ФАРМАЦЕВТИЧЕСКИЙ СОСТАВ ПОЛИМЕРНОГО ПРОИЗВОДНОГО, СОДЕРЖАЩЕГО КАМПТОТЕЦИН

Изобретение относится к фармацевтической промышленности, а именно к фармацевтическому противоопухолевому лиофилизированному составу, включающему рН регулирующий агент и блок-сополимер формулы (1), содержащий звено глутаминовой кислоты, связанное с производным камптотецина:,где R, R, R– H или (C-C) алкильная группа; А – (С-С) алкиленовая группа; R– H, (С-С) ацильная группа или (С-С) алкоксикарбонильная группа; R– -ОН и/или -N(R)CONH(R); Rи R– (C-C) алкильная группа; каждый из t, d, e - целое число; t=45-450; (d+e)=6-60; доля d и e относительно (d+e) соответственно 1-100% и 0-99%; доля звеньев глутаминовой кислоты, когда R-ОН и когда R-N(R)CONH(R), составляет соответственно 15-60% и 0-50% относительно (d+e). При этом рН водного раствора предложенного состава при концентрации блок-сополимера формулы (1) 1 мг/мл в пересчете на производное камптотецина составляет от 3,0 до 6,5. Изобретение обеспечивает улучшение стабильности состава при хранении, сохраняя свойства блок-сополимера образовывать ...

ЭФФЕКТИВНЫЙ ТРАНСПОРТ В ЛЕЙКОЦИТЫ

Изобретение относится к области биотехнологии. Описано применение специфических молекул-конъюгатов, которые являются транспортерами карго-молекул, для транспортировки представляющей интерес субстанции в лейкоциты. Указанные молекулы-конъюгаты, которые являются транспортерами карго-молекулы, можно применять для лечения, профилактики, ослабления и/или уменьшения интенсивности заболевания и/или нарушения, в котором принимают участие лейкоциты. Описаны также способ получения указанных молекул-конъюгатов, которые являются транспортерами карго-молекул, способ транспортировки представляющей интерес субстанции в лейкоциты и лейкоциты, содержащие указанные молекулы-конъюгаты, которые являются транспортерами карго-молекул. Изобретение может быть использовано в медицине. 5 н. и 21 з.п. ф-лы, 34 ил., 5 табл., 29 пр.

НОВЫЕ КОНСТРУКЦИИ ТРАНСПОРТЕРОВ И МОЛЕКУЛЫ-КОНЪЮГАТЫ, ЯВЛЯЮЩИЕСЯ ТРАНСПОРТЕРАМИ КАРГО-МОЛЕКУЛ

Изобретение относится к области биотехнологии. Описаны новые конструкции транспортеров общей формулы (I) DLLLD(LLLD)и их варианты. Также раскрыты молекулы-конъюгаты, которые являются транспортерами карго-молекул, прежде всего конъюгаты новых конструкций транспортеров с карго-фрагментом, например, с белками или пептидами, нуклеиновыми кислотами, цитотоксическими агентами, органическими молекулами и т.д. Описаны также фармацевтические композиции, содержащие указанные конъюгаты, и способы лечения и применения с использованием указанных конструкций транспортеров. Предложенная группа изобретений может быть использована в медицине. 6 н. и 12 з.п. ф-лы, 22 ил., 6 табл., 29 пр.

ФАРМАЦЕВТИЧЕСКАЯ КОМПОЗИЦИЯ, СОДЕРЖАЩАЯ ПОЛИМЕРНОЕ ПРОИЗВОДНОЕ КАМПТОТЕЦИНА

Изобретение относится к фармацевтической промышленности, а именно к фармацевтическому противоопухолевому лиофилизированному препарату, включающему блок-сополимер и 2-100 частей по массе сахарида или сахарного спирта относительно 1 части по массе указанного блок-сополимера, где блок-сополимер содержит звено глутаминовой кислоты, связанное с производным камптотецина, и представлен общей формулой (1)в которой R, R, R– H или (C-C) алкильная группа; A – (C-C) алкиленовая группа; R– H, (C-C) ацильная группа или (C-C) алкоксикарбонильная группа; R– -OH или -N(R)CONH(R); R, R– (C-C) алкильная группа; каждый из t, d, e, (d+e) – целое число; t=45-450; (d+e)=6-60; отношение d и e к (d+e) составляет соответственно 1-100% и 0-99%; относительное содержание звеньев глутаминовой кислоты, в которых R-ОН и в которых R-N(R)CONH(R), относительно (d+e) составляет соответственно 15-60% и 0-50%. Изобретение обеспечивает улучшение стабильности препарата при хранении, которая определяется как сохранением свойства ...

Выделение мутантов белка доставки лекарственного средства, усиливающих направленную миграцию

... 1. Способ усиления направленной миграции в клетку, включающий следующие стадии:обеспечение композиции, содержащей белок основания пентона (PB), несущий одну или более мутаций, усиливающих проникновение в клетку; ивведение эффективной дозы этой композиции в клетку.2. Способ по п. 1, где одна или более чем одна мутация представляет собой 111C и/или 333F.3. Способ по п. 1, где композиция направлена на цитоплазму и/или ядро клетки.4. Способ по п. 1, где композиция дополнительно содержит терапевтическое лекарственное средство.5. Способ по п. 1, где клетка представляет собой опухолевую клетку.6. Способ по п. 1, где одна или более чем одна мутация представляет собой SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 и/или SEQ ID NO: 20.7. Способ получения молекулы доставки ...

ПОЛУЧЕНИЕ КОМПЛЕКСОВ НУКЛЕИНОВЫХ КИСЛОТ И ПОПЕРЕЧНО СШИТЫХ ДИСУЛЬФИДНЫМИ СВЯЗЯМИ КАТИОННЫХ КОМПОНЕНТОВ, ПРЕДНАЗНАЧЕННЫХ ДЛЯ ТРАНСФЕКЦИИ И ИММУНОСТИМУЛЯЦИИ

... 1. Комплекс, содержащий полимерный носитель и карго-молекулу, который включает:а) в качестве носителя полимерный носитель, образованный из поперечно сшитых дисульфидными связями катионных компонентов, иб) в качестве карго-молекулы по меньшей мере одну молекулу нуклеиновой кислоты,предназначенный для применения в качестве иммуностимулирующего агента или адъюванта.2. Комплекс, содержащий полимерный носитель и карго-молекулу, предназначенный для применения в качестве иммуностимулирующего агента или адъюванта, по п.1, в котором по меньшей мере одна молекула нуклеиновой кислоты представляет собой РНК.3. Комплекс, содержащий полимерный носитель и карго-молекулу, предназначенный для применения в качестве иммуностимулирующего агента или адъюванта, по п.1 или п.2, в котором по меньшей мере одна молекула нуклеиновой кислоты представляет собой иммуностимулирующую нуклеиновую кислоту.4. Комплекс, содержащий полимерный носитель и карго-молекулу, предназначенный для применения в качестве иммуностимулирующего ...

ПОЛИГЛЮТАМАТАМИНОВЫЕ КИСЛОТНЫЕ КОНЬЮГАТЫ И МЕТОДЫ

... 1. Полимерный конъюгат, включающий повторяющееся звено формулы (I) и повторяющееся звено формулы (II) ! ! где ! каждый n независимо равен 1 или 2; ! каждый А1 представляет кислород или NR5; ! каждый А2 представляет кислород; ! R1 и R2 каждый независимо выбирают из группы, состоящей из C1-10 алкила, С6-20 арила, аммония, щелочного металла, полидентатного лиганда, предшественника полидентатного лиганда с защищенными атомами кислорода и соединения, которое включает агент; где агент выбирают из группы, состоящей из противоракового средства, нацеливающего агента, агента оптической визуализации и агента магнитно-резонансной визуализации; где по крайней мере один из R1 и R2 представляет собой группу, которая включает агент; ! R3 и R4 каждый независимо выбирают из группы, состоящей из водорода, аммония и щелочного металла; ! где полимерный конъюгат включает агент в количестве от приблизительно 1 до приблизительно 50% (вес./вес.), считая на массовое соотношение агента к полимерному конъюгату; !

КОПЛЕКСЫ ДЛЯ ВВЕДЕНИЯ: ВИРУСНЫЙ КОРОВЫЙ ПРОТЕИН-КАТИОННЫЙ ЛИПИД-НУКЛЕИНОВАЯ КИСЛОТА

... 1. Невирусный вектор для введения нуклеиновой кислоты, содержащий конденсированный комплекс полипептид/нуклеиновая кислота и катионный липид, где комплекс включает (а) представляющую интерес нуклеотидную последовательность (NOI), и (б) один или несколько вирусных упаковывающих нуклеиновую кислоту полипептидов или их производных, где полипептиды или их производные (I) обладают способностью связываться с NOI; и (II) обладают способностью конденсировать NOI; и где NOI является гетерологичной по отношению к полипептиду. 2. Вектор по п.1, в котором по меньшей мере один полипептид представляет собой аденовирусный упаковывающий нуклеиновую кислоту полипептид или его производное. 3. Вектор по п.2, где аденовирусный полипептид представляет собой Mul, pV или pVII или его производное. 4. Вектор по любому из пп.1-3, дополнительно включающий полипептид, содержащий последовательность ядерной локализации (NLS). 5. Вектор по п.4, где полипептид, содержащий последовательность ядерной локализации (NLS), ...

ERWEITERUNG DES VITAMIN B 12 - AUFNAHMESYSTEMS UNTER VERWENDUNG VON POLYMEREN

POLYAMINOSÄURE-TRÄGER FÜR OLIGONUKLEOTID

OLIGONUCLEOTID-POLYAMID KONJUGATE

PATHOGEN-GERICHTETE BIOKATALISATOREN

Immobilisierte und aktivitätsstabilisierte Komplexe von LHRH-Antagonisten und Verfahren zu deren Herstellung

The invention relates to a retard system for LHRH antagonists, specially cetrorelix, based on complexation with suitable biophile carriers enabling targeted release of the active substance over a period of several weeks. Acidic polyamino acids, polyasparaginic acids and polyglutaminic acids are selected for complexation with cetrorelix. The cetrorelix polyamino acid complexes are produced from aqueous solutions by combining the solutions and precipitating the complexes which are subsequently centrifuged off and vacuum dried by P2O5, lyophilization proving to be a suitable method. The acidic polyamino, polyglutaminic and polyasparaginic acids display good retarding properties in a static liberation system depending on the hydrophobicity and the molar mass of the polyamino acids. Animal testing demonstrates the principal efficacy of the cetrorelix polyamino acid complexes as a depot system. By complexation of cetrorelix with polyamino acids, testosterone suppression can be achieved in male ...

Wasserlösliche hochmolekulare polymere Arzneistoffzubereitung

BIOKOMPATIBLE MIKROKAPSELN

Daunorubicin-protein conjugates

Daunorubicin-protein conjugates in which the daunorubicin is bound to the protein through 9-acetyl side-chain of the daunorubicin, rather than through the 3'- primary amino group are provided. They may be prepared by reaction of 14-bromo-daunorubicin with an excess of a protein in aqueous- methanolic solution at ambient temperature for 2 to 4 hours. Neutrality is maintained by addition of dilute sodium hydroxide as necessary.

Hydrogel formulations

Protection of contact lenses from microbial contamination caused by handling

Polymers

Method of delivering genes to antigen presenting cells of the skin

Method of delivering genes to antigen presenting cells of the skin.

A molecular delivery complex specific to antigen-presenting cells is formed from a non-viral gene delivery system complexed with foreign genetic material. The complex then enters the targeted cells through a specific receptor and overcomes the degradation mechanism, so that functional uptake of the foreign genetic material, or transduction, of the cell, results in gene expression. The invention also includes method for genetic immunization without a needle.

MODULATION OF COMPLEMENT ACTIVITY

Method of delivering genes to antigen presenting cells of the skin

Method of delivering genes to antigen presenting cells of the skin.

MODULATION OF COMPLEMENT ACTIVITY

Method of delivering genes to antigen presenting cells of the skin

MODULATION OF COMPLEMENT ACTIVITY

CONDENSED PLASMID LIPOSOME ONE COMPLEX TO TRANSFEKTION

PURPOSEFUL COMBINATION IMMUNE THERAPY FOR CANCER AND INFECTIONS

SYNTHESIS AND USE OF REAGENTS FOR THE IMPROVED ONE DNA LIPOFEKTION AND/OR PRODRUGUND DRUG THERAPIES WITH SLOW RELEASE

MEANS FOR PREVENTION AND TREATMENT OF SEXUAL UBERTRAGENEN ILLNESS I

PHARMACEUTICAL FORMULATIONS FOR THE RETARDED RELEASE OF A OR MORE ACTIVE SUBSTANCES AND YOUR THERAPEUTIC APPLICATIONS

POLYGLUTAMAT AMINO ACID KONJUGATE ONE AND PROCEDURE

COMPOSITIONS FOR THE SUPPLY OF GENES TO ANTIGEN-PRESENTING CELLS OF THE SKIN

DEGRADABLE POLYACETAL POLYMERS

KONJUGATE TO THE SUPPLY AT BONES AND PROCEDURE FOR THEIR USE WHEN LEADING PROTEINS TO THE BONE

BLOCK COPOLYMER FOR WIRKSTOFFKONJUGATE AND THEIR PHARMACEUTICAL COMPOSITIONS

PATHOGEN ARRANGED BIOKATALISATOREN

PRE S GENE CODED HEPATITIS B IMMUNOGEN PEPTIDE, VAKZINE, DIAGNOSTIKA AND SYNTHETIC LIPIDI VESICLE CARRIERS.

CHELATING AGENT

STABLE MEDICINE MATERIAL DELIVERY COMPLEXES WITH LIPIDEN AND PROCEDURES FOR THEIR PRODUCTION

CONTROLLED DEGRADABLE POLYMER BIO MOLECULE OR ACTIVE SUBSTANCE CARRIER AND PROCEDURE FOR THE SYNTHESIS OF THIS CARRIER

KATIONI OF DENDRIMER CONNECTIONS AND THEIR USE AS OLIGONUCLEOTID/POLYNUCLEOTID CARRIERS

KONJUGAT, COMPREHENSIVE AN ACTIVE SUBSTANCE, A POLYPEPTID AND A POLYETHER

BIOCOMPATIBLE MICRO CAPS

OSTEOGENI GROWTH FACTORS TO THE DELIVERY AT GOAL ORGAN

NUCLEIC ACID COMPLEX WITH KATIONI POLYMER USEFUL FOR GENE THERAPY

POLYAMINOSÄURE CARRIER FOR OLIGONUKLEOTID

NEW OLIGOMERE KONJUGATE FOR THE TRANSFER OF BIOLOGICAL MOLECULES INTO CELLS

NEW PROTEIN POLYKATION KONJUGATE ONES

ARRANGED DELIVERY OF GENES, THE IMMUNOGEN PROTEINS CODING

Nucleic acid tranfer peptides and their use for injecting nucleic acids into eucaryotic cells

Treatment of infections

The present invention relates among other aspects to a conjugate or a pharmaceutically acceptable salt thereof or a pharmaceutical composition comprising said conjugate or its pharmaceutically acceptable salt for use in a method of preventing or treating an infection, wherein said conjugate is water-insoluble and comprises a polymeric moiety -Z to which a plurality of moieties -L ...

Cell-penetrating peptides

The present invention relates to peptides, in particular cell-penetrating peptides, and to conjugates of such cell-penetrating peptides with a therapeutic molecule. The present invention further relates to use of such peptides or conjugates in methods of treatment or as a medicament, especially in the treatment of genetic disorders and in particular muscular dystrophies such as Duchenne muscular dystrophy.

Nanoparticles for the targeted delivery of therapeutic polypeptides

Nanoparticles can be useful for delivering therapeutic agents, such as anticancer agents to diseased cells. The nanoparticles include a carrier polypeptide and a cargo, which can be bind through electrostatic interactions to form a nanoparticle composition. An exemplary composition comprises nanoparticles comprising a carrier polypeptide comprising a penton base segment and a binding segment: and a polypeptide cargo comprising a tag segment that binds to the binding segment of the carrier poly peptide through an electrostatic interaction. An exemplary carrier polypeptide comprises a penton base segment and a negatively -charged binding segment, which can bind to a positively charged cargo. The carrier polypeptide can also include a cell-targeting segment which can target the nanoparticle to a cell. Compositions comprising nanoparticles can be administered to a subject for the treatment of disease, such as cancer.

SYNTHETIC NANOCARRIERS THAT GENERATE HUMORAL AND CYTOTOXIC T LYMPHOCYTE (CTL) IMMUNE RESPONSES

Disclosed are methods for generating humoral and cytotoxic T lymphocyte (CTL) immune responses in a subject and related compositions. See Fig. 9. WO 2013/019669 PCT/US2012/048670 Anti-OVA Antibody Titers (day 14) Prime/Boost Nanocarrier Vaccination (days 0/10) 100000; Fig. 9 ...

Nucleic acid transporters for delivery of nucleic acids into a cell

Targeted delivery of genes encoding secretory proteins

Method and system for systemic delivery of growth arresting, lipid-derived bioactive compounds

Composition and method for enhancing transport across biological membranes

Methods of use of gamma inhibitor compounds for the attenuation of pain

High-molecular weight derivatives of camptothecins

Immunotherapy compositions, method of making and method of use thereof

Carbohydrate-polyamino acid-drug conjugates

Compositions that include a polymer conjugate and glucosamine operatively associated with the polymer conjugate, wherein the polymer conjugate includes a first drug, are described herein. Also disclosed herein are methods of using such compositions to treat, ameliorate, or diagnose a disease or condition such as cancer.

Synthetic nanocarriers that generate humoral and cytotoxic T lymphocyte (CTL) immune responses

Disclosed are methods for generating humoral and cytotoxic T lymphocyte (CTL) immune responses in a subject and related compositions.

Polyglutamate-amino acid conjugates and methods

Various biodegradable polyglutamate-amino acids comprising recurring units of the general Formulae (I) and (II) are prepared. Such polymers are useful for variety of drug, biomolecule and imaging agent delivery applications.

Uniform field magnetization and targeting of therapeutic formulations

Systems and methods for magnetic targeting of therapeutic particles are provided. Therapeutic particles comprise one or more magnetic or magnetizable materials and at least one therapeutic agent. Therapeutic particles are specifically targeted using uniform magnetic fields capable of magnetizing magnetizable materials, and can be targeted to particular locations in the body, or can be targeted for capture, containment, and removal. Therapeutic particles can comprise antioxidant enzymes, and can be targeted to cells to protect the cells from oxidative damage.

New and improved PEI:DNA vector formulations for in vitro and in vivo gene delivery

Cationic polymers, complexes associating said cationic polymers with therapeutically active substances comprising at least a negative charge, in particular nucleic acids, and their use in gene therapy

Targeted combination immunotherapy of cancer and infectious diseases

SELECTIVE INHIBITION OF POLYGLUTAMINE PROTEIN EXPRESSION

SELECTIVE INHIBITION OF POLYGLUTAMINE PROTEIN EXPRESSION The present invention relates to the selective inhibition of protein expression of CAG repeat-related disease proteins such as Huntingtin using nucleic acid analogs. Peptide nucleic acids and locked nucleic acids are particularly useful analogs.

Drug delivery vehicle comprising conjugates between targeting polyamino acids and fatty acids

The invention provide herein provides for a targeted drug delivery vehicle compositions, methods of manufacture, and methods of treatment for therapeutic applications.

Hydrogel prodrugs

The present invention relates to a process for the preparation of a hydrogel and to a hydrogel obtainable by said process. The present invention further relates to a process for the preparation of a hydrogel-spacer conjugate, to a hydrogel-spacer conjugate obtainable by said process, to a process for the preparation of a carrier-linked prodrug and to carrier- linked prodrugs obtainable by said process, in particular to carrier- linked prodrugs that provide for a controlled or sustained release of a drug from a carrier. In addition, the invention relates to the use of the hydrogel for the preparation of a carrier-linked prodrug.

Glutathione-based drug delivery system

The invention relates to methods of targeted drug delivery of compounds, including, chemical agents, (poly)peptides and nucleic acid based drugs (like DNA vaccines, antisense oligonucleotides, ribozymes, catalytic DNA (DNAzymes) or RNA molecules, siRNAs or 5 plasmids encoding thereof). Furthermore, the invention relates to targeted drug delivery of compounds to extravascular and intracellular target sites within cells, tissues and organs, in particular to target sites within the central nervous system (CNS), into and across the blood-brain barrier, by targeting to glutathione transporters present on these cells, tissues and organs. Thereto, the compounds, or the pharmaceutical acceptable carrier thereof, are conjugated to 0 glutathione-based ligands that facilitate the specific binding to and internalization by these glutathione transporters.

Pharmaceutical preparation of camptothecin-containing polymer derivative

The present invention addresses the problem of providing a pharmaceutical preparation composition which is a pharmaceutical preparation containing a polymerized camptothecin derivative produced by bonding a camptothecin derivative capable of associating in an aqueous solution thereof to form nano particle to a polymer carrier, and which has improved pharmaceutical stability. Particularly, the present invention addresses the problem of providing a pharmaceutical preparation capable of maintaining the nano particle-forming property thereof, which is an important factor, and having excellent storage stability. A pharmaceutical preparation which contains a block copolymer composed of a polyethylene glycol segment and a polyglutamic acid segment linked to each other, wherein the polyglutamic acid segment contains a glutamic acid unit having a camptothecin derivative bonded thereto. In an aqueous solution of the pharmaceutical preparation, associations can be formed. When the pharmaceutical preparation ...

Multi-component biological transport systems

Protecting group comprising a purification tag

The present invention relates to compounds comprising a protecting group moiety-tag moiety conjugate, a method of purification and monoconjugates obtained from such method of purification.

Compounds for medicinal applications

The present invention provides compounds for use in treating and/or preventing influenza. The compound comprises a first and second domain in which the first domain comprises at least one anchoring group which binds to the surface of influenza viruses and the second domain comprises at least one anionic group. The first and second domains are covalently linked. Also provided are pharmaceutically acceptable salts, solvates, prodrugs or stereoisomer of the compounds.

Self-assembling polynucleotide delivery system

Combinations for introducing nucleic acids into cells

Amplification of the vitamin B-12 uptake system using polymers

Internalisation of dna, using conjugates of poly-l-lysine and an integrin receptor ligand

Cationic polymer and lipoprotein-containing system for gene delivery

Nucleic acid transporters for delivery of nucleic acids into a cell

An anti-cyanovirin antibody with an internal image of gp120, a method of use thereof, and a method of using a cyanovirin to induce an immune response to gp120

Polypeptide conjugates for transporting substances across cell membranes

TARGETED DELIVERY OF BONE GROWTH FACTORS

PLATINUM-MACROMOLECULAR CARRIER COMPLEXES

METHODS OF USE OF GAMMA INHIBITOR COMPOUNDS FOR THE ATTENUATION OF PAIN

The disclosure herein relates to modified .gamma.PKC inhibitory peptides, methods of generating such peptides, and method for using .gamma.PKC inhibitory peptides for the treatment of pain.

D-GL CONJUGATE THERAPY

D-GL CONJUCATE THERAPY Receptor blocking technology using proteins conjugated to polymers of D-glutamic acid and D-lysine for treatment of antibody-mediated autoimmune disease, membrane and tumor disorders is disclosed.

GAMMA POLYGLUTAMATED LOMETREXOL AND USES THEREOF

The disclosure relates generally to gamma polyglutamated lometrexol compositions, including delivery vehicles such as liposomes containing the gamma polyglutamated lometrexol, and methods of making and using the gamma polyglutamated lometrexol compositions to treat hyperproliferative disorders (e.g., cancer) and disorders of the immune system (e.g., inflammation and autoimmune diseases such as rheumatoid arthritis).

MODIFIED HEAT SHOCK PROTEINS

The present disclosure generally relates to modified heat shock protein compositions that improve intracellular performance when delivered across the plasma and/or nuclear membranes. Also provided are methods for treating ocular, neurological, muscular, hepatic, renal, integumentary, cardiovascular and pulmonary conditions with the modified heat shock proteins are disclosed herein.

COMPOSITIONS AND METHODS FOR THE PREVENTION AND TREATMENT OF ERGOT ALKALOID TOXICITY

Embodiments of the present invention provide materials and methods for preventing and treating ergot-based toxicity in animals, including humans. In particular, the present disclosure provides materials and methods for ameliorating the harmful physical manifestations of various diseases caused, at least in part, by ergot-based toxicity, including but not limited to caudal heel pain syndrome, idiopathic headshaking, pituitary pars intermedia dysfunction, metabolic syndrome and laminitis in horses; fescue foot, infertility and summer slump in cattle, sheep and goats; and neurologic, mental and somatic disorders in humans.

NOVEL HYDROGEL CONJUGATES

The present invention relates to conjugates comprising backbone moieties that are crosslinked via particular crosslinker moieties to which a plurality of drug moieties are covalently and reversibly conjugated. It also relates to their use as medicaments and their use in the diagnosis, prevention and treatment of diseases.

PEPTIDE OLIGONUCLEOTIDE CONJUGATES

Provided herein are peptide-oligomer-conjugates. Also provided herein are methods of treating a central nervous system disorder, a muscle disease, a viral infection, or a bacterial infection in a subject in need thereof, comprising administering to the subject peptide-oligomer-conjugates described herein.

EXON SKIPPING OLIGOMER CONJUGATES FOR MUSCULAR DYSTROPHY

Antisense oligomer conjugates complementary to a selected target site in the human dystrophin gene to induce exon 53 skipping are described.

PREPARATION OF POLYMER CONJUGATES OF THERAPEUTIC, AGRICULTURAL, AND FOOD ADDITIVE COMPOUNDS

This invention provides an improved synthesis of polymer conjugates of fo rmula (I), of agricultural, therapeutic, and food additive compounds. In par ticular, a process is described for the preparation of conjugates by treatin g primary or secondary alcohol substituents of active compounds with polymer ic nucleophiles using "Mitsunobu" or related reaction conditions.

ESTROGEN CANCER THERAPY

Disclosed are methods for selecting a treatment for, and then treating various types of cancers in males and females, comprising delivery of an anti-cancer drug conjugated to a poly (amino acid) polymer, optionally in combination with estrogen therapy.

THERAPEUTIC COMPOSITIONS INCLUDING THERAPEUTIC SMALL MOLECULES AND USES THEREOF

Disclosed herein are methods and compositions for the treatment and/or prevention of diseases or conditions comprising administration of TSM, and/or naturally or artificially occurring derivatives, analogues, or pharmaceutically acceptable salts thereof, alone or in combination with one or more active agents (e.g., an aromatic-cationic peptide). The present technology provides compositions related to aromatic-cationic peptides linked to TSM and uses of the same. In some embodiments, the aromatic-cationic peptide comprises 2 ',6'- dimethyl-Tyr-D-Arg-Phe-Lys-NH2, Phe-D-Arg-Phe-Lys-NH2, or D-Arg-2',6'-Dmt-Lys-Phe- NH2.

PHARMACEUTICAL COMPOSITION CONTAINING CAMPTOTHECIN POLYMER DERIVATIVE

... [Problem] The problem is to provide a pharmaceutical formulation containing a polymerized camptothecin derivative obtained by bonding a camptothecin derivative having the ability to form nanoparticles by association in aqueous solution to a polymer carrier, wherein the pharmaceutical formulation composition has improved formulation stability. In particular, the problem is to provide a pharmaceutical formulation having excellent storage stability that maintains the ability to form nanoparticles and the camptothecin derivative bonding stability, which are important factors. [Solution] A pharmaceutical formulation containing a block copolymer linking a polyethylene glycol segment and a polyglutamic acid segment including a camptothecin derivative bonded to a glutamic acid unit, and a saccharide, wherein the pharmaceutical formulation forms aggregates in aqueous solution, and the change in the scattered light intensity of the aggregates in the pharmaceutical formulation is 20% or less after ...

Methods for treating adult respiratory distress syndrome

We have discovered that the activated phosphorylated form of focal adhesion kinase (hereafter “FAKp”) strengthens the microvascular endothelial cell (EC) junctions that form a barrier in pulmonary endothelia, and the increased barrier helps to prevent acute lung injury (ALI) and acute respiratory distress syndrome (ARDS). Thus certain embodiments of the invention are directed to prevention and treatment of ALI and ARDS by administering a therapeutically effective amount of FAKp to subjects at risk of developing or diagnosed as having either ALI or ARDS.

Polyacridine nucleic acid delivery peptide complexes

The present invention provides nucleic acid delivery polyplex complexes and anionic open polyplexes comprising a nucleic acid molecule reversibly bound to one or more of nucleic acid delivery polyplex complexes.

Cationic poly (amino acids) and uses thereof

The present invention provides an efficient delivery system for a nucleic acid, more specifically, a cationic poly(amino acid) that has a side chain having a plurality of different amine functional groups in a moiety including a cationic group and that has a hydrophobic group introduced into part of the side chain, and a polyion complex (PIC) of the poly(amino acid) and an oligo- or polynucleotide.

Tat-Based Tolerogen Compositions and Methods for Making and Using Same

A Tat-based tolerogen composition comprising at least one immunogenic antigen coupled to at least one human immunodeficiency virus (HIV) trans-activator of transcription (Tat) molecule wherein the immunogenic antigen can be a foreign or endogenous antigen or fragments thereof. Additionally methods of suppressing organ transplant rejection and methods of treating autoimmune diseases are provided.

Polyion complex comprising hydrophobized polyamino acid and use of the same

A polyion complex (PIC) or a PIC nanoparticle that may be easily prepared, and that is finally disappeared in vivo due to its suitable biodegradability while exhibiting high stability in vivo, an immunotherapy agent comprising the PIC nanoparticle to which various antigen proteins or peptides may be easily conjugated or incorporated and/or which may be easily mixed with the antigen proteins or peptides, as well as a process for preparing thereof are provided. Specifically, a polyion complex (PIC) comprising a hydrophobized poly(acidic amino acid) and a basic polypeptide, a nanoparticle thereof having a particle shape, an immunotherapy agent comprising the PIC nanoparticle, as well as a process for preparing the PIC, comprising steps of introducing a hydrophobic amino acid to a poly(acidic amino acid) to prepare a hydrophobized poly(acidic amino acid), and dissolving the hydrophobized poly(acidic amino acid) prepared to a buffer, and it is mixed with a basic polypeptide dissolved in a buffer.

Novel transporter constructs and transporter cargo conjugate molecules

The present invention relates to novel transporter constructs of the generic formula (I) D l LLL x D m (LLL y D n ) a and variants thereof. The present invention also refers to transporter cargo conjugate molecules, particularly of conjugates of the novel transporter constructs with a cargo moiety, e.g. proteins or peptides, nucleic acids, cytotoxic agents, organic molecules, etc. The present invention furthermore discloses (pharmaceutical) compositions comprising these conjugates and methods of treatment and uses involving such transporter constructs.

Long term potentiation with cyclic-glur6 analogs

This invention discloses CN2097-like compositions that facilitate the induction of long-term potentiation (LTP). In one embodiment the method comprises inducing long-term potentiation in a subject by the method of administering a therapeutically effective dose of a CN2907-like compound.

Block Copolymer For Intraperitoneal Administration Containing Anti-Cancer Agent, Micelle Preparation Thereof, And Cancer Therapeutic Agent Comprising The Micelle Preparation As Active Ingredient

To provide a therapeutic method using a water soluble, high molecular weight block polymer to enable that an intraperitoneally administered anti-cancer agent may maintain for a long-term retention in the abdominal cavity to enoughly exert the effect of the anti-cancer agent and reduce adverse side-effects thereof. A therapeutic agent as a micelle preparation, comprising a copolymer having a hydrophilic polymeric moiety and a polycarboxylic acid derivative moiety; and an anti-cancer agent bonding to or encapsulated in the copolymer, wherein the micelle preparation may exhibit sustained drug release capability, and enables an extension of a retention time period of the anti-cancer agent in an abdominal cavity, is provided. A superior life-prolonging effect was found in an intraperitoneal administration mouse model compared with a case in which only an encapsulated drug is administered, and thus the present invention was completed accordingly.

Co-Administration of An Agent Linked to an Internalization Peptide With an Anti-Inflammatory

The invention provides methods of delivering pharmacologic agents linked to an internalization peptide, in which an inflammatory response inducible by the internalization peptide is inhibited by co-administration of an anti-inflammatory or by linking the internalization peptide to biotin or similar molecule. Such methods are premised in part on the results described in the examples whereby administration of a pharmacological agent linked to tat at high dosages is closely followed by an inflammatory response, which includes mast cell degranulation, histamine release and the typical sequelae of histamine release, such as redness, heat, swelling, and hypotension.

Compositions and methods for enhancing drug delivery across and into ocular tissues

This invention provides compositions and methods for enhancing delivery of drugs and other agents across epithelial tissues, including into and across ocular tissues and the like. The compositions and methods are also useful for delivery across endothelial tissues, including the blood brain barrier. The compositions and methods employ a delivery enhancing transporter that has sufficient guanidino or amidino sidechain moieties to enhance delivery of a compound conjugated to the reagent across one or more layers of the tissue, compared to the non-conjugated compound. The delivery-enhancing polymers include, for example, poly-arginine molecules that are preferably between about 6 and 25 residues in length.

Use of a peptide enhancing the ability of radiation therapy to kill cancer cells

The present invention relates to a peptide consisting essentially of the N2 sequence of the RasGAP protein, a bio logically active fragment thereof, or a variant thereof, which is useful for the preparation of a medicament for the treatment of cancer. Furthermore, it relates to a method of treatment of cancer comprising administering to a subject in need thereof, a therapeutically effective amount of the peptide of the invention.

Complexation of nucleic acids with disulfide-crosslinked cationic components for transfection and immunostimulation

The present invention is directed to a polymeric carrier cargo complex, comprising as a cargo at least one nucleic acid (molecule) and disulfide-crosslinked cationic components as a (preferably non-toxic and non-immunogenic) polymeric carrier. The inventive polymeric carrier cargo complex allows for both efficient transfection of nucleic acids into cells in vivo and in vitro and/or for induction of an (innate and/or adaptive) immune response, preferably dependent on the nucleic acid to be transported as a cargo. The present invention also provides, pharmaceutical compositions, particularly vaccines and adjuvants, comprising the inventive polymeric carrier cargo complex and optionally an antigen, as well as the use of such the inventive polymeric carrier cargo complex and optionally an antigen for transfecting a cell, a tissue or an organism, for (gene-)therapeutic purposes as disclosed herein, and/or as an immunostimulating agent or adjuvant, e.g. for eliciting an immune response for the treatment or prophylaxis of diseases as mentioned above. Finally, the invention relates to kits containing the inventive polymeric carrier cargo complex and/or the inventive pharmaceutical composition, adjuvant or vaccine in one or more parts of the kit.

Novel Polymer Derivative Of Cytidine Metabolic Antagonist

[Problem] To provide a novel polymer derivative of a cytidine metabolic antagonist which allows release of a medicament irrespective of enzymes of the living body and is expected to have high therapeutic effects. [Solution] The polymer derivative of a cytidine metabolic antagonist in which a substituent represented by the general formula (I) or the general formula (II) [wherein R 7 and R 8 each independently represent a hydrogen atom or an optionally substituted (C1-C6)alkyl group, R 6 represents a hydrogen atom, an optionally substituted (C1-C40)alkyl group, an optionally substituted (C1-C40)aralkyl group, an optionally substituted aromatic group, an amino acid residue in which the carboxy group is protected, or an optionally substituted sugar residue, CX—CY represents CH—CH or C═C (double bond), and A represents the residue of the cytidine metabolic antagonist except the amino group at the position 4] is bonded to the side-chain carboxy group of a block copolymer of a polyethylene-glycol structural moiety and a polymer having 10 or more carboxy groups.

Vaccination in newborns and infants

The present invention relates to vaccines comprising at least one mRNA encoding at least one antigen for use in the treatment of a disease in newborns and/or infants, preferably exhibiting an age of not more than 2 years, preferably of not more than 1 year, more preferably of not more than 9 months or even 6 months, wherein the treatment comprises vaccination of the newborn or infant and eliciting an immune response in said newborn or infant. The present invention is furthermore directed to kits and kits of parts comprising such a vaccine and/or its components and to methods applying such a vaccine or kit.

Compositions and methods of treating therapy resistant cancer and uses thereof

The present disclosure is directed to a composition for the sustained-release delivery of an active agent to a target cell of an individual. The compositions disclosed herein comprise of at least one porous particle; at least one polymer; and at least one active agent. In an embodiment, the porous particle comprises a plurality of microscale reservoirs. In an exemplary embodiment, the at least one active agent is covalently linked to the at least one polymer to form a polymer-active agent conjugate, and the polymer-active agent conjugate is contained in the plurality of microscale reservoirs of the porous particle. The present disclosure is also directed to a method of treating a tumor, comprising the step of administering to an individual the composition described supra. Additionally, disclosed herein is a method of eliminating tumor stem cells. Furthermore, there is provided a method of circumventing multi-drug resistance in a tumor cell.

Particle composition and pharmaceutical composition using particle composition

A composition of matter for use in encapsulating a drug is expressed by formula (1) or formula (2): wherein R 1 and R 2 are each independently a hydrogen atom or a substituted or unsubstituted, linear or branched alkyl group having 1 to 12 carbon atoms; A is a hydrophilic polymer chain; L 1 and L 3 are each a linking group; B is a cation-containing group; R 3 is a side chain of an amino acid; z is an integer of 5 to 500; x is an integer of 40% or more of z; y is 0 or a positive integer; z-x-y is 0 or a positive integer; p is an integer of 1 to 10; and q is an integer of 1 to 10.

LOW DENSITY LIPOPROTEIN RECEPTOR-MEDIATED siRNA DELIVERY

The invention provides interfering RNA molecule-ligand conjugates useful as a delivery system for delivering interfering RNA molecules to a cell in vitro or in vivo. The conjugates comprise a ligand that can bind to a low density lipoprotein receptor (LDLR) or LDLR family member. Therapeutic uses for the conjugates are also provided.

Methods for treating progeroid laminopathies using oligonucleotide analogues targeting human lmna

Provided are methods of treatment in subjects having progeroid diseases and related conditions which rely upon LMNA-targeted antisense oligonucleotides for reducing expression of one or more aberrantly spliced LMNA mRNA isoforms that encode progerin.

Complexes of rna and cationic peptides for transfection and for immunostimulation

The present invention relates to a complexed RNA, comprising at least one RNA complexed with one or more oligopeptides, wherein the oligopeptide, which has the function of cell-penetrating peptide (CPP), has a length of 8 to 15 amino acids and has the empirical formula (Arg) l ;(Lys) m ;(His) n ;(Om) o ;(Xaa) x with the majority of residues being selected from Arg, Lys, His, Om. The invention further relates to a method for transfecting a cell or an organism, thereby applying the inventive complexed RNA. Additionally, pharmaceutical compositions and kits comprising the inventive complexed RNA, as well as the use of the inventive complexed RNA for transfecting a cell, tissue or an organism and/or for modulating, preferably inducing or enhancing, an immune response are disclosed herein.

Block Copolymer For Intraperitoneal Administration Containing Anti-Cancer Agent, Micelle Preparation Thereof, And Cancer Therapeutic Agent Comprising The Micelle Preparation As Active Ingredient

To provide a therapeutic method using a water soluble, high molecular weight block polymer to enable that an intraperitoneally administered anti-cancer agent may maintain for a long-term retention in the abdominal cavity to enoughly exert the effect of the anti-cancer agent and reduce adverse side-effects thereof. A therapeutic agent as a micelle preparation, comprising a copolymer having a hydrophilic polymeric moiety and a polycarboxylic acid derivative moiety; and an anti-cancer agent bonding to or encapsulated in the copolymer, wherein the micelle preparation may exhibit sustained drug release capability, and enables an extension of a retention time period of the anti-cancer agent in an abdominal cavity, is provided. A superior life-prolonging effect was found in an intraperitoneal administration mouse model compared with a case in which only an encapsulated drug is administered, and thus the present invention was completed accordingly.

Novel modulators and methods of use

Novel modulators, including antibodies and derivatives thereof, and methods of such modulators to treat hyperproliferative disorders are provided.

SELECTIVE HIGH-AFFINITY POLYDENTATE LIGANDS AND METHODS OF MAKING SUCH

This invention provides novel polydentate selective high affinity ligands (SHALs) that can be used in a variety of applications in a manner analogous to the use of antibodies. SHALs typically comprise a multiplicity of ligands that each bind different region son the target molecule. The ligands are joined directly or through a linker thereby forming a polydentate moiety that typically binds the target molecule with high selectivity and avidity. 2. The SHAL of claim 1 , wherein Ris biotin or DOTA.5. The method of claim 4 , wherein the HLA-DR10 marker comprises an epitope recognized by an anti-Lym-1 antibody.6. The method of claim 4 , wherein the tumor comprises a solid tumor.7. The method of claim 4 , wherein the cancer cell is a malignant B lymphocyte or a metastatic cancer cell.8. The method of claim 4 , wherein the cancer cell is associated with non-Hodgkins lymphoma or leukemia or a B-cell derived malignancies.9. The method of claim 4 , wherein the contacting is in vivo.10. The method of claim 4 , wherein the contacting is in vitro.11. The method of claim 4 , wherein the method comprises imaging a tumor in a subject in need thereof comprising administering to the subject a chelate comprising the SHAL of bound to a metal isotope.12. The method of claim 11 , wherein the metal isotope is selected from the group of: Tc claim 11 , Pb claim 11 , Ga claim 11 , Ga claim 11 , As claim 11 , In claim 11 , In claim 11 , Ru claim 11 , Cu claim 11 , Cu claim 11 , Fe claim 11 , Mn claim 11 , Cr claim 11 , Re claim 11 , Re claim 11 , As claim 11 , Y claim 11 , cu Er claim 11 , Sn claim 11 , Te claim 11 , Pr claim 11 , Pr claim 11 , Au claim 11 , Au claim 11 , Tb claim 11 , Pd claim 11 , Dy claim 11 , Pm Pm Sm claim 11 , Gd claim 11 , Gd Ho claim 11 , Tm Yb claim 11 , Yb claim 11 , Lu claim 11 , Rh claim 11 , and Ag.13. A method of treating lymphoma or leukemia that expresses a HLA-DR10 marker in a subject in need comprising administering to the subject the SHAL of .14. The ...

SYNTHETIC NANOPARTICLES FOR DELIVERY OF IMMUNOMODULATORY COMPOUNDS

The present disclosure provides a synthetic nanoparticle comprising a peptide nucleic acid (PNA) oligomer conjugated to a lipid, wherein the PNA oligomer noncovalently complexes with an immunomodulatory compound, thereby forming a nanoparticle. The nanoparticles are useful to elicit immune responses and can be used to treat a broad range of cancers and infectious diseases. 152-. (canceled)54. The composition of claim 53 , wherein the positively charged amino acid is lysine or arginine.55. The composition of claim 53 , wherein Xaaand Xaaare lysine and n is 3 to 6.56. The composition of claim 53 , wherein the PNA oligomer is lysine-(G)-lysine claim 53 , wherein G is guanine.57. The composition of claim 53 , wherein the one or more lipids is a diacyl lipid tail.58. The composition of claim 53 , wherein the CDN is cyclic di-guanine mono phosphate (cdGMP) claim 53 , an agonist of STING (STimulator of Interferon Genes) claim 53 , cyclic di-inosine monophosphate or cyclic d-AMP.59. The composition of claim 53 , further comprising a polymer claim 53 , wherein the polymer is polyethylene glycol claim 53 , or another hydrophilic polymer.60. The composition of claim 53 , wherein the PNA oligomer is noncovalently complexed to the CDN through pi-pi base stacking and hydrogen-bonding interactions.61. The composition of claim 53 , wherein the nanoparticle has a diameter in the range of approximately 10 nm to approximately 100 nm.62. The composition of claim 53 , wherein the nanoparticle comprises a structure selected from the group consisting of a worm-like micelle claim 53 , a disc-like micelle claim 53 , a nanofiber and a spherical micelle.63. A method of modulating an immune response in a subject claim 53 , inducing or enhancing an immune response in a subject with cancer claim 53 , or treating cancer claim 53 , comprising administering to a subject in need thereof the composition of .64. The method of claim 63 , wherein the immune response is an antigen specific immune ...

MODULATION OF COMPLEMENT ACTIVITY

The present invention provides modulators of complement activity. Also provided are methods of utilizing such modulators as therapeutics. 3. The compound of claim 2 , wherein the lysine residue is part of a polypeptide.4. The compound of claim 3 , wherein the lysine residue is the C-terminal residue of the polypeptide.6. The compound of claim 5 , wherein the compound is conjugated to the side chain amine group of lysine. This application is a continuation of U.S. patent application Ser. No. 16/237,893, filed Jan. 2, 2019, entitled MODULATION OF COMPLEMENT ACTIVITY, which is a continuation of U.S. patent application Ser. No. 16/128,561, now U.S. Pat. No. 10,208,089, filed Sep. 12, 2018, entitled MODULATION OF COMPLEMENT ACTIVITY, which is a continuation of U.S. patent application Ser. No. 15/318,063, now U.S. Pat. No. 10,106,579, filed Dec. 12, 2016, entitled MODULATION OF COMPLEMENT ACTIVITY, which is a 35 U.S.C. § 371 U.S. National Stage Entry of International Application No. PCT/US2015/035473 filed Jun. 12, 2015, which claims the benefit of priority of U.S. Provisional Patent Application No. 62/011,368, filed Jun. 12, 2014, entitled MODULATION OF COMPLEMENT ACTIVITY, U.S. Provisional Patent Application No. 62/077,460, filed Nov. 10, 2014, entitled MODULATION OF COMPLEMENT ACTIVITY, and U.S. Provisional Patent Application No. 62/108,772, filed Jan. 28, 2015, entitled MODULATION OF COMPLEMENT ACTIVITY, the contents of each of which are incorporated herein by reference in their entirety.The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Aug. 28, 2019, is named 2011_1005USCON3_SL.txt and is 130,757 bytes in size.The present invention relates to compounds, including polypeptides, which are useful as inhibitors and/or antagonists of complement activity. Also provided are methods of utilizing the inhibitors as therapeutics.The ...

PEGYLATED PEPTIDE AMPHIPHILE NANOFIBERS AND METHODS OF USE

Provided herein are peptide amphiphiles (PAs). In some embodiments, provided herein are PEGylated PAs (e.g. nonionic PAs). In some embodiments, the peptide amphiphiles are assembled into nanofibers. The nanofibers may further comprise a growth factor protein, which may bind to a growth factor binding sequence presented on the nonionic PA. In some embodiments, the nanofibers further comprise a charged peptide amphiphile. The charged peptide amphiphile may be bound to a growth factor protein. Further provided herein are methods of use of the peptide amphiphiles and compositions comprising the same, such as for regenerative therapy. 1. A peptide amphiphile comprising a hydrophobic tail , a structural peptide segment , and a PEG domain.2. The peptide amphiphile of claim 1 , wherein the hydrophobic tail comprises an 8-24 carbon alkyl chain (C).3. The peptide amphiphile of claim 1 , wherein the structural peptide segment has a propensity for forming β-sheet conformations.4. The peptide amphiphile of claim 3 , wherein the structural peptide segment comprises VA2 or VA.5. The peptide amphiphile of claim 1 , wherein the PEG domain comprises a PEG containing 1-20 repeating ethylene glycol subunits.6. The peptide amphiphile of claim 5 , wherein the PEG contains 10 repeating ethylene glycol subunits.7. The peptide amphiphile of claim 1 , further comprising a growth factor binding sequence.8. The peptide amphiphile of claim 7 , wherein the growth factor binding sequence binds to a TGF-β family protein.9. The peptide amphiphile of claim 8 , wherein the growth factor binding sequence comprises the peptide sequence HSNGLPL.10. A nanofiber comprising the peptide amphiphile of .11. The nanofiber of claim 10 , further comprising one or more charged peptide amphiphiles claim 10 , wherein the charged peptide amphiphiles comprise a hydrophobic tail claim 10 , a structural peptide segment claim 10 , and a charged peptide segment.12. The nanofiber of claim 11 , wherein the charged segment ...

Carrier Peptide Fragment and use Thereof

A method of introducing a foreign substance from the outside of eukaryotic cells into at least a cytoplasm of the cells in vitro or in vivo disclosed here includes the following steps: 1. A method of introducing a foreign substance from the outside of eukaryotic cells into at least a cytoplasm of the cells in vitro or in vivo , (1) preparing a construct for introducing a foreign substance, wherein the construct includes a carrier peptide fragment composed of the following amino acid sequence:', 'TLKERCLQVVRSLVKKKRTLRKNDRKKR (SEQ ID NO: 1), and, 'the method comprising the following steps (2) supplying the construct into a sample containing target eukaryotic cells; and', '(3) incubating the sample to which the construct is supplied, wherein the construct is introduced into the target eukaryotic cells in the sample., 'the foreign substance bound to an N-terminal side and/or C-terminal side of the carrier peptide fragment;'}2. The method according to claim 1 , wherein the foreign substance is any organic compound selected from the group consisting of polypeptides claim 1 , nucleic acids claim 1 , dyes and drugs.4. The method according to claim 3 , wherein the amino acid sequence corresponding to a mature polypeptide or its precursor polypeptide as the foreign substance is arranged on the N-terminal side of the carrier peptide fragment.5. The method according to claim 1 , wherein the target eukaryotic cells to which the construct is introduced are human or non-human mammal cells.6. A construct for introducing a foreign substance from the outside of eukaryotic cells into at least a cytoplasm of the cells claim 1 , comprisinga carrier peptide fragment composed of the following amino acid sequence:TLKERCLQVVRSLVKKKRTLRKNDRKKR (SEQ ID NO: 1), anda foreign substance bound to an N-terminal side and/or C-terminal side of the carrier peptide fragment.7. The construct according to claim 6 , wherein the foreign substance is any organic compound selected from the group consisting ...

USE OF PLL FOR IMPROVING THE STABILITY OF MOLECULES IN SOLUTION

The invention relates to a molecular complex comprising at least one polylysine conjugate (PLL), comprising a main PLL straight chain and at least one molecule F having an average molecular weight of between 50 daltons and 1000 daltons that is covalently bonded to said main chain, and at least one molecule M that is unstable in solution, the conjugate(s) and the molecule(s) M being bonded by means of a non-covalent bond. The invention also relates to a composition comprising a complex of this kind, to a method for obtaining said composition and use thereof, and to the use of one or more PLL-based conjugates for improving the hydrophilicity, the effectiveness, and the activity of a molecule that is unstable in solution, over a time period that is compatible with the use of said molecule. The invention also relates to a method for identifying a PLL-based conjugate or a combination of a plurality of PLL-based conjugates that makes it possible to improve the hydrophilicity, the effectiveness, and the activity of a molecule that is unstable in solution, and to a kit for implementing said method. 133-. (canceled)34. Molecular complex that comprises: a main PLL straight chain, and', 'at least one molecule F that has a mean molecular weight of between 50 dalton and 1000 dalton and is linked covalently to said main chain, and, 'at least one polylysine (PLL) conjugate, comprisingat least one molecule M that is unstable in solution,with the conjugate(s) and the molecule(s) M being linked by a non-covalent bond.35. Molecular complex according to claim 34 , wherein the molecule M is an organic molecule or a protein.36. Molecular complex according to claim 34 , having at least one of the following characteristics:the ratio between the molar concentration of the conjugate(s) and that of the molecule(s) M is between 1 and 30,the molecular mass ratio and the area of the peaks between the molecule(s) F and the main chain (determined by the FTIR method) is from approximately 10 to ...

NEGATIVELY CHARGED NUCLEIC ACID COMPRISING COMPLEXES FOR IMMUNOSTIMULATION

The present invention is directed to a pharmaceutical composition including (e.g., for use as an adjuvant) a (negatively charged) nucleic acid comprising complex comprising as a carrier cationic or polycationic compounds (e.g. peptides, proteins or polymers) and as a cargo at least one nucleic acid (molecule) and at least one antigen that is selected from an antigen from a pathogen associated with infectious disease; an antigen associated with allergy or allergic disease; an antigen associated with autoimmune disease; or an antigen associated with a cancer or tumour disease, or in each case a fragment, variant and/or derivative of said antigen. The pharmaceutical composition allows for efficient induction of an adaptive immune response directed against said antigen. The present invention furthermore provides kits, as well as the use of the pharmaceutical composition or the kit as a vaccine, particularly in the treatment of infectious diseases, allergies, autoimmune diseases and tumour or cancer diseases. 1. A pharmaceutical composition comprising: a) cationic and/or polycationic components comprising PEI and lipidic cationic components; and', 'b) at least one RNA molecule;', 'wherein the charge of complex (A) is negative; and', 'wherein the complex does not include a mRNA encoding an antigen,, '(A) a complex, comprisingand (i) an antigen from a pathogen associated with infectious disease;', '(ii) an antigen associated with allergy or allergic disease;', '(iii) an antigen associated with autoimmune disease; and', '(iv) an antigen associated with a cancer or tumour disease,', 'or an antigenic fragment of said antigen., '(B) at least one polypeptide antigen selected from the group consisting of2. The pharmaceutical composition of claim 1 , wherein the charge of complex (A) is negative and wherein the cationic and/or polycationic components and the RNA molecule comprised in said complex (A) are present in an N/P ratio of below 1.3. The pharmaceutical composition of ...

POLYION COMPLEX CAPABLE OF EFFICIENTLY DELIVERING MRNA INTO LIVING BODY, AND DRUG AND METHOD FOR TREATING ARTHROPATHY IN WHICH SAID COMPLEX IS USED

The present invention provides a polyion complex which can efficiently deliver mRNA into a living body as well as a therapeutic agent and a therapeutic method of arthropathy in which the polyion complex is used. For example, there is provided a polyion complex comprising a cationic polymer and mRNA, wherein the cationic polymer is a polymer comprising a cationic unnatural amino acid as a monomer unit and the cationic unnatural amino acid is an amino acid having a group represented by —(NH—(CH))—NH, wherein p is 2, 3 or 4, as a side chain. 1: A polyion complex comprising a cationic polymer and mRNA ,{'sub': 2', '2', 'p', '2, 'wherein the cationic polymer is a polymer comprising a cationic unnatural amino acid as a monomer unit and the cationic unnatural amino acid is an amino acid having a group represented by —(NH—(CH))—NH, wherein p is 2, 3 or 4, as a side chain.'}2: The polyion complex according to claim 1 , wherein the cationic polymer is a block copolymer with polyethylene glycol.4: A pharmaceutical composition for treating arthropathy claim 1 , comprising the polyion complex according to claim 1 ,wherein the mRNA is an mRNA of a factor promoting joint formation.5: The pharmaceutical composition according to claim 4 , wherein p is 3 or 4.6: The pharmaceutical composition according to claim 5 , wherein p is 4.7: The pharmaceutical composition according to claim 4 , wherein the pharmaceutical composition is formulated for administration once every 2 days or once every 3 days.8: The pharmaceutical composition according to claim 5 , wherein the pharmaceutical composition is formulated for administration once every 7 days.9: The pharmaceutical composition according to claim 4 , wherein the arthropathy is osteoarthritis or rheumatoid arthritis.10: A delivery agent suitable for use in delivering mRNA into cells claim 3 , comprising the polyion complex according to claim 3 , wherein p is 3 or 4.11: The delivery agent according to claim 10 , wherein p is 4. This ...

Polynucleotide encapsulation and preservation using self-assembling membranes

Polynucleotides such as DNA are stored inside vesicles formed from self-assembling membranes. The vesicles may be protocells, liposomes, micelles, colloidosomes, proteinosomes, or coacervates. The vesicles may include surface functionalization to improve polynucleotide encapsulation and/or to bind polynucleotides having specific sequences. Encapsulation in vesicles provides protection for the polynucleotides. Additional protection is provided by addition of one or more stabilizers. The stabilizer may be nucleic-acid stabilizers that stabilize the polynucleotides or may be a protective structural layer around the vesicles such as a layer of silica. A process for stably storing polynucleotides in vesicles and a process for recovering stored polynucleotides from vesicles are both disclosed. The polynucleotides may be used for storage of digital information.

Compositions and methods for treating mitochondrial neurogastrointestinal encephalopathy

Disclosed herein are compositions and methods of treating disclosure provides for compounds for use in treating Mitochondrial Neurogastrointestinal Encephalopathy Syndrome (MNGIE). In some embodiments, the compounds have cell penetrating activity and thymidine phosphorylase activity. In certain embodiments, the compounds disclosed herein comprise: a) at least one cell-penetrating peptide (CPP) moiety; and b) a thymidine phosphorylase, or an active fragment or analog thereof (TP), wherein the CPP is coupled, directly or indirectly, to TP.

HIGH-DENSITY LIPOPROTEIN, AND DELIVERY OF DRUG TO POSTERIOR SEGMENT OF EYE BY OCULAR INSTILLATION OF SAID CYTOPHILIC PEPTIDE-FUSED HIGH-DENSITY LIPOPROTEIN

The purpose of the present invention is to provide a novel system for the delivery of a drug to a posterior segment of the eye. The present invention relates to: a cytophilic peptide-fused high-density lipoprotein (cHDL) which can be used as a carrier for the delivery of a drug to a posterior segment of the eye; a method for producing the cytophilic peptide-fused high-density lipoprotein; a system of the delivery of a drug to a posterior segment of the eye, a pharmaceutical composition, and a system of the delivery of a drug to a posterior segment of the eye, each of which utilizes the cytophilic peptide-fused high-density lipoprotein; and a method for diagnosing, preventing or treating posterior ocular disease. 118-. (canceled)19. A cytophilic peptide-bound high-density lipoprotein , comprising a high-density lipoprotein and a cytophilic peptide ,wherein the cytophilic peptide is at least one kind selected from the group consisting of penetratin, polyarginine (R8), LL-37, transportan, Pep-1 and MTS.20. The cytophilic peptide-bound high-density lipoprotein according to claim 19 , wherein the high-density lipoprotein consists of apolipoprotein and at least one kind of phospholipid selected from the group consisting of dimyristoylphosphatidylcholine (DMPC) claim 19 , dipalmitoylphosphatidylcholine (DPPC) and di stearoylphosphatidylcholine (DSPC).21. The cytophilic peptide-bound high-density lipoprotein according to claim 19 , wherein the cytophilic peptide is penetratin or polyarginine (R8).22. The cytophilic peptide-bound high-density lipoprotein according to claim 19 , wherein the apolipoprotein is at least one kind selected from the group consisting of apolipoprotein A-I claim 19 , apolipoprotein A-II claim 19 , apolipoprotein C claim 19 , apolipoprotein E claim 19 , a partial fragment thereof claim 19 , and a genetically modified apolipoprotein thereof.23. The cytophilic peptide-bound high-density lipoprotein according to claim 20 , wherein the cytophilic peptide- ...

CONJUGATES FOR PROTECTION FROM NEPHROTOXIC ACTIVE SUBSTANCES

The present invention relates to a conjugate containing at least one kidney-selective carrier molecule and at least one active compound which has a protective action for the kidney against nephrotoxic active compounds, to a process for the preparation of the conjugate, to the use thereof for the protection of the kidney against nephrotoxic active compounds, and to a medicament comprising the conjugate. 116-. (canceled)17. A conjugate containing at least one kidney-selective carrier molecule and at least one active compound which has a protective action for the kidney against nephrotoxic active compounds , (i) the peptide or oligopeptide overall has a chain length of 15 to 100 amino acid units;', '(ii) the peptide or oligopeptide comprises at least 50% (based on the number of amino acid units) of amino acids K and E, or R and E, respectively; and', '(iii) the oligopeptide comprises at least 3 consecutive sequence sections., 'an oligopeptide comprising multiple monomeric peptides comprising more than 50% (based on the number of amino acid units) of sequence sections selected from the group consisting of KKEE (SEQ ID NO: 78), KKEEE (SEQ ID NO: 76), RREEE (SEQ ID NO: 77), KKKEEE (SEQ ID NO: 79) and KKKEE (SEQ ID NO: 80), wherein'}, 'wherein the at least one kidney-selective carrier molecule is'}18. The conjugate of claim 17 , wherein the oligopeptide contains 3 to 5 successive sequence sections.19. The conjugate of claim 17 , wherein the oligopeptide is selected from the group consisting of (RREEE)R (SEQ ID NO: 81) claim 17 , (KKEE)K (SEQ ID NO: 82) claim 17 , (KKKEE)K (SEQ ID NO: 83) claim 17 , (KKKEEE)K (SEQ ID NO: 84) and (KKEEE)K (SEQ ID NO: 85).201. The conjugate of claim claim 17 , wherein the at least one active compound is an antioxidant and/or an apoptosis inhibitor.211. A pharmaceutical composition comprising at least one conjugate of claim .22. A method for the protection of the kidney against nephrotoxic active compounds claim 21 , comprising administering ...

SYNTHETIC NANOPARTICLES FOR DELIVERY OF IMMUNOMODULATORY COMPOUNDS

The present disclosure provides a synthetic nanoparticle comprising a peptide nucleic acid (PNA) oligomer conjugated to a lipid, wherein the PNA oligomer noncovalently complexes with an immunomodulatory compound, thereby forming a nanoparticle. The nanoparticles are useful to elicit immune responses and can be used to treat a broad range of cancers and infectious diseases. 1. A synthetic nanoparticle comprising a PNA-amphiphile conjugate and an immunomodulatory compound , wherein the PNA-amphiphile conjugate comprises (i) a peptide nucleic acid (PNA) oligomer comprising at least one guanine nucleoside , or an analog thereof , (ii) one or more lipids , and optionally , (iii) a polymer , wherein the immunomodulatory compound is a cyclic dinucleotide (CDN) , and wherein the CDN is noncovalently complexed with the PNA oligomer , thereby forming a synthetic nanoparticle.2. The synthetic nanoparticle of claim 1 , wherein the PNA oligomer comprises 3 guanine nucleosides claim 1 , or analogs thereof claim 1 , or at least one positively charged amino acid.3. (canceled)4. The synthetic nanoparticle of claim 1 , wherein the positively charged amino acid is lysine or arginine.5. The synthetic nanoparticle of claim 1 , wherein the PNA oligomer is represented from N- to C-terminus by the formula: Xaa-(G)-Xaa claim 1 , wherein Xaais selected from the group consisting of lysine and arginine claim 1 , wherein G is guanine and n is 1 to 12 claim 1 , and wherein Xaais selected from the group consisting of lysine and arginine.6. The synthetic nanoparticle of claim 5 , wherein Xaaand Xaaare lysine and n is 3 to 6.7. The synthetic nanoparticle of claim 1 , wherein the PNA oligomer is lysine-(G)-lysine claim 1 , wherein G is guanine.8. The synthetic nanoparticle of claim 1 , wherein the one or more lipids is a diacyl lipid tail.9. The synthetic nanoparticle of claim 1 , wherein the CDN is cyclic di-guanine mono phosphate (cdGMP) claim 1 , an agonist of STING (STimulator of Interferon ...

TOPICAL DELIVERY OF THERAPEUTIC AGENTS USING CELL-PENETRATING PEPTIDES FOR THE TREATMENT OF AGE-RELATED MACULAR DEGENERATION AND OTHER EYE DISEASES

The present disclosure provides therapeutic agents for the treatment of age-related macular degeneration (AMD) and other eye disorders. One or more therapeutic agents can be used to treat any stages (including the early, intermediate and advance stages) of AMD, and any phenotypes of AMD, including geographic atrophy (including non-central GA and central GA) and neovascularization (including types 1, 2 and 3 NV). In some embodiments, the one or more therapeutic agents are or include an anti-dyslipidemic agent, an antioxidant, an anti-inflammatory agent, a complement inhibitor, a neuroprotector or an anti-angiogenic agent, or any combination thereof. In certain embodiments, the one or more therapeutic agents are or include an anti-dyslipidemic agent (e.g., an apolipoprotein mimetic or/and a statin). In some embodiments, the one or more therapeutic agents are mixed with, non-covalently associated with or covalently bonded to a cell-penetrating peptide (CPP), encapsulated in CPP-conjugated nanoparticles, micelles or liposomes, or modified (e.g., stapled, prenylated, lipidated or coupled to a small-molecule α-helix mimic) to acquire membrane-translocating ability. In certain embodiments, the one or more therapeutic agents are administered by eye drop. 1. A transepithelial , transmembrane or transmucosal drug-delivery system (TDS) comprising a therapeutic agent and a cell-penetrating peptide (CPP) , wherein:the therapeutic agent is an anti-dyslipidemic agent, an antioxidant, an anti-inflammatory agent, a complement inhibitor or a neuroprotector; andthe TDS is capable of delivering the therapeutic agent into the eye.2. The TDS of claim 1 , which is capable of delivering the therapeutic agent into the posterior segment of the eye.3. The TDS of claim 1 , which is capable of delivering the therapeutic agent into the eye when administered by an eye drop or a contact lens.4. The TDS of claim 1 , wherein the therapeutic agent is an apoA-I mimetic claim 1 , an apoE mimetic or a ...

IMMUNOSTIMULATORY COMPOSITIONS AND METHODS OF USE THEREOF

Lipid conjugates for enhanced delivery of cargo to the lymph nodes are disclosed. The lipid conjugates typically include three domains: a lipophilic domain that binds to albumin, a polar block domain, and a cargo such as a molecular adjuvant or immunostimulatory compound (such as an oligonucleotide) or antigenic peptide. Depending on the cargo, the length and compositions of the polar block can be tailored to push the equilibrium toward albumin binding, stable micelle formation, or cell insertion. The conjugates can be administered to a subject, for example, a subject with cancer or an infection, to induce or enhance a robust immune response in the subject. 1. An amphiphilic albumin-binding conjugate comprising(a) a lipid component;(b) an optional polar component; and(c) an immunomodulatory compound or molecular adjuvant;wherein the immunomodulatory compound or molecular adjuvant is bound directly to the lipid or is bound to the lipid via a linker,wherein the conjugate is sufficiently soluble such that the lipid binds to albumin under physiological conditions, andwherein a plurality of the conjugates can spontaneously form micelles in aqueous solution.2. The conjugate of wherein the immunomodulatory compound or molecular adjuvant is bound to the lipid via a linker.3. The conjugate of wherein the linker is an oligonucleotide linker.4. The conjugate of wherein the oligonucleotide linkers comprises “N” consecutive guanines claim 3 , wherein N is between 0-2.5. The conjugate of comprising the structure L-5′-Gn-ON-3′ claim 4 , wherein “L” the lipid claim 4 , “G” is a guanine claim 4 , “n” is 0-2 claim 4 , and “ON” is the immunostimulatory oligonucleotide.6. The conjugate of wherein the oligonucleotide-conjugate exhibits increased accumulation in the lymph node when administered to a subject in vivo compared to administration of the immunostimulatory oligonucleotide alone.7. The conjugate of wherein the lipid is a diacyl lipid.8. The conjugate of wherein the acyl chains ...

MESSENGER RNA VACCINES AND USES THEREOF

The present invention provides, among other things, methods and compositions of formulating nucleic acid-containing nanoparticles for efficient delivery of payload in vivo such that the method and compositions can be used to generate mRNA vaccines. 1. A method of inducing an immune response in vivo comprising:administering to a subject in need thereof a composition comprising a messenger RNA (mRNA) encoding an antigen, encapsulated in a lipid nanoparticle, at a dosing regimen sufficient to induce an antigen specific T cell response and/or an antigen specific antibody response.2. The method of claim 1 , wherein the composition is administered subcutaneously.35-. (canceled)6. The method of claim 1 , whereinthe composition is a vaccine composition.7. A method of delivering a vaccine in vivo comprising:administering to a subject in need thereof a vaccine composition comprising a messenger RNA (mRNA) encoding an antigen, encapsulated in a lipid nanoparticle, wherein the vaccine composition is administered intramuscularly or subcutaneously.8. The method of claim 7 , wherein the vaccine composition is administered at a dosing regimen sufficient to induce an antigen specific T cell response and/or an antigen specific antibody response.910-. (canceled)11. The method of claim 1 , wherein the composition comprises one or more mRNAs encoding one or more polypeptides.12. The method of claim 1 , wherein the dosing regimen comprises injecting a single dose.13. The method of claim 1 , wherein the dosing regimen comprises injecting multiple doses periodically.1419-. (canceled)20. The method of claim 13 , wherein each of the multiple doses comprise a different dosage amount of mRNA.2123-. (canceled)24. The method of claim 13 , wherein the multiple doses are injected at the following schedule: Dose 1 week 0 claim 13 , dose 2 in week 3 claim 13 , and dose 3 in week 5.25. The method of claim 1 , wherein the mRNA comprises one or more modified nucleotides.26. (canceled)27. The method of ...

PREPARATION, MEMBER FOR PREPARATION, AND METHODS FOR MANUFACTURING THESE

Objects of the present invention are to provide a preparation, which satisfies both a sufficient drug carrying amount and a preferred decomposition rate, and a method for manufacturing the preparation and to provide a member for a preparation used in the preparation of the present invention described above and a method for manufacturing the member. According to the present invention, there are provided a preparation containing a crosslinked substance of an anionic polypeptide and a cationic, polypeptide and a cationic drug; a method for manufacturing the preparation including a freezing step, a drying step, a crosslinking step, and a drug adding step; a member for a preparation formed of a crosslinked substance of an anionic polypeptide and a cationic polypeptide; and a method for manufacturing the member for a preparation. 1. A preparation comprising:a crosslinked substance of an anionic polypeptide and a cationic polypeptide; anda cationic drug.2. The preparation according to that is for local administration.3. The preparation according to claim 1 ,wherein a molar ratio of the anionic polypeptide to the cationic polypeptide is 1 to 3 to 3 to 1.4. The preparation according to claim 1 ,wherein each of the anionic polypeptide and the cationic polypeptide is a gene recombinant, which has an amino acid sequence derived from a partial amino acid sequence of collagen, or a chemical modification product thereof.5. The preparation according to claim 4 ,wherein the anionic polypeptide is a chemical modification product of a cationic polypeptide, andthe cationic polypeptide is a chemical modification product of an anionic polypeptide.6. The preparation according to claim 4 ,wherein the gene recombinant having an amino acid sequence derived from a partial amino acid sequence of collagen has a repeating sequence represented by Gly-X-Y, X and Y each independently represent any amino acid,a plurality of sequences represented by Gly-X-Y may be the same as or different from each ...

Design of pH-Sensitive Oligopeptide Complexes For Drug Release Under Mildly Acidic Conditions

The present invention discloses a design for a molecular delivery vehicle capable of delivering a molecular payload to a target cell and its intracellular compartments. Also disclosed are highly pH-sensitive nanoconstruct that takes advantage of the requirement of cationic charge for internalization of CPPs to mask the non-specific internalization, compositions containing nanoconstruct, and methods for forming the same. 1. A peptide nanoconstruct for targeted cell delivery , comprising:a cell targeting element comprising a cellular targeting peptide (CPP) having a cationic charge; anda pH-sensitive masking element comprising a pH-sensitive oligopeptide for masking the cationic charge of the cell targeting element,wherein the targeting element is operatively linked to the pH-sensitive masking element either directly or via an optional peptide linker.2. The peptide nanoconstruct of claim 1 , wherein said pH-sensitive oligopeptide comprises a histidine-glutamic acid repeat (HE) claim 1 , wherein n=10 to 40 claim 1 , and wherein said glutamic acid can be individually replaced by aspartic acid (D).3. The peptide nanoconstruct of claim 1 , wherein said CPP is one comprising arginine residues in clusters of three (-RRR-) or more.4. The peptide nanoconstruct of claim 1 , wherein said CPP is amphipathic.5. The peptide nanoconstruct of claim 1 , wherein said cell targeting element further comprises a cysteine residue (C) for thiol-linkage of a molecular payload.6. The peptide nanoconstruct of claim 1 , wherein the pH-sensitive oligopeptide and the CPP have matching opposite charges.7. The peptide nanoconstruct of claim 1 , wherein the pH-sensitive oligopeptide and the CPP have the same length.8. The peptide nanoconstruct of claim 1 , wherein the linkage between the cell targeting element and the pH-sensitive masking element is via direct linkage.9. The peptide nanoconstruct of claim 1 , wherein said peptide linker is cleavable by an enzyme.10. The peptide nanoconstruct of ...

CELL PENETRATING PEPTIDES

The present invention relates to peptides, in particular cell penetrating peptides, of 40 amino acid residues or less comprising at least one directly glycosylated amino residue and one or more arginine rich arm domains, and to conjugates of such cell penetrating peptides with a therapeutic molecule. The present invention further relates to the use of the peptides or conjugates in methods of treatment or as a medicament, especially in the treatment of genetic disorders of the central nervous system. 1. A peptide comprising at least one directly glycosylated amino acid residue and one or more arginine-rich arm domains , wherein the total length of the peptide is 40 amino acid residues or less.2. A peptide according to claim 1 , wherein the at least one directly glycosylated amino acid residue is O-linked glycosylated claim 1 , N-linked glycosylated or S-linked glycosylated.3. A peptide according to claim 1 , wherein at least one directly glycosylated amino acid residue is glycosylated at a functional group present in the amino acid side chain selected from an OH claim 1 , NH claim 1 , NHand SH.4. A peptide according to claim 1 , wherein the at least one directly glycosylated amino acid residue is selected from a glycosylated serine claim 1 , cysteine claim 1 , threonine claim 1 , asparagine claim 1 , glutamine claim 1 , aminoproline claim 1 , hydroxyproline claim 1 , tyrosine claim 1 , lysine claim 1 , and amino acid analogues thereof claim 1 , preferably the at least one directly glycosylated amino acid residue is a glycosylated serine.57-. (canceled)8. A peptide according to claim 1 , wherein the at least one directly glycosylated amino acid residue is glycosylated with a sugar selected from: glucose claim 1 , allose claim 1 , altrose claim 1 , idose claim 1 , gulose claim 1 , talose claim 1 , xylose claim 1 , lactose claim 1 , mannose claim 1 , galactose claim 1 , mannoseamine claim 1 , glucosamine claim 1 , galactosamine claim 1 , N-acetylgalactosamine claim 1 , ...

PLASMA CELL CYTOKINE VEHICLE CONTAINING FUSION PROTEINS FOR TARGETED INTRODUCTION OF SIRNA INTO CELLS AND TISSUES

A fusion molecule is provided that includes one or more inhibitory nucleic acids, a targeting polypeptide, and a nucleic acid binding moiety. The targeting polypeptide and the nucleic acid binding moiety include specific the amino acid sequences. A fusion molecule is also provided that includes one or more inhibitory nucleic acids, a targeting polypeptide, and a nucleic acid binding moiety adapted to bind a double-stranded RNA or to a small hairpin RNA. The targeting polypeptide being IL6 or IL21 or a fragment thereof. 1. A fusion molecule comprising one or more inhibitory nucleic acids , a targeting polypeptide , and a nucleic acid binding moiety , wherein said targeting polypeptide and said nucleic acid binding moiety comprise the amino acid sequence of SEQ ID NO: 19 or 20.2. A fusion molecule comprising one or more inhibitory nucleic acids , a targeting polypeptide , and a nucleic acid binding moiety adapted to bind a double-stranded RNA or to a small hairpin RNA , wherein said targeting polypeptide consists of IL6 or IL21 or a fragment thereof having like targeting , and said nucleic acid binding moiety is selected from the group consisting of: histone , protamine , cysteine-less human protamine 1 fused with the heavy chain of human ferritin , RDE4 and PKR (Accession number in parenthesis) (AAA36409 , AAA61926 , Q03963) , TRBP (P97473 , AAA36765) , PACT (AAC25672 , AAA49947 , NP 609646) , Staufen (AAD17531 , AAF98119 , AAD17529 , P25159) , NFAR1 (AF167569) , NFAR2 (AF167570 , AAF31446 , AAC71052 , AAA19960 , AAA19961 , AAG22859) , SPNR (AAK20832 , AAF59924 , A57284) , RHA (CAA71668 , AAC05725 , AAF57297) , NREBP (AAK07692 , AAF23120 , AAF54409 , T33856) , kanadaptin (AAK29177 , AAB88191 , AAF55582 , NP 499172 , NP 198700 , BAB19354) , HYL1 (NP 563850) , hyponastic leaves (CAC05659 , BAB00641) , ADAR1 (AAB97118 , P55266 , AAK16102 , AAB51687 , AF051275) , ADAR2 P78563 , P51400 , AAK17102 , AAF63702) , ADAR3 (AAF78094 , AAB41862 , AAF76894) , TENR (XP_059592 , ...

EXPRESSION VECTOR DELIVERY SYSTEM AND USE THEREOF FOR INDUCING AN IMMUNE RESPONSE

Embodiments of a novel system for delivering an expression vector encoding an antigen to a subject that allows for spatiotemporal control over stimulation of the subject's immune response to the antigen are provided. In some embodiments, the expression vector delivery system includes a polymer linked to an adjuvant in prodrug form that can form polymer nanoparticles and enter a cell (such as an immune cell) under physiological conditions. In some embodiments, the adjuvant is linked to the polymer by an enzyme degradable labile bond, the cleavage of which activates the adjuvant to stimulate an immune response. 1. A polymer linked to an adjuvant prodrug , wherein:the polymer linked to the adjuvant prodrug forms polymer nanoparticles that enter immune cells under physiological conditions, andthe adjuvant of the adjuvant prodrug comprises a functional moiety for adjuvant activity that is masked by linkage to a linker connected to the polymer,the linker comprises an enzyme-degradable labile bond, andcleavage of the enzyme-degradable labile bond by an intracellular enzyme unmasks the functional moiety and releases an active adjuvant.2. The polymer linked to the adjuvant prodrug of claim 1 , wherein the enzyme is a cathepsin.3. The polymer linked to the adjuvant prodrug of claim 1 , wherein the linker comprises a cathepsin-cleavable peptide comprising L-amino acids or D-amino acids comprising the amino acid sequence set forth as one of: KPLR (SEQ ID NO: 2) claim 1 , KLRP (SEQ ID NO: 3) claim 1 , SLVR (SEQ ID NO: 4) claim 1 , or SLRV (SEQ ID NO: 5) claim 1 , and cathepsin cleavage of the peptide cleaves the labile bond and activates the adjuvant.4. The polymer linked to the adjuvant prodrug of claim 1 , wherein the adjuvant prodrug comprises a toll-like receptor (TLR) agonist claim 1 , a Stimulator of Interferon Genes (STING) agonist claim 1 , a C-type lectin receptor (CLR) agonist claim 1 , a RIG-I-like receptor (RLR) agonist claim 1 , or a NOD-like receptor (NLR) agonist. ...

BLOCK COPOLYMERS

Described herein are block copolymers, and methods of making and utilizing such copolymers. The described block copolymers are disruptive of a cellular membrane, including an extracellular membrane, an intracellular membrane, a vesicle, an organelle, an endosome, a liposome, or a red blood cell. Preferably, in certain instances, the block copolymer disrupts the membrane and enters the intracellular environment. In specific examples, the block copolymer is endosomolytic and capable of delivering an oligonucleotide (e.g., an mRNA) to a cell. Compositions comprising a block copolymer and an oligonucleotide (e.g., an mRNA) are also disclosed. 120-. (canceled)22. The copolymer of claim 21 , wherein A is a random copolymer formed from monomers comprising formulae A2 and A5.25. A composition comprising:{'claim-ref': {'@idref': 'CLM-00021', 'claim 21'}, 'a) a block copolymer of ; and'}b) an oligonucleotide.26. The composition of claim 25 , wherein the oligonucleotide is selected from the group consisting of an siRNA claim 25 , an antisense oligonucleotide claim 25 , a dicer substrate claim 25 , a miRNA claim 25 , an aiRNA claim 25 , and an shRNA.28. The method of claim 27 , wherein the oligonucleotide is selected from the group consisting of an siRNA claim 27 , an antisense oligonucleotide claim 27 , a dicer substrate claim 27 , a miRNA claim 27 , an aiRNA claim 27 , and an shRNA.29. The method of claim 27 , wherein A is a random copolymer formed from monomers comprising formulae A2 and A5.30. The method of claim 29 , wherein B is a random copolymer formed from monomers comprising formulae B1 claim 29 , B2 claim 29 , and B3.33. The method of claim 27 , wherein L1 is a polymer having molecular weight of from 0.5 kDa to 6 kDa and comprising at least 10 ethylene oxide units.35. The method of claim 34 , wherein the oligonucleotide is selected from the group consisting of an siRNA claim 34 , an antisense oligonucleotide claim 34 , a dicer substrate claim 34 , a miRNA claim 34 , ...

MULTI-TARGETED, TUNABLE, SUSTAINED DELIVERY OF PAYLOADS TO CHARGED AVASCULAR TISSUES

Provided here in are methods and compositions for delivering a payload molecule to a charged avascular tissue or charged partially vascularized tissue in a subject, the method including administering to a subject in need thereof an effective amount of a carrier, wherein the carrier is a cationic carrier and/or has a surface charge distribution such that about 40% or greater of a continuous region of the surface is positively charged, and wherein the carrier is linked with a payload molecule, to deliver the payload molecule to the charged avascular tissue and/or the charged partially vascularized tissue. 1. A method for delivering a payload molecule to a charged avascular tissue and/or a charged partially vascularized tissue in a subject , comprising:administering to a subject in need thereof an effective amount of a carrier, wherein the carrier is a cationic carrier and/or has a surface charge distribution such that about 40% or greater of a continuous region of the surface is positively charged, and wherein the carrier is linked with a payload molecule, to deliver the payload molecule to the charged avascular tissue and/or the charged partially vascularized tissue.2. The method of claim 1 , wherein the charged avascular tissue and/or the partially vascularized tissue is articular cartilage claim 1 , an intervertebral disc claim 1 , meniscus claim 1 , cornea claim 1 , tracheal cartilage claim 1 , costal cartilage claim 1 , nasal cartilage claim 1 , auricular cartilage claim 1 , a tendon claim 1 , or a ligament.3. The method of claim 1 , wherein the payload molecule is delivered to the extracellular space of the charged avascular tissue or the charged partially vascularized tissue.4. The method of claim 1 , wherein the carrier has a net neutral charge claim 1 , optionally wherein the carrier has a surface charge distribution such that about 40% or greater of a continuous region of the surface is positively charged.5. The method of claim 4 , wherein the carrier is an ...

Modified heat shock proteins

The present disclosure generally relates to modified heat shock protein compositions that improve intracellular performance when delivered across the plasma and/or nuclear membranes. Also provided are methods for treating ocular, neurological, muscular, hepatic, renal, integumentary, cardiovascular and pulmonary conditions with the modified heat shock proteins are disclosed herein.

Method of developing a vaccine using peptide-poly ic complexes

The invention describes the development of more potent peptide vaccines to prevent or treat infections or cancer. Small synthetic peptides from the known sequences of viral, bacterial, parasitic or tumor antigens are modified so they can spontaneously form complexes with a synthetic nucleic acid, such as Poly IC, that functions as an immunological adjuvant. The peptide-nucleic acid complexes are dramatically more immunogenic as compared to the separate components. The procedure for developing the vaccine involves the conjugation of a synthetic peptide containing a C residue to poly-K using a bi-functional cross-linking reagent (SMCC). The peptide/poly-K complex was then formulated with CMC and poly-IC to produce a self-adjuvant vaccine that was 36-fold more effective as compared to the same peptide administered mixed with the same adjuvant (but not complexed to it).

Peptides for Assisting Delivery Across the Blood Brain Barrier

The present invention provides compositions and methods useful for delivering agents to target cells or tissues, for example nerve cells and other cells in the central nervous system. The compositions and methods are useful for delivering agents across the blood-brain barrier. The present invention also provides methods of using the compositions provided by the present invention to deliver agents, for example therapeutic agents for the treatment of neurologically related disorders.

COMPOSITIONS AND METHODS TO MODIFY CELLS FOR THERAPEUTIC OBJECTIVES

The present disclosure provides compositions and methods that rapidly and selectively modify cells of the immune system to achieve therapeutic objectives. The methods can be practiced in vivo and any cell type that expresses a known marker can be targeted for a therapeutic objective. 142-. (canceled)43. A method of selectively transfecting T cells with a polynucleotide in vivo through receptor-mediated endocytosis , the method comprising: (i) a negatively-charged coating surrounding a porous core;', '(ii) a lymphocyte-directing agent extending from the surface of the nanocarrier wherein the lymphocyte-directing agent comprises a binding domain consisting of an ScFv fragment of a CD3 antibody or an ScFv fragment of a CD8 antibody that induces receptor-mediated endocytosis upon binding to CD3 or CD8 on the surface of a T cell; and', '(iii) a polynucleotide encoding a chimeric antigen receptor (CAR) targeting agent within the pores of the core;, 'Infusing a nanocarrier into the bloodstream of a subject wherein the nanocarrier comprises'}thereby selectively transfecting T cells with the polynucleotide in vivo through receptor-mediated endocytosis.44. A method of wherein the binding domain consists of SEQ ID NO. 1.45. A method of wherein the polynucleotide is a plasmid claim 43 , a minicircle plasmid claim 43 , or an mRNA molecule.46. A method of wherein the CAR is P28z.47. A method of wherein the nanocarrier further comprises an endosomal release agent extending from the surface of the nanocarrier and (ii) a nuclear localization signal (NLS) within the pores of the core.48. A method of wherein the endosomal release agent is selected from any one of SEQ ID NOs. 29-50.49. A method of wherein the NLS is selected from any one of SEQ ID NOS. 51-93.50. A method of wherein the nanocarrier further comprises a S/MAR element claim 43 , a PiggyBac transposase-containing plasmid claim 43 , or a Sleeping Beauty transposase-containing plasmid.51. A method of wherein the CAR targeting ...

TRANSFERRIN RECEPTOR TARGETING PEPTIDES

Described herein are peptides and variants thereof as well as peptide constructs comprising peptides conjugated to, linked to, or fused to agents, wherein the peptides and peptide constructs are capable of binding TfR. Binding of a peptide or peptide construct as described herein to TfR can enable transcytosis across an endothelial layer, e.g., the blood brain barrier, or the crossing of a cell membrane. Pharmaceutical compositions and uses of peptides and peptide constructs, as well as methods of designing and manufacturing such peptides and peptide constructs, to treat a disease or condition are also described herein. 1. A composition comprising an engineered transferrin receptor (TfR)-binding peptide , or a variant , homolog , fragment , or analog thereof.2. A composition comprising a peptide construct , wherein the peptide construct comprises:a) a transferrin receptor (TfR)-binding peptide, or a variant, homolog, fragment, or analog thereof; andb) an active agent,wherein the peptide is conjugated to, linked to, or fused to the active agent.3. A composition comprising an engineered peptide having at least 75% , at least 80% , at least 85% , at least 90% , at least 92% , at least 95% , at least 96% , at least 97% , at least 98% , at least 99% , or 100% sequence identity with any one of SEQ ID NO: 1-SEQ ID NO: 32 , SEQ ID NO: 36-SEQ ID NO: 67 , SEQ ID NO: 136-SEQ ID NO: 167 , SEQ ID NO: 171-SEQ ID NO: 202 , or SEQ ID NO: 356-SEQ ID NO: 358 , or a variant or a functional fragment thereof.4. The composition of any one of - , wherein the peptide penetrates a cellular layer comprising a blood brain barrier (BBB).5. The composition of any one of - , wherein the peptide penetrates a membrane and wherein the membrane is the membrane of a cell.6. The composition of claim 5 , wherein the cell expresses a TfR.7. The composition of claim 5 , wherein the peptide penetrates the membrane of the cell via TfR-mediated endocytosis.8. The composition of any one of - claim 5 , ...

Vaccination in newborns and infants

The present invention relates to vaccines comprising at least one mRNA encoding at least one antigen for use in the treatment of a disease in newborns and/or infants, preferably exhibiting an age of not more than 2 years, preferably of not more than 1 year, more preferably of not more than 9 months or even 6 months, wherein the treatment comprises vaccination of the newborn or infant and eliciting an immune response in said newborn or infant. The present invention is furthermore directed to kits and kits of parts comprising such a vaccine and/or its components and to methods applying such a vaccine or kit.

ANTISENSE ANTIBACTERIAL COMPOUNDS AND METHODS

Provided are antisense morpholino oligomers targeted against bacterial virulence factors such as genes that contribute to antibiotic resistance or biofilm formation, or genes associated with fatty acid biosynthesis, and related compositions and methods of using the oligomers and compositions, for instance, in the treatment of an infected mammalian subject. 1. An antisense morpholino oligomer , composed of morpholino subunits and phosphorus-containing intersubunit linkages joining a morpholino nitrogen of one subunit to a 5′-exocyclic carbon of an adjacent subunit , and having (a) about 10-40 nucleotide bases , and (b) a targeting sequence of sufficient length and complementarity to specifically hybridize to a bacterial mRNA target sequence that encodes a virulence factor; where the oligomer is conjugated to a cell-penetrating peptide (CPP).3. (canceled)4. The antisense morpholino oligomer of claim 2 , where the virulence factor is an antibiotic resistance protein selected from at least one of New Delhi metallo-beta-lactamase (NDM-1) and resistance-nodulation-cell division (RND)-type multidrug efflux pump subunit AdeA (adeA) claim 2 , or the virulence factor is a biofilm formation protein.5. The antisense morpholino oligomer of claim 4 , wherein the target sequence is selected from SEQ ID NOS: 1-4 claim 4 , wherein thymine bases (T) are optionally uracil bases (U).6. The antisense morpholino oligomer of claim 4 , wherein the targeting sequence is set forth in SEQ ID NOS: 11-15 claim 4 , comprises a fragment of at least 10 contiguous nucleotides of SEQ ID NOS: 11-15 claim 4 , or comprises a variant having at least 80% sequence identity to SEQ ID NOS: 11-15 claim 4 , wherein thymine bases (T) are optionally uracil bases (U).7. The antisense morpholino oligomer of claim 4 , wherein the biofilm formation protein is encoded by at least one of CepI or SuhB.8. The antisense morpholino oligomer of claim 7 , wherein the target sequence is selected from SEQ ID NOS: 5-9 claim 7 ...

Nanozyme Compositions and Methods of Synthesis and Use Thereof

Nanozymes and methods of use and synthesis thereof are provided.

TARGETED TRANSPLANTATION OF MITOCHONDRIA TO HEPATOCYTES

The present disclosure relates to, inter alia, compositions and kits comprising an asialoglycoprotein covalently attached to a polycation, and functional mammalian mitochondria that are at least partially purified and are electrostatically bound to the AsG-polycation molecule; as well as methods of their preparation and use. 1. A pharmaceutical composition comprising:an asialoglycoprotein (AsG) covalently attached to a polycation;and functional mammalian mitochondria that are at least partially purified;wherein the AsG, covalently attached to a polycation, is complexed electrostatically to the mitochondria.2. The composition of claim 1 , wherein the AsG comprises asialoorosomucoid (AsOR).3. The composition of claim 1 , wherein the polycation is highly positively charged and is selected from the group of polycations consisting of polylysine (PL) claim 1 , polyarginine claim 1 , and polyornithine.4. The composition of claim 3 , wherein the polycation is polylysine (PL).5. The composition of claim 1 , further comprising an endosomolytic agent.6. The composition of claim 5 , wherein the endosomolytic agent is listeriolysin.7. The composition of claim 5 , wherein the endosomolytic agent is a fragment of listeriolysin having endosomolytic activity or a listeriolysin peptide having endosomolytic activity.8. The composition of claim 1 , wherein the endosomolytic agent is covalently attached to an AsG by a bond cleavable under conditions that exist in endosome.9. The composition of claim 8 , wherein the bond cleavable under conditions that exist in endosome is a disulfide bond claim 8 , and an acid-labile bond.10. The composition of claim 9 , wherein the acid-labile bond is an imino- claim 9 , acetal claim 9 , or lactone bond.11. The compositions of claim 1 , wherein the mitochondria are obtained from a cell from a healthy donor or isolated from a mammalian cell or tissue.12. The composition of claim 11 , wherein the donor mammalian cell is a hepatocyte claim 11 , white ...

CO-ADMINISTRATION OF AN AGENT LINKED TO AN INTERNALIZATION PEPTIDE WITH AN ANTI-INFLAMMATORY

The invention provides methods of delivering pharmacologic agents linked to an internalization peptide, in which an inflammatory response inducible by the internalization peptide is inhibited by co-administration of an anti-inflammatory or by linking the internalization peptide to biotin or similar molecule. Such methods are premised in part on the results described in the examples whereby administration of a pharmacological agent linked to tat at high dosages is closely followed by an inflammatory response, which includes mast cell degranulation, histamine release and the typical sequelae of histamine release, such as redness, heat, swelling, and hypotension. 1. A method of inhibiting cerebral ischemia due to endovascular surgery , comprising:administering to a subject undergoing endovascular surgery a pharmacologic agent that inhibits binding of PSD95 to NDMAR 2B linked to an internalization peptide in a regime effective to inhibit cerebral ischemia; andadministering to the subject a mast cell degranulation inhibitor, whereby the mast cell degranulation inhibitor can inhibit an-anti-inflammatory response inducible by the internalization peptide and/or the mast cell degranulation inhibitor is administered within a period of 30 minutes before to 15 minutes after the pharmacological agent.2. A pharmacologic agent that inhibits binding of PSD95 to NDMAR 2B linked to an internalization peptide for use in inhibiting cerebral ischemia due to endovascular surgery in combination with a mast cell degranulation inhibitor to inhibit an inflammatory response inducible by the internalization peptide3. A mast cell degranulation inhibitor for use in inhibiting cerebral ischemia due to endovascular surgery in combination with a pharmacologic agent that inhibits binding of PSD95 to NDMAR 2B linked to an internalization peptide , wherein the mast cell degranulation inhibitor inhibits an inflammatory response inducible by the internalization peptide.3. The method claim 1 , agent or ...

EXON SKIPPING COMPOSITIONS FOR TREATING MUSCULAR DYSTROPHY

Antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon 44 skipping are described. 120.-. (canceled)21. An antisense oligonucleotide of 24 bases comprising the base sequence CTGTTCAGCTTCTGTTAGCCACTG (SEQ ID NO: 12) , wherein the antisense oligonucleotide is a morpholino antisense oligonucleotide , or a pharmaceutically acceptable salt thereof.22. The antisense oligonucleotide of claim 21 , wherein the antisense oligonucleotide is chemically linked to one or more moieties or conjugates that enhance the activity claim 21 , cellular distribution claim 21 , or cellular uptake of the antisense oligonucleotide.23. The antisense oligonucleotide of claim 21 , wherein the oligonucleotide is chemically linked to a polyethylene glycol moiety.24. A pharmaceutical composition comprising an antisense oligonucleotide of 24 bases comprising the base sequence CTGTTCAGCTTCTGTTAGCCACTG (SEQ ID NO: 12) claim 21 , wherein the antisense oligonucleotide is a morpholino antisense oligonucleotide claim 21 , and a pharmaceutically acceptable carrier.25. The pharmaceutical composition of claim 24 , wherein the antisense oligonucleotide is chemically linked to one or more moieties or conjugates that enhance the activity claim 24 , cellular distribution claim 24 , or cellular uptake of the antisense oligonucleotide.26. The pharmaceutical composition of claim 24 , wherein the oligonucleotide is chemically linked to a polyethylene glycol moiety. This patent application is a continuation of U.S. patent application Ser. No. 16/213,428, filed Dec. 7, 2018, which is a continuation of U.S. patent application Ser. No. 15/422,127, filed Feb. 1, 2017, which is a continuation of U.S. patent application Ser. No. 14/214,480, filed Mar. 14, 2014, now abandoned, which claims the benefit of U.S. Provisional Patent Application Ser. No. 61/784,547, filed Mar. 14, 2013. The entire contents of each of the foregoing applications are incorporated herein by ...

Cell membrane penetrating conjugates for gene editing

A genome-editing complex for modifying a target polynucleotide comprising a recombinant β helical protein linked to either one or more molecules of a genome-editing system or a plasmid encoding for one or more molecules of a genome-editing system, wherein the β helical protein length is in the range of from 5 nm to 25 nm, and width is in the range of from 1 nm to 5 nm.

OCA-B PEPTIDE CONJUGATES AND METHODS OF TREATMENT

Disclosed herein, are compounds comprising a peptide, wherein the peptide is OCA-B or an OCA-B fragment thereof; a linker; and a cell penetrating peptide. Also described herein, are methods of administering compounds to subjects for the treatment of Type I diabetes and blocking the interaction between OCA-B and Jmjd1a. 1. A compound comprising a peptide , wherein the peptide is OCA-B , an OCA-B fragment , or a variant thereof; a linker; and a cell penetrating peptide.2. (canceled)3. The compound of claim 1 , wherein the linker is a hydrocarbon linker.4. The compound of claim 1 , wherein the OCA-B fragment has the amino acid sequence as set forth in SEQ ID NO: 2 or SEQ ID NO: 3.5. (canceled)6. (canceled)7. The compound of claim 1 , wherein the OCA-B fragment has an amino acid sequence of at least 90% sequence identity when compared to a wild type fragment of an OCA-B peptide.8. The compound of claim 1 , wherein the OCA-B variant has an amino acid sequence of at least 90% sequence identify when compared to a reference sequence.9. (canceled)10. The compound of claim 1 , wherein the linker is a peptide linker.11. (canceled)12. The compound of claim 1 , wherein the cell penetrating peptide is a TAT sequence.13. (canceled)14. (canceled)15. The compound of claim 1 , wherein the peptide is SEQ ID NO: 2 claim 1 , the linker is GSG claim 1 , and the cell penetrating peptide is SEQ ID NO: 4.16. (canceled)17. The compound of claim 1 , wherein the compound is capable of blocking the interaction of OCA-B with Jmjd1a.18. The compound of claim 1 , wherein the compound is cyclized or PEGylated.19. A pharmaceutical composition comprising the compound of and a pharmaceutically acceptable carrier.20. The pharmaceutical composition of claim 19 , wherein the pharmaceutical composition is formulated for intravenous administration.21. A method of treating a subject with a disease claim 19 , wherein the treatment of the disease requires OCA-B repression claim 19 , the method comprising ...

COMPOSITIONS AND METHODS FOR MODULATING SMN GENE FAMILY EXPRESSION

Aspects of the invention provide single stranded oligonucleotides for activating or enhancing expression of SMN1 or SMN2. Further aspects provide compositions and kits comprising single stranded oligonucleotides for activating or enhancing expression of SMN1 or SMN2 that comprises exon 7. Methods for modulating expression of SMN1 or SMN2 using the single stranded oligonucleotides are also provided. Further aspects of the invention provide methods for selecting a candidate oligonucleotide for activating or enhancing expression of SMN1 or SMN2. 1. A composition comprising a cell and a single stranded oligonucleotide , wherein the single stranded oligonucleotide is produced by a process comprising:synthesizing a single stranded oligonucleotide that:(a) has a sequence 5′-X-Y-Z, wherein X is any nucleotide, Y is a nucleotide sequence of 6 nucleotides in length that is not a seed sequence of a human microRNA, and Z is a nucleotide sequence of 1-8 nucleotides in length,(b) is 100% complementary with a PRC2-associated region of a human SMN gene, wherein the PRC2-associated region is a region of the SMN gene that has a sequence that occurs at a higher frequency in a sequencing reaction of products of an RNA-immunoprecipitation assay that employs an antibody that targets Ezh2 to immunoprecipitate RNA-associated PRC2 complexes from cells comprising the SMN gene compared to a control sequencing reaction of products of a control RNA-immunoprecipitation assay that employs a control antibody, and(c) is 8 to 15 nucleotides in length,wherein, during the synthesis, at least one nucleotide incorporated into the oligonucleotide comprises a 2′ O-methyl and/or a 2′-fluoro, and a phosphorothioate internucleotide linkage is incorporated between at least two nucleotides.2. The composition of claim 1 , wherein the oligonucleotide does not comprise three or more consecutive guanosine nucleotides.3. The composition of claim 1 , wherein the oligonucleotide does not comprise four or more ...

UNIT STRUCTURE-TYPE PHARMACEUTICAL COMPOSITION FOR NUCLEIC ACID DELIVERY

A unit structure-type pharmaceutical composition includes a single nucleic acid, such as an antisense nucleic acid, electrostatically bound to a single block copolymer having a cationic polyamino acid segment and a hydrophilic polymer chain segment. The negative charges of the nucleic acid are counterbalanced, at least substantially, by the positive charges of the cationic polyamino acid segment such that the pharmaceutical composition is electrically neutral or nearly electrically neutral. Further, the nucleic acid is covered with the hydrophilic polymer chain segment. The block copolymer thereby improves the blood retention capability of the nucleic acids. 19.-. (canceled)10. A unit structure , consisting of:a single nucleic acid having a length of 10 to 30 bases, anda single block copolymer having a cationic polyamino acid segment and a hydrophilic polymer chain segment,wherein:(i) a difference between a total of positive charges derived from cationic groups of the cationic polyamino acid segment and a total of negative charges derived from the nucleic acid in the unit structure falls within a range of ±10% of the total of the negative charges derived from the nucleic acid,(ii) the hydrophilic polymer chain segment comprises polyethylene glycol,(iii) the polyethylene glycol has a radius of inertia (Rg) equal to or longer than the length of the nucleic acid, and(iv) the cationic polyamino acid segment is bound to the nucleic acid via electrostatic bonds.11. The unit structure according to claim 10 , wherein:the hydrophilic polymer chain segment comprises a 2-arm branched polyethylene glycol, andeach of the arms of the 2-arm branched polyethylene glycol has a radius of inertia (Rg) equal to or longer than the length of the nucleic acid.12. The unit structure according to claim 10 , wherein all cationic amino acids in the cationic polyamino acid segment have only one cationic group in each side chain.13. The unit structure according to claim 10 , wherein the ...

Hydrogel-Linked IL-1ra Prodrug

The present invention relates to a hydrogel-linked IL-Ira prodrug or pharmaceutically acceptable salt thereof. It further relates to a pharmaceutical composition comprising said hydrogel-linked IL-Ira prodrug, its use as medicament for the treatment of a IL-1 mediated disease, ways of application of such hydrogel-linked IL-Ira prodrugs or pharmaceutical compositions, and containers comprising the hydrogel-linked IL-Ira prodrugs or pharmaceutically acceptable salt thereof or a pharmaceutical composition comprising said hydrogel-linked IL-Ira prodrug or pharmaceutically acceptable salt thereof.

AMPHIPATHIC PEPTIDE

The present invention is directed to an amphipathic peptide and methods of using the amphipathic peptide for delivering small molecule agents to a cell. Ideally, the amphipathic cell penetrating peptide comprises less than approximately 50 amino acid residues with at least 6 arginine residues, at least 12 Alanine Residues, at least 6 leucine residues, optionally at least one cysteine residue, and at least two but no greater than three glutamic acids wherein the arginine residues are evenly distributed along the length of the peptide; and the peptide has a defined ratio of arginine to negatively charged amino acid residues and a defined ratio of hydrophilic amino acid residues to hydrophobic amino acid residues. The present invention is also directed to a nanoparticle and cell delivery system comprising the amphipathic cell penetrating peptide of the invention. The peptide, nanoparticle or cell delivery system of the invention may be used in therapy. For example, the peptide may be used as a therapeutic agent delivery system, in which the therapeutic agent may include nucleic acids or other small molecules. 1. An amphipathic cell penetrating peptide of less than approximately 50 amino acid residues comprising at least 6 arginine residues (R) , at least 12 alanine residues (A) , at least 6 leucine residues (L) , optionally at least one cysteine residue (C) , and at least two but no greater than three glutamic acids (E) whereinthe arginine (R) residues are evenly distributed along the length of the peptide;the ratio of arginine (R) to negatively charged glutamic acid (E) residues is from at least 6:2 to 9:2; andthe ratio of hydrophilic amino acid residues to hydrophobic amino acid residues at pH 7 is at least 30:67 to 40:60; orwherein the peptide comprises or consists of WEARLARALARALARELARALARALRACEA (SEQ ID No. 4).2. An amphipathic cell penetrating peptide of less than approximately 50 amino acid residues comprising at least 6 arginine residues (R) , at least 12 ...

COMPOUNDS AND METHODS FOR MODULATING PHARMACOKINETICS

Methods and compositions are described for management of the pharmacokinetic properties of active agents, e.g., therapeutic moieties, by conjugating, fusing, or non-direct linkage of the active agent to one or more wild-type or modified heparin-binding peptides (HB). Compounds may be administered to tissues including skin. Contemplated uses include treatment of disease, allergen immunotherapy, and immunization. Other aspects relate to compositions, methods and kits comprising heparin-binding peptides (HB) fused or conjugated to the therapeutic agents. 1. A composition for controlled systemic release of a therapeutic , the composition comprising:a therapeutic moiety; andat least one heparin binding peptide linked to the therapeutic moiety, wherein the heparin binding peptide includes a portion with a sequence differing from KRKKKGKGLGKKRDPCLRKYK (SEQ ID NO: 1) by at least one amino acid.2. The composition of wherein the sequence shares at least 80% amino acid identity with KRKKKGKGLGKKRDPCLRKYK.3. The composition of wherein the sequence shares at least 95% amino acid identity with KRKKKGKGLGKKRDPCLRKYK.4. The composition of claim 3 , further comprising at least a second heparin binding peptide comprising a sequence sharing at least 80% amino acid identity with KRKKKGKGLGKKRDPCLRKYK.5. The composition of wherein the sequence is KRKKKGKGLGKKRDPCLRKYK except that the C at the 16position has been replaced by the at least one amino acid.6. The composition of wherein the sequence is one selected from the group consisting of: KRKKKGKGLGKKRDPRLRKYK (SEQ ID NO: 2); and KRKKKGKGLGKKRDPKLRKYK (SEQ ID NO: 3).7. The composition of wherein the sequence is KRKKKGKGLGKKRDPSLRKYK (SEQ ID NO: 82).8. The composition of wherein the therapeutic moiety comprises insulin-like growth factor 1 (IGF-1) or Interleukin 1 receptor antagonist (IL-IRA).9. The composition of claim 1 , further comprising one or more of a polyhistidine tag claim 1 , a FLAG-tag claim 1 , and a hydrogel.10E. coli. The ...

METHODS FOR IMPROVING EXERCISE TOLERANCE IN MYALGIC ENCEPHALOMYELITIS PATIENTS

The present invention relates to methods for treating a subject with myalgic encephalomyelitis/chronic fatigue syndrome symptoms comprising administering a target subject a pharmaceutical composition comprising a therapeutic dsRNA (tdsRNA).

CELL PENETRATING PEPTIDES FOR INTRACELLULAR DELIVERY OF MOLECULES

A cell-penetrating peptide characterized in that it comprises an amino acid sequence XXXXXXXXXXXXXXXX(SEQ ID No: 1 1), wherein Xis F or W, Xis F, W or Y, Xis beta-A or S, Xis K, R or L, Xis E, R or S, Xis R. T or S, Xis E, R or S, Xis none, F or W, Xis P or R, Xis R or L, Xis K, W or R, Xis R or F and Xis R or K. 1. A method of delivering a cargo molecule into an individual , comprising administering a nanoparticle or complex into the individual , wherein the nanoparticle or complex comprises a VEPEP-3 cell-penetrating peptide and said cargo molecule , and wherein the VEPEP-3 cell-penetrating peptide comprises an amino acid sequence of:{'sub': 3', '4', '1', '2', '5', '4', '1', '2', '6', '7', '1', '8', '9', '10', '11', '12', '13', '1', '2', '3', '4', '5', '6', '7', '8', '9', '10', '11', '12', '13, 'a) XXXXXXXXXXXXXXXXX(SEQ ID No: 11), wherein Xin positions 3, 7, and 11 are, independently from each other, F or W, Xin positions 4 and 8 are, independently from each other, F, W or Y, Xis beta-A or S, Xin positions 2 and 6 are, independently from each other, K, R or L, Xis E, R or S, Xis R, T or S, Xis E, R or S, Xis none, F or W, Xis P or R, Xis R or L, Xis K, W or R, Xis R or F and Xis R or K;'}{'sub': 3', '14', '14', '3', '14, 'b) XKXWWERWWRXWPRKRK (SEQ ID No: 9), wherein Xis a beta-alanine or a serine, Xin positions 3 and 11 are, independently from each other, a non-natural amino acid, and there is a hydrocarbon linkage between the two non-natural amino acids; or'}{'sub': 3', '14', '14', '3', '14, 'c) XRWWXLWWRSWXRLWRR (SEQ ID No: 10), wherein Xis a beta-alanine or a serine, Xin positions 5 and 12 are, independently from each other, a non-natural amino acid, and there is a hydrocarbon linkage between the two non-natural amino acids.'}2. The method of claim 1 , wherein the nanoparticle or complex comprises a core comprising the VEPEP-3 cell-penetrating peptide and the cargo claim 1 , wherein the cargo molecule is complexed to the VEPEP-3 cell-penetrating peptide.3. The ...

Pharmaceutical Preparation Containing Camptothecin-Based Polymeric Derivative

Provided is a pharmaceutical preparation including a polymerized camptothecin derivative obtained by bonding a camptothecin derivative to a polymer carrier, the polymerized camptothecin derivative being capable of associating in an aqueous solution and having a nanoparticle-forming property, and the pharmaceutical preparation is a pharmaceutical preparation composition having enhanced preparation stability. Particularly, a pharmaceutical preparation having an excellent associated aggregate-forming property, which is an important factor, and excellent storage stability against chemical stability is provided. Disclosed is a pharmaceutical preparation including a block copolymer in which a polyethylene glycol segment and a polyglutamic acid segment containing a glutamic acid unit having a camptothecin derivative bonded thereto, and a pharmaceutical preparation including one or more additives selected from the group consisting of arginine, histidine, and sodium chloride. 2. The pharmaceutical preparation according to claim 1 , wherein the pharmaceutical preparation is a freeze-dried preparation. The present invention relates to a pharmaceutical preparation having enhanced preparation stability, the pharmaceutical preparation including a polymerized camptothecin derivative having a camptothecin derivative bonded to a polymer carrier. The polymerized camptothecin derivative has associative properties between a plurality of the derivative molecules in an aqueous solution and has a property of forming nanoparticles. The invention relates to a technology concerning a pharmaceutical preparation having excellent storage stability, the pharmaceutical preparation including a polymerized camptothecin derivative having such a nanoparticle-forming property.In order to effectively exhibit the efficacy of a pharmaceutical product, it is required to cause a pharmacologically active compound to act on an appropriate site in vivo at an appropriate concentration at an appropriate time. ...

PEPTIDE-MEDIATED INTRAVESICAL DELIVERY OF THERAPEUTIC AND DIAGNOSTIC AGENTS

The present invention relates to compositions comprising therapeutic and/or diagnostic anionic agents together with cationic peptides and their use in methods for delivering the anionic agents to bladder cells. 1. A method of treating a subject with overactive bladder , comprising administering into the bladder of the subject an effective amount of an antisense oligonucleotide directed against nerve growth factor in combination with protamine in an amount that promotes the uptake of the antisense oligonucleotide into bladder cells , wherein the antisense oligonucleotide and the protamine form a non-covalent attachment , and wherein the mass ratio of protamine to antisense oligonucleotide directed against nerve growth factor is 5:1 to 15:1 respectively.2. The method of which is a method of treating a subject with overactive bladder claim 1 , comprising administering into the bladder of the subject a therapeutic amount of the antisense oligonucleotide toward nerve growth factor in combination with protamine in an amount that promotes the uptake of the antisense oligonucleotide into bladder cells to reduce the level of nerve growth factor and reduce the frequency of urination and/or feeling of urgency to urinate.3. The method of claim 1 , where the oligonucleotide inhibits expression of nerve growth factor.5. The method of claim 1 , where the mass ratio of protamine to antisense oligonucleotide directed against nerve growth factor is 10:1 respectively.6. The method of claim 1 , where the mass ratio of protamine to antisense oligonucleotide directed against nerve growth factor is 5:1 respectively.7. The method of claim 1 , comprising the antisense oligonucleotide directed against nerve growth factor in a concentration range between 2 to 20 μM.8. The method of claim 1 , comprising protamine in a concentration range between 20 to 200 μM.9. The method of claim 1 , comprising the antisense oligonucleotide directed against nerve growth factor in a concentration range between ...

PEPTIDE-POLYNUCLEOTIDE COMPLEX FOR POLYNUCLEOTIDE TRANSFECTION

A pharmaceutical composition comprising a peptide-polynucleotide complex, and methods of use thereof. 1. A pharmaceutical composition comprising a peptide-polynucleotide complex , the peptide-polynucleotide complex comprising a ratio of peptide:polynucleotide that is less than 50:1 , wherein the peptide is (a) non-lytic and capable of affecting the release of a polynucleotide from an endosome of a cell , and (b) comprises an amino acid sequence with at least 80% identity to the amino acid sequence of SEQ ID NO: 1.2. The composition of claim 1 , wherein the ratio of peptide to oligonucleotide is chosen from about 5:1 to about 45:1.3. The composition of claim 2 , wherein the ratio of peptide to oligonucleotide is about 5:1 to about 35:1 claim 2 , about 10:1 to about 40:1 claim 2 , or about 15:1 to about 45:1.4. (canceled)5. The composition of claim 2 , wherein the ratio of peptide to oligonucleotide is about 5:1 to about 25:1 claim 2 , about 10:1 to about 30:1 claim 2 , about 15:1 to about 35:1 claim 2 , or about 20:1 to about 40:1 claim 2 , or about 25:1 to about 45:1.6. The composition of claim 1 , wherein the complex is a nanoparticle with a diameter of about 50 nm to about 200 nm.7. The composition of claim 1 , wherein the peptide comprises an amino acid sequence with at least 90% identity to SEQ ID NO: 1.8. The composition of claim 1 , wherein the peptide comprises at least one cationic region and at least one histidine residue located adjacent to or within at least one cationic region of the peptide.9. The composition of claim 1 , wherein the polynucleotide is a non-coding RNA capable of regulating or inhibiting the expression of a nucleic acid sequence.10. The composition of claim 9 , wherein the polynucleotide is a small interfering RNA (siRNA) or an microRNA (miRNA).11. The composition of claim 1 , wherein the complex is coated with albumin.12. The composition of claim 1 , wherein the polynucleotide of the complex disrupts at least one nucleic acid sequence ...

Cyclodextrin-based polymers for therapeutic delivery

Provided are methods relating to the use of CDP-therapeutic agent conjugates for the treatment of a disease or disorder, e.g., autoimmune disease, inflammatory disease, central nervous system disorder, cardiovascular disease, or metabolic disorder. Also provided are CDP-therapeutic agent conjugates, particles comprising CDP-therapeutic agent conjugates, and compositions comprising CDP-therapeutic agent conjugates.

Methods for treating progeroid laminopathies using oligonucleotide analogues targeting human lmna

Provided are methods of treatment in subjects having progeroid diseases and related conditions which rely upon LMNA-targeted antisense oligonucleotides for reducing expression of one or more aberrantly spliced LMNA mRNA isoforms that encode progerin.

THERAPEUTIC NANOCONJUGATES AND USES THEREOF

The present invention relates to nanostructured conjugates, more specifically to nanostructured fusion proteins suitable for the selective delivery of their conjugated therapeutic agents to specific cell and tissue types. It also relates to nanoparticles comprising such nanostructured proteins and the therapeutic uses thereof. 1. A fusion protein comprising(i) a polycationic peptide,(ii) an intervening polypeptide region which is stefin A or a variant thereof and(iii) a positively charged amino acid-rich region,wherein the intervening polypeptide region is conjugated to at least one auristatin molecule.2. The fusion protein according to wherein the polycationic peptide is selected from the group consisting of(i) a sequence which is capable of specifically interacting with a receptor on a cell surface and promoting internalization of the fusion protein on said cell,(ii) an arginine-rich sequence,(iii) the GWH1 peptide,(iv) a CD44 ligand,(v) a peptide capable of crossing the blood brain barrier,(vi) a cell penetrating peptide and(vii) a nucleolin-binding peptide.3. The fusion protein according to wherein the CXCR4 ligand is a peptide selected from the group consisting of a peptide comprising the sequence RRWCYRKCYKGYCYRKCR (SEQ ID NO:5) claim 3 , the V1 peptide (SEQ ID NO:6) claim 3 , the CXCL12 (SEQ ID NO:7) peptide claim 3 , the vCCL2 (SEQ ID NO:8) or a functionally equivalent variant thereof.4. The fusion protein according to any of to wherein the positively charged amino acid-rich region is a polyhistidine region.5. The fusion protein according to any of to wherein the Stefin A is human Stefin A claim 3 , wherein the Stefin A comprises a V48D mutation claim 3 , a G4W mutation and wherein amino acids 71 to 73 are replaced with a heterologous peptide insertion consisting of the amino acids NGP.6. The fusion proteome according to any of to wherein the auristatin is monomethylauristatin E.7. The fusion protein according to any of to wherein the polycationic peptide is ...

Peptide Oligonucleotide Conjugates

Provided herein are oligonucleotides, peptides, and peptide-oligonucleotide-conjugates. Also provided herein are methods of treating a muscle disease, a viral infection, or a bacterial infection in a subject in need thereof, comprising administering to the subject oligonucleotides, peptides, and peptide-oligonucleotide-conjugates described herein. 56-. (canceled)9. The peptide-oligonucleotide-conjugate of claim 1 , or a pharmaceutically acceptable salt thereof claim 1 , wherein the peptide-oligonucleotide-conjugate is of the formula (Ia) and Ris —C(O)(O—CHCH)OH.10. The peptide-oligonucleotide-conjugate of claim 1 , or a pharmaceutically acceptable salt thereof claim 1 , wherein the peptide-oligonucleotide-conjugate is of the formula (Ib) and E′ is selected from H claim 1 , Calkyl claim 1 , —C(O)CH claim 1 , benzoyl claim 1 , and stearoyl.11. The peptide-oligonucleotide-conjugate of claim 1 , or a pharmaceutically acceptable salt thereof claim 1 , wherein each Ris fluorine.13. The peptide-oligonucleotide-conjugate of claim 1 , or a pharmaceutically acceptable salt thereof claim 1 , whereinJ is independently selected from cysteine and arginine.14. The peptide-oligonucleotide-conjugate of claim 1 , or a pharmaceutically acceptable salt thereof claim 1 , whereintwo J groups are cysteine.15. The peptide-oligonucleotide-conjugate of claim 1 , or a pharmaceutically acceptable salt thereof claim 1 , whereinz is 15-25.16. The peptide-oligonucleotide-conjugate of claim 1 , or a pharmaceutically acceptable salt thereof claim 1 , wherein each Ris N(CH).17. The peptide-oligonucleotide-conjugate of claim 1 , or a pharmaceutically acceptable salt thereof claim 1 , wherein{'sup': '2', 'each Ris a nucleobase independently at each occurrence selected from adenine, guanine, cytosine, 5-methyl-cytosine, thymine, uracil, and hypoxanthine.'}1920-. (canceled)21. The peptide-oligonucleotide-conjugate of claim 1 , or a pharmaceutically acceptable salt thereof claim 1 , wherein{'sub': '3', ' ...

NUCLEIC ACID-POLYPEPTIDE COMPOSITIONS AND METHODS OF INDUCING EXON SKIPPING

Disclosed herein are molecules and pharmaceutical compositions that induce an insertion, deletion, duplication, or alteration in an incorrectly spliced mRNA transcript to induce exon skipping or exon inclusion. Also described herein include methods for treating a disease or disorder that comprises a molecule or a pharmaceutical composition that induces an insertion, deletion, duplication, or alteration in an incorrectly spliced mRNA transcript to induce exon skipping or exon inclusion. 1. A method of inducing exon skipping in a targeted pre-mRNA transcript of DMD gene , comprising:a) contacting a muscle cell with a phosphorodiamidate morpholino oligonucleotide (PMO) conjugate, wherein the PMO conjugate comprises an anti-transferrin receptor antibody or antigen binding fragment thereof, and a PMO targeting an acceptor splice site, a donor splice site, or an exonic splice enhancer element of the targeted pre-mRNA transcript of the DMD gene; wherein the PMO induces exon skipping in the targeted pre-mRNA transcript, and wherein the PMO conjugate is preferentially delivered into the muscle cell;b) hybridizing the PMO to the targeted pre-mRNA transcript to induce exon skipping in the targeted pre-mRNA transcript; andc) translating a mRNA transcript produced from the targeted pre-mRNA transcript processed in step b) in the muscle cell to generate a truncated DMD protein.2. The method of claim 1 , wherein the PMO induces skipping of exon 8 of the DMD gene.3. The method of claim 1 , wherein the PMO induces skipping of exon 23 of the DMD gene.4. The method of claim 1 , wherein the PMO induces skipping of exon 35 of the DMD gene.5. The method of claim 1 , wherein the PMO induces skipping of exon 43 of the DMD gene.6. The method of claim 1 , wherein the PMO induces skipping of exon 44 of the DMD gene.7. The method of claim 1 , wherein the PMO induces skipping of exon 45 of the DMD gene.8. The method of claim 1 , wherein the PMO induces skipping of exon 53 of the DMD gene.9. The ...

METHOD OF DEVELOPING A VACCINE USING PEPTIDE-POLY IC COMPLEXES

The invention describes the development of more potent peptide vaccines to prevent or treat infections or cancer and their administration to a subject in order to elicit a T cell response in the subject. Small synthetic peptides from the known sequences of viral, bacterial, parasitic or tumor antigens are modified so they can spontaneously form complexes with a synthetic nucleic acid, such as Poly IC, that functions as an immunological adjuvant. The peptide-nucleic acid complexes are dramatically more immunogenic as compared to the separate components. The procedure for developing the vaccine involves the conjugation of a synthetic peptide containing a C residue to poly-K using a bi-functional cross-linking reagent (SMCC). The peptide/poly-K complex was then formulated with CMC and poly-IC to produce a self-adjuvant vaccine that was 36-fold more effective as compared to the same peptide administered mixed with the same adjuvant (but not complexed to it). 1. A method of eliciting an antigen-specific T cell response in a subject comprising: an immune adjuvant wherein the immune adjuvant is a synthetic nucleic acid inducing a cell-mediated response and selected from the group consisting of polyinosinic:polycytidylic acid (Poly-IC), Poly-IC/LC, Poly-K, Poly-IC12U, and carboxymethyl cellulose (CMC); and', a T cell epitope for infectious agents or tumor antigens wherein the T cell epitope is between 8 to 15 amino acids in length;', 'a short hydrophobic amino acid linker; and', 'at least one arginine (R) residue wherein the at least one arginine residue is appended to an amino or a carboxy terminal end of the T-cell epitope;', 'wherein the modified peptide consists of the T-cell epitope, the short hydrophobic amino acid linker, and the at least one arginine residue without any additional amino acids;, 'a modified peptide comprising, 'wherein interaction of the immune adjuvant and the modified peptide form a complex; and, 'obtaining a vaccine comprisingadministering the ...

VACCINATION IN NEWBORNS AND INFANTS

The present invention relates to vaccines comprising at least one mRNA encoding at least one antigen for use in the treatment of a disease in newborns and/or infants, preferably exhibiting an age of not more than 2 years, preferably of not more than 1 year, more preferably of not more than 9 months or even 6 months, wherein the treatment comprises vaccination of the newborn or infant and eliciting an immune response in said newborn or infant. The present invention is furthermore directed to kits and kits of parts comprising such a vaccine and/or its components and to methods applying such a vaccine or kit. 1. Vaccine comprising at least one mRNA encoding at least one antigen for use in the prophylaxis and/or treatment of a disease in newborns and/or infants , exhibiting an age of not more than 2 years , wherein the treatment comprises vaccination of the newborn or infant and eliciting an immune response in said newborn or infant.2. Vaccine for use according to claim 1 , wherein eliciting an immune response in a patient comprises eliciting a Th1 immune response.3. Vaccine for use according to any of or claim 1 , wherein the newborns or infants is male or female claim 1 , a mammal claim 1 , a human and/or exhibits an age of not more than 3 years of not more than 2 years claim 1 , of not more than 1.5 years claim 1 , of not more than 1 year (12 months) claim 1 , of not more than 9 months claim 1 , 6 months or 3 months.4. Vaccine for use according to any of to claim 1 , wherein the disease is selected from infectious diseases claim 1 , viral claim 1 , bacterial or protozoological infectious diseases claim 1 , autoimmune diseases claim 1 , allergies or allergic diseases or cancer or tumour diseases.5. Vaccine for use according to any of to claim 1 , wherein the antigen is selected from protein and peptide antigens claim 1 , tumour antigens claim 1 , self-antigens or auto-antigens claim 1 , autoimmune self-antigens claim 1 , pathogenic antigens claim 1 , viral antigens ...

COMPOSITIONS AND METHODS OF TREATING THERAPY RESISTANT CANCER AND USES THEREOF

The present disclosure is directed to a composition for the sustained-release delivery of an active agent to a target cell of an individual. The compositions disclosed herein comprise of at least one porous particle; at least one polymer; and at least one active agent. In an embodiment, the porous particle comprises a plurality of microscale reservoirs. In an exemplary embodiment, the at least one active agent is covalently linked to the at least one polymer to form a polymer-active agent conjugate, and the polymer-active agent conjugate is contained in the plurality of microscale reservoirs of the porous particle. In some embodiments, the active agent is released with zero-order or near zero-order kinetics following administration of the composition. The present disclosure is also directed to a method of treating a tumor by administering to an individual the composition described supra. 1. A method of delivering an active agent to a target cell in a subject , said method comprising: at least one porous particle,', 'wherein the porous particle comprises a plurality of reservoirs, and, 'administering to the subject a composition comprisingwherein the plurality of reservoirs comprise an open cavity that is open to a surface of the porous particle;at least one polymer; and wherein the at least one active agent is covalently linked via a cleavable bond to the at least one polymer to form a polymer-active agent conjugate,', 'wherein the cleavable bond is cleavable in response to an environmental condition within the target cell, and', 'wherein the polymer-active agent conjugate is dispersibly contained in the plurality of reservoirs of the least one porous particle;, 'at least one active agent,'}wherein the polymer-active agent conjugate is released at a target cell from the porous particle;wherein the released polymer-active agent conjugate self-assembles into nanoparticles upon coming in contact with an aqueous environment;wherein the polymer-active agent conjugate ...

Photodynamic therapy composition

A method of treating a PSMA expressing cancer in a subject includes (a) administering to the subject a PSMA-targeted phthalocyanine conjugate compound having the formula (I), (b) detecting the PSMA-targeted phthalocyanine compound bound to and/or complexed with the prostate cancer cells to determine the location and/or distribution of the prostate cancer cells in the subject, (c) surgical resection of the detected cancer, and (d) irradiating the PSMA-targeted phthalocyanine compound at the site of surgical resection, thereby inducing the cytotoxic effects of the phthalocyanine compound on residual prostate cancer cells following surgical resection.

Methods of immunostimulation with complexes of rna and cationic carriers

The present invention relates to a complexed RNA, comprising at least one RNA complexed with one or more oligopeptides, wherein the oligopeptide has a length of 8 to 15 amino acids and has the empirical formula (Arg) l ;(;Lys) m ;(His) n ;(Orn) o ;(Xaa) x . The invention further relates to a method for transfecting a cell or an organism, thereby applying the inventive complexed RNA. Additionally, pharmaceutical compositions and kits comprising the inventive complexed RNA, as well as the use of the inventive complexed RNA for transfecting a cell, tissue or an organism and/or for modulating, preferably inducing or enhancing, an immune response are disclosed herein.

COMPOSITIONS AND METHODS FOR NUCLEIC ACID TRANSFER

Disclosed are methods for the enhancement of nucleic acid delivery systems. The methods may employ treatment with a compound and/or an RNAi molecule in combination with a nucleic acid to improve nucleic acid uptake into a cell. In particular, the disclosed methods may be useful for improved gene therapy techniques. 1. A method for transferring a gene into a eukaryotic cell , comprising the step(s) ofa. contacting said eukaryotic cell with an RNAi molecule or an active agent, in an amount sufficient to inhibit synthesis of one or more proteins that inhibit nucleic acid delivery vehicle uptake; andb. contacting said eukaryotic cell with a nucleic acid delivery vehicle.2. The method of claim 1 , wherein said RNAi molecule inhibits expression of a gene encoding a protein selected from Table 1.3. The method of claim 1 , wherein said active agent is selected from Table 2 or Table 3.4. The method of claim 1 , wherein said active agent is selected from roscovitine claim 1 , geldanamycin claim 1 , acetohexamide claim 1 , and ruxolitinib claim 1 , or a combination thereof.5. The method of claim 1 , wherein said nucleic acid delivery vehicle is a nanoparticle comprising said gene.6. The method of claim 1 , wherein said nucleic acid delivery vehicle is a nanoparticle comprising a lysine polymer conjugated to PEG and complexed with a nucleic acid comprising said gene.7. The method of claim 1 , wherein said proteins that inhibit nucleic acid delivery vehicle uptake are selected from keratin 13 claim 1 , APC protein claim 1 , protocadherin 17 claim 1 , spectrin alph (non-erythrocytic 1) claim 1 , or a combination thereof.8. The method of claim 1 , wherein a period of time exists between step a and step b9. The method of claim 1 , wherein said nucleic acid is single stranded.10. The method of claim 1 , wherein said nucleic acid is double stranded.11. The method of claim 1 , wherein said method is carried out in vitro.12. The method of claim 1 , wherein said method is carried out ex ...

Methods and compounds for calcium ion channel regulation

The present invention generally relates to methods of modulating Ca v 1.2 channels and Ca v 1.2 channel activators.

Compositions and Methods for Topical and Diagnostic and Therapeutic Transport

Compositions and methods are provided that are useful for the delivery, including transdermal delivery, of biologically active agents, such as non-protein non-nucleotide therapeutics and protein-based therapeutics excluding insulin, botulinum toxins, antibody fragments, and VEGF. The compositions and methods are particularly useful for topical delivery of antifungal agents and antigenic agents suitable for immunization. Alternatively, the composition can be prepared with components useful for targeting the delivery of the compositions as well as imaging components. 1. A method of administering a non-protein non-nucleotide biologically active agent to a subject comprisingtopically applying to the skin or epithelium of the subject the biologically active agent in conjunction with an effective amount of a carrier comprising a polymeric backbone having attached positively charged branching groups,wherein the association between the carrier and the biologically active agent is non-covalent.2. The method according to wherein the composition provides greater transdermal delivery of the biologically active agent relative to the agent in the absence of the carrier.3. The method according to in which the biologically active agent has a therapeutic activity.4. The method according to in which the biologically active protein and carrier are administered to the subject in a composition containing both components.5. The method according to in which the biologically active protein and carrier are administered separately to the subject.6. The method according to in which the biologically active protein and carrier are administered to the subject in a composition containing both components.7. The method according to in which the biologically active agent and carrier are administered separately to the subject.8. The method according to in which the composition is a controlled release composition.9. The method according to in which the composition is a controlled release composition. ...

COMPOSITIONS AND METHODS FOR TREATING DISEASES BY INHIBITING EXOSOME RELEASE

A method for treating a cancer comprises administering to a subject in need of such treatment an effective amount of a pharmaceutical composition comprising an anti-cancer agent having at least one secretion modifying region (SMR) peptide from HIV-1 Nef fused to at least one cell-penetrating peptide (CPP) or at least one Clusterin (Clu)-binding peptide (Clu-BP). 121.-. (canceled)22. A multipartite peptide , comprising:at least one secretion modifying region (SMR) peptide from HIV-1 Nef; anda cell-penetrating peptide (CPP) fused to the SMR peptide,wherein the CCP comprises the amino acid sequence of GRKKRRQRRRPPQ (SEQ ID NO:38).23. The multipartite peptide of claim 22 , wherein the SMR peptide comprises an amino acid sequence selected from the group consisting of VGFPV (SEQ ID NO: 1) claim 22 , VGFPVAAVGFPV (SEQ ID NO: 2) and NXNVGFPVAAVGFPV (SEQ ID NO: 36).24. The multipartite peptide of claim 22 , wherein the multipartite peptide comprises the amino acid sequence of VGFPVAAVGFPVGRKKRRQRRRPPQ (SEQ ID NO: 39).25. The multipartite peptide of claim 22 , further comprising a signal peptide domain for secretion of the multipartite peptide from cells expressing the multipartite peptide.26. A polynucleotide encoding the multipartite peptide of .27. An expression vector claim 22 , comprising:{'claim-ref': {'@idref': 'CLM-00026', 'claim 26'}, 'the polynucleotide of ; and'}a regulatory sequence, operably linked to the polynucleotide.28. A multipartite peptide claim 22 , comprising the amino acid sequence of NXNVGFPVAAVGFPVHPLSKHPYWSQP (SEQ ID NO: 37).29. The multipartite peptide of claim 28 , further comprising a signal peptide domain for secretion of the multipartite peptide from cells expressing the multipartite peptide.30. A polynucleotide encoding the multipartite peptide of .31. An expression vector claim 28 , comprising:{'claim-ref': {'@idref': 'CLM-00029', 'claim 29'}, 'the polynucleotide of ; and'}a regulatory sequence operably linked to the polynucleotide. This ...

Inhibitors of Phosphatase and Tensin Homolog (PTEN) Compositions, Uses and Methods

Described herein are isolated polypeptides having phosphatase and tensin homolog (PTEN) inhibitory activity, vectors and cells for the expression thereof and methods for their use in treating diseases associated with cytotoxic stress, such as spinal cord injury, stroke, traumatic brain injury, multiple sclerosis, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Parkinson's disease, and Huntington's disease.

Compositions and methods relating to c5l2

In some aspects, provided herein is a method of enhancing production of interleukin-17 (IL-17), interferon gamma (IFN-γ), or both by a mammalian T cell, the method comprising contacting the cell with a C5L2 inhibitor. In some aspects, provided herein is a method of enhancing Th1 and/or Th17 responses by a mammalian T cell, the method comprising contacting the cell with a C5L2 inhibitor. In some aspects, provided herein is a method of enhancing production of interleukin-6 (IL-6), interleukin 1 beta (IL-1β), or both by a mammalian T cell or monocyte, the method comprising contacting the cell with a C5L2 inhibitor. In some aspects, provided herein is a method of decreasing suppressive activity of a T regulatory cell, e.g., a natural regulatory T (nTreg) cell, the method comprising contacting a Treg cell, e.g., an nTreg cell, with an inhibitor of C5L2.

Use of Single Dendritic Wedge Cell Penetrating Peptides to Facilitate Cellular Delivery of Nanoparticles and Nanoparticles Carrying Cargos

Nanoparticles (and optionally a cargo such as a drug) can be delivered to cells by attaching just a single dendritic peptide to the nanoparticle. The dendritic peptide includes a polyhisitidine motif and a hinge and a spacer connecting the polyhistidine to a lysine-based dendritic wedge displaying at least two copies of a cell-penetrating peptide motif. 1. A method of delivering a nanoparticle to a cell comprising:contacting a living cell with a nanoparticle bound to a single dendritic peptide thereby causing entry of the nanoparticle into the cell,wherein the dendritic peptide comprises a polyhisitidine motif and a hinge and a spacer connecting the polyhistidine to a lysine-based dendritic wedge displaying at least two copies of the peptide sequence RRRRRRRRRFG (SEQ ID No: 2).2. The method of claim 1 , wherein the nanoparticle is also bound to a cargo which is delivered to the cell with the nanoparticle.3. A method of delivering a nanoparticle to a cell comprising:contacting a living cell with a nanoparticle bound to a single dendritic peptide thereby causing entry of the nanoparticle into the cell,wherein the dendritic peptide comprises a hexahistidine motif connected to a lysine-based dendritic wedge displaying at least two copies of the peptide sequence RRRRRRRRRFG (SEQ ID No: 2) via a hinge and spacer comprising six prolines and two glycines.4. The method of claim 3 , wherein the nanoparticle is also bound to a cargo which is delivered to the cell with the nanoparticle.5. A method of delivering a nanoparticle to a cell comprising:contacting a living cell with a nanoparticle bound to a single dendritic peptide thereby causing entry of the nanoparticle into the cellwherein the dendritic peptide comprises a polyhisitidine motif and a hinge and a spacer connecting the polyhistidine to a lysine-based dendritic wedge displaying at least two copies of the peptide sequence RRRRRRRRRFG (SEQ ID No: 2); andwherein the nanoparticle is free of any other cell-penetrating ...

GAMMA-D POLYGLUTAMATED PEMETREXED AND USES THEREOF

The disclosure relates generally to polyglutamated antifolates, formulations containing liposomes filled with the polyglutamated antifolates, methods of making the polyglutamated antifolates and liposome containing formulations, and methods of using the polyglutamated antifolates and liposome containing formulations to treat hyerproliferative disorders (e.g., cancer) and disorders of the immune system (e.g., an autoimmune disease such as rheumatoid arthritis). 175-. (canceled)76. A liposomal composition comprising a pegylated liposome encapsulated polyglutamated pemetrexed (PMX) comprising glutamate residues linked by their gamma carboxyl groups.77. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises 5-10 claim 76 , or >4 glutamyl groups.78. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises 4 claim 76 , 5 claim 76 , 2-10 claim 76 , 4-6 claim 76 , or >5 claim 76 , L glutamyl groups linked by their gamma carboxyl groups.79. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises pentaglutamated PMX.80. The liposomal composition of claim 79 , wherein the pentaglutamated PMX comprises 4 claim 79 , L glutamyl groups linked by their gamma carboxyl groups.81. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises hexaglutamated PMX.82. The liposomal composition of claim 81 , wherein the polyglutamated hexaglutamated PMX comprises 5 claim 81 , L glutamyl groups linked by their gamma carboxyl groups.83. The liposomal composition of claim 76 , wherein the liposome has a diameter in the range of 20 nm to 200 nm or 80 nm to 120 nm.84. The liposomal composition of claim 76 , wherein the liposome is formed from liposomal components and wherein: the liposomal components comprise:at least one of an anionic lipid and a neutral lipid;at least one member selected from the group consisting of: DSPE; DSPE-PEG-maleimide; HSPC; HSPC-PEG; cholesterol; cholesterol-PEG; and ...

ALPHA POLYGLUTAMATED PEMETREXED AND USES THEREOF

The disclosure relates generally to polyglutamated antifolates, formulations containing liposomes filled with alpha or D-gamma polyglutamated antifolates, methods of making the polyglutamated antifolates and liposome containing formulations, and methods of using polyglutamated antifolates and liposome containing formulations to treat hyerproliferative disorders (e.g., cancer) and disorders of the immune system (e.g., an autoimmune disease such as rheumatoid arthritis). 175-. (canceled)76. A liposomal composition comprising polyglutamated pemetrexed (PMX) encapsulated by a pegylated liposome , wherein the polyglutamated PMX comprises at least 3 glutamate residues linked by alpha carboxyl group linkages.77. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises 3 claim 76 , 4 claim 76 , 5 claim 76 , 6 claim 76 , 7 claim 76 , 8 claim 76 , 9 claim 76 , or 2-10 glutamate residues linked by alpha carboxyl group linkages.78. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises 4 claim 76 , 5 claim 76 , 5-10 claim 76 , or more than 5 claim 76 , glutamate residues.79. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises pentaglutamated PMX.80. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises hexaglutamated PMX.81. The liposomal composition of claim 76 , wherein the liposome has a diameter in the range of 20 nm to 200 nm or 80 nm to 120 nm.82. The liposomal composition of claim 76 , wherein the liposome is formed from liposomal components and wherein: the liposomal components comprise:(a) at least one of an anionic lipid and a neutral lipid;(b) at least one member selected from the group consisting of: DSPE; DSPE-PEG; DSPE-PEG-maleimide; HSPC; HSPC-PEG; cholesterol; cholesterol-PEG; and cholesterol-maleimide; or(c) at least one selected from the group consisting of: DSPE; DSPE-PEG-FITC; DSPE-PEG-maleimide; cholesterol; and HSPC.83. The liposomal composition of ...

GAMMA-D POLYGLUTAMATED PEMETREXED AND USES THEREOF

The disclosure relates generally to polyglutamated antifolates, formulations containing liposomes filled with alpha or D-gamma polyglutamated antifolates, methods of making the polyglutamated antifolates and liposome containing formulations, and methods of using polyglutamated antifolates and liposome containing formulations to treat hyerproliferative disorders (e.g., cancer) and disorders of the immune system (e.g., an autoimmune disease such as rheumatoid arthritis). 175-. (canceled)76. A liposomal composition comprising polyglutamated pemetrexed (PMX) encapsulated by a pegylated liposome , wherein the polyglutamated PMX comprises at least 1 D-glutamate residue.77. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises 3 claim 76 , 4 claim 76 , 5 claim 76 , 6 claim 76 , 7 claim 76 , 8 claim 76 , 9 claim 76 , or 2-10 D-glutamate residues.78. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises 4 claim 76 , 5 claim 76 , 5-10 claim 76 , or more than 5 claim 76 , glutamate residues.79. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises at least 3 glutamate residues linked by alpha carboxy group linkages.80. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises at least 2 glutamate residues linked by gamma carboxy group linkages.81. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises pentaglutamated PMX.82. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises 4 D-gamma glutamate residues.83. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises hexaglutamated PMX.84. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises 5 D-gamma glutamate residues.85. The liposomal composition of claim 76 , wherein the polyglutamated PMX comprises at least 1 D-glutamate residue and at least one L-glutamate residue.86. The liposomal composition of claim 76 , wherein ...

SELF-ASSEMBLED PEPTIDE NANOPARTICLE AND USE THEREOF

Disclosed are self-assembling nanoparticle compositions that comprise a plurality of cationic cell penetrating peptides, each covalently linked to a hydrophobic therapeutic molecule (e.g., an antigenic peptide, mRNA, siRNA, DNA, or the like), and optionally, non-covalently bound to at least one TLR (Toll-like receptor) ligand. Also disclosed are methods for use of the nanoparticle compositions in the treatment, prophylaxis, and/or the amelioration of one or more symptoms of a mammalian disease, including, without limitation, cancer, infection, inflammation, and related diseases and abnormal conditions. 1. A composition comprising:(a) a population of nanoparticles, self-assembling at neutral pH, and comprised of a plurality of cationic cell-penetrating peptides covalently linked to a hydrophobic therapeutic peptide ligand;(b) a pharmaceutically-acceptable buffer, diluent, carrier, or vehicle.2. The composition in accordance with claim 1 , wherein the nanoparticles further comprise a negatively-charged molecule such as mRNA claim 1 , siRNA claim 1 , dsRNA claim 1 , RNA claim 1 , DNA claim 1 , or any combination thereof claim 1 , or a hydrophobic peptide such as MPLA.3. The composition in accordance with or claim 1 , further comprising an amphiphobic or amphipathic peptide claim 1 , such as CPP-TAT covalently linked to a therapeutic peptide claim 1 , such as NY-ESO-1 (SEQ ID NO:1) or TRP-2 (SEQ ID NO:2).4. The composition in accordance with any preceding claim claim 1 , adapted and configured for increasing IFN-I expression claim 1 , when introduced into suitable mammalian cells; preferably for increasing expression of IFN-α4 or IFN-β.5. The composition in accordance with any preceding claim claim 1 , comprised within an isolated population of mammalian cells claim 1 , such as tumor cells or dendritic cells.6. The composition in accordance with any preceding claim claim 1 , comprising one or more cationic cell penetrating peptides as disclosed in any one of SEQ ID NO:3 ...

Biodegradable vectors for efficient rna delivery

The disclosure provides for vectors, and methods of using the vectors to efficiently deliver mRNA and/or ssRNA into cells.

PH-SENSITIVE AND BIOREDUCIBLE POLYMER-VIRUS COMPLEX FOR CANCER TREATMENT

Disclosed is a pH-sensitive and bioreducible polymer-virus complex which can destroy tumor cells more effectively by increasing the efficiency of virus transduction. A pH-sensitive and bioreducible polymer contains (i) an escapable portion from immune reactions, (ii) a chargeable portion having one or more amine groups and (iii) a bioreducible portion including one or more disulfide linkages. The and to a pharmaceutical composition containing the polymer-virus complex. Also disclosed are a pharmaceutical composition containing the pH-sensitive and bioreducible polymer-virus complex and methods for treating cancer in a subject, employing the composition. 1. A method for treating cancer in a subject in need thereof , comprising a step of administering a pharmaceutical composition comprising (a) a therapeutically effective amount of a polymer-virus complex and (b) a pharmaceutically acceptable carrier to the subject ,wherein a polymer of the polymer-virus complex of (a) is a pH-sensitive and bioreducible polymer, and a virus of the polymer-virus complex of (a) is an oncolytic virus having cancer-specificity, wherein the pH-sensitive and bioreducible polymer is bounded to a surface of the virus; and wherein the escapable portion of (i) is bound to the chargeable portion of (ii), and is selected from the group consisting of PEG (polyethylene glycol), mPEG(methoxy polyethylene glycol), and a combination thereof;', 'wherein the chargeable portion of (ii) is piperazine or 1-(2-aminoethyl)piperazine; and', 'wherein the bioreducible portion of (iii) is bound to the chargeable portion of (ii), and is N,N-cystaminebisacrylamide., 'wherein the pH-sensitive and bioreducible polymer comprises (i) an escapable portion from immune reactions, (ii) a chargeable portion having one or more amine groups and (iii) a bioreducible portion including one or more disulfide linkages,'}2. The method for treating cancer according to claim 1 , wherein pH-sensitive and bioreducible polymer ...

NANOPARTICLES FOR THE TARGETED DELIVERY OF THERAPEUTIC POLYPEPTIDES

Nanoparticles can be useful for delivering therapeutic agents, such as anticancer agents to diseased cells. The nanoparticles include a carrier polypeptide and a cargo, which can be bind through electrostatic interactions to form a nanoparticle composition. An exemplary composition comprises nanoparticles comprising a carrier polypeptide comprising a penton base segment and a binding segment: and a polypeptide cargo comprising a tag segment that binds to the binding segment of the carrier poly peptide through an electrostatic interaction. An exemplary carrier polypeptide comprises a person base segment and a negatively-charged binding segment, which can bind to a positively charged cargo. The carrier polypeptide can also include a cell-targeting segment which can target the nanoparticle to a cell. Compositions comprising nanoparticles can be administered to a subject for the treatment of disease, such as cancer. 1. A composition comprising nanoparticles comprising:a carrier polypeptide comprising a penton base segment and a binding segment; anda polypeptide cargo comprising a tag segment that binds to the binding segment of the carrier polypeptide through an electrostatic interaction.2. The composition of claim 1 , wherein the tag segment is heterologous to the rest of the polypeptide cargo.3. The composition of claim 1 , wherein the tag segment is autologous to the rest of the polypeptide cargo.4. The composition of any one of - claim 1 , wherein the tag segment is at the C-terminus or the N-terminus of the polypeptide cargo.5. The composition of claim 4 , wherein the tag segment is cleavable.6. The composition of any one of - claim 4 , wherein the tag segment is internal to the polypeptide cargo.7. The composition of any one of - claim 4 , wherein the tag segment is about 4 amino acids to about 20 amino acids in length.8. The composition of any one of - claim 4 , wherein the binding segment is positively charged.9. The composition of any one of - claim 4 , wherein ...

EXON SKIPPING OLIGOMER CONJUGATES FOR MUSCULAR DYSTROPY

Antisense oligomer conjugates complementary to a selected target site in the human dystrophin gene to induce exon 45 skipping are described. 2. The antisense oligomer conjugate of claim 1 , wherein each Nu is independently selected from cytosine (C) claim 1 , guanine (G) claim 1 , thymine (T) claim 1 , adenine (A) claim 1 , 5-methylcytosine (5mC) claim 1 , uracil (U) claim 1 , and hypoxanthine (I).3. The antisense oligomer conjugate of claim 1 , wherein the targeting sequence is SEQ ID NO: 1 (5′-CAATGCCATCCTGGAGTTCCTG-3′) claim 1 , wherein thymine (T) is optionally uracil (U).12. A pharmaceutical composition claim 1 , comprising an antisense oligomer conjugate of any one of to claim 1 , or a pharmaceutically acceptable salt thereof claim 1 , and a pharmaceutically acceptable carrier.13. A method for treating Duchenne muscular dystrophy (DMD) in a subject in need thereof wherein the subject has a mutation of the dystrophin gene that is amenable to exon 45 skipping claim 1 , the method comprising administering to the subject the antisense oligomer conjugate of any one of to .14. The method of claim 13 , wherein the antisense oligomer conjugate is administered weekly.15. The method of claim 13 , wherein the antisense oligomer conjugate is administered biweekly.16. The method of claim 13 , wherein the antisense oligomer conjugate is administered every third week.17. The method of claim 13 , wherein the antisense oligomer conjugate is administered monthly.18. A method of restoring an mRNA reading frame to induce dystrophin production in a subject having a mutation of the dystrophin gene that is amenable to exon 45 skipping claim 13 , the method comprising administering to the subject the antisense oligomer conjugate of any one of to .19. The method of claim 18 , wherein the antisense oligomer conjugate is administered weekly.20. The method of claim 18 , wherein the antisense oligomer conjugate is administered biweekly.21. The method of claim 18 , wherein the antisense ...

NANOPARTICLE TO TARGET CANCER

A construct, or a pharmaceutically acceptable salt thereof, comprising: 1. A construct , or a pharmaceutically acceptable salt thereof , comprising:(a) a polyethylene glycol-block-poly(L-lysine) polymer moiety, wherein the polyethylene glycol is thiol-functionalized;(b) a cholecystokinin-B (CCK-B) receptor ligand coupled to the polyethylene glycol of the polymer moiety; and(c) a siRNA complexed with the poly(L-lysine) of the polymer moiety,wherein the construct is neutralized.2. The construct of claim 1 , wherein the construct is a nanoparticle having an average hydrodynamic size (Z Ave 48 nm) of less than 100 nm.3. The construct of claim 1 , wherein the construct is a nanoparticle having an average hydrodynamic size (Z Ave 48 nm) of 30 to 60 nm.4. The construct of claim 1 , wherein the siRNA is a GASTRIN-targeted siRNA claim 1 , a mutant KRAS-targeted siRNA claim 1 , or a combination thereof.5. The construct of claim 1 , wherein the cholecystokinin-B (CCK-B) receptor ligand comprises gastrin-10.6. The construct of claim 1 , wherein the cholecystokinin-B (CCK-B) receptor ligand comprises a DNA aptamer.7. The construct of claim 1 , wherein the cholecystokinin-B (CCK-B) receptor ligand has a structure of 3-maleimido-propionyl-Glu-Glu-Glu-Ala-Tyr-Gly-Trp-Met-Asp-Phe-NH.11. The construct of claim 1 , wherein the construct comprises a polyplex structure having the siRNA in a core surrounded by the polyethylene glycol claim 1 , wherein the cholecystokinin-B (CCK-B) receptor ligand is located on the surface of the polyplex structure.13. A construct claim 1 , or a pharmaceutically acceptable salt thereof claim 1 , comprising:(a) a polyethylene glycol-block-poly(L-lysine) polymer moiety, wherein the polyethylene glycol is thiol-functionalized;(b) a cholecystokinin-B (CCK-B) receptor ligand coupled to the polyethylene glycol of the polymer moiety; and(c) a therapeutically active agent complexed with the poly(L-lysine) of the polymer moiety,wherein the construct is neutralized ...

Pharmaceutical Preparation Of Camptothecin-Containing Polymer Derivative

Provided is a pharmaceutical preparation composition comprising a polymerized camptothecin derivative which is obtained by bonding a camptothecin derivative to a polymer carrier, and has nanoparticle-forming properties of associating in an aqueous solution, the pharmaceutical preparation composition having enhanced preparation stability. Particularly, a pharmaceutical preparation maintaining nanoparticle-forming properties, which are an important factor, and having an excellent storage stability is provided. Disclosed is a pharmaceutical preparation comprising a block copolymer in which a polyethylene glycol segment is linked to a polyglutamic acid segment containing a glutamic acid unit having a camptothecin derivative bonded thereto, the pharmaceutical preparation capable of forming associates in an aqueous solution. When the pharmaceutical preparation is made into an aqueous solution containing the camptothecin derivative at a concentration of 1 mg/mL, the pH of the aqueous solution is 2.4 to 7.0, and the change ratio of the associate-forming ability of the pharmaceutical preparation after storage at 40° C. for one week under light-blocked conditions is 50% or less.

CELL PENETRATING PEPTIDES FOR INTRACELLULAR DELIVERY OF MOLECULES

A cell-penetrating peptide characterized in that it comprises an amino acid sequence: XXXWWXXWAXXXXXXXXWXR (SEQ ID No: 10), wherein X, is beta-A or S, Xis L or none, Xis R or none, Xis L, R or G, Xis R, W or S, Xis S, P T, Xis W or P, X8 is F, A or R, Xis S, L, P or R, Xis R or S, Xn is W or none, Xis A, R or none and Xis W or F, and wherein if Xis none, then X, Xand Xare none as well. 123-. (canceled)24. A complex comprising:a) a cell-penetrating peptide characterized in that it comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-6; andb) a cargo selected from the group consisting of peptides, proteins, peptide analogs, oligonucleotides, PNAs and small hydrophobic molecules.25. The complex of claim 24 , wherein the cell-penetrating peptide further comprises a) an acetyl group claim 24 , a nitrilotriacetic acid claim 24 , or a poly-ethylene glycol covalently linked to the N-terminal end of the amino acid sequence claim 24 , and/or b) a cysteamide group claim 24 , a nitrilotriacetic acid claim 24 , or a poly-ethylene glycol covalently linked to the C-terminal end of the amino acid sequence.26. A nanoparticle comprising a core comprising a cargo selected from the group consisting of peptides claim 24 , proteins claim 24 , peptide analogs claim 24 , oligonucleotides claim 24 , PNAs and small hydrophobic molecules claim 24 , wherein:a) the core comprises the cargo complexed to a VEPEP-9 cell-penetrating peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-6, and the core is coated by a peripheral cell-penetrating peptide; orb) the core comprises the cargo complexed to a first entity selected from the group consisting of cell-penetrating peptides, liposomes, polycationic structures and carbon nanoparticles, and the core is coated by a peripheral cell-penetrating peptide that is a VEPEP-9 cell-penetrating peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-6 ...

Compositions and methods for cancer therapy

One aspect of this disclosure is directed to a method for treating a cancer in a subject in need thereof by administering to the subject at least a first compound and a second compound in any order together or separately. The first compound is an effective amount of a checkpoint inhibitor optionally with at least one pharmaceutically acceptable carrier. The second compound is an effective amount of an Therapeutic Double Stranded RNA (tdsRNA) optionally with at least one pharmaceutically acceptable carrier. The compounds can be administered together or separately. Compositions for the practice of the method are also described.

METHODS FOR FORMING POLYPLEXES

The present disclosure relates method for forming polyplexes, which find use in gene therapy applications as safe and non-toxic nucleic acid transfection agents. 1. A method for making one or more polyplexes , the method comprising: i. a polymer in a first liquid stream;', 'ii. a nucleic acid component in a second liquid stream;, '(a) providing(b) contacting the polymer in the first liquid stream with the nucleic acid component in the second liquid stream to form a polyplex having a size and charge that is suitable for therapeutic administration; and(c) isolating the polyplex to provide a stabilized polyplex.2. The method of claim 1 , wherein the isolating comprises conveying the polyplex in a liquid channel for a residence time sufficient to stabilize the polyplex.3. The method of any one of the preceding claims claim 1 , further comprising assessing and harvesting one or more polyplexes.4. The method of any one of the preceding claims claim 1 , wherein the first liquid stream and first liquid streams are solutions.5. The method of any one of the preceding claims claim 1 , further comprising flowing the first liquid stream and the second liquid stream through a flow-regulating device at a rate that provides a polyplex having a size and charge that is suitable for transdermal administration.6. The method of claim 5 , wherein flow-regulating device is selected from the group consisting of a positive displacement pump claim 5 , a syringe driven pump claim 5 , a pressure driven pump claim 5 , and a gravity feed pump.7. The method of any one of the preceding claims claim 5 , wherein the contacting step uses a nozzle claim 5 , a micro fluidics mixing device claim 5 , a touch tube claim 5 , a liquid bridge claim 5 , a vertical mixer claim 5 , a rotating double tube claim 5 , or an atomizer.8. The method any one of the preceding claims claim 5 , wherein the contacting step occurs in an air gap or in carrier fluid within the liquid channel.9. The method of any one of the ...

Exon skipping oligomer conjugates for muscular dystrophy

Antisense oligomer conjugates complementary to a selected target site in the human dystrophin gene to induce exon 45 skipping are described.

INHIBITION OF PULMONARY FIBROSIS WITH NUTLIN-3A AND PEPTIDES

In fibrotic lung fibroblasts, basal levels of p53 protein (and miR-34a) are markedly suppressed, leading to reduced p53-mediated inhibition of uPA and uPAR, or concurrent induction of PAI-1. These changes contribute to excessive FL-fibroblast proliferation and production of extracellular matrix (ECM), and, therefore, pulmonary fibrosis. These processes are reversed by treating the cells, and treating subjects suffering from idiopathic pulmonary fibrosis (IPF) with the small organic molecule nutlin-3a (NTL) or with a peptide, CSP-4 (SEQ ID NO:1), or variants or derivatives or multimers of this peptide, which increase p53 levels by inhibiting MDM2-mediated degradation of p53 protein. Use of these compounds serves as a new approach to the treatment of IPF, as they restore p53 expression and p53-mediated changes in the uPA-fibrinolytic system in FL-fibroblasts and restrict production and deposition of ECM. 130-. (canceled)31. A method of reducing fibrosis in a subject , comprising administering to the subject in need thereof , an effective amount of a polypeptide consisting of an amino acid sequence of FTTFTVT (SEQ ID NO: 1).32. The method of claim 31 , wherein the fibrosis is pulmonary fibrosis.33. The method of claim 31 , wherein the fibrosis is idiopathic pulmonary fibrosis.34. The method of claim 31 , wherein the polypeptide is administered by instillation into the lungs of the subject.35. The method of claim 31 , wherein the polypeptide is administered intranasally or intrabronchially to the subject.36. A method of reducing or inhibiting proliferation of fibroblasts in a subject claim 31 , comprising administering to the subject in need thereof claim 31 , an effective amount of a polypeptide consisting of an amino acid sequence of FTTFTVT (SEQ ID NO: 1).37. The method of claim 36 , wherein the fibroblasts are lung fibroblasts.38. The method of claim 37 , wherein the fibroblasts are fibrotic lung fibroblasts.39. The method of claim 36 , wherein the subject has ...

GLYCOPOLYMERS SEQUESTERING CARBOHYDRATE-BINDING PROTEINS

The invention relates to polymers comprising carbohydrate ligands and moieties, respectively, that bind to carbohydrate-binding proteins (CBPs), as well as to these carbohydrate ligands, and to their use in diagnosis and therapy of diseases that are associated with CBP-mediated cytotoxicity, agglutinatination, or immune complex deposit formation. In particular, the invention relates to polymers comprising a multitude of said carbohydrate ligands and moieties, respectively, mimicking carbohydrates that are bound by CBPs which belong to the group of (i) bacterial exotoxins, (ii) agglutinins, and (iii) immune complex deposit-forming immunoglobulins. Furthermore, the invention relates to the use of these polymers and carbohydrate ligands and moieties respectively, in diagnosis as well as for the treatment of diseases that are associated with CBP-mediated cytotoxicity, agglutinatination, or immune complex deposit formation. In one embodiment, the polymer is polylysine. 4. The polymer of any one of to , wherein said linker Z is —X-A-(B)-(CH)—Y , wherein{'sup': 'a', 'X is N(R);'}{'sup': 'a', 'sub': 1-4', '1-4', '2', '6', '5', '2', '2', '6', '5', '2', '6', '5', '2', '2', '6', '5, 'Ris H, Calkyl, Calkoxy, CHCH, CHCHCH, OCHCH, or OCHCHCH;'}{'sub': 1-7', '1-7', '1-4', '2', '2', 'r', '1-4', '1-7', '1-7, 'sup': b', 'b', 'b, 'A is Calkylene, OCalkylene, Calkylene-(OCHCH)O—C-alkylene, OCalkylene-Ror R—Calkylene wherein Ris an optionally substituted aryl or an optionally substituted heteroaryl, and wherein r is 0 to 6, preferably r is 1, 2 or 3, and further preferably r is 1;'}B is NHC(O) or S;p is 0 or 1;q is 0 to 6, preferably q is 0 to 4, and further preferably q is 0, 2 or 3;{'sub': 3', '2, 'Y is SH, Nor NH.'}5. The polymer of any one of to , wherein said linker Z is —X-A-(B)-(CH)—Y , whereinX is O;{'sub': 1-7', '1-4', '2', '2', 'r', '1-4', '1-7, 'sup': b', 'b, 'A is Calkylene, Calkylene-(OCHCH)OCalkylene or R—Calkylene, wherein Ris an optionally substituted aryl or an ...