterized as having one or more properties that afford such compounds advantages relative to other similarly classified lipids. 2. (canceled)3. The nanoparticle of claim 1 , wherein Ris imidazole.4. The nanoparticle of claim 1 , wherein{'sub': '1', 'Ris imidazole;'}andn is 1.5. The nanoparticle of claim 1 , wherein Ris guanidinium.6. The nanoparticle-of claim 1 , wherein{'sub': '1', 'Ris guanidinium;'}andn is 1.723.-. (canceled)2629.-. (canceled)30. The nanoparticle of claim 1 , further comprising one or more compounds selected from the group consisting of a cationic lipid claim 1 , a PEG-modified lipid claim 1 , a non-cationic lipid and a helper lipid.31. (canceled)32. The nanoparticle of claim 1 , wherein one or more of the polynucleotides comprises a chemical modification.33. The nanoparticle of claim 1 , wherein the one or more polynucleotides is selected from the group consisting of an antisense oligonucleotide claim 1 , siRNA claim 1 , miRNA claim 1 , snRNA claim 1 , snoRNA and combinations thereof.34. (canceled)35. The nanoparticle of claim 1 , wherein the one or more polynucleotides comprise DNA.36. The nanoparticle of claim 1 , wherein the one or more polynucleotides comprise RNA.37. (canceled)38. The nanoparticle of claim 36 , wherein the RNA encodes an enzyme.39. The nanoparticle of claim 38 , wherein the enzyme is selected from the group consisting of agalsidase alfa claim 38 , alpha-L-iduronidase claim 38 , iduronate-2-sulfatase claim 38 , N-acetylglucosamine-1-phosphate transferase claim 38 , N-acetylglucosaminidase claim 38 , alpha-glucosaminide acetyltransferase claim 38 , N- ...

BETA-LACTAMASE FORMULATIONS AND USES THEREOF

The present invention provides, in part, formulations comprising a beta-lactamase. Particularly, modified-release formulations comprising a beta-lactamase are provided which release a substantial amount of the beta-lactamase in the intestines. Therapeutic uses of the beta-lactamase formulations are also provided. 1. A modified-release formulation , comprising a beta-lactamase , wherein the formulation releases a substantial amount of the beta-lactamase in the GI tract.2. The modified-release formulation of claim 1 , wherein the beta-lactamase comprises an amino acid sequence having at least 95% identity with SEQ ID NO: 1.3. The formulation of any of the above claims claim 1 , wherein the beta-lactamase is substantially released in the small intestine.4. The formulation of any of the above claims claim 1 , wherein the beta-lactamase is substantially released in the large intestine.5. The formulation of any of the above claims claim 1 , wherein the formulation comprises a core particle claim 1 , a base coat over the core particle claim 1 , and wherein the base coat comprises the beta-lactamase.6. The formulation of claim 5 , wherein the core particle comprises sucrose.7. The formulation of any of the above claims claim 5 , wherein the formulation comprises a core particle claim 5 , and wherein the beta-lactamase is encapsulated within the core particle.8. The formulation of - claim 5 , wherein the formulation comprises a plurality of core particles.9. The formulation of any one of the above claims claim 5 , wherein the formulation further comprises a modified-release coating that is substantially stable in gastric fluid.10. The formulation of any one of the above claims claim 5 , wherein the formulation comprises a modified-release coating that is degraded by a microbial enzyme present in the gut flora.11. The formulation of any one of the above claims claim 5 , wherein the formulation comprises a modified-release coating having a solubility that is pH-dependent.12. ...

Antibodies to argininosuccinate synthase and related methods

Provided are antibodies, and antigen-binding fragments thereof, which specifically bind to argininosuccinate synthase, and related compositions, kits, and methods of use thereof, for instance, as companion diagnostics to identify suitable subjects for arginine deprivation or depletion therapies such as ADI-PEG 20 and other arginine deiminase (ADI) polypeptide-based therapies.

ARGINASE1 POLYPEPTIDES

The present invention relates to novel polypeptides, which are derived from Arginase 1. The invention also relates to polynucleotides encoding the polypeptides. The invention also relates to compositions comprising the polypeptides and polynucleotides. The invention also concerns uses of the polypeptides, polynucleotides, and compositions. 2. The polypeptide of claim 1 , which consists of the amino acid sequence of SEQ ID NO: 1.3. The polypeptide of or claim 1 , in which the C terminal amino acid is replaced with the corresponding amide.4. A composition comprising the polypeptide or polynucleotide of any one of to and an adjuvant.5. A composition according to claim 4 , comprising at least one pharmaceutically acceptable diluent claim 4 , carrier or preservative.6. A composition according to or wherein the adjuvant is selected from the group consisting of bacterial DNA based adjuvants claim 4 , oil/surfactant based adjuvants claim 4 , viral dsRNA based adjuvants claim 4 , imidazochinilines claim 4 , and a Montanide ISA adjuvant.7. A method of treating or preventing a disease or condition in a subject claim 4 , the method comprising administering to the subject the polypeptide or polynucleotide of any one of to or the composition of to .8. The method of wherein the disease or condition is characterized at least in part by inappropriate or excessive immune suppressive function of an Arginase claim 7 , and/or said wherein disease or condition is cancer.9. The method of or wherein the disease or condition is cancer and optionally wherein the method further comprises the simultaneous or sequential administration of an additional cancer therapy claim 7 , preferably an antibody.10. The method of any one of to wherein said cancer is breast claim 7 , lung claim 7 , colon or prostate cancer claim 7 , or is a melanoma claim 7 , or is a leukemia claim 7 , preferably acute myeloid leukemia (AML).11. A method of stimulating arginase1-specific T cells claim 7 , the method ...

SUMOYLATION OF SERCA2A AND CARDIOVASCULAR DISEASE

Methods for treating cardiovascular disease, and in particular heart failure, are provided comprising administering a therapeutically effective amount of a modulator of SERCA2a post-translation modification such as SUMOylation or acetylation. Also provided are methods of treating cardiovascular disease by inhibiting SERCA2a degradation. Further provided are methods of diagnosing a propensity to develop heart failure comprising determining if a SERCA2a mutant is present or determining the level of expression of SUMO1 in cardiomyocytes. The disclosure also provides methods of screening for therapeutics that modulate the post-translational modification of SERCA2a, such as by modulating post-translational SUMOylation and/or acetylation. 1. A method of treating cardiac dysfunction in a subject comprising administering a therapeutically effective amount of a modulator of SERCA2a post-translational modification to the subject.2. The method according to wherein the cardiac dysfunction is selected from the group consisting of heart failure claim 1 , pressure overload-induced cardiac dysfunction claim 1 , and cardiac dysfunction induced by inhibited calcium decay.3. The method according to wherein the heart failure comprises contractile dysfunction.4. The method according to wherein the heart failure is TAC-induced heart failure.5. The method according to wherein the subject is a human.6. The method according to wherein the modulator modulates SERCA2a post-translational SUMOylation.7. The method according to wherein the modulator is a vector comprising an expressible coding region encoding a protein selected from the group consisting of SERCA2a and SUMO1 claim 6 , and wherein the coding region is operably linked to at least one expression control element.8. The method according to wherein the vector is a recombinant adeno-associated virus.9. The method according to wherein the recombinant adeno-associated virus is rAAV1.10. The method according to wherein the modulator ...

Early Hyperlipidemia Promotes Endothelial Activation via a Caspase-1-Sirtuin 1 Pathway

The present invention provides compositions and methods for treating or preventing a disease or disorder associated with endothelial activation, inflammation or atherogenesis, including but not limited to cardiovascular diseases and inflammatory disorders. 1. A method for treating or preventing a disease or disorder associated with at least one of endothelial activation , inflammation and atherogenesis in a subject in need thereof comprising administering to the subject an inhibitor of caspase-1-Sirt1-AP-1 pathway.2. The method of claim 1 , wherein the inhibitor is an inhibitor of at least one of the group consisting of caspase-1 activity and caspase-1 expression.3. The method of claim 1 , wherein the inhibitor is a non-cleavable Sirt1 peptide inhibitor.4. The method of claim 3 , wherein the inhibitor is a human non-cleavable Sirt1 peptide inhibitor.5. The method of claim 3 , wherein the non-cleavable Sirt1 peptide inhibitor comprises a cell membrane permeable protein transduction sequence.7. The method of claim 2 , wherein the inhibitor is selected from the group consisting of a nucleic acid claim 2 , a siRNA claim 2 , an antisense nucleic acid claim 2 , a ribozyme claim 2 , a peptide claim 2 , a small molecule claim 2 , an antagonist claim 2 , an aptamer claim 2 , and a peptidomimetic.8. An inhibitor of caspase-1 activity comprising a non-cleavable Sirt1 peptide inhibitor.9. The inhibitor of claim 8 , wherein the inhibitor is a human non-cleavable Sirt1 peptide inhibitor.10. The inhibitor of claim 9 , wherein the non-cleavable Sirt1 peptide inhibitor comprises a cell membrane permeable protein transduction sequence. This application is the U.S. national phase application filed under 35 U.S.C. §371 claiming benefit to International Patent Application No. PCT/US 16/15964, filed Feb. 1, 2016, which is entitled to priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 62/109,918 filed Jan. 30, 2015, the contents of which are each incorporated ...

Methods and compositions for modulating tau levels

Methods and agents for reducing a level of an acetylated Tau polypeptide in a cell are provided. Methods for treating a tauopathy in an individual are also provided. Also provided is a method for diagnosing a cognitive impairment disorder in an individual. Methods for identifying an agent suitable for treating a tauopathy are also provided.

Formulations of 5-fluorocytosine and uses thereof

The disclosure provides an extended release formulation of 5-fluorocytosine. In another aspect, a method of treating a fungal disease is provided. The method comprises administering to a subject in need thereof a fungus-treating effective amount of a composition comprising 5-fluorocytosine. In yet another aspect, a method of treating a cancer is provided. The method comprises administering to a subject in need thereof a sufficient amount of an expression vector to induce expression of cytosine deaminase which is capable of converting 5-fluorocytosine to 5-fluorouracil in cells of the cancer and a cancer-treating effective amount of a composition comprising 5-fluorocytosine.

TREATMENT WITH ANTI-VEGF ANTIBODIES

This invention concerns in general treatment of diseases and pathological conditions with anti-VEGF antibodies. More specifically, the invention concerns the treatment of human patients susceptible to or diagnosed with cancer using an anti-VEGF antibody, preferably in combination with one or more additional anti-tumor therapeutic agents. 1. A method of treating cancer in a human patient , comprising administering to the patient effective amounts of an anti-VEGF antibody and an anti-neoplastic composition , wherein said anti-neoplastic composition comprises at least one chemotherapeutic agent.2. The method of claim 1 , wherein the cancer is selected from the group consisting of breast cancer claim 1 , colorectal cancer claim 1 , rectal cancer claim 1 , non-small cell lung cancer claim 1 , non-Hodgkins lymphoma (NHL) claim 1 , renal cell cancer claim 1 , prostate cancer claim 1 , liver cancer claim 1 , pancreatic cancer claim 1 , soft-tissue sarcoma claim 1 , kaposi's sarcoma claim 1 , carcinoid carcinoma claim 1 , head and neck cancer claim 1 , melanoma claim 1 , ovarian cancer claim 1 , mesothelioma claim 1 , and multiple myeloma.3. The method of claim 1 , wherein the cancer is metastatic.4. The method of claim 1 , wherein the patient is previously untreated.5. The method of claim 1 , wherein the chemotherapeutic agent is selected from the group consisting of alkylating agents claim 1 , antimetabolites claim 1 , folic acid analogs claim 1 , pyrimidine analogs claim 1 , purine analogs and related inhibitors claim 1 , vinca alkaloids claim 1 , epipodopyyllotoxins claim 1 , antibiotics claim 1 , L-Asparaginase claim 1 , topoisomerase inhibitor claim 1 , interferons claim 1 , platinum cooridnation complexes claim 1 , anthracenedione substituted urea claim 1 , methyl hydrazine derivatives claim 1 , adrenocortical suppressant claim 1 , adrenocorticosteroides claim 1 , progestins claim 1 , estrogens claim 1 , antiestrogen claim 1 , androgens claim 1 , antiandrogen claim 1 ...

BETA-LACTAMASES WITH IMPROVED PROPERTIES FOR THERAPY

This invention relates to, in part, compositions of beta-lactamases and methods of using these enzymes in, for example, gastrointestinal tract (GI tract) disorders such as infection (CDI). 173-. (canceled)74. A beta-lactamase comprising an amino acid sequence having at least 95% sequence identity with SEQ ID NO: 1 and the following mutations according to Ambler classification:an aliphatic hydrophobic residue other than alanine (A) at position 232,a polar and neutral hydrophilic residue other than alanine (A) at position 237,an aliphatic hydrophobic residue other than alanine (A) at position 238,a polar and negative hydrophilic residue other than serine (S) at position 240, anda polar and neutral hydrophilic residue other than (R) at position 244.75. The beta-lactamase of claim 74 , wherein the beta-lactamase has a further mutation of a polar and positive hydrophilic residue other than aspartate (D) at position 276 according to Ambler classification.76. The beta-lactamase of claim 74 , wherein the aliphatic hydrophobic residue is selected from glycine (G) claim 74 , leucine (L) claim 74 , isoleucine (I) claim 74 , methionine (M) claim 74 , and valine (V).77. The beta-lactamase of claim 74 , wherein the polar and neutral hydrophilic residue is selected from asparagine (N) claim 74 , glutamine (Q) claim 74 , serine (S) claim 74 , threonine (T) claim 74 , proline (P) claim 74 , and cysteine (C).78. The beta-lactamase of claim 74 , wherein the polar and negative hydrophilic residue is selected from aspartate (D) and glutamate (E).79. The beta-lactamase of claim 75 , wherein the polar and positive hydrophilic residue is selected from arginine (R) and lysine (K).80. A polynucleotide comprising a polynucleotide sequence encoding the beta-lactamase of .81. A host cell comprising the polynucleotide of .82. A pharmaceutical composition claim 74 , comprising the beta-lactamase of and a pharmaceutically acceptable carrier or excipient.83. The pharmaceutical composition of claim ...

COMPOSITIONS AND METHODS FOR TREATING INFLAMMATORY RELATED DISEASES OR CONDITIONS USING PEDIOCOCCUS ACIDILACTICI PROBIOTICS

The present invention provides a method of treating a disease or condition characterized by inflammation in a subject in need thereof, comprising administering to the subject an effective amount of a probiotic. Compositions of probiotic are also provided. 1Pediococcus acidilactici. A method of treating a disease or condition characterized by inflammation in a subject in need thereof , comprising administering to the subject an effective amount of a probiotic.2. The method of claim 1 , wherein the disease or condition selected from the group consisting of malignancy (cancer) claim 1 , arthritis claim 1 , cardiovascular disease claim 1 , hepatitis claim 1 , infection claim 1 , wound healing claim 1 , pancreatitis claim 1 , gastroesophageal reflux disease claim 1 , diabetes claim 1 , inflammatory bowel disease claim 1 , peptic ulcer disease claim 1 , bronchitis claim 1 , cholecystitis claim 1 , appendicitis claim 1 , bursitis claim 1 , dermatitis claim 1 , asthma claim 1 , autoimmune disease claim 1 , pelvic inflammatory disease claim 1 , gout claim 1 , trauma claim 1 , foreign body infection claim 1 , burns claim 1 , dental work claim 1 , tendonitis claim 1 , rhinitis claim 1 , mucositis claim 1 , and exposure to toxins such as chemicals and alcohol.3Pediococcus acidilactici. The method of claim 1 , wherein the probiotic is strain NRRL B-50517.4. The method of claim 1 , wherein the subject is a human.5. The method of claim 1 , wherein the subject is administered greater than 1.0×10cfu of the probiotic.6. The method of claim 1 , wherein the subject is administered greater than 4.0×10cfu of the probiotic.7. The method of claim 1 , wherein the subject is administered one or more additional therapeutic agents.8. The method of claim 1 , wherein the subject is not administered another therapeutic agent.9Pediococcus acidilactici. The method of claim 1 , wherein the probiotic increases the number of anti-inflammatory M2 macrophage cells in the subject.10. The method of claim ...

CERAMIDE LEVELS IN THE TREATMENT AND PREVENTION OF INFECTIONS

The present invention relates to a method for treating or preventing pathogenic infections in a subject having Cystic Fibrosis, COPD, and/or an open wound. This method involves selecting a subject having Cystic Fibrosis, COPD, and/or an open wound and administering to the selected subject a ceramidase under conditions effective to reduce ceramide and to treat or prevent the pathogenic infection. The method also involves the use of a ceramidase in combination with other drugs to reduce infection, reduce ceramide, or improve lung function in Cystic Fibrosis, COPD, and/or open wound patients. 1. A method for treating or preventing pathogenic infections in a subject having Cystic Fibrosis , COPD , and/or an open wound , said method comprising:selecting a subject having Cystic Fibrosis, COPD, and/or an open wound andadministering to said selected subject a ceramidase under conditions effective reduce ceramide and to treat or prevent said pathogenic infection in said selected subject.2. The method of claim 1 , wherein the subject is selected based on elevated ceramide levels compared to a reference level for a subject not having said Cystic Fibrosis claim 1 , COPD claim 1 , and/or an open wound.3. The method of claim 1 , wherein said selecting is based on ceramide level in lung epithelium claim 1 , nasal epithelium claim 1 , mucus claim 1 , and/or cells isolated from an open wound site.4. The method of claim 1 , wherein said administering is carried out under conditions effective to normalize ceramide levels in the subjects' respiratory epithelia claim 1 , mucus claim 1 , or cells at an open wound site.5. The method of claim 1 , wherein said ceramidase is acid ceramidase.6. The method of claim 1 , wherein one or more additional agents that reduce ceramide levels are administered in combination with said ceramidase.7. The method of claim 6 , wherein said one or more additional agents are selected from the group consisting of one or more additional ceramide reducing agents ...

Compositions and methods for treating or ameliorating fibrosis, systemic sclerosis and scleroderma

Provided are Adenosine Deaminase (ADA), or a polypeptides or peptides having an ADA activity, or an ADA conjugate, pharmaceutical compositions and formulations, products of manufacture and kits, and methods containing them for the prevention and treatment of a scleroderma-associated vasculopathy, in particular proliferative obliterative vasculopathy, progressive obliterative vasculopathy or an idiopathic obliterative vasculopathy and/or preventing or decreasing the progression of scleroderma, wherein optionally the scleroderma comprises a local scleroderma or a diffuse, or a systemic scleroderma.

BETA-LACTAMASES WITH IMPROVED PROPERTIES FOR THERAPY

This invention relates to, in part, compositions of beta-lactamases and methods of using these enzymes in, for example, gastrointestinal tract (GI tract) disorders such as infection (CDI). 173-. (canceled)74. A beta-lactamase comprising an amino acid sequence having at least 95% sequence identity with SEQ ID NO: 1 and having a polar and neutral hydrophilic residue other than alanine (A) at position 238 according to Ambler classification.75. The beta-lactamase of claim 74 , further comprising a polar and positively charged hydrophilic residue other than glycine (G) at position 156 according to Ambler classification.76. The beta-lactamase of claim 74 , further comprising a polar and neutral hydrophilic residue other than aspartate (D) at position 276 according to Ambler classification.77. The beta-lactamase of claim 76 , further comprising an aromatic hydrophobic residue other than phenylalanine (F) at position 33 according to Ambler classification.78. The beta-lactamase of claim 74 , wherein the polar and neutral hydrophilic residue is selected from asparagine (N) claim 74 , glutamine (Q) claim 74 , serine (S) claim 74 , threonine (T) claim 74 , proline (P) claim 74 , and cysteine (C).79. The beta-lactamase of claim 75 , wherein the polar and positively charged hydrophilic residue is selected from arginine (R) claim 75 , and lysine (K).80. The beta-lactamase of claim 76 , wherein the polar and neutral hydrophilic residue is selected from asparagine (N) claim 76 , glutamine (Q) claim 76 , serine (S) claim 76 , threonine (T) claim 76 , proline (P) claim 76 , and cysteine (C).81. The beta-lactamase of claim 77 , wherein the aromatic hydrophobic residue is selected from tryptophan (W) claim 77 , and tyrosine (Y).82. The beta-lactamase of claim 74 , wherein the beta-lactamase hydrolyzes one or more of penicillins and cephalosporins.83. The beta-lactamase of claim 82 , wherein the penicillin is ampicillin.84. The beta-lactamase of claim 82 , wherein the cephalosporin is ...

DIAGNOSING AND TREATING ALZHEIMERS DISEASE

Described herein are methods, systems and compositions for the diagnosis, prognosis and treatment of dementia and Alzheimer's disease. Also described are methods, systems and compositions to distinguish between Alzheimer's disease and Parkinson's disease. In various embodiments levels of PACAP and/or SIRT3 are analyzed for the diagnosis, prognosis and treatment of dementia and Alzheimer's disease. 1. A method of detecting PACAP protein expression in a human subject suspected of having late onset Alzheimer's disease (LOAD) , the method comprising the steps of:(a) obtaining or having obtained a sample from the human subject suspected of having LOAD, wherein the sample comprises at least one of a brain tissue or cerebrospinal fluid; and(b) detecting, using an antibody-based assay, an expression level of PACAP protein in the sample.2. The method of claim 1 , wherein the expression level of PACAP protein in the sample is detected using at least one of ELISA claim 1 , Western blot claim 1 , and flow cytometry.3. The method of and further comprising comparing the detected expression level of PACAP protein in the subject's sample to a reference level of PACAP protein.4. The method of and further comprising administering a composition comprising PACAP to the subject if the subject's expression level of PACAP is below that of the reference level of PACAP protein.5. A method of monitoring PACAP protein expression in a human subject suspected of having late onset Alzheimer's disease (LOAD) claim 1 , the method comprising the steps of:(a) obtaining or having obtained a first sample from the human subject suspected of having LOAD, wherein the sample comprises at least one of a brain tissue or cerebrospinal fluid;(b) detecting, using an antibody-based assay, an expression level of PACAP protein in the first sample;(c) obtaining or having obtained a second sample from the human subject suspected of having LOAD, wherein the sample comprises at least one of a brain tissue or ...

RNA PREPARATIONS COMPRISING PURIFIED MODIFIED RNA FOR REPROGRAMMING CELLS

The present invention provides compositions and methods for reprogramming somatic cells using purified RNA preparations comprising single-strand mRNA encoding an iPS cell induction factor. The purified RNA preparations are preferably substantially free of RNA contaminant molecules that: i) would activate an immune response in the somatic cells, ii) would decrease expression of the single-stranded mRNA in the somatic cells, and/or iii) active RNA sensors in the somatic cells. In certain embodiments, the purified RNA preparations are substantially free of partial mRNAs, double-stranded RNAs, un-capped RNA molecules, and/or single-stranded run-on mRNAs. 118-. (canceled)19. A method for reducing the immunogenicity for mammalian cells of a preparation of in vitro-synthesized RNA molecules comprising:purifying a preparation of in vitro-synthesized RNA molecules obtained by a process comprising in vitro transcription (IVT),{'sup': 1', '5', '5', '2, 'wherein said in vitro-synthesized RNA molecules encode at least one recombinant protein and comprise at least one modified nucleoside selected from ψ, mψ, mU, moU, and sU in place of U,'}wherein said purifying uses a purification process that removes RNA contaminant molecules comprises dsRNA molecules that are toxic to mammalian cells by inducing an innate immune response, and wherein said purifying generates a purified RNA preparation that exhibits reduced immunogenicity,wherein said reduced immunogenicity is detectable using an in vitro MDDC immunogenicity assay by measuring secretion of less IFN-α or TNF-α cytokine secreted by human or murine monocyte-derived dendritic cells (MDDCs) transfected with said purified RNA preparation than is secreted from MDDCs transfected with said preparation of in vitro-synthesized RNA molecules that have not been subjected to said purifying.20. The method of claim 19 , wherein said process comprises replacing at least a portion of the UTP in the IVT reaction mixture by the corresponding ...

Methods for treatment of inflammatory and infectious diseases

Methods and therapeutic treatments of diseases such as viral infections are provided including applying peg-Arginase I. Methods are provided that treat inflammation mediated diseases with peg-Arginase I.

Erythrocytes containing arginine deiminase

Use of erythrocytes containing arginine deirainase for the preparation of a medicinal product for lowering the plasma concentration of arginine in vivo. The use relates in particular to the treatment of arginine-dependent tumors, such as hepatocarcinoma and malignant melanoma, or inhibition of the synthesis of nitric oxide, and the prevention and/or treatment of septic shock.

CHOLIX TOXIN-DERIVED FUSION MOLECULES FOR ORAL DELIVERY OF BIOLOGICALLY ACTIVE CARGO

The present disclosure relates to pharmaceutical compositions comprising a non-naturally occurring fusion molecule and one or more pharmaceutically acceptable carriers, formulated for oral delivery to a subject, and designed to provide for improved, effective therapies for treatment of, e.g., inflammatory diseases, autoimmune diseases, cancer, metabolic disorders, and growth deficiency disorders. The present disclosure relates to a non-toxic mutant form of the Cholix gene (ntCholix), a variant of Cholix truncated at amino acid A(Cholix) and the use of other various Cholix-derived polypeptide sequences to enhance intestinal delivery of biologically-active therapeutics. The systems and methods described herein provide for: the ability to deliver macromolecule doses without injections; the ability to deliver cargo such as siRNA or antisense molecules into intracellular compartments where their activity is required; and the delivery of nanoparticles and dendrimer-based carriers across biological membranes. 116.-. (canceled)17. A method for delivering a therapeutic cargo across an epithelium of a subject , the method comprising:orally administering to the subject a pharmaceutical composition comprising a non-toxic Cholix toxin coupled to the therapeutic cargo; anddelivering the therapeutic cargo across the epithelium of the subject.18. The method of comprising delivering the therapeutic cargo via transcytosis through a polarized gut epithelial cell.19. The method of comprising transporting the therapeutic cargo preferentially across a polarized epithelial cell versus a cell comprising a CD91 cell receptor.20. The method of comprising delivering the therapeutic cargo via binding a cell receptor not bound by a non-toxic ExoA.21. The method of claim 17 , wherein the non-toxic Cholix toxin lacks a domain III or lacks a functional domain III.22. The method of claim 17 , wherein the non-toxic Cholix toxin is truncated.23. The method of claim 17 , wherein the non-toxic Cholix ...

RNA Containing Modified Nucleosides and Methods of Use Thereof

This invention provides RNA, oligoribonucleotide, and polyribonucleotide molecules comprising pseudouridine or a modified nucleoside, gene therapy vectors comprising same, methods of synthesizing same, and methods for gene replacement, gene therapy, gene transcription silencing, and the delivery of therapeutic proteins to tissue in vivo, comprising the molecules. The present invention also provides methods of reducing the immunogenicity of RNA, oligoribonucleotide, and polyribonucleotide molecules. 115-. (canceled)16. A method for reducing the immunogenicity of in vitro-synthesized RNA comprising an open reading frame that encodes a recombinant protein of interest , the method comprising: replacing at least a portion of uridine nucleotides of in vitro-synthesized RNA with a nucleotide comprising the modified nucleoside 5-methoxyuridine (moU) , thereby generating in vitro-synthesized RNA comprising moU in place of at least a portion of uridine nucleotides and reducing the immunogenicity of said in vitro-synthesized RNA compared with the in vitro-synthesized RNA that does not comprise moU in place of uridine.17. The method of claim 16 , wherein the reduced immunogenicity is detected by at least one method selected from the group consisting of:{'sup': 5', '5, '(i) detecting a decrease in immunogenicity such that the in vitro-synthesized RNA comprising moU in place of uridine can be repeatedly administered without eliciting an immune response sufficient to detectably reduce expression of said recombinant protein of interest, whereas repeatedly administering the same quantity of in vitro-synthesized RNA that does not comprise moU in place of uridine does detectably reduce expression of said recombinant protein of interest;'}(ii) measuring less secretion of at least one cytokine in response to administration of{'sup': 5', '5, 'in vitro-synthesized RNA comprising moU in place of uridine compared to the amount of said cytokine secreted in response to administration of the ...

COMPOSITIONS AND METHODS FOR NEUROPROTECTION UTILIZING NANOPARTICULATE SILVER

A preparation of silver nanoparticles has been found to be effective in improving functional and behavioral recovery from traumatic spinal cord injury. The silver nanoparticles are provided in a non-flowable gel vehicle, from which they are release at high efficiency, that is applied locally at the site of the spinal cord injury. Silver nanoparticle formulations described herein were found to modify the M1/M2 macrophage phenotype ratio and provides a synergistic effect in the combination with arginase to promote healing processes at the treated injury site, reducing postinjury inflammation. 187-. (canceled)88. A method of providing a treatment of a neuronal tissue , comprising:providing a silver nanoparticle preparation comprising silver nanoparticles; andapplying the silver nanoparticle preparation to a site in need of treatment.89. The method of claim 88 , wherein the treatment comprises treatment of a neuronal injury following damage to the neuronal tissue.90. The method of claim 88 , wherein the treatment comprises providing neuroprotection prior to damage to the neuronal tissue.91. The method of claim 88 , wherein the site in need of treatment is selected from the group consisting of a site of an acute spinal cord injury claim 88 , a site of a head injury claim 88 , a site of injury to a nerve claim 88 , and a site of stroke.92. The method of claim 88 , further comprising the step of administering a complementary therapeutic selected from the group consisting of arginase claim 88 , a corticosteroid claim 88 , an antibody claim 88 , and a cytokine.93. A method of modulating an M1/M2 macrophage balance claim 88 , comprising:providing a silver nanoparticle preparation comprising silver nanoparticles; andapplying the silver nanoparticle preparation to a site in need of a treatment providing protection from inflammation, wherein silver nanoparticles are provided in an amount effective to modulate M1/M2 macrophage balance.94. The method of claim 93 , wherein the ...

Binding Proteins To The Constant Region Of Immunoglobulin G

The present invention provides polypeptides that bind to immunoglobulin G and methods for their use. 1. A polypeptide comprising an amino acid sequence of general formula 1 Z1-Z2-Z3 (SEQ ID NO: 1) , wherein X1 is any four amino acids; and', 'X2 is any nine amino acids;, 'Z1 is a peptide with an amino acid sequence according to general formula 2: X1-S-X2 (SEQ ID NO: 2), wherein'}Z2 is a peptide of between 17 and 50 amino acid residues; and B1 is any four amino acids;', 'B2 is any two amino acids; and', 'B3 is any four amino acids., 'Z3 is a peptide with an amino acid amino acid sequence according to general formula 3: B1-Q-B2-F-Y-B3 (SEQ ID NO: 3)'}2. (canceled)3. The polypeptide of claim 1 , wherein X2 is a peptide of general formula 4: R-J1-V-J2 (SEQ ID NO: 4) claim 1 , whereinJ1 is any two amino acids; andJ2 is any five amino acids.4. The polypeptide of claim 1 , wherein X1 is EY(A/C)V (SEQ ID NO: 10).5. The polypeptide of claim 1 , wherein X2 is RTA(X3)D(A/F)(L/R/K)(K/L)H (SEQ ID NO: 5);wherein X3 is any amino acid.67.-. (canceled)9. (canceled)10. The polypeptide of claim 1 , wherein B1 is (T/S/R/M/P/W/V/T)(M/F)(E/M/K/L/V)(Q) (SEQ ID NO: 6).11. (canceled)12. The polypeptide of claim 1 , wherein B2 is (S/A)(F/L/M/I).1314.-. (canceled)15. The polypeptide of wherein B3 is M(B4)(L/W)(R/K) (SEQ ID NO: 7) claim 1 , wherein B4 is any amino acid.1619.-. (canceled)21. The polypeptide of claim 1 , wherein Z2 is a peptide of between 17 and 32 amino acids.2325.-. (canceled)26. The polypeptide of claim 1 , wherein the polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO:88-119.27. The polypeptide of claim 1 , wherein the polypeptides comprises an amino acid sequence of general formula 5 claim 1 , Z4-Z1-Z2-Z3 (SEQ ID NO: 8) claim 1 , wherein Z4 is a peptide of at least between 100-200 amino acids in length.28. The polypeptide of claim 27 , wherein Z4 comprises an amino acid sequence of SEQ ID NO:120.2930.-. (canceled)31. The polypeptide ...

THERAPEUTIC ACID CERAMIDASE COMPOSITIONS AND METHODS OF MAKING AND USING THEM

The present invention relates to a therapeutic composition including a ceramidase mixture and a pharmaceutically acceptable carrier, where the ceramidase mixture includes an inactive acid ceramidase precursor and an active acid ceramidase. The invention also relates to a method of acid ceramidase treatment, including formulating the acid ceramidase used in said treatment as a ceramidase mixture, where the ceramidase mixture includes an inactive acid ceramidase precursor and an active acid ceramidase. The invention further relates to a method of producing a therapeutic composition including providing a medium containing an inactive acid ceramidase precursor; incubating the medium under conditions effective to transform a portion of the inactive acid ceramidase precursor to active acid ceramidase; and recovering the incubated medium as a ceramidase mixture comprising the inactive acid ceramidase precursor and an active acid ceramidase. The present invention also relates to preparation of a therapeutic composition of a ceramidase lacking acid sphingomyelinase. 1. A method of producing a therapeutic composition , the method comprising:providing a medium containing an inactive acid ceramidase precursor;incubating the medium under conditions effective to transform a portion of the inactive acid ceramidase precursor to active acid ceramidase; andrecovering the incubated medium as a ceramidase mixture comprising the inactive acid ceramidase precursor and an active acid ceramidase.2. The method of claim 1 , wherein said incubating is carried out under conditions effective to reduce the transformation rate of inactive acid ceramidase precursor to active acid ceramidase compared to the transformation rate achieved when said incubating is carried out at a pH of 4 and a temperature of 4° C. or 37° C. claim 1 , for 24 hours claim 1 , under otherwise consistent conditions.3. The method of claim 2 , wherein the pH of the ceramidase mixture during said incubating is over 4.0 and up ...

Novel Polypeptides Having Endolysin Activity and Uses Thereof

The present invention provides isolated polypeptides comprising a fragment of the amino acid sequence of SEQ ID NO:1, or a variant, derivative or fusion thereof, which is capable of binding specifically to and lysing cells of , wherein the polypeptide exhibits greater lytic activity on cells of than the polypeptide of SEQ ID NO:1. The invention further provides means for producing the same, methods for killing bacterial cells such as cells of , as well as methods for diagnosing, treating and preventing diseases and conditions associated with infection of the same. 1100-. (canceled)101Clostridium difficile. An isolated polypeptide comprising or consisting of an amino acid sequence with at least 95% identity to the amino acid sequence of SEQ ID NO:2 , wherein the polypeptide exhibits greater lytic activity on cells of than the polypeptide of SEQ ID NO:1.102. The isolated polypeptide of claim 101 , wherein the polypeptide consists of amino acids 1 to 179 of SEQ ID NO:1 (i.e. claim 101 , SEQ ID NO:2).103. The isolated polypeptide of claim 101 , consisting of the amino acid sequence of SEQ ID NO:2 claim 101 , 4 claim 101 , or 6.104. An isolated nucleic acid molecule encoding the polypeptide of .105. A vector comprising a nucleic acid molecule encoding the polypeptide of .106. A host cell comprising a nucleic acid molecule encoding the polypeptide of or a vector comprising a nucleic acid molecule encoding the polypeptide of .107. A method for producing the polypeptide of comprising culturing a population of host cells comprising a nucleic acid molecule encoding the polypeptide of or a vector comprising a nucleic acid molecule encoding the polypeptide of under conditions in which the polypeptide is expressed claim 101 , and isolating the polypeptide therefrom.108. A pharmacological composition comprising:{'claim-ref': {'@idref': 'CLM-00101', 'claim 101'}, '(a) the polypeptide of ;'}{'claim-ref': {'@idref': 'CLM-00101', 'claim 101'}, '(b) a nucleic acid molecule encoding ...

PHAGE DERIVED ANTIMICROBIAL ACTIVITIES

The present invention provides methods and compositions to reduce growth of microbial colonies, including infections, and includes therapeutic compositions, methods for treatment of infections, and methods for identifying additional such compositions. 1. A chimeric Tail Associated Muralytic Enzyme (TAME) polypeptide , wherein the chimeric TAME polypeptide comprises a muralytic domain (MD) and a heterologous cell binding domain (CBD) that binds to a target bacterium , wherein the target bacterium exhibits reduced or no growth after being contacted with the chimeric TAME polypeptide.2. The chimeric TAME polypeptide of claim 1 , wherein the MD has an activity selected from the group consisting of murein glycosidase claim 1 , glucosaminidase claim 1 , muraminidase claim 1 , transglycosylase claim 1 , lysozyme claim 1 , amidase and endopeptidase activity.3. The chimeric TAME polypeptide of claim 1 , wherein the MD is a catalytic domain from an ORF56 protein.4. The chimeric TAME polypeptide of claim 1 , wherein the MD is selected from a catalytic domain from a lysostaphin protein claim 1 , a catalytic domain from an ORF56 protein claim 1 , and a catalytic domain from a LytM peptidase.5Staphylococcus. The chimeric TAME polypeptide of claim 1 , wherein the target bacterium is a species.6Staphylococcus. The chimeric TAME polypeptide of claim 5 , wherein the target bacterium is a methicillin-resistant species.7. The chimeric TAME polypeptide of claim 1 , wherein the target bacterium is a slowly replicating bacterial species.8. A method of enzymatically degrading a cell wall of a bacterium claim 1 , the method comprising contacting the cell wall with the chimeric TAME polypeptide of .9. A method of treating a bacterial infection in a subject in need of such treatment claim 1 , the method comprising administering a pharmaceutical composition comprising the chimeric TAME polypeptide of to the subject.10. The method of claim 9 , wherein the subject is a mammal.11. The method of ...

ASPARAGINASE-INDUCED GLUTAMINE DEPLETION COMBINED WITH BCL-2 INHIBITION FOR TREATMENT OF HEMATOLOGIC AND SOLID CANCERS

Methods of treating cancer and prolonging survival of a subject having cancer, such as acute myeloid leukemia, via administration of therapeutically effective amounts of agents that depletes plasma glutamine and agents that inhibit BCL-2 activity are detailed herein. Suitable agents that depletes plasma glutamine include asparaginase Suitable agents that inhibit BCL-2 activity include Venetoclax. 1. A method of treating cancer in a subject or prolonging survival of a subject having cancer , comprising administering therapeutically effective amounts of a first agent that depletes plasma glutamine and a second agent that inhibits BCL-2 activity to a subject having cancer.2. The method of claim 1 , wherein the first and second agents are administered in any order claim 1 , alone or in any combination claim 1 , sequentially or concurrently claim 1 , with overlapping or non-overlapping periods of administration.3. The method of claim 2 , comprising concurrently administering therapeutically effective amounts of the first and second agents.4. The method of claim 2 , comprising sequentially administering therapeutically effective amounts of the first and second agents claim 2 , in any order.5. The method of claim 1 , wherein one or more of the first and second agents are formulated claim 1 , separately or together claim 1 , in any combination claim 1 , in pharmaceutical compositions comprising a pharmaceutically acceptable carrier or diluent.6. The method of claim 1 , wherein the combination of the first and second agents has an additive therapeutic effect on the cancer. (original) The method of claim 1 , wherein the combination of the first and second agents has a synergistic therapeutic effect on the cancer.8E. coliE. coliErwinia chrysanthemiErwinia chrysanthemiErwinia chrysanthemi. The method of claim 1 , wherein the agent that depletes plasma glutamine is one or more asparaginase selected from the group consisting of -derived short acting asparaginase claim 1 , ...

Novel Polypeptides Having Endolysin Activity and Uses Thereof

The present invention provides isolated polypeptides comprising the amino acid sequence of SEQ ID NO: 1, or a fragment, variant, derivative or fusion thereof which is capable of binding specifically to and/or lysing cells of , and means for producing the same, with the proviso that the fragment, variant, derivative or fusion is not a naturally occurring lysin of a bacteriophage of . The invention further provides methods for killing bacterial cells, such as cells of , and for diagnosing, treating and preventing diseases and conditions associated with infection of the same. The invention also provides diagnostic kits for use in such methods. 1103-. (canceled)104. An isolated polypeptide comprising:(i) the amino acid sequence of SEQ ID NO: 1, or(ii) a fragment or variant of SEQ ID NO: 1,{'i': 'Clostridium difficile,', 'wherein the polypeptide is capable of binding specifically to or lysing cells of'}wherein the fragment or variant comprises an amino acid sequence with at least 95% identity to the amino acid sequence of residues 1 to 175 of SEQ ID NO: 1,wherein the variant includes one or more amino acid sequence insertions, deletions, conservative substitutions, and/or non-conservative substitutions, relative to the amino acid sequence of SEQ ID NO: 1, and{'i': 'Clostridium difficile', 'wherein the polypeptide is not the lysin of bacteriophage ΦCD119, bacteriophage ΦC2, or prophages 1 or 2 of strain 630 (CD630).'}105. A polypeptide according to wherein the fragment or variant has at least 95% identity to the amino acid sequence of SEQ ID NO: 1.106Clostridium difficile.. A polypeptide according to wherein the fragment or variant is not a naturally occurring lysin of a bacteriophage of107. An isolated polypeptide according to comprising or consisting of the amino acid sequence of SEQ ID NO: 1.108Clostridium difficile.. An isolated polypeptide according to wherein the polypeptide is capable of lysing cells of multiple strains of109Clostridium difficile. An isolated ...

NOVEL USE OF MULTI-ARM POLYETHYLENE GLYCOL MODIFIER AND APPLICATION OF MULTI-ARM POLYETHYLENE GLYCOL MODIFIER IN L-ASPARAGINASUM MODIFICATION

Methods for use of a multi-arm polyethylene glycol (PEG) modifier in modification of asparaginase. The described multi-arm PEG modifier enhances the subunit interaction of a multimeric protein to maintain the multimeric protein in a polymerized form, thereby improving the stability of the multimeric protein, maintaining the bioactivity of the multimeric protein, and reducing the probability of exposure of the antigen binding site after depolymerization of the subunits, so as to reduce the immunogenicity. 1. A method comprising modifying a multimeric protein with a multi-arm polyethylene (PEG).3. The method according to claim 2 , wherein n is an integer selected from 2 to 500 claim 2 , and preferably an integer selected from 25 to 100; k is 1 claim 2 , m is 4 claim 2 , and p is 2; and the molecular weight of the multi-arm PEG is from 1 to 40 kDa claim 2 , and preferably 5 to 10 kDa.4. The method according to claim 3 , wherein the multi-arm PEG is an aldehyde or ester activated multi-arm PEG derivative claim 3 , wherein the ester activated PEG derivative is any one selected from 4-arm PEG succinimidyl acetate claim 3 , 4-arm PEG succinimidyl propionate or 4-arm PEG succinimidyl carbonate; and the aldehyde activated PEG derivative is any one selected from 4-arm PEG propionaldehyde claim 3 , 4-arm PEG butyraldehyde claim 3 , 4-arm PEG acetaldehyde or 4-arm PEG amylic aldehyde claim 3 , and preferably 4-arm PEG propionaldehyde.5. The method according to claim 1 , wherein the multimeric protein is any one selected from alkaline phosphatase claim 1 , asparaginase or urease.7. The method according to claim 6 , wherein n is an integer selected from 2 to 500 claim 6 , and preferably an integer selected from 25 to 100; k is 1 claim 6 , m is 4 claim 6 , and p is 2; and the molecular weight of the multi-arm PEG is from 1 to 40 kDa claim 6 , and preferably 5 to 10 kDa.8. The method according to claim 7 , wherein the multi-arm PEG is an aldehyde or ester activated multi-arm PEG ...

RNA Containing Modified Nucleosides and Methods of Use Thereof

This invention provides RNA, oligoribonucleotide, and polyribonucleotide molecules comprising pseudouridine or a modified nucleoside, gene therapy vectors comprising same, methods of synthesizing same, and methods for gene replacement, gene therapy, gene transcription silencing, and the delivery of therapeutic proteins to tissue in vivo, comprising the molecules. The present invention also provides methods of reducing the immunogenicity of RNA, oligoribonucleotide, and polyribonucleotide molecules.

STREPTOCOCCUS BACTERIOPHAGE LYSINS FOR DETECTION AND TREATMENT OF GRAM POSITIVE BACTERIA

The present invention provides methods, compositions and articles of manufacture useful for the prophylactic and therapeutic amelioration and treatment of gram-positive bacteria, including and and related conditions. The invention provides compositions and methods incorporating and utilizing derived bacteriophage lysins, particularly PlySs2 and/or PlySs1 lytic enzymes and variants thereof, including truncations thereof. Methods for treatment of humans are provided.

Modified beta-lactamases and methods and uses related thereto

The present invention relates to pharmaceuticals and modified beta-lactamases. Specifically, the invention relates to novel recombinant beta-lactamases and pharmaceutical compositions comprising the beta-lactamases. Also, the present invention relates to methods for modifying a beta-lactamase, producing the beta-lactamase and treating or preventing beta-lactam antibiotic induced adverse effects. Furthermore, the present invention relates to the beta-lactamase for use as a medicament and to the use of the beta-lactamase in the manufacture of a medicament for treating or preventing beta-lactam antibiotics induced adverse effects. Still further, the invention relates to a polynucleotide and a host cell comprising the polynucleotide.

BETA-LACTAMASE VARIANTS

The present invention relates to an isolated polypeptide having beta-lactamase activity and nucleic acid sequences encoding the polypeptide. The isolated polypeptide of the invention is a VIM-2 variant with improved properties such as improved protease stability. 1. An isolated polypeptide having beta-lactamase activity , which comprises an amino acid sequence having at least 70% sequence identity to SEQ ID NO:1 , said polypeptide further comprising a substitution at a position corresponding to residue 34 in SEQ ID NO: 1 and a C-terminal truncation of residues 237-240 of SEQ ID NO:1.2. The polypeptide according to claim 1 , which comprises:a C-terminal truncation of residues 236-240 of SEQ ID NO:1; ora C-terminal truncation of residues 235-240 of SEQ ID NO:1.3. The polypeptide according to claim 1 , wherein said substitution is Q34R.4. An isolated polypeptide having beta-lactamase activity claim 1 , which comprises an amino acid sequence having at least 70% sequence identity to SEQ ID NO:1 claim 1 , and which comprises a C-terminal truncation of exactly five residues from position 236 to 240 of SEQ ID NO:1.5. The polypeptide according to claim 1 , wherein the first residue of SEQ ID NO:1 is replaced with a methionine residue.6. The polypeptide according to claim 1 , further comprising a signal peptide at its N-terminal end having the sequence of SEQ ID NO:2.7. The polypeptide according to claim 1 , comprising a truncation at its N-terminal end as compared to the sequence of SEQ ID NO:1.8. The polypeptide according to claim 1 , comprising or consisting of the amino acid sequence of any one of SEQ ID NO:3 to 6.9. An isolated nucleic acid sequence comprising a nucleic acid sequence encoding the polypeptide according to .10. A nucleic acid construct comprising the nucleic acid sequence of claim 9 , operably linked to one or more control sequences that direct the expression of the polypeptide in a suitable expression host.11. A recombinant host cell comprising the ...

MODIFIED BETA-LACTAMASES AND METHODS AND USES RELATED THERETO

The present invention relates to pharmaceuticals and modified beta-lactamases. Specifically, the invention relates to novel recombinant beta-lactamases and pharmaceutical compositions comprising the beta-lactamases. 123-. (canceled)24. A method for preventing a beta-lactam antibiotic induced adverse effect , comprising administering an effective amount of a beta-lactamase to a subject in need thereof , wherein:the subject is receiving a beta-lactam antibiotic andthe beta-lactamase comprises an amino acid sequence having at least 68% sequence identity with SEQ ID NO: 1 and a hydrophilic amino acid residue other than aspartic acid (D) at a position corresponding to position 276 according to Ambler classification.25Clostridium difficile. The method of claim 24 , wherein the beta-lactam antibiotic induced adverse effect is a infection.26. The method of claim 24 , wherein the hydrophilic amino acid residue is selected from asparagine (N) claim 24 , glutamine (Q) claim 24 , serine (S) claim 24 , or threonine (T).27. The method of claim 24 , wherein the hydrophilic amino acid residue is selected from arginine (R) claim 24 , histidine (H) claim 24 , or lysine (K).28. The method of claim 24 , wherein the beta-lactamase hydrolyses a penicillin and a cephalosporin.29. The method of claim 28 , wherein the cephalosporin is selected from cefoperazone and ceftriaxone.30. The method of claim 24 , wherein the beta-lactamase is administered simultaneously to or sequentially with the beta-lactam antibiotic.31. The method of claim 30 , wherein the beta-lactamase is administered before the beta-lactam antibiotic.32. The method of claim 24 , wherein the beta-lactamase is administered orally.33. The method of claim 24 , wherein the beta-lactam antibiotic is administered by intravenous injection.34. The method of claim 24 , wherein the beta-lactam antibiotic is selected from penicillin and cephalosporin.35. The method of claim 34 , wherein the cephalosporin is selected from cefoperazone ...

Pegylated L-asparaginase

Disclosed is a conjugate of a protein having substantial L-asparagine aminohydrolase activity and polyethylene glycol. In particular, the polyethylene glycol has a molecular weight less than or equal to about 5000 Da and the protein is an L-asparaginase from . The conjugate of the invention has shown superior properties such as maintenance of a high level of in vitro activity and an unexpected increase in half-life in vivo. Also disclosed are methods of producing the conjugate and use of the conjugate in therapy. In particular, a method is disclosed for use of the conjugate in the treatment of cancer, particularly Acute Lymphoblastic Leukemia (ALL). More specifically, a method is disclosed for use of the conjugate as a second line therapy for patients who have developed hypersensitivity or have had a disease relapse after treatment with other L-asparaginase preparations. 1Erwinia chrysanthemiErwinia chrysanthemi. A conjugate comprising an L-asparaginase from having at least 90% sequence identity to the amino acid of SEQ ID NO:1 and conjugated to at least one polyethylene glycol (PEG) molecule , wherein the at least one PEG has a molecular weight less than or equal to 5000 Da and the conjugate has at least fifty times more in vivo L-asparaginase activity compared to an L-asparaginase not conjugated to PEG.2. The conjugate of claim 1 , wherein said L-asparaginase has at least 95% to 99% sequence identity to the amino acid of SEQ ID NO:1.3. (canceled)4. The conjugate of claim 1 , wherein said L-asparaginase comprises the amino acid of SEQ ID NO:1.530-. (canceled)31. The conjugate of claim 1 , wherein the PEG is covalently linked to one or more amino groups of said L-asparaginase.32. (canceled)33. The conjugate of claim 31 , wherein the PEG molecules are covalently linked to at least from about 40% to about 100% of the accessible amino groups of said L-asparaginase.34. (canceled)35. The conjugate of having the formula:{'br': None, 'sub': '2', 'i': x', 'n, 'Asp-[NH—CO—( ...

RAAV VECTOR COMPOSITIONS, METHODS FOR TARGETING VASCULAR ENDOTHELIAL CELLS AND USE IN TREATMENT OF TYPE I DIABETES

Disclosed are capsid-modified rAAV expression vectors, as well as infectious virions, compositions, and pharmaceutical formulations that include them. Also disclosed are methods of preparing and using novel capsid-protein-mutated rAAV vector constructs in a variety of diagnostic and therapeutic applications including, inter alia, as delivery agents for diagnosis, treatment, or amelioration of one or more diseases, disorders, or dysfunctions of the mammalian vascular system, and complications from Type I diabetes. Also disclosed are methods for systemic and tissue-localized delivery of therapeutic rAAV-based gene expression cassettes to vascular endothelial cells, tissues, and organs, as well as use of the disclosed compositions in the manufacture of medicaments for a variety of in vitro and/or in vivo applications including the treatment of vasculitis, and complications arising from Type I diabetes, such as macular edema, nephropathy, diabetic retinopathy, and the like. 1. A recombinant adeno-associated viral (rAAV) expression system comprising:a) a polynucleotide that encodes a modified capsid protein, wherein the modified capsid protein comprises five or more non-native amino acid substitutions at positions corresponding to five or more distinct surface-exposed amino acid residues in the wild-type AAV2 capsid protein, and further wherein the transduction efficiency of a virion comprising the modified capsid protein is higher than that of a virion comprising a corresponding, unmodified wild-type capsid protein; andb) an expression cassette packaged within the virion, that comprises an isolated polynucleotide comprising a nucleic acid segment that encodes or that expresses a diagnostic or a therapeutic molecule in a mammal transformed with the expression system, wherein the nucleic acid segment is operably linked to a promoter or a control region that expresses the nucleic acid segment in one or more vascular endothelial cells of the mammal to produce the diagnostic ...

ENGINEERED COMMENSAL BACTERIA AND METHODS OF USE

Provided are compositions comprising populations of commensal bacteria isolated from a microbiome sample of a mammalian subject and engineered to express a heterologous polynucleotide, compositions comprising such engineered commensal bacteria and methods of use for delivering a therapeutic polypeptide to a mammal, e.g, by administering the engineered commensal/native bacteria. 1. A method of delivering a therapeutic polypeptide to a mammalian subject in need thereof , the method comprising:a) obtaining a microbiome sample comprising bacterial cells from a donating subject;b) isolating a bacterial cell from the microbiome sample, wherein the bacteria cell is from a bacterial strain that is commensal/native to the donating subject;c) culturing the isolated bacteria cells in vitro to yield a substantially homogeneous population of the isolated and cultured bacteria cells;d) transforming the population of bacterial cells with one or more polynucleotides that are heterologous to the bacteria and/or the donating subject, wherein the one or more polynucleotides encode one or more therapeutic polypeptides; ande) administering or causing to be administered to a receiving subject at least a portion of the substantially homogeneous and transformed population of the isolated and cultured bacteria cells, wherein the administered bacteria cells are capable of colonizing permanently or long-term in or on the mammalian subject and express the one or more therapeutic polypeptides.2. The method of claim 1 , further comprising the step of determining and/or measuring the colonization or presence of the administered bacteria cells in or on said mammalian subject.3. The method of any one of to claim 1 , wherein the microbiome sample is obtained from a biological sample selected from the group consisting of a bodily excretion (e.g. claim 1 , feces claim 1 , saliva claim 1 , mucus claim 1 , urine claim 1 , or breath) claim 1 , a biopsy or swab of a surface (e.g. claim 1 , ...

Sumoylation of Serca2A and Cardiovascular Disease

Methods for treating cardiovascular disease, and in particular heart failure, are provided comprising administering a therapeutically effective amount of a modulator of SERCA2a post-translation modification such as SUMOylation or acetylation. Also provided are methods of treating cardiovascular disease by inhibiting SERCA2a degradation. Further provided are methods of diagnosing a propensity to develop heart failure comprising determining if a SERCA2a mutant is present or determining the level of expression of SUMO1 in cardiomyocytes. The disclosure also provides methods of screening for therapeutics that modulate the post-translational modification of SERCA2a, such as by modulating post-translational SUMOylation and/or acetylation. 117.-. (canceled)18. A method of diagnosing a subject's propensity to develop heart failure , comprising determining the level of expression of SUMO1 in a cardiomyocyte of the subject and comparing that level to the level of expression of SUMO1 in a cardiomyocyte of a healthy control , wherein reduced expression of SUMO1 relative to the control is indicative of a propensity to develop cardiac failure.19. (canceled)20. A method of diagnosing a patient's disposition towards a cardiovascular disease , comprising (a) obtaining a biological sample from a patient , (b) determining the amino acid sequence of SERCA2a at one or more positions 479-482 and/or one or more positions 584-587 , and (c) diagnosing a disposition towards cardiovascular disease if the amino acid sequence varies from the wild-type sequence of SERCA2a (SEQ ID NO: 2).21. The method of claim 20 , wherein step b is carried out by determining the polynucleotide sequence encoding the amino acid sequence of SERCA2a at the position(s).22. The method of claim 20 , wherein the cardiovascular disease is heart failure.23. A method of diagnosing a subject's propensity to develop heart failure claim 20 , comprising (a) determining the expression level of SERCA2a claim 20 , the level of ...

A LYOPHILIZED COMPOSITION OF PEGASPARGASE

The present invention relates to a novel, economically viable, storage stable, lyophilized composition of pegaspargase. The composition comprises pegaspargase, a cryoprotectant, a bulking agent, a buffer and may optionally contain other pharmaceutically acceptable excipients including but not limited to a salt. The composition of the present invention is stable for extended periods over significant range of temperatures, without the presence of any significant amount of impurities. The present invention also relates to an economically viable and scalable lyophilization process for the production of the storage stable composition of pegaspargase. 1. An optimum storage stable lyophilized composition comprising pegaspargase , a cryoprotectant , a bulking agent , a buffer , optionally a pharmaceutically acceptable excipient.2. The composition as claimed in claim 1 , wherein the pegaspargase is a pegylated asparaginase comprising a polyalkylene oxide group covalently linked by a linker to asparaginase; wherein the polyalkylene oxide is mono-methoxy polyethylene glycol (mPEG) and is covalently linked by a succinate linker via an amide bond to one or more primary amine groups of an L-asparaginase through conjugation; wherein conjugation of mPEG and L-asparaginase results in covalent attachment of 1-12 mPEGs per monomer of L-asparaginase.3E. coliErwinia chrysanthemiE. coli. The composition as claimed in claim 2 , wherein L-Asparaginase is from a bacterial source selected from the group consisting of and or obtained through genetically engineered through recombinant technology.4. The composition as claimed in claim 1 , wherein an amount of pegaspargase in the composition is 2-32 of the composition.5. The composition as claimed in claim 1 , wherein the cryoprotectant is selected from the group consisting of sugar claim 1 , polyol claim 1 , polymer claim 1 , and amino acid; wherein claim 1 , the cryoprotectant is present in a range of 9-91% of the composition.6. The ...

METHODS AND COMPOSITIONS FOR MODULATING THE IMMUNE SYSTEM WITH ARGINASE I

Methods and compositions comprising recombinant Arginase I proteins which are capable of depleting the plasma arginine levels in a subject are disclosed. The methods and compositions can be used to modulate the activity of the immune system in a subject. Modulation of the immune system is useful in the treatment of immune disorders and in preventing rejection of a transplanted organ, tissue, or cell. The methods and compositions can also be used to treat a bone condition of a subject. 1. A pharmaceutical composition comprising , a recombinant human Arginase I or a functional fragment thereof , wherein the recombinant human Arginase I inhibits T-cell polarization when administered to a subject.2. The pharmaceutical composition of claim 1 , wherein the recombinant human Arginase I comprises at least one polyethylene glycol (PEG) oligomer.3. The pharmaceutical composition of claim 2 , wherein the recombinant human Arginase I comprises at least two polyethylene glycol oligomers.4. The pharmaceutical composition of claim 3 , wherein at least one of the two polyethylene glycol oligomers weighs from about 20 kilodaltons and about 40 kilodaltons.5. The pharmaceutical composition of claim 2 , wherein the recombinant human Arginase I comprises from about 4 polyethylene glycol oligomers to about 13 polyethylene glycol oligomers.6. The pharmaceutical composition of claim 2 , wherein the polyethylene glycol oligomer weighs about 5 kilodaltons.7. The pharmaceutical composition of claim 2 , wherein the total molecular weight of the polyethylene glycol oligomer conjugated with each molecule of said recombinant human Arginase I is about 20-120 kilodaltons.8. The pharmaceutical composition of claim 7 , wherein the total molecular weight of the PEG oligomer conjugated with each molecule of said recombinant human Arginase I is about 30-60 kilodaltons.9. The pharmaceutical composition of claim 2 , wherein the polyethylene glycol oligomer is conjugated to a cysteine residue of the ...

BETA-LACTAMASE VARIANTS

The present invention relates to an isolated polypeptide having beta-lactamase activity and nucleic acid sequences encoding the polypeptide. The isolated polypeptide of the invention is a VIM-2 variant with improved properties such as improved protease stability, stability in intestinal medium, improved activity against one or more antibiotics, improved specific activity and/or improved production in a host cell. 1. An isolated polypeptide having beta-lactamase activity , which comprises an amino acid sequence having at least 70% sequence identity to SEQ ID NO:1 , said polypeptide comprising substitutions in position 34 and in at least one position selected from positions 22 and 130 , wherein the positions correspond to the positions in SEQ ID NO:1.2. The polypeptide according to claim 1 , wherein the polypeptide comprises:a substitution at each of positions 22 and 34;a substitution at each of positions 34 and 130; ora substitution at each of positions 22, 34 and 130.3. The polypeptide of claim 1 , which comprises at least one modification selected from the following:Q22H or Q22N;Q34R; andE130D.4. The polypeptide according to claim 1 , wherein the first residue of SEQ ID NO:1 is replaced with a methionine residue.5. The polypeptide according to claim 1 , further comprising a signal peptide at its N-terminal end.6. The polypeptide according to claim 1 , comprising a truncation at its N-terminal or C-terminal end as compared to the sequence shown in SEQ ID NO:1.7. The polypeptide according to claim 6 , which comprises:a C-terminal truncation of residues 237-240 of SEQ ID NO:1;a C-terminal truncation of residues 236-240 of SEQ ID NO:1; ora C-terminal truncation of residues 235-240 of SEQ ID NO:1.8. The polypeptide according to claim 1 , comprising or consisting of the amino acid sequence of any one of SEQ ID NO:3 to 22 or a fragment thereof having beta-lactamase activity.9. An isolated nucleic acid sequence comprising a nucleic acid sequence encoding the polypeptide ...

Test for Predicting Neutralization of Asparaginase Activity

Method of in vitro measurement of the presence of factors that are able to neutralize asparaginase activity in a sample of blood, plasma, serum or derived medium that may contain asparaginase neutralizing factors, obtained from a patient, comprising mixing of said sample with asparaginase, incubation of said mixture, then measurement of the residual asparaginase activity in the mixture and determination or quantification of the presence of said neutralizing factors. Method for predicting the efficacy of a treatment with asparaginase. 1. A method of treatment of an asparaginase-sensitive pathology in a patient , said methods comprising:(a) obtaining a sample of blood, plasma, or serum from a patient;(b) incubating said sample with a known amount of asparaginase for a period of time sufficient to produce antibody-asparaginase immune complexes;(c) removing from the incubated sample any antibody-asparaginase immune complexes formed during incubation step (b) and recovering a sample free of antibody-asparaginase immune complexes;(d) incubating the sample obtained at step (c) with asparagine; and(e) determining a residual asparaginase activity or the amount of asparaginase residual activity in the resultant mixture of step (d).2. The method according to claim 1 , further comprises (f) treating said patient by means of this asparaginase and/or by means of another form of asparaginase depending on step (e) determining the residual asparaginase activity or the amount of asparaginase residual activity in the resultant mixture of step (d).3. The method according to claim 1 , further comprises after step (e) claim 1 , determining or quantifying the presence of neutralizing factors.4. The method according to claim 1 , wherein the patient is currently being treated with asparaginase or has been treated with asparaginase.5. The method according to claim 1 , wherein measuring the activity of the asparaginase in the mixture is carried out by adding claim 1 , to the mixture claim 1 , ...

ARGININE DEIMINASE WITH REDUCED CROSS-REACTIVITY TOWARD ADI - PEG 20 ANTIBODIES FOR CANCER TREATMENT

The present invention relates generally to isolated to arginine deiminase (ADI) proteins that have reduced cross-reactivity with anti-ADI-PEG 20 antibodies as compared to ADI-PEG 20, but which can have functional characteristics comparable to or better than ADI-PEG 20, compositions comprising the ADI proteins, and related methods of treating arginine-dependent diseases or related diseases such as cancer. 1. A therapeutic composition comprising an isolated arginine deiminase , or a fragment thereof having ADI activity , and a pharmaceutically-acceptable carrier , wherein the isolated arginine deiminase is from an organism listed in Table 1 and has reduced cross-reactivity with patient anti-ADI-PEG 20 antibodies.23-. (canceled)4. The therapeutic composition of wherein the isolated arginine deiminase has one or more properties comparable to or better than those of ADI-PEG 20.5. The therapeutic composition of wherein the one or more properties is Kcat claim 1 , Km claim 1 , pH optimum claim 1 , stability claim 1 , in vivo proteolytic stability claim 1 , or no requirement for ions or cofactors that are not already present in blood claim 1 , or any combination thereof.6M. hominis. The therapeutic composition of wherein the isolated arginine deiminase has at least 20 surface residue changes as compared to arginine deiminase.7M. hominis. The therapeutic composition of wherein the isolated arginine deiminase has between 20 and 135 surface residue changes as compared to arginine deiminase.8M. hominis. The therapeutic composition of wherein the isolated arginine deiminase has between 40 and 100 surface residue changes as compared to arginine deiminase.9M. hominis. The therapeutic composition of wherein the isolated arginine deiminase has between 30 and 60 surface residue changes as compared to arginine deiminase.10M. hominis. The therapeutic composition of wherein the isolated arginine deiminase has between 80 and 100 surface residues changes as compared to arginine deiminase. ...

METHOD OF AMELIORATING A PRO-INFLAMMATORY IMMUNOPHENOTYPE IN FARBER DISEASE SUBJECTS BY REPEATED ADMINISTRATION OF A RECOMBINANT HUMAN ACID CERAMIDASE

Compositions and methods for treating inflammation associated with Farber disease in a subject in need thereof by administering to the subject a pharmaceutical composition comprising a recombinant human acid ceramidase in a therapeutically effective amount of about 0.1 mg/kg to about 50 mg/kg to inhibit inflammation and/or to inhibit or reduce pro-inflammatory potential of neutrophils and/or monocytes in the subject. 1. A method for treating inflammation associated with Farber disease in a subject in need thereof , the method comprising administering to the subject a pharmaceutical composition comprising a recombinant human acid ceramidase in a therapeutically effective amount of about 0.1 mg/kg to about 50 mg/kg.2. The method according to claim 1 , wherein the recombinant acid ceramidase comprises UniProt Q13510 claim 1 , UniProt Q9H715 claim 1 , UniProt Q96AS2 claim 1 , OMIM 228000 claim 1 , NCBI Gene 427 claim 1 , NCBI RefSeq NP_808592 claim 1 , NCBI RefSeq NP_004306 claim 1 , NCBI RefSeq NM_177924 claim 1 , NCBI RefSeq NM_004315 claim 1 , NCBI UniGene 427 claim 1 , NCBI Accession 013510 claim 1 , NCBI Accession AAC73009 claim 1 , or a combination thereof.3. The method according to claim 1 , wherein the recombinant human acid ceramidase is a rhAC encoded by the ASAH1 gene (NCBI UniGene GeneID No. 427).4. The method according to claim 1 , wherein the recombinant human acid ceramidase comprises the sequence of SEQ ID NO: 1.5. The method according to claim 1 , wherein the recombinant acid ceramidase comprises the sequence of UniProt Q 13510.6. The method according to claim 1 , wherein the recombinant acid ceramidase comprises the sequence of NCBI RefSeq NP_308592.7. The method according to claim 1 , further comprising administering a second anti-inflammatory agent in a therapeutically effective amount in combination with the recombinant human acid ceramidase.8. The method according to claim 7 , wherein the second anti-inflammatory agent is selected from the group ...

L-ASPARAGINASE VARIANTS AND FUSION PROTEINS WITH REDUCED L-GLUTAMINASE ACTIVITY AND ENHANCED STABILITY

Variant L-asparaginases with reduced L-glutaminase activity and enhanced in vivo circulation are described as are fusion proteins containing an L-asparaginase and three tandem soluble domains of TRAIL for use in the treatment of cancers such as acute lymphoblastic leukemia and acute myeloid leukemia. 1Erwinia chrysanthemi. An L-asparaginase (ErA) variant comprising an amino acid substitution at one or more of positions 31 , 63 and 254 of SEQ ID NO:1.2. The ErA variant of claim 1 , wherein the amino acid substitution at position 31 comprises an isoleucine claim 1 , valine claim 1 , leucine claim 1 , or threonine.3. The ErA variant of claim 1 , wherein the amino acid substitution at position 63 comprises a glutamine claim 1 , asparagine claim 1 , or aspartate.4. The ErA variant of claim 1 , wherein the amino acid substitution at position 254 comprises an asparagine or glutamine.5. The ErA variant of comprising an amino acid sequence set forth in SEQ ID NO:2 claim 1 , SEQ ID NO:3 claim 1 , SEQ ID NO:4 claim 1 , SEQ ID NO:5 claim 1 , SEQ ID NO:6 or SEQ ID NO:7.6. The ErA variant of claim 1 , wherein said ErA variant exhibits an asparaginase reaction rate (k) of least 75% of wild-type ErA enzyme.7. The ErA variant of claim 1 , wherein said ErA variant exhibits a Km for L-asparagine of less than 250 μM.8. The ErA variant of claim 1 , wherein said ErA variant exhibits a glutaminase reaction rate (k) of less than 60% of wild-type ErA enzyme.9. The ErA variant of claim 1 , wherein said ErA variant exhibits a Km for L-glutamine of greater than 3 mM.10. The ErA variant of claim 1 , further comprising a histidine tag claim 1 , a SUMO tag claim 1 , an albumin-binding domain claim 1 , or a combination thereof.11. The ErA variant of claim 1 , wherein said ErA variant is PEGylated.12. The ErA variant of claim 11 , wherein the ErA variant further comprises a cysteine residue at position 72 claim 11 , 76 claim 11 , 79 claim 11 , 84 claim 11 , 85 claim 11 , 206 claim 11 , 210 claim 11 ...

Methods of administering immunosuppressants having a specified pharmacodynamic effective life and therapeutic macromolecules for the induction of immune tolerance

This invention relates to methods that provide immunosuppressants and therapeutic macromolecules that are administered within a pharmacodynamically effective window of the immunosuppressants to induce immune tolerance to the therapeutic macromolecules. The methods allow shifting the immune response in favor of tolerogenic immune response development specific to the therapeutic macromolecule.

MODIFIED BETA-LACTAMASES AND METHODS AND USES RELATED THERETO

The present invention relates to pharmaceuticals and modified beta-lactamases. Specifically, the invention relates to novel recombinant beta-lactamases and pharmaceutical compositions comprising the beta-lactamases. 1. A beta-lactamase comprising an amino acid sequence having at least 60% sequence identity with SEQ ID NO: 1 and having a hydrophilic amino acid residue at a position of SEQ ID NO: 1 corresponding to position 276 according to Ambler classification , or a variant or fragment thereof.2. A method of modifying a beta-lactamase comprising an amino acid sequence having at least 60% sequence identity with SEQ ID NO: 1 , characterized in that an amino acid of the beta-lactamase at a position of SEQ ID NO: 1 corresponding to position 276 according to Ambler classification is replaced with a hydrophilic amino acid.3. The beta-lactamase according to or the method according to , wherein the beta-lactamase comprises an amino acid sequence having at least 68% sequence identity with SEQ ID NO:1 , or a variant or fragment thereof having beta-lactamase activity and including a hydrophilic amino acid residue other than aspartic acid (D) at a position corresponding to position 276 according to Ambler classification.4. The beta-lactamase according to or the method according to , wherein the beta-lactamase comprises an amino acid sequence having at least 60% sequence identity with SEQ ID NO:1 , and wherein the hydrophilic amino acid residue at a position corresponding to position 276 according to Ambler classification is other than aspartic acid (D).5. The beta-lactamase according to or the method according to , characterized in that the hydrophilic amino acid is selected from polar and positively charged hydrophilic amino acids from the group consisting of arginine (R) , histidine (H) and lysine (K).6. The beta-lactamase according to or the method according to , characterized in that the hydrophilic amino acid is selected from polar and neutral of charge hydrophilic amino ...

SELECTIVE RECOVERY

Provided herein are methods of selective screening. In addition, various targeting proteins and sequences, as well as methods of their use, are also provided. 1. An AAV vector comprising an amino acid sequence that comprises at least 4 contiguous amino acids from the sequence TLAVPFK (SEQ ID NO: 1) or KFPVALT (SEQ ID NO: 3).2. The AAV vector of claim 1 , wherein the amino acid sequence results in an increase in CNS cell transduction by the AAV.3. The AAV vector of claim 1 , wherein the amino acid sequence is part of a capsid protein of the AAV vector.4. The AAV vector of claim 1 , wherein the sequence TLAVPFK (SEQ ID NO: 1) is inserted between AA588-589 of an AAV sequence of the vector (SEQ ID NO: 2).5. The AAV vector of claim 1 , wherein the sequence TLAVPFK (SEQ ID NO: 1) is inserted between AA586-592 of an AAV sequence of the vector (SEQ ID NO: 2).6. The AAV vector of claim 1 , wherein the sequence TLAVPFK (SEQ ID NO: 1) further comprises at least two of amino acids 587 claim 1 , 588 claim 1 , 589 claim 1 , or 590 of SEQ ID NO: 2.7. A central nervous system targeting peptide claim 1 , the peptide comprising an amino acid sequence of SEQ ID NO: 1.8. The peptide of claim 7 , further conjugated to a nanoparticle claim 7 , a second molecule claim 7 , or a viral capsid protein.9. The targeting peptide of claim 7 , wherein the targeting peptide is part of an AAV.10. The targeting peptide of claim 9 , wherein the targeting peptide is part of an AAV9.11. A nucleic acid sequence encoding any four contiguous amino acids in TLAVPFK (SEQ ID NO: 1) or in KFPVALT (SEQ ID NO: 3).12. The nucleic acid sequence of claim 11 , wherein the nucleic acid sequence is inserted between a sequence encoding for amino acids 588 and 589 of AAV9 (SEQ ID NO: 2).13. A method of delivering a nucleic acid sequence to a nervous system claim 11 , the method comprising:providing a protein comprising TLAVPFK (SEQ ID NO: 1), wherein the protein is part of a capsid of an AAV, and wherein the AAV ...

COMPOSITIONS AND METHODS OF USE THEREOF FOR TREATMENT OF METABOLIC DESEASES AND RELATED DISORDERS

The present disclosure relates to compositions and methods of using the same for the treatment of various metabolic diseases and related disorders (e.g. diabetes mellitus, NAFLD, obesity, metabolic syndrome). The compositions and methods of the disclosure relate to the administration of an arginine-degrading enzyme. 1. A method for treating a metabolic disease or related disorder in a subject in need thereof comprising administering to the subject a composition comprising a therapeutically effective amount of an arginine deprivation agent.2. The method of claim 1 , wherein the arginine deprivation agent is one or more of an arginase claim 1 , an arginine deiminase or an arginine decarboxylase.3. The method of claim 2 , wherein the composition is a pharmaceutical composition comprising a viral vector comprising a nucleic acid sequence encoding an arginine deprivation agent selected from an arginase claim 2 , an arginine deiminase or an arginine decarboxylase.4. The method of claim 1 , wherein the composition is a pharmaceutical composition comprising an isolated viral particle having a genome comprising open reading frames that encode an arginase claim 1 , an arginine deiminase or an arginine decarboxylase.5. The method of claim 4 , wherein the isolated viral particle is an adeno-associated virus virion.6. The method of claim 4 , wherein expression of the arginase claim 4 , an arginine deiminase or an arginine decarboxylase is driven by a liver-specific promoter.7. The method of claim 1 , wherein the arginine deprivation agent is arginase II.8. The method of claim 7 , wherein the arginase II comprises the sequence set forth in SEQ ID NO: 2.9. The method of claim 2 , wherein the composition is a pharmaceutical composition comprising an arginine-degrading enzyme polypeptide.10. The method of claim 9 , wherein the arginine-degrading enzyme polypeptide is one or more of an arginase polypeptide claim 9 , an arginine deiminase polypeptide and an arginine decarboxylase ...

Medicament for the Treatment of Acute Myeloid Leukemia (AML)

The present invention relates to the therapeutic treatment of Acute Myeloid Leukemia (AML). It concerns in particular a novel composition for the treatment of this cancer and an associated therapeutic treatment method. The invention concerns a suspension of erythrocytes encapsulating asparaginase as a medicament for treating Acute Myeloid Leukemia (AML). The invention also concerns a method for treating Acute Myeloid Leukemia (AML) comprising administering an efficient amount of a suspension of erythrocytes encapsulating asparaginase. 129-. (canceled)30. A method for treating Acute Myeloid Leukemia (AML) comprising administering to a patient in need thereof an efficient amount of a suspension of erythrocytes encapsulating asparaginase , wherein one administers at least two doses of suspension during a phase treatment , wherein one dose of suspension comprises from 50 to 500 IU of encapsulated asparaginase per kg body weight and wherein two doses administered to the same patient are administered with a lag time which is above or equal to 14 days.31. The method of claim 30 , wherein two doses administered to the same patient are administered with a lag time which is from 14 to 45 days.32. The method of claim 30 , wherein one dose of suspension comprises from 50 to 200 IU of encapsulated asparaginase per kg body weight.33. The method of claim 30 , wherein one dose of suspension comprises from 80 to 170 IU of encapsulated asparaginase per kg body weight.34. The method of claim 30 , wherein one dose of suspension comprises 100 IU of asparaginase per kg body weight.35. The method of claim 30 , wherein one dose of suspension comprises 150 IU of asparaginase per kg body weight.36. The method of claim 30 , wherein the patient is a child claim 30 , an adult or an elderly.37. The method of claim 30 , wherein the patient is an elderly over 65 years.38. The method of claim 30 , wherein the patient is an unfit patient.39. The method of claim 30 , wherein the suspension of ...

MUCOADHESIVE DEVICES FOR THE RELEASE OF PROBIOTICS AND FOR THE MAINTENANCE OF THEIR ENZYME ACTIVITIES

The present invention relates to medical devices in the form of mucoadhesive films for the release of live lactic bacteria and bifidobacteria (probiotics) and/or for the release and maintenance of their pharmacologically useful enzyme activities. 1. An article of manufacture comprising a mucoadhesive film , the article of manufacture comprising:{'i': 'Bifidobacterium', '(a) one or more bacterial strains of lactic bacteria and one or more bifidobacteria of the genus ; and/or'}{'i': 'Bifidobacterium,', '(b) one or more enzymes derived from said one or more bacterial strains of lactic bacteria and one or more bifidobacteria of the genus'}wherein said mucoadhesive film films being characterised in that the one or more bacterial strains of lactic bacteria, the bifidobacteria and/or the one or more enzymes derived from said one or more bacterial strains of lactic bacteria or one or more bifidobacteria are present on only one of the surfaces of the mucoadhesive film.2. The article of manufacture of claim 1 , in which the mucoadhesive film has a thickness of about ≤1 mm and the quantity of the one or more bacterial strains of lactic bacteria and the one or more bifidobacteria on the film's surface is between about 10and 10cfu/cm.3. The article of manufacture of claim 1 , wherein: the{'i': Lactobacillus acidophilus, Lactobacillus buchneri, Lactobacillus brevis, Lactobacillus casei, Lactobacillus catenaforme, Lactobacillus cellobiosus, Lactobacillus crispatus, Lactobacillus curvatus, Lactobacillus delbrueckii, Lactobacillus jensenii, Lactobacillus leichmanii, Lactobacillus minutus', 'bacillus plantarum Lactobacillus rogosae, Lactobacillus salivarius, Lactobacillus reuteri, Lactobacillus rhamnosus', 'Bifidobacterium animalis', 'lactis', 'Bifidobacterium adolescentis, Bifido', 'bacterium angulatum, Bifidobacterium bifidum, Bifidobacterium catenulatum, Bifidobacterium dentium, Bifidobacterium eriksonii, Bifidobacterium infantis, Bifidobacterium longum, Bifidobacterium plantarum, ...

SELECTIVE RECOVERY

Provided herein are methods of selective screening. In addition, various targeting proteins and sequences, as well as methods of their use, are also provided. 123.-. (canceled)24. A method of delivering a nucleic acid sequence to a nervous system of a subject , the method comprising:providing a targeting peptide comprising at least 4 contiguous amino acids from an amino acid sequence selected from the group consisting of TLAVPFK (SEQ ID NO: 1), KFPVALT (SEQ ID NO: 3), SVSKPFL (SEQ ID NO: 28), FTLTTPK (SEQ ID NO: 29), MNATKNV (SEQ ID NO: 30), ILGTGTS (SEQ ID NO: 55), TRTNPEA (SEQ ID NO: 56), NGGTSSS (SEQ ID NO: 58), and YTLSQGW (SEQ ID NO: 60), wherein the targeting peptide is part of a capsid of an AAV vector comprising a nucleic acid sequence to be delivered to the nervous system; andadministering the AAV vector to the subject.25. The method of claim 24 , wherein the nucleic acid sequence to be delivered comprises one or more of:a) a DNA sequence that encodes a trophic factor, a growth factor, or other soluble factors capable of being released from the transduced cells and affect the survival or function of that cell and/or surrounding cells;b) a cDNA that restores protein function to humans or animals harboring a genetic mutation(s) in that gene;c) a cDNA that encodes a protein that can be used to control or alter the activity or state of a cell;d) a cDNA that encodes a protein or a nucleic acid used for assessing the state of a cell;e) a cDNA and/or associated guide RNA for performing genomic engineering;f) a sequence for genome editing via homologous recombination;g) a DNA sequence encoding a therapeutic RNA;h) a shRNA or an artificial miRNA delivery system; andi) a DNA sequence that influences the splicing of an endogenous gene.26. The method of claim 24 , wherein the targeting peptide comprises an amino acid sequence selected from the group comprising: TLAVPFK (SEQ ID NO: 1); LAVPFK (SEQ ID NO: 31); AVPFK (SEQ ID NO: 32); VPFK (SEQ ID NO: 33); TLAVPF (SEQ ID ...

BETA-LACTAMASES WITH IMPROVED PROPERTIES FOR THERAPY

This invention relates to, in part, compositions of beta-lactamases and methods of using these enzymes in, for example, gastrointestinal tract (GI tract) disorders such as infection (CDI). 1. A beta-lactamase comprising an amino acid sequence having at least 70% sequence identity with SEQ ID NO: 1 and one or more of the following mutations of Ambler classification: F33X , Q135X , G156X , A232X , A237X , A238X , S240X , 1243X , R244X , S266X , and D276X , wherein X is any naturally-occurring amino acid and with the proviso that D276X is not present in the context of a single mutant.2. The beta-lactamase of claim 1 , wherein X is a hydrophilic or hydrophobic amino acid residue.3. The beta-lactamase of any one of the above claims claim 1 , wherein the hydrophilic amino acid residue is a polar and positively charged hydrophilic residue selected from arginine (R) and lysine (K) or an aromatic claim 1 , polar and positively charged hydrophilic including histidine (H).4. The beta-lactamase of any one of the above claims claim 1 , wherein the hydrophilic amino acid residue is a polar and neutral of charge hydrophilic residue selected from asparagine (N) claim 1 , glutamine (Q) claim 1 , serine (S) claim 1 , threonine (T) claim 1 , proline (P) claim 1 , and cysteine (C).5. The beta-lactamase of any one of the above claims claim 1 , wherein the hydrophilic amino acid residue is a polar and negatively charged hydrophilic residue selected from aspartate (D) and glutamate (E).6. The beta-lactamase of any one of the above claims claim 1 , wherein the hydrophobic amino acid is a hydrophobic claim 1 , aliphatic amino acid selected from glycine (G) claim 1 , alanine (A) claim 1 , leucine (L) claim 1 , isoleucine (I) claim 1 , methionine (M) claim 1 , and valine (V) or a hydrophobic claim 1 , aromatic amino acid selected from phenylalanine (F) claim 1 , tryptophan (W) claim 1 , and tyrosine (Y).7. A beta-lactamase comprising an amino acid sequence having at least about 70% sequence ...

Modulation of Oxidative Stress and Amino Acid Metabolism for the Treatment or Prevention of Diseases and Disorders

The present invention relates methods for treating cancer by comprising administering to the subject an agent for reducing at least one NEAA, inhibiting the PPP pathway, inhibiting the sorbitol pathway, inhibiting heme biosynthesis, or any combination thereof. The invention also includes methods of treating cancer comprising detecting a tumor as having increased ROS administering to the subject an agent for reducing at least one NEAA, inhibiting the PPP pathway, inhibiting the sorbitol pathway or inhibiting heme biosynthesis, or any combination thereof. 1. A method for treating or preventing tumor growth or metastasis in a subject in need thereof , the method comprising at least one of:a) increasing the level of reactive oxygen species (ROS) in the subject;b) administering a composition, or treatment regimen, for reducing the level of at least one amino acid selected from the group consisting of glutamate, glutamine, proline, serine, alanine, glycine, arginine, lysine, asparagine, methionine, threonine, and isoleucine;c) inhibiting the pentose phosphate pathway (PPP);d) inhibiting the sorbitol pathway; ande) inhibiting the heme biosynthesis pathway.2. The method of claim 1 , wherein the method of increasing the level of reactive oxygen species in the subject comprises at least one selected from the group consisting of:a) administering an inhibitor of Keap1;b) administering an inhibitor of glutathione (GSH);c) administering an activator of NRF2;d) administering an inhibitor of thioredoxin reductases; ande) administering an electrophile that reacts with Keap1 cysteines and leads to Nrf2 stabilization, to the subject.3. The method of claim 2 , wherein the inhibitor of Keap1 is selected from the group consisting of a chemical compound claim 2 , a protein claim 2 , a peptide claim 2 , a peptidomemetic claim 2 , an antibody claim 2 , a ribozyme claim 2 , a small molecule chemical compound claim 2 , a nucleic acid claim 2 , a vector claim 2 , and an antisense nucleic acid ...

Methods and compositions for modulating the immune system with arginase i

Methods and compositions comprising recombinant Arginase I proteins which are capable of depleting the plasma arginine levels in a subject are disclosed. The methods and compositions can be used to modulate the activity of the immune system in a subject. Modulation of the immune system is useful in the treatment of immune disorders and in preventing rejection of a transplanted organ, tissue, or cell. The methods and compositions can also be used to treat a bone condition of a subject.

SELECTIVE RECOVERY

Provided herein are methods of selective screening. In addition, various targeting proteins and sequences, as well as methods of their use, are also provided. 1. An AAV polynucleotide comprising a capsid sequence , wherein said capsid sequence (a) encodes an AAV capsid protein , (b) has at least 99% identity to SEQ ID NO: 11 , and (c) comprises a nucleotide sequence which (i) comprises at least 12 nucleotides from the sequence ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51) and encodes at least 4 contiguous amino acids from the sequence TRTNPEA (SEQ ID NO: 56) , or (ii) comprises at least 12 nucleotides from the sequence AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO: 26) and encodes at least 4 contiguous amino acids from the sequence SVSKPFL (SEQ ID NO: 28).2. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises a nucleotide sequence which comprises at least 12 nucleotides from the sequence ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51) and encodes at least 4 contiguous amino acids from the sequence TRTNPEA (SEQ ID NO: 56).3. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises a nucleotide sequence which comprises at least 18 nucleotides from the sequence ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51) and which encodes at least 6 contiguous amino acids from the sequence TRTNPEA (SEQ ID NO: 56).4. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51).5. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51) inserted between two nucleotides in the capsid sequence which correspond to nucleotides 1764 and 1765 of SEQ ID NO: 11.6. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises a nucleotide sequence which comprises at least 12 nucleotides from the sequence AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO: 26) and encodes at least 4 contiguous amino acids from the sequence SVSKPFL (SEQ ID NO: 28).7. The AAV polynucleotide of claim 1 , wherein the ...

METHODS OF TREATING CANCER WITH FARNESYLTRANSFERASE INHIBITORS

The present invention relates to the field of molecular biology and cancer biology. Specifically, the present invention relates to methods of treating a KIR-mutant cancer in a subject with a farnesyltransferase inhibitor (FTI). The present invention also relates to methods of treating a subject with a farnesyltransferase inhibitor (FTI) that include determining whether the subject is likely to be responsive to the FTI treatment based on the mutation status of a member of the KIR family in the subject. 1. A method of treating a cancer in a subject in need thereof , said method comprising administering a therapeutically effective amount of a farnesyltransferase inhibitor (FTI) to said subject , wherein the cancer is a cancer known to have or determined to have a mutation in a member of the KIR family selected from the group consisting of: KIR2DL1 , KIR2DL3 , KIR2DL4 , KIR3DL1 , and KIR3DL2.2. The method of claim 1 , wherein the KIR2DL1 claim 1 , KIR2DL3 claim 1 , KIR2DL4 claim 1 , KIR3DL1 claim 1 , and/or KIR3DL2 claim 1 , has two of more mutations comprising two or more modifications at two or more codons encoding two or more amino acids in the extracellular domain claim 1 , at two or more codons encoding two or more amino acids in the cytoplasmic domain claim 1 , or combinations thereof.3. The method of any one of - claim 1 , wherein the KIR2DL1 claim 1 , KIR2DL3 claim 1 , KIR2DL4 claim 1 , KIR3DL1 claim 1 , and/or KIR3DL2 claim 1 , has three of more mutations comprising three or more modifications at three or more codons encoding three or more amino acids in the extracellular domain claim 1 , at three or more codons encoding three or more amino acids in the cytoplasmic domain claim 1 , or combinations thereof.4. The method of any one of - claim 1 , wherein the FTI claim 1 , optionally tipifarnib claim 1 , is selectively administered to a subject to treat the KIR-mutant cancer claim 1 , and wherein the KIR-mutant cancer has or comprises a mutation in KIR2DL1.5. The ...

NEW VACCINAL STRATEGY TO PREVENT OR TREAT RHUMATOID ARTHRITIS

The present invention relates to field of treatment of rheumatoid arthritis. The inventors propose that PAD4, one of the enzymes which convert arginine into citrulline, is a target antigen for T cells that help the production of ACPA. They recently demonstrated that PAD immunization triggers anti-citrullinated fibrinogen antibody production in normal mice. Here, they demonstrate that the risk (OR) to develop RA associated with each of 12 HLA-DRB1 genotype correlates with the likelihood for the two HLA-DR molecules encoded by each genotype to bind at least one random peptide from PAD4, but not from citrullinated or native fibrinogen. PBLs from patients with RA, PsA and controls proliferate to PAD4 and they identify, notably, a peptide from PAD4, p8 (SEQ ID NO: 6), that stimulates T cells from RA patients and a few patients with PsA. Proliferative responses to p8 are associated with RA, shared epitope positive HLA-DR alleles and antibodies to PAD4. Thus the present invention relates to a peptide derived from the PAD4 protein and its use in the treatment and prevention of rheumatoid arthritis. 1. A peptide derived from the PAD4 protein of SEQ ID NO°: 2.2. The peptide according to wherein said peptide is described in table 1.3. The peptide according to wherein said peptide binds to a HLA-DRB1*0101 claim 1 , HLA-DRB1*0401 claim 1 , HLA-DRB1*0404 claim 1 , HLA-DRB1*0402 or HLA-DRB1*0701 molecule.4. The peptide according to wherein said peptide comprises or consists of the amino acid sequence of amino acids 61 to 100 of SEQ ID NO°: 2.5. The peptide according to wherein said peptide comprises or consists of the amino acid sequence SEQ ID NO: 3: or SEQ ID NO: 4.6. The peptide according to wherein said peptide comprises or consists of the amino acid sequence SEQ ID NO: 5: DPGVEVTLTMK-Xaa12-ASGSTGDQ wherein Xaa12 is an alanine (Ala or A) claim 1 , or a valine (Val or V) or a function-conservative variant thereof.7. The peptide according to wherein said peptide has the amino ...

THERANOSTIC IMAGING AGENTS AND METHODS OF USE

The present invention provides targeted nanoplex molecules which carry multimodality imaging reporters together with target enzyme inhibitors such as siRNAs and target prodrug enzymes, that are useful for theranostic imaging of cells and diseases, including, for example, various cancers, and including metastatic prostate cancer. The nanoplex molecules of the present invention provide a platform technology toward many cancer subtypes and alternative therapeutic targets. Downregulation of specific pathways using targeted enzyme inhibitors further provides unique opportunities to target cancer cells selectively while sparing normal tissue. The nanoplex molecule platform described herein has the ability to deliver multiple siRNA enzyme inhibitors. Methods of diagnosis and treatment of various diseases are also included. The strategy described herein can be useful to down-regulate multi-drug resistance pathways, or repair enzymes with the goal of increasing the efficacy, safety, and efficiency of chemotherapeutic or irradiation therapies. 1. A nanoplex molecule comprising:a) a prodrug enzyme portion;b) a reporter portion;c) an enzyme inhibitor portion; andd) a targeting agent.2. A nanoplex molecule comprising a prodrug portion , a reporter portion , an enzyme portion and a targeting agent , wherein ,the prodrug enzyme portion comprises an enzyme;the reporter portion comprises a poly-L-lysine carrier linked to a dye and a chelating agent labeled with a radioisotope linked to a polyethyleneimine (PEI):poly ethylene glycol (PEG) co-polymer; andthe targeting agent binds a target cell membrane protein with high affinity.3. The nanoplex molecule of claim 1 , wherein the prodrug enzyme portion comprises the enzyme bacterial cytosine deaminase (bCD).4. The nanoplex molecule of claim 1 , wherein the reporter portion comprises a poly-L-lysine carrier linked to Cy5.5 dye.5. The nanoplex composition of claim 1 , wherein the reporter portion comprises a DOTA moiety labeled with In ...

Cancer combination therapy and recombinant vectors

This disclosure relates to a combination therapy of chemotherapeutics and/or radiosensitizing agents with a replication competent viral vectors for treating cell proliferative disorders and chemotherapeutic treatments. The disclosure further relates to the use of such replication competent viral vectors for delivery and expression of a heterologous nucleic acid in normal and diseased tissues and methods and compositions that facilitate such delivery and expression to tissues in vivo and in vitro. The disclosure further relates to replication competent retroviral vectors for these uses and in conjunction with methods and compositions that facilitate in vivo therapeutics.

BETA-LACTAMASE FORMULATIONS AND USES THEREOF

The present invention provides, in part, formulations comprising a beta-lactamase. Particularly, modified-release formulations comprising a beta-lactamase are provided which release a substantial amount of the beta-lactamase in the intestines. Therapeutic uses of the beta-lactamase formulations are also provided. 151-. (canceled)52. A modified-release formulation comprising a beta-lactamase , wherein the formulation comprises at least one modified-release pellet , and wherein each modified-release pellet comprises:about 10-20% by weight beta-lactamase;about 20-30% by weight sucrose sphere;about 30-40% by weight hydroxypropylcellulose;about 15-25% by weight an enteric polymer;about 1.5-2.5% by weight triethyl citrate;about 0.5-1.5% by weight glyceryl monostearate;about 0.1-1.0% by weight polysorbate-80; andabout 1-2% by weight of buffer salt.53. The modified-release formulation of claim 52 , wherein each modified-release pellet comprises:about 16% by weight beta-lactamase;about 23% by weight sucrose sphere;about 35% by weight hydroxypropylcellulose;about 21% by weight an enteric polymer;about 2% by weight triethyl citrate;about 1% by weight glyceryl monostearate;about 0.5% by weight polysorbate-80; andabout 2% by weight of buffer salt.54. The modified-release formulation of claim 52 , wherein each modified-release pellet comprises:about 15.8% by weight beta-lactamase;about 23.3% by weight sucrose sphere;about 35% by weight hydroxypropylcellulose;about 20.8% by weight an enteric polymer;about 2.1% by weight triethyl citrate;about 1% by weight glyceryl monostearate;about 0.4% by weight polysorbate-80; andabout 1.6% by weight of buffer salt.55. The modified-release formulation of claim 52 , wherein the beta-lactamase comprises an amino acid sequence having at least 95% identity with SEQ ID NO: 1.56. The modified-release formulation of claim 55 , wherein the beta-lactamase comprises an amino acid sequence having at least 95% identity with SEQ ID NO: 1 and an asparagine ...

Compositions and methods comprising sirtuin stimulators and non-sirtuin protein deacetylase inhibitors

The present technology relates to cosmetic and pharmaceutical compositions useful for minimizing the appearance of aging via a safe method of stimulating sirtuin activity. In particular, the present technology relates to compositions and methods that utilize a combination of a sirtuin activator with a sirtuin-offsetting agent in order to maintain a healthy population of skin cells while preventing survival and growth of abnormal cells that are irreparably damaged.

ABHD5 AND PARTIAL HDAC4 FRAGMENTS AND VARIANTS AS A THERAPEUTIC APPROACH FOR THE TREATMENT OF CARDIOVASCULAR DISEASES

The present invention relates to Abhydrolase containing domain 5 (ABHD5) and N-terminal fragments of HDAC4 (HDAC4-NT) and variants of the aforementioned peptides for the treatment and prevention of heart failure. The present invention further provides vectors for the cardiomyocyte-specific expression of said peptides and a test system comprising ABHD5 for the identification of novel compounds which are useful for the treatment of heart failure. 117-. (canceled)18. An abhydrolase containing domain 5 (ABHDS) or variant thereof or a vector comprising a nucleic acid encoding said ABHDS or variant thereof.19. The ABHD5 or variant thereof or vector of claim 18 , wherein ABHDS or variant thereof is expressed under control of the human troponin promoter and a recognition site for micro-RNA 122 between the promoter and the terminator sequence so that said recognition site becomes part of the transcript produced from this vector.20. The ABHD5 or variant thereof or vector of claim 18 , wherein said ABHD5 variant is a deletion variant of human claim 18 , mouse or rat ABHD5 lacking 30 amino acid positions at the N-terminus.21. The ABHD5 or variant thereof or vector of claim 18 , wherein said ABHD5 variant is a substitution variant of human ABHDS claim 18 , wherein at least one tryptophan selected from the group consisting of the tryptophan at position 19 claim 18 , the tryptophan at position 23 and the tryptophan at position 27 is replaced by an alanine.22. The ABHD5 or variant thereof or vector of claim 18 , wherein said ABHD5 variant is a substitution variant of mouse or rat ABHD5 claim 18 , wherein at least one tryptophan selected from the group consisting of the tryptophan at position 22 claim 18 , the tryptophan at position 26 and the tryptophan at position 30 is replaced by an alanine.23. An elongated and/or multimerized variant of the N-terminal fragment of histone deacetylase 4 (HDAC4-NT) or a vector comprising a nucleic acid encoding said HDAC4-NT variant.24. The ...

Cellular apobec3 proteins and modulators thereof for regulating dna repair processes and treating proliferative diseases

The present invention provides methods, compositions and kits for modulating DSB repair processes in a subject in need thereof. More specifically, the invention provides the use of compounds that modulate the expression or activity of at least one APOBEC family member for modulating DSB repair processes.

PHARMACEUTICAL COMPOSITION AGAINST CHRONIC BACTERIAL INFECTIONS

The present invention relates to a polypeptide comprising a peptidoglycan hydrolase for use as a medicament for the treatment of chronic bacterial infections. The present invention further relates to a polypeptide comprising a peptidoglycan hydrolase comprising an endopeptidase, N-acetyl-muramoyl-L-alanine-amidase, N-acetyl-muramidase, N-acetyl-glucosaminidase and/or lytic transglycosylase. 1Pseudomonas, Escherichia, Staphylococcus aureus, Acinetobacter, Mycobacterium avium, Mycobacterium tuberculosis, Listeria monocytogenesSalmonella. A method of treating a chronic bacterial infection in a subject comprising administering to said subject an endolysin , wherein the chronic bacterial infection is associated with and/or bacteria.2. The method of claim 1 , wherein the endolysin is an endopeptidase claim 1 , N-acetyl-muramoyl-L-alanine-amidase claim 1 , N-acetyl-muramidase claim 1 , N-acetyl-glucosaminidase and/or lytic transglycosylase.3. The method of claim 1 , wherein the endolysin is PhiV10p30 of phage ΦV10 STM0907.Fels0 of phage FELS-1 claim 1 , epsilon15p25 of phage ε15 claim 1 , YuA20 of phage YUA claim 1 , ORF23 of phage B3 claim 1 , BcepMu22 of phage BcepMu claim 1 , F116p62 of phage F116 claim 1 , STM2715.S.Fels2 of phage Fels2 claim 1 , gp76 of phage ES18 claim 1 , SPSV3_gp23 of phage SETP3 claim 1 , phi32_17 of phage ΦECO32 claim 1 , HK022p54 of phage HK022 claim 1 , HK97p58 of phage HK97 claim 1 , HK620p36 of phage HK620 claim 1 , VIP0007 of phage E1 claim 1 , Sf6p62 of phage SF6 claim 1 , R (SfVp40) of phage SFV claim 1 , gp22 of phage BCEPC6B claim 1 , K (P2p09) of phage P2 claim 1 , K (Wphi09) of phage WΦ claim 1 , rv5_gp085 of phage RV5 claim 1 , EpJS98_gp116 of phage JS98 claim 1 , gp3.5 of phage 13A claim 1 , gp3.5 of phage BA14 claim 1 , gp3.5 of phage ECODS1 claim 1 , CKV1F_gp16 of phage K1F claim 1 , T3p18 of phage T3 claim 1 , gh-1p12 of phage GH-1 claim 1 , gp3.5 of phage K11 claim 1 , ORF12 of phage ΦCTX claim 1 , Bcep43-27 of phage BCEP43 claim ...

Polypeptide with Asparaginase Activity, Expression Cassette, Expression Vector, Host Cell, Pharmaceutical Composition, Methods for Producing a Polypeptide with Asparaginase Activity and for Preventing or Treating Cancer, and Use of a Polypeptide

The present invention refers to polypeptides with asparaginase activity that have an increased rate of self-processing compared to human wild L-asparaginase (ASRGL1), with mutation in the ASRGL1 glycine rich loop called HGG loop (Histidine 8-Glycine 9-Glycine 10). Polynucleotides that encode the polypeptides of invention are also described here, expression cassettes comprising so-called polynucleotides, expression vectors, host cells, pharmaceutical compositions, uses of the invention polypeptide in the manufacture of a preventive medicine or cancer treatment and methods to produce the polypeptide of invention and to prevent or treat cancer. 1. A polypeptide with asparaginase activity , characterized by the fact that it is selected from the group consisting of(i) a polypeptide that has an increased rate of auto-processing compared to human L-asparaginase in the wild presented in SEQ ID NO: 1;(ii) a polypeptide comprising the amino acid sequence having at least 90% identity with the sequences of any of the SEQ ID NOs: 3-5;(iii) a polypeptide in which the amino acid glycine at position 10 of the SEQ ID NO: 1 is replaced by an amino acid selected from the group consisting of glutamic acid, aspartic acid and histidine;(iv) a polypeptide comprising the amino acid sequence presented in any of the SEQ ID NO: 3-5; e(v) a polypeptide of (i) to (iv) comprising one or more conservative amino acid substitutions.2. Polypeptide according to claim 1 , characterized by the fact that it comprises the SEQ ID NO:3 amino acid sequence.3. Polypeptide according to or claim 1 , characterized by the fact that it is for use in cancer prevention or treatment.4. Polypeptide according to claim 3 , characterized by the fact that the cancer is acute myeloid leukemia (AMI) claim 3 , chronic lymphoid leukemia claim 3 , ovarian cancer claim 3 , brain cancer claim 3 , prostate cancer claim 3 , lung adenocarcinoma claim 3 , non-Hodgkin's lymphoma or sarcoma.5. Polypeptide according to claim 4 , ...

PROTEIN FORMULATIONS AND METHODS OF MAKING SAME

The invention provides an aqueous formulation comprising water and a protein, and methods of making the same. The aqueous formulation of the invention may be a high protein formulation and/or may have low levels of conductivity resulting from the low levels of ionic excipients. Also included in the invention are formulations comprising water and proteins having low osmolality. 1101-. (canceled)102. An aqueous pharmaceutical formulation comprising:(a) an anti-tumor necrosis factor alpha antibody comprising a light chain variable region (LCVR) having a CDR3 domain comprising the amino acid sequence of SEQ ID NO:3, a CDR2 domain comprising the amino acid sequence of SEQ ID NO:5, and a CDR1 domain comprising the amino acid sequence of SEQ ID NO: 7, and a heavy chain variable region (HCVR) having a CDR3 domain comprising the amino acid sequence of SEQ ID NO:4, a CDR2 domain comprising the amino acid sequence of SEQ ID NO: 6, and a CDR1 domain comprising the amino acid sequence of SEQ ID NO:8, wherein the concentration of the antibody is 50 to 200 mg/ml;(b) from 10-50 mM NaCl;(c) a surfactant;(d) a polyol; and(e) water;wherein the formulation does not comprise a buffering system, andwherein the pH of the formulation is from 4 to 8.103. The formulation of claim 102 , wherein the surfactant is a non-ionic surfactant.104. The formulation of claim 103 , wherein the surfactant is a polysorbate.105. The formulation of claim 104 , wherein the surfactant is polysorbate-20 or polysorbate-80.106. The formulation of claim 102 , wherein the polyol is a sugar or sugar alcohol.107. The formulation of claim 106 , wherein the polyol is sucrose or mannitol.108. The formulation of claim 102 , wherein the surfactant is a non-ionic surfactant claim 102 , and wherein the polyol is a sugar or sugar alcohol.109. The formulation of claim 108 , wherein the surfactant is a polysorbate.110. The formulation of claim 109 , wherein the surfactant is polysorbate-20 or polysorbate-80.111. The ...

CHOLIX TOXIN-DERIVED FUSION MOLECULES FOR ORAL DELIVERY OF BIOLOGICALLY ACTIVE CARGO

The present disclosure relates to pharmaceutical compositions comprising a non-naturally occurring fusion molecule and one or more pharmaceutically acceptable carriers, formulated for oral delivery to a subject, and designed to provide for improved, effective therapies for treatment of, e.g., inflammatory diseases, autoimmune diseases, cancer, metabolic disorders, and growth deficiency disorders. 1. A pharmaceutical composition comprising a non-naturally occurring fusion molecule and one or more pharmaceutically acceptable carriers , and formulated for oral delivery to a subject , wherein the fusion molecule comprises: (i) a modified Cholix toxin consisting of at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NO: 1 or a fragment thereof conjugated to (ii) a biologically active cargo selected from:an interleukin-10 consisting of at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NO: 82 or a fragment thereof;an interleukin-22 consisting of at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NO: 85 or a fragment thereof;a human growth hormone consisting of at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NO: 95 or a fragment thereof;an anti-TNF-α antibody or antibody fragment consisting of at least 90% sequence identity to the amino acid sequence set forth in any one of SEQ ID NOS: 88-91 or a combination thereof; ora GLP-1 agonist peptide consisting of at least 90% sequence identity to the amino sequence set forth in any one of SEQ ID NOS: 93-94 or a fragment thereof.2. The pharmaceutical composition of claim 1 , wherein the modified Cholix toxin comprises a truncation at an amino acid residue within Cholix toxin domain Ib.3. The pharmaceutical composition of claim 1 , wherein the fusion molecule has the ability to activate the receptor for the biologically active cargo claim 1 , or to enable the catalytic process of a catalytically-active material.4. The ...

Heparosan-Polypeptide and Heparosan-Polynucleotide Drug Conjugates and Methods of Making and Using Same

Compositions containing conjugates of heparosan polymer with at least one drug are disclosed, along with methods of production and use thereof. 1. A composition comprising at least one heparosan polymer-drug conjugate , comprising:at least one heparosan polymer, wherein the heparosan polymer is characterized as being substantially non-antigenic, substantially non-immunogenic, and substantially biologically inert within extracellular compartments of a mammalian patient, being stable in the mammalian bloodstream, and being degraded intracellularly in the mammalian patient; andat least one drug covalently or non-covalently conjugated to the at least one heparosan polymer, wherein the at least one drug comprises at least one polypeptide and/or at least one polynucleotide, and wherein the at least one drug is selected from the group consisting of a cytokine, a hormone, an enzyme, an antibody, an antibody fragment, an aptamer, functional equivalents or analogs thereof, and combinations thereof.2. The composition of claim 1 , wherein the at least one drug is selected from the group consisting of Granulocyte Colony Stimulating Factor (G-CSF) claim 1 , Interferon claim 1 , Insulin claim 1 , Growth Hormone (hGH) claim 1 , Glucagon-like peptide-1 (GLP-1) claim 1 , Phenylalanine Ammonia-Lyase (PAL) claim 1 , L-Asparaginase (Asp) claim 1 , Anti-TNF alpha Fab′ claim 1 , functional equivalents or analogs thereof claim 1 , and combinations thereof.3. The composition of claim 1 , wherein the heparosan polymer has a mass in a range of from about 600 Da to about 4.5 MDa.4. The composition of claim 1 , wherein the heparosan polymer comprises an activated group with which a group on the drug has reacted to effect the covalent or non-covalent conjugation of the drug to the heparosan polymer claim 1 , and wherein the reactive group is selected from the group consisting of an aldehyde claim 1 , alkyne claim 1 , ketone claim 1 , maleimide claim 1 , thiol claim 1 , azide claim 1 , amino ...

POLYPEPTIDE MIXES WITH ANTIBACTERIAL ACTIVITY

The invention relates to the field of microbiology, specifically to a combination of a source of a first enzymatic active domain and a source of a second enzymatic active domain and to a composition comprising said combination. The invention further relates to a composition comprising said combination for use as a medicament, to the use of said composition as an antimicrobial agent and to a method for controlling microbial contamination in a food- or feed product, on and/or in food- or feed processing equipment, on and/or in food- or feed containers. 1. A composition comprising a combination of a source of a first enzymatic active domain and a source of a second enzymatic active domain , wherein said first and second enzymatic active domains each exhibit distinct target bond specificities and are comprised on a distinct first and second polypeptide , and wherein said first and second polypeptide comprise a different multiplicity of said first and/or second enzymatic active domain.2Staphylococcus.. The composition according to claim 1 , wherein said different target bonds are essential bonds in a peptidoglycan layer of a bacterial cell claim 1 , wherein said bacterial cell is a3. The composition according to claim 2 , wherein said first and/or said second enzymatic active domain is a domain selected from the group consisting of a cysteine claim 2 , histidine-dependent amidohydrolases/peptidase domain claim 2 , an endopeptidase domain claim 2 , an amidase domain and a glycosylhydrolase.4. (canceled)5. The composition according to claim 1 , wherein each of said distinct first and second polypeptide further comprises a cell wall-binding domain.6. The composition according to claim 5 , wherein:said first enzymatic active domain is a cysteine, histidine-dependent amidohydrolases/peptidase domain and said second enzymatic active domain is an endopeptidase domain,said combination further comprises a source of a third enzymatic active domain comprised on a distinct third ...

GENE EXPRESSION SYSTEM AND REGULATION THEREOF

The present invention relates to a novel gene expression system comprising: a) a first nucleotide sequence encoding a fusion polypeptide of: a1) a destabilizing domain (DD) based on DHFR, and a2) a GTPcyclohydrolase 1 (GCH1) polypeptide, or a biologically active fragment or variant thereof; and b) a second nucleotide sequence encoding a tyrosine hydroxylase (TH) polypeptide, or a biologically active fragment or variant thereof. The invention also relates to use of this gene expression system together with a ligand binding to a destabilizing domain (DD) based on dihydrofolate reductase (DHFR) for treatment of diseases associated with a reduced dopamine level, such as Parkinson's disease. 1. A gene expression system comprising: a) a destabilizing domain (DD), and', 'b) a GTPcyclohydrolase 1 (GCH1) polypeptide, or a biologically active fragment or variant thereof; and, 'a first nucleotide sequence encoding a fusion polypeptide ofa second nucleotide sequence encoding a tyrosine hydroxylase (TH) polypeptide, or a biologically active fragment or variant thereof.24-. (canceled)5. A gene expression system according to claim 1 , wherein said gene expression system comprises two vectors each containing one expression cassette claim 1 , wherein:the expression cassette in the first vector comprises the first nucleotide sequence and a first promoter sequence operably linked to the first nucleotide sequence, andthe expression cassette in the second vector comprises the second nucleotide and a second promoter sequence operably linked to the second nucleotide sequence.6. A gene expression system according to claim 1 , wherein said gene expression system comprises one vector comprising both the first nucleotide sequence and the second nucleotide sequence claim 1 , wherein the vector comprises either: ia) a promotor is operably linked to either the first or the second nucleotide sequence, and wherein the nucleotide sequence to which the promotor is linked to the other of the first ...

Beta-lactamase formulations

The present invention provides, in part, formulations comprising a beta-lactamase. Particularly, modified-release powder formulations comprising a beta-lactamase are provided which release a substantial amount of the beta-lactamase in the intestines. Therapeutic uses of the beta-lactamase formulations are also provided.

ENZYME-RESPONSIVE PEPTIDE NANOFIBER COMPOSITIONS AND USES THEREOF

The disclosure provides compositions comprising peptide-based nanofiber precursors and methods of using the same to inhibit cancerous cell growth and/or to deliver therapeutic or diagnostic agents to cells, e.g., cancerous cells. The compositions of the present technology include peptide-based nanofiber precursors as well as carrier complexes comprising a therapeutic or diagnostic agent, and a peptide-based nanofiber precursor. Also provided herein are methods for delivering a therapeutic or diagnostic agent to a cell comprising contacting the cell with a carrier complex including a therapeutic or diagnostic agent, and a peptide-based nanofiber precursor. 1. A peptide-based nanofiber comprising a plurality of peptides , wherein each peptide comprises a methoxypolyethylene glycol (mPEG) polymer , a fluorophore and a self-assembling domain comprising the sequence KLDLKLDLKLDLK (SEQ ID NO: 1) , wherein the self-assembling domain is interspersed between the fluorophore and the mPEG polymer , wherein each amino acid of SEQ ID NO: 1 is an L-amino acid.2. The peptide-based nanofiber of claim 1 , wherein each peptide further comprises a hexalysine motif claim 1 , wherein the hexalysine motif is interspersed between the mPEG polymer and the self-assembling domain.3. The peptide nanofiber of claim 1 , wherein the fluorophore is FITC claim 1 , TAMRA or Cy5.5®.46.-. (canceled)7. A peptide-based nanofiber comprising a mixture of a first plurality of peptides and a second plurality of peptides claim 1 ,wherein each peptide of the first plurality of peptides comprises a first methoxypolyethylene glycol (mPEG) polymer, a first fluorophore, and a first self-assembling domain comprising the sequence KLDLKLDLKLDLK (SEQ ID NO: 1), wherein the first self-assembling domain is interspersed between the first fluorophore and the first mPEG polymer, wherein each amino acid of SEQ ID NO: 1 is an L-amino acid; andwherein each peptide of the second plurality of peptides comprises a second ...

Arginine Deiminase Mutant Methods of Using the Same

An arginine deiminase mutant with improved enzyme activity and temperature stability and application thereof were provided, belonging to the technical field of genetic engineering and enzyme engineering. The arginine deiminase mutant is proline, namely Gly292 Pro, mutated from glycine near an enzyme active center. A wild-type arginine deiminase arcA coding gene is molecularly modified by a site-directed mutation technique to obtain a mutant enzyme ADIG292P, which has glycine at position 292 of an amino acid sequence of the wild type arginine deiminase mutated to proline. The arginine deiminase, modified by site-directed mutation, of the present invention has 1.5 times of increase in enzyme activity and 5.43 times of increase in half-life period at 40° C. compared with the wild-type enzyme, which solves the problems of low catalytic ability and temperature stability during the catalytic synthesis of citrulline using arginine deiminase, and lays a foundation for industrial production of efficient synthesis of citrulline and medication application. 1. A gene encoding an arginine deaminase mutant, wherein the nucleotide sequence of the gene is set forth in SEQ ID NO: 2, wherein the arginine deaminase mutant comprises mutation Gly292Pro compared to a parent arginine deiminase and greater enzyme activity and greater temperature stability than the parent arginine deiminase. This application claims priority to U.S. patent application Ser. No. 15/907,340 filed on Feb. 28, 2018 and Chinese Patent Application CN 201710119423.9 filed on Mar. 2, 2017, the entirety of the contents of which are incorporated herein by reference.The disclosure herein relates to the field of genetic engineering and enzyme engineering, which relates to an arginine deiminase mutant with improved enzyme activity and temperature stability and application thereof.Arginine deiminase (EC 3.5.3.6), abbreviated as ADI, can hydrolyze arginine to produce citrulline and ammonia. Since the first report in 1933, ...

APOBEC3A AS AN ANTI-TUMOR AGENT

The present invention relates to the use of a nucleic acid that comprises a sequence encoding an APOBEC3A protein, in preventing or treating a tumor in a patient. 1. A protein for use in A method for preventing or treating a solid tumor in a patient , which method comprises administering the patient with a nucleic acid that comprises a sequence encoding an APOBEC3A protein , by injection at the tumor site.2. The method according to claim 1 , wherein the sequence encodes SEQ ID NO: 2.3. The method according to claim 1 , wherein the nucleic acid sequence encodes an amino acid sequence that shows at least 95% homology with SEQ ID NO: 2.4. The method according to claim 3 , wherein the nucleic acid sequence encodes an amino acid sequence that is identical to SEQ ID NO: 2 claim 3 , except for one or up to six point mutations.5. The method according to claim 1 , wherein the nucleic acid is in form of a plasmid or viral vector.6. The method according to claim 1 , wherein the nucleic acid is injected by electroporation.7. The method according to claim 1 , wherein the tumor is a solid cancer.8. The method according to claim 7 , wherein the tumor is a solid cancer selected from the group consisting of melanoma claim 7 , brain tumor such as glioblastoma claim 7 , neuroblastoma and astrocytoma and carcinomas of the bladder claim 7 , breast claim 7 , cervix claim 7 , colon claim 7 , lung claim 7 , especially non-small cell lung cancer (NSCLC) claim 7 , pancreas claim 7 , prostate claim 7 , head and neck cancer claim 7 , or stomach cancer.9. The method according to claim 1 , wherein the nucleic acid is administered in combination with a chemotherapeutic agents claim 1 , an immunomodulator claim 1 , immune checkpoint blocker or radiotherapy.10. The method according to claim 1 , wherein the nucleic acid is for preventing cancer relapses.11. The method according to claim 1 , wherein the injection of the nucleic acid encoding an APOBEC3A protein induces DNA damage response apoptosis ...