ВЕКТОРЫ AAV

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая аденоассоциированный вирус (AAV) для трансдукции клеток сетчатки, фармацевтическую композицию для переноса генов в клетки сетчатки, применение AAV для лечения поражения фоторецепторных клеток, применение in vitro AAV для трансдукции ядра клеток сетчатки и набор для переноса генов в клетки сетчатки. Изобретение расширяет арсенал средств для трансдукции клеток сетчатки. 5 н. и 9 з.п. ф-лы, 16 ил., 2 табл., 6 пр.

ВИРИОНЫ АДЕНОАССОЦИИРОВАННОГО ВИРУСА С ВАРИАНТНЫМ КАПСИДОМ И СПОСОБЫ ИХ ИСПОЛЬЗОВАНИЯ

Изобретение относится к биотехнологии. Описан вирион рекомбинантного аденоассоциированного вируса rAAV, содержащий: a) капсидный белок вариантного AAV, который содержит пептидную вставку, по сравнению с соответствующим капсидным белком родительского AAV, где пептидная вставка имеет длину от 7 аминокислот до 10 аминокислот, где участок вставки расположен между двумя соседствующими аминокислотами в положении между аминокислотами, соответствующем аминокислотам 570 и 611 VP1 из AAV2 или соответствующем положении в капсидном белке другого серотипа AAV; и b) гетерологичную нуклеиновую кислоту, содержащую нуклеотидную последовательность, кодирующую генный продукт. Представлена фармацевтическая композиция, содержащая данный вирион. Представлен способ лечения заболевания сетчатки, который включает введение индивидууму, нуждающемуся в этом, эффективного количества описанного вириона. При осуществлении изобретения достигается большая инфекционность ретинальной клетки, поскольку вирионы AAV вводятся ...

КОМПОЗИЦИЯ И СПОСОБЫ ВЫСОКОЭФФЕКТИВНОГО ПЕРЕНОСА ГЕНОВ С ПОМОЩЬЮ ВАРИАНТОВ КАПСИДА AAV

... 1. Улучшенный вектор на основе аденоассоциированного вируса (AAV), содержащий капсидный белок VP1, который содержит одну или несколько замен лизина, при этом упомянутый вектор дополнительно содержит миниген, содержащий инвертированные концевые повторы AAV и гетерологичную последовательность нуклеиновой кислоты, функционально связанную с регуляторными последовательностями, которые направляют экспрессию продукта из гетерологичной последовательности нуклеиновой кислоты в клетку-хозяин, и упомянутая замена лизина является эффективной для ингибирования убиквитинирования упомянутого капсидного белка, и тем самым увеличивается трансдукция упомянутого вектора AAV в клетке-мишени.2. Вектор AAV по п. 1, имеющий серотип, выбираемый из группы, состоящей из AAV1, AAV2, AAV3, AAV4, AAV-rh74, AAV5, AAV6, AAV7, AAV8 и AAV9.3. Вектор AAV по п. 1, содержащий капсидный белок VP1, который несет по меньшей мере одну замену лизина в остатке лизина, что показано в таблицах, при этом по меньшей мере одна упомянутая ...

КАПСИДЫ ВАРИАНТОВ АДЕНОАССОЦИИРОВАННЫХ ВИРУСОВ И МЕТОДЫ ИХ ПРИМЕНЕНИЯ

ANTIVIRALE AKTIVITAET DES VOM ADENO-ASSOZIIERTEN VIRUS TYP 2 CODIERTEN REP-GENS

Prepn. of Rep-negative adeno-associated virus mutants

Cells that stably express the adeno-associated virus (AAV)-Rep proteins 78 and 52, as well as 40 and/or 68 are new. Also new are the expression plasmid pCMRep40 (DSM 9488) and (2) Rep-negative AAV mutants produced using the new cells.

FROM ADENO ASSOCIATING VIRUSES REKOMBINANTE VECTORS.

AAV CAPSIDVEHIKEL FOR MOLECULAR TRANSPORT

PROCEDURE FOR THE PRODUCTION OF REKOMBINANTER ADENO ATE VIRUSES (AAV) AND THEIR USE

ADJUSTED EXPRESSION FROM PROTEINS IN STABLY TRANSFORMED MAMMALIAN CELLS

ADENO ASSOZIERTER VIRUS - ITS DIAGNOSTIC APPLICATION FOR EARLY ABORTION

Structural protein of adeno-associated virus with modified antigenicity, its production and its use

Manipulation and detection of protein phosphatase 2c - pp2calpha - expression in tumor cells for cancer therapy, prevention and detection

Adeno-associated virus compositions for targeted gene therapy

Described herein are compositions and kits comprising recombinant adeno-associated viruses (rAAVs) with tropisms showing increased specificity and efficiency of viral transduction in targeted cell-types, for e.g., the brain, and lung. The rAAV compositions described herein also have tropisms showing decreased specificity and decreased efficiency of viral transduction in an off-target cell type, for e.g., the liver. The rAAV compositions described herein encapsidate a transgene, such a therapeutic nucleic acid. Upon systemic delivery to a subject, the rAAV is capable of increased specificity and increased transduction of the transgene in a target cell-type, as compared to a parental or reference AAV.

Liver-specific tropism of adeno-associated viruses

This disclosure provides compositions and methods for altering or changing the tissue tropism, e.g., liver tropism, of adeno-associated viruses (AAV).

AAV polynucleotides, polypeptides and virions

The present disclosure relates generally to polypeptides derived from marsupial adeno-associated virus (AAV). The disclosure is also related to nucleic acid molecules encoding the polypeptides, and vectors comprising the nucleic acid molecules, and AAV vectors comprising the polypeptides. The disclosure also relates to uses of the nucleic acid molecules, polypeptides and AAV vectors, such as for capsid diversification.

Highly efficient transduction and lateral spread in the retina by a novel AAV virus enhanced by rational design

The disclosure provides rAAV particles comprising a new capsid variant, AAV44.9(E531D). The disclosure also provides rAAV particles comprising AAV44.9(E531D) for treatment of the eye, including treatment of retinal disorders. In particular embodiments, the disclosure provides rAAV particles comprising an AAV44.9(E531D) capsid that exhibits enhanced lateral spread after subretinal injection to a fovea of the subject, wherein detachment of the fovea is minimized. The disclosure further provides rAAV particles comprising an AAV44.9(E531D) capsid and a polynucleotide encoding a heterologous nucleic acid sequence. Methods of treatment comprising administering rAAV particles to a mammal in need thereof, and methods of transducing photoreceptor and RPE cells with rAAV particles, are also provided.

Virus compositions with enhanced specificity in the brain

Provided are compositions and kits comprising recombinant adeno-associated viruses (rAAVs) with tropisms showing increased specificity and efficiency of viral transduction in targeted cell-types, for e.g., the brain and the liver. Therapeutic and biomedical research applications of the rAAVs are also described, including without limitation methods of discovering rAAVs using a multiplexed Cre recombination-based AAV targeted evolution (M- CREATE) method, and methods of treating various diseases and conditions by rAAV-mediated transgene therapy.

Fully-human post-translationally modified antibody therapeutics

Provided are methods and compositions for the delivery of fully human post-translationally modified therapeutic monoclonal antibodies and antigen-binding fragments thereof. The fully human post-translationally modified therapeutic monoclonal antibodies may be preferably delivered by gene therapy methods, particularly as a recombinant adeno-associated virus (rAAV) vector to the appropriate tissue. Methods of manufacture of the AAV vectors, pharmaceutical compositions and methods of treatment are also provided. In addition, provided are methods of producing therapeutic antibodies that are "biobetters" as fully human post-translationally modified. These fully human post-translationally modified therapeutic antibodies may be administered to a subject in need of treatment with the therapeutic antibody.

METHODS OF PREDICTING ANCESTRAL VIRUS SEQUENCES AND USES THEREOF

Methods are described for predicting ancestral sequences for viruses or portions thereof. Also described are predicted ancestral sequences for adeno-associated virus (AAV) capsid polypeptides. The disclosure also provides methods of gene transfer and methods of vaccinating subjects by administering a target antigen operably linked to the AAV capsid polypeptides.

Modified AAV capsid proteins and uses thereof

Adeno associated viral (AAV) particles are emerging as a useful vehicle for gene delivery to various organs and tissues, one of them being the retina. Provided here are variant AAV (e.g., variant serotype 2 (AAV2)) capsid proteins and variant capsid protein containing particles with enhanced ability to transduce retinal cells.

IMPROVED rAAV VECTORS FOR ENHANCING TRANSDUCTION OF CELLS EXPRESSING LOW-DENSITY LIPOPROTEIN RECEPTORS

IMPROVED REAGENTS AND METHODS FOR PRODUCING PARVOVIRUSES

Scleroprotein of an adeno-associated virus with modified chromatographic properties, the production thereof and use of the same

Gene delivery vectors and their uses

Method for purification of viral vectors having proteins which bind sialic acid

Adeno-associated virus vector

Disclosed herein is a recombinant adeno-associated virus (AAV) vector comprising (a) a variant AAV2 capsid protein, wherein the variant AAV2 capsid protein comprises at least four amino acid substitutions with respect to a wild type AAV2 capsid protein; wherein the at least four amino acid substitutions are present at the following positions in an AAV2 capsid protein sequence: 457, 492, 499 and 533; and (b) a heterologous nucleic acid comprising a nucleotide sequence encoding a gene product.

Capsid

There is described an AAV capsid protein having an amino acid sequence which has at least 98% identity to the sequence of SEQ ID NO: 3 or at least 94% identity to the sequence of SEQ ID NO: 4. Also described is a pharmaceutical composition, an AAV capsid and a viral particle comprising the capsid protein, a recombinant AAV vector comprising a nucleotide sequence which encodes for the capsid protein, and a host cell and a transgenic animal comprising the capsid protein or the vector. In addition, there is described a method of transferring a nucleic acid of interest into a mammal comprising introducing a recombinant AAV vector into the mammal, wherein the recombinant AAV vector comprises a gene of interest which is encapsidated into a capsid comprising the capsid protein.

Baculoviral vectors comprising repeated coding sequences with differential codon biases

Methods and materials for producing recombinant viruses in eukaryotic microalgae

The present invention is directed to methods and materials for producing recombinant viruses. In particular, methods and materials are provided for producing recombinant viruses in eukaryotic microalgae such as ...

Rescue of central and peripheral neurological phenotype of Friedreich's Ataxia by intravenous delivery

Provided herein is an adeno-associated virus (AAV) particle comprising a capsid and a viral genome, wherein said capsid delivers the AAV particle to a nervous system, and wherein said viral genome comprises a polynucleotide sequence encoding Frataxin and one or more microRNA binding sites. Also, provided herein is a method for treating, ameliorating, and/or preventing a disorder in a subject stemming from a loss or partial loss of frataxin protein in the subject, wherein the method comprises: administering to the subject a therapeutically effective amount of a composition comprising an AAV particle comprising a capsid and a viral genome, wherein said capsid delivers the viral genome to a nervous system, and wherein said viral genome comprises a polynucleotide sequence encoding Frataxin and one or more microRNA binding sites, as described herein.

Method for preparing recombinant adeno-associated viruses (AAV), and uses thereof

AAV CAPSID vehicles for molecular transfer

Methods for generating high titer helper-free preparations of released recombinant AAV vectors

VIRUS VECTORS AND METHODS OF MAKING AND ADMINISTERING THE SAME

The present invention provides genetically-engineered parvovirus capsids and viruses designed to introduce a heterologous gene into a target cell. The parvoviruses of the invention provide a repertoire of vectors with altered antigenic properties, packaging capabilities, and/or cellular tropisms as compared with current AAV vectors.

ADENO-ASSOCIATED VIRUS SEROTYPE 1 NUCLEIC ACID SEQUENCES, VECTORS AND HOST CELLS CONTAINING SAME

... ▓▓▓The nucleic acid sequences of adeno-associated virus (AAV) serotype 1 are ▓provided, as are vectors and host cells containing these sequences and ▓functional fragments thereof. Also provided are methods of delivering genes ▓via AAV-1 derived vectors.▓ ...

NOVEL AAV CAPSIDS AND COMPOSITIONS CONTAINING SAME

Provided herein are novel AAV capsids and rAAV comprising the same. In one embodiment, vectors employing a novel AAV capsid show increased transduction of a selected target tissue as compared to a prior art AAV.

RECOMBINANT ADENO-ASSOCIATED VIRUSES AND USES THEREOF

The present invention relates to recombinant adeno-associated viruses (rAAVs) having capsid proteins engineered to include amino acid sequences that confer and/or enhance desired properties. In particular, the invention provides engineered capsid proteins comprising peptide insertions from heterologous proteins inserted within or near variable region IV (VR-IV) of the virus capsid, such that the insertion is surface exposed on the AAV particle. The invention also provides capsid proteins that direct rAAVs to target tissues, in particular, capsid proteins comprising peptides derived from erythropoietin or dynein that are inserted into surface- exposed variable regions and that target rAAVs to retinal tissue and/or neural tissue, including the central nervous system, and deliver therapeutics for treating neurological and/or eye disorders.

METHODS FOR GENERATING HIGH TITER HELPER-FREE PREPARATIONS OF RELEASED RECOMBINANT AAV VECTORS

The invention described herein provides methods of producing rAAV particles by culturing producer cells under conditions, such as temperature and pH, that promote release of virus.

HOST CELLS FOR PACKING A RECOMBINANT ADENO-ASSOCIATED VIRUS (RAAV), METHOD FOR THE PRODUCTION AND USE THEREOF

The invention relates to host cells for packing a recombinant adeno-associated virus (rAAV). Said cells contain at least one copy of a first auxiliary construct for expressing at least one AAV Rep protein, and at least one copy of another auxiliary construct for expressing at least one AAV Cap protein. The invention also relates to auxiliary constructs for expressing at least one AAV Rep protein and one AAV Cap protein in a host cell; vector constructs comprising at least one nucleic acid which is heterologous in relation to the AAV; a method for producing a host cell for packing a recombinant adeno- associated virus (rAAV); and the use of the host cell for producing an rAAV.

NOVEL ADENO-ASSOCIATED VIRUS (AAV) VECTORS, AAV VECTORS HAVING REDUCED CAPSID DEAMIDATION AND USES THEREFOR

A recombinant adeno-associated virus (rAAV) vector comprising an AAV capsid having a heterogeneous population of vp1 proteins, a heterogeneous population of vp2 protein and a heterogeneous population of vp3 proteins. The capsid contains modified amino acids as compared to the encoded VP1 amino acid sequence, the capsid containing highly deamidated asparagine residues at asparagine - glycine pair, and further comprising multiple other, less deamidated asparagine and optionally glutamine residues.

ADENO-ASSOCIATED VIRUS VARIANT CAPSIDS AND METHODS OF USE THEREOF

Provided herein are variant adeno-assoeiated virus (AAV) capsid proteins having one or more modifications in amino acid sequence relative to a parental AAV capsid protein, which, when present in an AAV virion, confer increased infectivity of one or more types of retinal cells as compared to the infectivity of the retinal cells by an AA V virion comprising the unmodified parental AAV capsid protein. Also provided are recombinant AAV virions and pharmaceutical compositions thereof comprising a variant AAV capsid protein as described herein, methods of making these rAAV capsid proteins and virions, and methods for using these rAAV capsid proteins and virions in research and in clinical practice, for example in, e.g., the delivery of nucleic acid sequences to one or more cells of the retina for the treatment of retinal disorders and diseases.

ANTIBODY-EVADING VIRUS VECTORS

The present disclosure provides AAV capsid proteins comprising a modification in the amino acid sequence and virus vectors comprising the modified AAV capsid protein. The disclosure also provides methods of administering the virus vectors and virus capsids of the disclosure to a cell or to a subject in vivo.

ADENO-ASSOCIATED VIRUS COMPOSITIONS FOR TARGETED GENE THERAPY

Described herein are compositions and kits comprising recombinant adeno-associated viruses (rAAVs) with tropisms showing increased specificity and efficiency of viral transduction in targeted cell-types, for e.g., the brain, and lung. The rAAV compositions described herein also have tropisms showing decreased specificity and decreased efficiency of viral transduction in an off-target cell type, for e.g., the liver. The rAAV compositions described herein encapsidate a transgene, such a therapeutic nucleic acid. Upon systemic delivery to a subject, the rAAV is capable of increased specificity and increased transduction of the transgene in a target cell-type, as compared to a parental or reference AAV.

IMPROVED AAV CAPSID PRODUCTION IN INSECT CELLS

The present invention relates to the production of adeno-associated viral vectors in insect cells. The insect cells therefore comprise a first nucleotide sequence encoding the adeno- associated virus (AAV) capsid proteins, whereby the initiation codon for translation of the AAV VP1 capsid protein is an AUG. Upstream of the VP1 open reading frame an alternative out of frame start codon is placed such that translation initiation of the VP1 protein is modified, i.e. reduced, to allow production of VP1 :VP2: VP3 in a good stoichiometry resulting in AAV with high potency.

METHODS AND COMPOSITIONS FOR ANTIBODY-EVADING VIRUS VECTORS

The present invention provides AAV capsid proteins comprising a modification in the amino acid sequence and virus vectors comprising the modified AAV capsid protein. The invention also provides methods of administering the virus vectors and virus capsids of the invention to a cell or to a subject in vivo.

NOVEL ADENO-ASSOCIATED VIRUS CAPSID PROTEINS

The invention relates to novel adeno-associated virus (AAV) capsid proteins, AAV particles comprising a novel capsid protein, polynucleotides encoding these capsid proteins and AAV vectors expressing these capsid proteins. The invention also relates to methods of making the herein described AAV vectors expressing the novel capsid proteins of the invention and associated therapeutic uses of thereof.

GENE TRANSFER COMPOSITIONS, METHODS AND USES FOR TREATING NEURODEGENERATIVE DISEASES

Provided are methods of treating a lysosomal storage disorder in a mammal which method includes administering AAV particles encoding a polypeptide to the central nervous system of the mammal. AAV particles may be delivered by direct injection into the brain, spinal cord, cerebral spinal fluid or a portion thereof for expression.

FUSION PROTEINS COMPRISING A CELL SURFACE MARKER SPECIFIC VHH

The present invention relates to fusion proteins comprising a cell surface marker specific VHH. In particular, the invention relates to bispecific VHH adaptor proteins, i.e. fusion proteins comprising an adeno-associated virus (AAV) specific VHH linked to a cell surface marker specific VHH. Moreover, the invention relates to a recombinant AAV which comprises a fusion protein in which a cell surface marker specific VHH is integrated into a capsid protein of the AAV. Also nucleotide sequences encoding such fusion proteins, vectors are contemplated. The invention moreover refers to uses of the fusion proteins and nucleic sequences for gene therapy.

ADENO-ASSOCIATED VIRUS (AAV) CLADES, SEQUENCES, VECTORS CONTAINING SAME, AND USES THEREFOR

A MODIFIED RAAV CAPSID PROTEIN FOR GENE THERAPY

The invention relates to recombinant adeno-associated virus (rAAV) virions for gene therapy, wherein the rAAV virions comprise a novel capsid protein. In particular,the invention relates to the use of such virions in gene therapy for the treatment of an arthritic disease, such as for example rheumatoid arthritis, or symptoms thereof, preferably by intraarticular administration.

STRUCTURAL PROTEIN OF ADENO-ASSOCIATED VIRUS WITH MODIFIED CHROMATOGRAPHIC PROPERTIES, ITS PRODUCTION AND USE

The invention relates to a scleroprotein of an adeno-associated virus which contains at least one mutation. Said mutation causes the chromatographic properties to be modified. The invention also relates to the production of said scleroprotein and the use thereof.

SIMIAN ADENOVIRUS NUCLEIC ACID AND AMINO ACID SEQUENCES, VECTORS CONTAINING SAME, AND METHODS OF USE

... ²²²A recombinant vector comprises simian adenovirus sequences and a heterologous ²gene under the control of regulatory sequences. A cell line which expresses ²simian adenovirus gene(s) is also disclosed. Methods of using the vectors and ²cell lines are provided.² ...

RECOMBINANT HERPES VIRUSES FOR PREPARING RECOMBINANT ADENO-ASSOCIATED VIRUSES

The invention relates to a recombinant herpes virus which contains the rep and cap genes of the adeno-associated virus, and to a method for producing high- titre, highly infectious adeno-associated virus vector preparations.

VECTORS WITH MODIFIED INITIATION CODON FOR THE TRANSLATION OF AAV-REP78 USEFUL FOR PRODUCTION OF AAV IN INSECT CELLS

The present invention relates nucleic acid constructs for the production of recombinant parvoviral (e.g. adeno-associated viral) vectors in insect cells, to insect cells comprising such constructs and to methods wherein the cells are used to produce recombinant parvoviral virions. The insect cells preferably comprise a first nucleotide sequence encoding the parvoviral rep proteins whereby the initiation codon for translation of the parvoviral Rep78 protein is a suboptimal initiation codon that effects partial exon skipping upon expression in insect cells. The insect cell further comprises a second nucleotide sequence comprising at least one parvoviral (AAV) inverted terminal repeat (ITR) nucleotide sequence and a third nucleotide sequence comprising a sequences coding for the parvoviral capsid proteins.

STRUCTURAL PROTEIN OF ADENO-ASSOCIATED VIRUS WITH MODIFIED ANTIGENICITY, ITS PRODUCTION AND ITS USE

The present invention relates to a structural protein of adeno-associated virus (AAV) which comprises at least one modification which brings about a reduction in the antigenicity, its production and use.

ANCESTRAL VIRUS SEQUENCES AND USES THEREOF

Methods are described for predicting ancestral sequences for viruses or portions thereof Also described are predicted ancestral sequences for adeno-associated virus (AAV) capsid polypeptides. The disclosure also provides methods of gene transfer and methods of vaccinating subjects by administering a target antigen operably linked to the AAV capsid polypeptides.

A METHOD OF DETECTING AND/OR IDENTIFYING ADENO-ASSOCIATED VIRUS (AAV) SEQUENCES AND ISOLATING NOVEL SEQUENCES IDENTIFIED THEREBY

A method for detecting and isolating AAV sequences in a sample of DNA obtained from tissue or cells is provided. The invention further provides AAV sequences identified by this method, and vectors constructed using these sequences.

RECOMBINANT AAV VARIANTS AND USES THEREOF

The disclosure in some aspects relates to recombinant adeno-associated viruses having distinct tissue targeting capabilities. In some aspects, the disclosure relates to gene transfer methods using the recombinant adeno-associated viruses. In some aspects, the disclosure relates to isolated AAV capsid proteins and isolated nucleic acids encoding the same.

MUTATED PARVOVIRUS STRUCTURAL PROTEINS AS VACCINES

The present invention is related to a method for identifying a parvovirus mutated structural protein capable of specifically binding to a binder for an antigen, a parvovirus mutated structural protein which comprises at least one B-cell epitope heterologous to the parvovirus, a multimeric structure comprising the protein, a nucleic acid encoding the protein, a virus or cell comprising the protein, a method of preparing the protein, a medicament comprising the protein, nucleic acid or multimeric structure and its use.

VIRAL VECTORS WITH MODIFIED TRANSDUCTION PROFILES AND METHODS OF MAKING AND USING THE SAME

The present invention provides AAV capsid proteins, virus capsids comprising said capsid proteins and virus vectors comprising said capsid proteins, wherein the AAV capsid proteins have one or more mutations, wherein the mutation(s) result in a phenotype of decreased liver transduction and/or reduced glycan binding affinity as compared to a control. The invention also provides methods of administering the virus vectors and virus capsids of the invention to a cell or to a subject.

SIMIAN ADENOVIRUS NUCLEIC ACID AND AMINO ACID SEQUENCES, VECTORS CONTAINING SAME, AND METHODS OF USE

A METHOD OF DETECTING AND/OR IDENTIFYING ADENO-ASSOCIATED VIRUS (AAV) SEQUENCES AND ISOLATING NOVEL SEQUENCES IDENTIFIED THEREBY

A method for detecting and isolating AAV sequences in a sample of DNA obtained from tissue or cells is provided. The invention further provides AAV sequences identified by this method, and vectors constructed using these sequences.

HIGH EFFICIENCY HELPER SYSTEM FOR AAV VECTOR PRODUCTION

Novel nucleic acid molecules are provided having adeno-associated virus (AAV ) coding regions that are capable of expressing necessary AAV functions to complement an AAV vector in the production of recombinant AAV (rAAV) virions. The molecules feature a nucleotide sequence that is substantially homologous to an AAV p5 promoter region, wherein the p5 promoter region is situated in the molecules in a site that is other than its natural position relative to the AAV rep coding region in the wild-type AAV genome. AAV helper function constructs are also provided, comprising the instant nucleic acid molecules embodied in a replicon that is capable of being transcribed and translated to express complementing AAV helper functions in a suitable host cell. Novel AAV packaging cells and AAV producer cells are provided, which contain the AAV helper constructs of the invention, and methods of producing enhanced levels of rAAV virions using the AAV helper constructs of the invention are also provided.

METHODS USING CRE-LOX FOR PRODUCTION OF RECOMBINANT ADENO-ASSOCIATED VIRUSES

Methods for efficient production of recombinant AAV are described. In one aspect, three vectors are introduced into a host cell. A first vector directs expression of cre recombinase, a second vector contains a promoter, a spacer sequence flanked by loxP sites and rep/cap, and a third vector contains a minigene containing a transgene and regulatory sequences flanked by AAV ITRs. In another aspect, the host cell stably or inducibly expresses cre recombinase and two vectors carrying the other elements of the system are introduced into the host cell.

GENE DELIVERY VECTORS AND THEIR USES

Preparations of infectious viral particles include viral particles which can act as helper virus for adeno-associated virus (AAV), and include particles comprising DNA (i) that includes at least one chosen nucleic acid sequence for delivery to target host cells, and further encoding proteins and replicating functions which together are sufficient, when said particles of said preparation infect first target host cells, for assembly and release, from said first target cells, of infectious recombinant AAV particles that comprise said chosen nucleic acid sequence whereby said infectious recombinant AAV particles are able in turn to infect second target host cells, and cause expression of said DNA (i) in said infected second target host cells.

IMPROVED PRODUCT CAPSID AAV IN CELLS OF INSECTS

DEVELOPMENT OF KAPSIDOVAAV

METHODS AND COMPOSITIONS FOR GENE TRANSFER BY VASCULAR NETWORK

VECTORS BASED ON AAV FOR GENETIC THERAPY IN RETINA AND CNS

VECTOR BASED ON ADENOASSOCIATED VIRUS (AAV) THE TREASURES F AND ITS APPLICATION

БАКУЛОВИРУСНЫЕ ВЕКТОРЫ, ВКЛЮЧАЮЩИЕ ПОВТОРНЫЕ КОДИРУЮЩИЕ ПОСЛЕДОВАТЕЛЬНОСТИ С ДИФФЕРЕНЦИАЛЬНЫМИ НЕОДНОЗНАЧНОСТЯМИ КОДОНОВ

Настоящее изобретение относится к продукции белков в клетках насекомых, в силу чего в бакуловирусных векторах используются повторные кодирующие последовательности. В частности, настоящее изобретение относится к продукции парвовирусных векторов, которые могут использоваться в генной терапии, и к увеличениям экспрессии вирусных белков Rep, которые увеличивают продуктивность парвовирусных векторов.

FURTHER IMPROVED AAV VECTORS PRODUCED IN INSECT CELLS

ADDITIONALLY IMPROVED VECTORS AAV, PRODUCED BY INSECT CELLS

VERSION ADENOASSOCIATED VIRUSES AND METHODS OF THEIR APPLICATION

ADENO-ASSOCIATED VIRUS VECTOR

Modular system for gene and protein delivery based AAV

vetor de vírus adeno-associados

vírus adeno-associados variantes e métodos de utilização

CAPSID-MODIFIED, RAAV3 VECTOR COMPOSITIONS AND USES IN GENE THERAPY OF HUMAN LIVER CANCER

Expression vectors for large-scale production of rAAV in the baculovirus/Sf9 system

The present disclosure describes methods and systems for use in the production of adeno-associated virus (AAV) particles, including recombinant adeno-associated virus (rAAV) particles. In certain embodiments, the production process and system use Baculoviral Expression Vectors (BEVs) in the production of AAV particles. In certain embodiments, the production process and system use Spodoptera frugiperdainsect cells (such as Sf9 or Sf21) as viral production cells. In certain embodiments, the production process and system use BEVs which lacks a portion or an entirety of the v-cath gene or includes a mutationally inactivated version of the v-cath gene.

ADENO-ASSOCIATED VIRUS VECTOR VARIANTS FOR HIGH EFFICIENCY GENOME EDITING AND METHODS THEREOF

Vectores virales recombinantes con tropismo modificado y usos de los mismos para la introducción dirigida de material genético a células humanas (divisional de la solicitud 201903842)

En la presente descripción se proporcionan composiciones y métodos para redireccionar proteínas de la cápside viral/cápsides/ vectores recombinantes, por ejemplo in vivo, con una molécula de unión multiespecífica, tal como un anticuerpo biespecífico, que se une específicamente a un epítopo heterólogo presentado por la proteína de la cápside y una proteína expresada en la célula de interés para el suministro dirigido de un nucleótido de interés.

ISOLATION, CLONING AND CHARACTERIZATION OF NEW ADENO-ASSOCIATED VIRUS (AAV) SEROTYPES

The present invention provides new adeno-associated virus (AAV) viruses and vectors, and particles derived therefrom. In addition, the present invention provides methods of delivering a nucleic acid to a cell using the AAV vectors and particles.

IMPROVED AAV VECTORS PRODUCED IN INSECT CELLS

The present invention relates to the production of adeno-associated viral vectors in insect cells. The insect cells therefore comprise a first nucleotide sequence encoding the adeno-associated virus (AAV) capsid proteins, whereby the initiation codon for translation of the AAV VP1 capsid protein is a non-ATG, suboptimal initiation codon. The insect cell further comprises a second nucleotide sequence comprising at least one AAV inverted terminal repeat (ITR) nucleotide sequence; a third nucleotide sequence comprising a Rep52 or a Rep40 coding sequence operably linked to expression control sequences for expression in an insect cell; and, a fourth nucleotide sequence comprising a Rep78 or a Rep68 coding sequence operably linked to expression control sequences for expression in an insect cell. The invention further relates to adeno-associated viral vectors with an altered ratio of the viral capsid proteins that provides improved infectivity o f the viral particles.

SIMIAN ADENOVIRUS NUCLEIC ACID AND AMINO ACID SEQUENCES, VECTORS CONTAINING SAME, AND METHODS OF USE

A recombinant vector comprises simian adenovirus sequences and a heterologous gene under the control of regulatory sequences. A cell line which expresses simian adenovirus gene(s) is also disclosed. Methods of using the vectors and cell lines are provided.

Use of AAV integration efficiency element for mediating site-specific integration of a transcription unit

The invention provides an expression construct comprising a nucleic acid sequence encoding an adeno-associated virus integration efficiency element (AAV IEE), wherein the expression construct is substantially devoid of AAV inverted terminal repeats (AAV ITRs). Such an expression construct site-specifically integrates into a host cell chromosome when provided to a host cell in conjunction with an AAV Rep protein. The invention also provides a method of integrating a nucleic acid sequence of interest into a host cell chromosome through use of such an expression construct, as well as a method of prophylactically or therapeutically treating a mammal for a pathologic state comprising administering to a mammal such an expression construct comprising a nucleic acid sequence encoding a therapeutic factor.

High titer recombinant AAV production

The invention includes methods and compositions for the production of high titer recombinant adeno-associated virus (rAAV). The disclosed rAAV are useful in gene therapy applications. Methods are based on the use of recombinant herpes virus vectors and result in highly efficient production of rAAV.

Gene delivery vectors and their uses

Gene Delivery Vectors and Their Uses Preparations of infectious viral particles include viral particles which can act as helper virus for adeno-associated virus (AAV), and include particles comprising DNA (i) that includes at least one chosen nucleic acid sequence for delivery to target host cells, and further encoding proteins and replicating functions which together are sufficient, when said particles of said preparation infect first target host cell, for assembly and release, from said first target cells of infectious recombinant AAV particles that comprise said chosen nucleic acid sequence, whereby said infectious recombinant AAV particles are able in turn to infect second target host cells, and cause expression of said DNA (i) in said infected second target host cells.

ADENO-ASSOCIATED VIRUS (AAV) CLADES, SEQUENCES, VECTORS CONTAINING SAME, AND USES THEREFOR

Sequences of novel adeno-associated virus capsids and vectors and host cells containing these sequences are provided. Also described are methods of using such host cells and vectors in production of rAAV particles. AAV-mediated delivery of therapeutic and immunogenic genes using the vectors of the invention is also provided.

RECOMBINANT AAV1, AAV5, AND AAV6 CAPSID MUTANTS AND USES THEREOF

Provided herein are modified recombinant adeno-associated virus (rAAV) capsid proteins, such as modified rAAV1, rAAV5, and rAAV6 capsid proteins, rAAV particles comprising such capsid proteins, nucleic acid molecules encoding such capsid proteins, as well as compositions, kits and methods of use thereof. 1. A modified adeno-associated virus (AAV) capsid protein , wherein a VP3 region of the modified AAV capsid protein comprises a replacement of tyrosine residues with non-tyrosine residues and/or a replacement of a threonine residue with a non-threonine residue at positions corresponding to:Y705, Y731, and T492 of a wild-type AAV1 capsid protein having the sequence of SEQ ID NO: 1,Y436, Y693, and Y719 of a wild-type AAV5 capsid protein having the sequence of SEQ ID NO: 2, orY705, Y731, and T492 of a wild-type AAV6 capsid protein having the sequence of SEQ ID NO: 3.2. The modified AAV capsid protein of claim 1 , wherein the modified AAV capsid protein is a modified AAV1 capsid protein and the modified AAV1 capsid protein comprises replacement of tyrosine residues with non-tyrosine residues and a replacement of a threonine residue with a non-threonine residue at each of the positions corresponding to Y705 claim 1 , Y731 claim 1 , and T492 of the wild-type AAV1 capsid protein having the sequence of SEQ ID NO: 1.3. The modified AAV capsid protein of claim 1 , wherein the modified AAV capsid protein is a modified AAV5 capsid protein and the modified AAV5 capsid protein comprises replacement of tyrosine residues with non-tyrosine residues at each of the positions corresponding to Y436 claim 1 , Y693 claim 1 , and Y719 of a wild-type AAV5 capsid protein having the sequence of SEQ ID NO: 2.4. The modified AAV capsid protein of claim 1 , wherein the modified AAV capsid protein is a modified AAV6 capsid protein and the modified AAV6 capsid protein comprises replacement of tyrosine residues with non-tyrosine residues and a replacement of a threonine residue with a non-threonine ...

Recombinant Adeno-Associated Virus Production

The present invention relates to methods and materials for recombinant adeno-associated virus production. More particularly, the invention relates to use of recombinant adenovirus encoding adeno-associated virus protein in recombinant adeno-associated virus production methods.

AAV CAPSID PRODUCTION IN INSECT CELLS

The present invention relates to the production of adeno-associated viral vectors in insect cells. The insect cells therefore comprise a first nucleotide sequence encoding the adeno-associated virus (AAV) capsid proteins, whereby the initiation codon for translation of the AAV VP1 capsid protein is an AUG. Upstream of the VP1 open reading frame an alternative out of frame start codon is placed such that translation initiation of the VP1 protein is modified, i.e. reduced, to allow production of VP1:VP2:VP3 in a good stoichiometry resulting in AAV with high potency.

Inducible AAV REP genes

The present invention relates to host cells comprising a nucleic acid encoding Adeno-associated virus (AAV) Rep proteins Rep78 and Rep68, wherein the internal AAV promoter p19 has been inactivated by one or more mutations that maintain the functionality of said Rep78 and Rep68 proteins. The present invention further relates to respective nucleic acids and vectors comprising the same, as well as respective methods for the production of AAV.

Adeno-Associated Virus Virions with Variant Capsid and Methods of Use Thereof

The present disclosure provides adeno-associated virus (AAV) virions with altered capsid protein, where the AAV virions exhibit greater infectivity of retinal cells, when administered via intravitreal injection, compared to wild-type AAV. The present disclosure further provides methods of delivering a gene product to a retinal cell in an individual, and methods of treating ocular disease.

METHODS AND COMPOSITIONS FOR TARGETED GENE TRANSFER

The present invention provides AAV capsid proteins comprising a modification in the amino acid sequence and virus capsids and virus vectors comprising the modified AAV capsid protein. The invention also provides methods of administering the virus vectors and virus capsids of the invention to a cell or to a subject in vivo.

Adeno-associated virus virions with variant capsid and methods of use thereof

The present disclosure provides adeno-associated virus (AAV) virions with altered capsid protein, where the AAV virions exhibit greater infectivity of retinal cells, when administered via intravitreal injection, compared to wild-type AAV. The present disclosure further provides methods of delivering a gene product to a retinal cell in an individual, and methods of treating ocular disease.

REDIRECTION OF TROPISM OF AAV CAPSIDS

The disclosure relates to compositions, methods, and processes for the preparation, use, and/or formulation of adeno-associated virus capsid proteins, wherein the capsid proteins comprise targeting peptide inserts tor enhanced tropism to a target tissue.

Modified Virus Vectors and Methods of Making and Using the Same

The present invention provides AAV capsid proteins (VP1, VP2 and/or VP3) comprising a modification in the amino acid sequence in the three-fold axis loop 4 and virus capsids and virus vectors comprising the modified AAV capsid protein. In particular embodiments, the modification comprises a substitution of one or more amino acids at amino acid positions 585 to 590 (inclusive) of the native AAV2 capsid protein sequence or the corresponding positions of other AAV capsid proteins. The invention also provides methods of administering the virus vectors and virus capsids of the invention to a cell or to a subject in vivo.

Adeno-associated virus serotype i nucleic acid sequences, vectors and host cells containing same

The nucleic acid sequences of adeno-associated virus (AAV) serotype 1 are provided, as are vectors and host cells containing these sequences and functional fragments thereof. Also provided are methods of delivering genes via AAV-1 derived vectors.

Viral vectors with modified transduction profiles and methods of making and using the same

The present invention provides AAV capsid proteins, virus capsids comprising said capsid proteins and virus vectors comprising said capsid proteins, wherein the AAV capsid proteins have one or more mutations, wherein the mutation(s) result in a phenotype of decreased liver transduction and/or reduced glycan binding affinity as compared to a control. The invention also provides methods of administering the virus vectors and virus capsids of the invention to a cell or to a subject.

MUTANT OF ADENO-ASSOCIATED VIRUS (AAV) CAPSID PROTEIN

The present invention provides: a mutant of adeno-associated virus (AAV) capsid protein, which contains at least one amino acid substitution in PLA2 domain when compared with the amino acid sequence for wild-type AAV capsid protein; a nucleic acid encoding the mutant; a cell containing the nucleic acid; a method for producing a recombinant AAV particle, comprising a step of culturing the cell to produce the recombinant AAV particle; a recombinant AAV particle containing the mutant; a composition containing the recombinant AAV particle; and a method for transferring a gene into a target cell, comprising a step of bringing the recombinant AAV particle into contact with the target cell. 2. The mutant of an AAV capsid protein according to claim 1 , wherein the one or more amino acid replacements are one or more amino acid replacements selected from the group consisting of:(1) a replacement of alanine at position 3 by threonine (A3T),(2) a replacement of tyrosine at position 6 by histidine (Y6H),(3) a replacement of alanine at position 68 by valine (A68V),(4) a replacement of aspartic acid at position 87 by asparagine (D87N),(5) a replacement of leucine at position 91 by proline (L91P),(6) a replacement of serine at position 149 by tyrosine (S149Y),(7) a replacement of proline at position 150 by histidine (P150H), and(8) a replacement of serine at position 156 by tyrosine (S156Y)in the amino acid sequence of AAV2 VP1 capsid protein, or one or more amino acid replacements corresponding to the above (1) to (8) in the amino acid sequence of VP1 capsid protein of an AAV other than AAV2.3. The mutant of an AAV capsid protein according to claim 1 , wherein the one or more amino acid replacements are one or more amino acid replacements selected from the group consisting of:(1) a replacement of alanine at position 3 by threonine (A3T),(2) a replacement of tyrosine at position 6 by histidine (Y6H), and(3) a replacement of alanine at position 68 by valine (A68V)in the amino acid ...

MODIFIED AAV CAPSID PROTEINS AND USES THEREOF

Adeno associated viral (AAV) particles are emerging as useful vehicle for gene delivery to various organs and tissues, one of them being the retina. Provided here are variant AAV (e.g., variant serotype 2 (AAV2)) capsid proteins and variant capsid protein containing particles with enhanced ability to transduce retinal cells. 1. A variant recombinant adeno-associated virus (rAAV) serotype 2 (AAV2) capsid protein comprising sequences DGE and DF in variable region (VR) V (VRV) and any one of the following sets of sequences and/or substitutions:(a) EDATENXIXXDR (SEQ ID NO: 4) in VRVII,(b) NA in VRI; and SAAGADXAXDS (SEQ ID NO: 5) in VRVII,(c) NA in VRI; and EDATENXIXXDR (SEQ ID NO: 4) in VRVII,(d) SAAGADXAXDS (SEQ ID NO: 5) substitution in VRVII,(e) NA in VRI; and SGREGDAEXXD (SEQ ID NO: 6) in VRVII,(f) a Q to A substitution in loop I; and EDATENXIXXDR (SEQ ID NO: 4) in VRVII,(g) a Q to A substitution in loop I; a K to T substitution in VRV; and EDATENXIXXDR (SEQ ID NO: 4) in VRVII, and(h) a S to W substitution at position 267; and EDATENXIXXDR (SEQ ID NO: 4) in VRVII;wherein X may be any amino acid.2. A variant recombinant AAV2 capsid protein comprising any one of the following sets of sequences and/or substitutions:(a) NA in VRI; a F at position 444; and DEAXSEXKXTXR (SEQ ID NO: 7) in VRIV,(b) Q325K in VRII; Y444F; S452A, T454N and T455V in VRIV; and K527R, E530D and E531D in VRVI,(c) Q263A in VRI; K490T, S492P, E499D and Y500F in VRV; and E530D in VRVI,(d) NA in VRI; Y444F; P451A, T454N, T455V and R459T in VRIV; and RXXDD (SEQ ID NO: 8) in VRVI,(e) E530D in VRVI,(f) QDXE (SEQ ID NO: 9), and substitutions Y500F and T503P in VRV, and(g) EA in VRI; T491V and Y500F in VRV; and AAADDXEXDG (SEQ ID NO: 10) in VRVII;wherein X may be any amino acid.335-. (canceled)36. A variant recombinant adeno-associated virus (rAAV) serotype 2 (AAV2) capsid protein comprising one or more of the following sequences in the variable regions (VRs) of SEQ ID NO 29:(a) XX in VRI; QDXE in VRV; ...

METHODS AND COMPOSITIONS FOR TARGETED GENE TRANSFER

The present invention provides AAV capsid proteins comprising a modification in the amino acid sequence and virus capsids and virus vectors comprising the modified AAV capsid protein. The invention also provides methods of administering the virus vectors and virus capsids of the invention to a cell or to a subject in vivo. 1. An adeno-associated virus (AAV) serotype 4 (AAV4) capsid protein , wherein the AAV4 capsid protein comprises a modification at amino acid residues K492 , K503 and N585 and further comprises a modification at one or more of amino acid residues M523 , G580 , G581 , Q583 , S586 , N587 , L588 , T590 , D592 , R593 , L594 , T595 and/or A596 in any combination , wherein the numbering of the residues is based on the amino acid sequence of SEQ ID NO:1.2. An adeno-associated virus (AAV) serotype 4 (AAV4) capsid protein , wherein the AAV4 capsid protein comprises a modification at amino acid residues K493 , K504 and N586 and further comprises a modification at one or more of amino acid residues M524 , G581 , G582 , Q584 , S587 , N588 , L589 , T591 , D593 , R594 , L595 , T596 and/or A597 in any combination , wherein the numbering of the residues is based on the amino acid sequence of SEQ ID NO:2.3. The AAV4 capsid protein of claim 1 , comprising a K492E substitution claim 1 , a K503E substitution and/or a N585S substitution claim 1 , in any combination.4. The AAV4 capsid protein of claim 1 , comprising a N585R substitution.5. The AAV4 capsid protein of claim 2 , comprising a K493E substitution claim 2 , a K504E substitution and/or a N586S substitution claim 2 , in any combination.6. The AAV4 capsid protein of claim 2 , comprising a N586R substitution.7. The AAV4 capsid protein of claim 2 , comprising the amino acid sequence of SEQ ID NO:29.8. The AAV4 capsid protein of claim 2 , comprising the amino acid sequence of SEQ ID NO:30.9. The AAV4 capsid protein of claim 2 , comprising the amino acid sequence of SEQ ID NO:31.10. The AAV4 capsid protein of claim 2 ...

MATERIALS AND METHODS FOR DELIVERING NUCLEIC ACIDS TO COCHLEAR AND VESTIBULAR CELLS

Provided herein are materials and methods for efficiently delivering nucleic acids to cochlear and vestibular cells. 1. An AAV vector comprising an Anc80 capsid protein and one or more transgenes selected from the group consisting of TMC1 , TMC2 , MYO7A , USCH1C , CDH23 , PCDH15 , SANS , CIB2 , USH2A , VLGR1 , WHRN , CLRN1 , PDZD7.2. A method of delivering a transgene to one or more cells in the inner ear in a subject , the method comprising:administering an adeno-associated virus (AAV) to the inner ear in a subject, wherein the AAV comprises an Anc80 capsid protein and a transgene.3. The method of claim 2 , wherein the one or more cells in the inner ear are selected from the group consisting of inner hair cells (IHCs) and outer hair cells (OHCs).4. The method of claim 3 , wherein the transgene is delivered to at least 80% of inner hair cells and at least 80% of outer hair cells.5. The method of claim 2 , wherein the one or more cells in the inner ear are selected from the group consisting of spiral ganglion neurons claim 2 , vestibular hair cells claim 2 , vestibular ganglion neurons claim 2 , supporting cells claim 2 , and cells in the stria vascularis.6FOXI. The method of claim 2 , wherein the transgene is selected from the group consisting of ACTG1 claim 2 , ADCY1 claim 2 , ATOHI claim 2 , ATP6V1B1 claim 2 , BDNF claim 2 , BDP1 claim 2 , BSND claim 2 , DATSPER2 claim 2 , CABP2 claim 2 , CD164 claim 2 , CDC14A claim 2 , CDH23 claim 2 , CEACAM16 claim 2 , CHD7 claim 2 , CCDC50 claim 2 , CIB2 claim 2 , CLDN14 claim 2 , CLIC5 claim 2 , CLPP claim 2 , CLRN1 claim 2 , COCH claim 2 , COL2A1 claim 2 , COL4A3 claim 2 , COL4A4 claim 2 , COL4A5 claim 2 , COL9A1 claim 2 , COL9A2 claim 2 , COL11A1 claim 2 , COL11A2 claim 2 , CRYM claim 2 , DCDC2 claim 2 , DFNA5 claim 2 , DFNB31 claim 2 , DFNB59 claim 2 , DIAPH1 claim 2 , EDN3 claim 2 , EDNRB claim 2 , ELMOD3 claim 2 , EMOD3 claim 2 , EPS8 claim 2 , EPS8L2 claim 2 , ESPN claim 2 , ESRRB claim 2 , EYA1 claim 2 , EYA4 claim 2 , ...

AAV VIRIONS WITH DECREASED IMMUNOREACTIVITY AND USES THEREFOR

Methods of making and using recombinant AAV virions with decreased immunoreactivity are described. The recombinant AAV virions include mutated capsid proteins or are derived from non-primate mammalian AAV serotypes and isolates that display decreased immunoreactivity relative to AAV-2. 143-. (canceled)44. A mutated adeno-associated virus (AAV) capsid protein comprising a substitution of one or more of the amino acids occurring at a position corresponding to a position of the full-length AAV-2 VP2 capsid , wherein the one or more amino acids are selected from the group consisting of amino acid:124 substituted with a threonine;126 substituted with an alanine;127 substituted with an alanine or a leucine;128 substituted with an alanine or an aspartic acid;130 substituted with a threonine or an alanine;131 substituted with a glutamine or an alanine;132 substituted with a glutamic acid, an alanine, or an asparagine;133 substituted with an alanine;134 substituted with a glutamine, a phenylalanine, or an alanine;188 substituted with an alanine;190 substituted with an alanine;191 substituted with a serine;193 substituted with an alanine;245 substituted with an alanine;246 substituted with an alanine;247 substituted with an alanine;248 substituted with an alanine;315 substituted with an alanine;317 substituted with an alanine;318 substituted with an alanine;320 substituted with an alanine;322 substituted with an alanine;329 substituted with an arginine;331 substituted with an alanine;332 substituted with an alanine;334 substituted with an alanine;335 substituted with an alanine;347 substituted with a cysteine;350 substituted with a lysine;354 substituted with an alanine;355 substituted with a threonine or an alanine;356 substituted with an arginine;357 substituted with a glutamic acid, a glutamine, an alanine, or an asparagine;358 substituted with a lysine;359 substituted with an alanine;360 substituted with a histidine, a lysine, or an alanine;361 substituted with an alanine ...

METHODS AND COMPOSITIONS FOR GENE DELIVERY TO ON BIPOLAR CELLS

Disclosed are capsid-modified rAAV expression vectors, as well as infectious virions, compositions, and pharmaceutical formulations that include them. Also disclosed are methods of preparing and using novel capsid-protein-mutated rAAV vector constructs in a variety of diagnostic and therapeutic applications including, inter alia, as delivery agents for diagnosis, treatment, or amelioration of one or more diseases, disorders, or dysfunctions of the mammalian eye. Also disclosed are methods for intravitreal delivery of therapeutic gene constructs to retinal neuron cells, and specifically to ON bipolar cells, of the mammalian eye, as well as use of the disclosed compositions in the manufacture of medicaments for a variety of in vitro and/or in vivo applications including the treatment of retinitis pigmentosa, melanoma-associated retinopathy, and congenital stationary night blindness. 1. An adeno-associated viral (AAV) particle comprising:(a) a recombinant adeno-associated viral (rAAV) vector polynucleotide that comprises a nucleic acid segment that encodes a diagnostic or therapeutic agent operably linked to an ON bipolar cell-specific promoter that is capable of expressing the nucleic acid segment in one or more middle retinal neuron cells of a mammalian eye; and(b) a modified capsid protein, wherein the modified capsid protein comprises at least a first non-native amino acid at a position that corresponds to a surface-exposed amino acid residue in the wild-type AAV2 capsid protein, and further wherein the transduction efficiency of a virion comprising the modified capsid protein is higher than that of a virion comprising a corresponding, unmodified wild-type capsid protein.2. The AAV particle of claim 1 , wherein the modified capsid protein comprises three or more non-native amino acid substitutions at positions corresponding to three distinct surface-exposed amino acid residues of the wild-type AAV2 capsid protein as set forth in SEQ ID NO:2; or to three distinct ...

PLASMID FREE AAV VECTOR PRODUCING CELL LINES

Disclosed herein are packaging cell lines, in which adenovirus (Ad) E1A is constitutively expressed, that also contain integrated AAV rep and cap genes. The packaging cell lines exhibit little to no expressed Rep protein until helper virus function, such as adenovirus (Ad) E4, E2A and/or VA RNA are provided by, for example, transduction of the cells with a virus, vector or plasmid, such as an Ad-AAV hybrid virus. The promoter driving expression of AAV rep gene can be positioned far enough upstream (5′) of the rep coding sequence that E1A is unable to activate the promoter, activate substantial transcription of the rep gene and in turn produce Rep protein. Introduction of helper virus function, such as E2A, E4 and/or VA RNA into these packaging cells is able to drive AAV rep gene transcription, subsequent Rep protein expression and production of rAAV vector particles. 1. A mammalian cell line expressing adenovirus (Ad) E1A protein , comprising an integrated adeno-associated virus (AAV) rep gene operably linked to a promoter , wherein a nucleic acid spacer is positioned between said rep gene and said promoter , and an integrated AAV cap gene.2. The cell line of claim 1 , wherein said cell line is passagable for at least about 5 passages claim 1 , at least about 10 passages claim 1 , at least about 15 passages claim 1 , or at least about 20 passages while E1A protein is expressed in the cell line.3. The cell line of claim 1 , wherein said cell line is passagable for at least about 5 passages claim 1 , at least about 10 passages claim 1 , at least about 15 passages claim 1 , or at least about 20 passages without substantial death of said cell line.4. (canceled)5. The cell line of claim 1 , wherein Rep protein expression from said rep gene increases in the presence of helper virus function.6. The cell line of claim 1 , wherein said promoter drives expression of said rep gene only in the presence of helper virus function.7. The cell line of claim 6 , wherein said helper ...

METHOD OF DETECTING AND/OR IDENTIFYING ADENO-ASSOCIATED VIRUS (AAV) SEQUENCES AND ISOLATING NOVEL SEQUENCES IDENTIFIED THEREBY

Adeno-associated virus rh.20 sequences, vectors containing same, and methods of use are provided. 1. A cultured host cell containing a recombinant nucleic acid molecule encoding an AAV vp1 capsid protein having a sequence comprising amino acids 1 to 738 of SEQ ID NO: 85 (AAVrh.20) , wherein the recombinant nucleic acid molecule further comprises a heterologous non-AAV sequence.2. The cultured host cell according to claim 1 , which further comprises a functional rep gene.3. A cultured host cell containing a recombinant nucleic acid molecule encoding an AAV vp2 capsid protein having a sequence comprising amino acids 138 to 738 of SEQ ID NO: 85 (AAVrh.20) claim 1 , wherein the recombinant nucleic acid molecule further comprises a heterologous non-AAV sequence.4. The cultured host cell according to claim 3 , which further comprises a functional rep gene.5. A cultured host cell containing a recombinant nucleic acid molecule encoding an AAV vp3 capsid protein having a sequence comprising amino acids 204 to 738 of SEQ ID NO: 85 (AAVrh.20) claim 3 , wherein the recombinant nucleic acid molecule further comprises a heterologous non-AAV sequence.6. The cultured host cell according to claim 5 , which further comprises a functional rep gene.7. A cultured host cell containing a recombinant nucleic acid molecule comprising (a) nucleotides 844 to 3057 of SEQ ID NO: 27 claim 5 , (b) nucleotides 1255 to 3057 of SEQ ID NO: 27 claim 5 , or (c) nucleotides 1453 to 3057 of SEQ ID NO: 27 claim 5 , wherein the recombinant nucleic acid molecule further comprises a heterologous non-AAV sequence.8. The cultured host cell according to claim 7 , which further comprises a rep gene.9. The cultured host cell according to claim 2 , wherein the rep gene is from AAV2.10. The cultured host cell according to claim 4 , wherein the rep gene is from AAV2.11. The cultured host cell according to claim 6 , wherein the rep gene is from AAV2.12. The cultured host cell according to claim 8 , wherein the rep ...

Adeno-associated virus (aav) clades, sequences, vectors containing same, and uses therefor

Sequences of novel adeno-associated virus capsids and vectors and host cells containing these sequences are provided. Also described are methods of using such host cells and vectors in production of rAAV particles. AAV-mediated delivery of therapeutic and immunogenic genes using the vectors of the invention is also provided.

METHODS AND COMPOSITIONS FOR DUAL GLYCAN BINDING AAV VECTORS

The present invention provides methods and compositions comprising an adeno-associated virus (AAV) capsid protein, comprising one or more amino acids substitutions, wherein the substitutions introduce a new glycan binding site into the AAV capsid protein. 1. An adeno-associated virus (AAV) capsid protein , comprising one or more amino acids substitutions , wherein the substitutions introduce a new glycan binding site into the AAV capsid protein.2. The AAV capsid protein of claim 1 , wherein the amino acid substitutions are in amino acid 266 claim 1 , amino acids 463-475 and amino acids 499-502 in AAV2 or the corresponding amino acid positions in AAV1 claim 1 , AAV3 claim 1 , AAV4 claim 1 , AAV5 claim 1 , AAV6 claim 1 , AAV7 claim 1 , AAV8 or AAV10.3. The AAV capsid protein of claim 1 , wherein the new glycan binding site is a hexose binding site claim 1 , wherein the hexose is a galactose (Gal) claim 1 , a mannose (Man) claim 1 , a glucose (Glu) or a fucose (fuc).4. The AAV capsid protein of claim 1 , wherein the new glycan binding site is a sialic acid (Sia) binding site claim 1 , wherein the Sia residue is N-acetylneuraminic acid (Neu5Ac) or N-Glycolylneuraminic acid (Neu5Gc).5. The AAV capsid protein of claim 1 , wherein the new glycan binding site is a disaccharide binding site claim 1 , wherein the disaccharide is a sialic acid linked to galactose in the form Sia(alpha2 claim 1 ,3)Gal or Sia(alpha2 claim 1 ,6)Gal.6. The AAV capsid protein of claim 3 , wherein the new glycan binding site is a galactose binding site.7. The AAV capsid protein of claim 1 , wherein the substitutions introduce a new glycan binding site from a first AAV serotype into the capsid protein of a second AAV serotype that is different from said first AAV serotype.8. The AAV capsid protein of claim 7 , wherein the serotype of the second AAV serotype is AAV serotype 1 (AAV1) claim 7 , AAV serotype 2 9AAV2) claim 7 , AAV serotype 3a (AAV3a) claim 7 , AAV serotype 3b (AAV3b) claim 7 , AAV ...

ADENO-ASSOCIATED VIRUS VARIANTS AND METHODS OF USE THEREOF

The present disclosure provides infectious recombinant adeno-associated virus (rAAV) virions that comprise a variant capsid protein and a heterologous nucleic acid. The present disclosure further provides the variant adeno-associated virus (AAV) capsid proteins (and/or a nucleic acid encoding the variant AAV capsid proteins), which confer to an infectious rAAV virion an increased resistance to human AAV neutralizing antibodies. The present disclosure further provides host cells comprising an infectious rAAV virion and/or a nucleic acid encoding a subject variant AAV capsid protein. The present disclosure further provides methods of delivering a heterologous nucleic acid to a target cell where the target cell is contacted with a subject infectious rAAV virion. The present disclosure further provides methods of delivering a gene product to an individual, the methods generally involving administering an effective amount of a subject rAAV virion to an individual in need thereof. 1. An infectious recombinant adeno-associated virus (rAAV) virion comprising:(a) a variant adeno-associated virus (AAV) capsid protein comprising an amino acid sequence having at least about 90% amino acid sequence identity to amino acids 203-736 of the amino acid sequence set forth in one of SEQ ID NOs:11-13 and 26-33; and(b) a heterologous nucleic acid.2. The infectious rAAV of claim 1 , wherein the variant AAV capsid protein comprises an amino acid sequence having at least about 95% amino acid sequence identity to amino acids 203-736 of the amino acid sequence set forth in one of SEQ ID NOs:11-13 and 26-33.3. The infectious rAAV of claim 1 , wherein the variant AAV capsid protein comprises the amino acid sequence set forth in one of SEQ ID NOs:11-13 and 26-33.4. An infectious recombinant adeno-associated virus (rAAV) virion comprising:(a) a variant adeno-associated virus (AAV) capsid protein that comprises an amino acid sequence having at least about 95% amino acid sequence identity to amino ...

CAPSID-MODIFIED RAAV VECTOR COMPOSITIONS AND METHODS THEREFOR

Disclosed are capsid-modified rAAV expression vectors, as well as infectious virions, compositions, and pharmaceutical formulations containing them. Also provided are methods of preparing and using the disclosed capsid-protein-mutated rAAV constructs in a variety of diagnostic and therapeutic modalities, including, inter alia, as mammalian cell-targeting delivery agents, and as human gene therapy vectors. Also disclosed are large-scale production methods for capsid-modified rAAV expression vectors, viral particles, and infectious virions having improved transduction efficiencies over those of the corresponding, un-modified, rAAV vectors, as well as use of the disclosed compositions in the manufacture of medicaments for a variety of in vitro and/or in vivo applications. 125-. (canceled)26. A modified AAV capsid protein , comprising:a) a non-serine amino acid residue at a position corresponding to S663 of the wildtype AAV6 capsid protein as set forth in SEQ ID NO:6; orb) a non-threonine amino acid residue at a position corresponding to T492 of the wild-type AAV6 capsid protein as set forth in SEQ ID NO:6.27. The modified AAV capsid protein of claim 26 , wherein the capsid protein is of a serotype selected from the group consisting of AAV1 claim 26 , AAV2 claim 26 , AAV3 claim 26 , AAV4 claim 26 , AAV5 claim 26 , AAV6 claim 26 , AAV7 claim 26 , AAV8 AAV9 claim 26 , and AAV10 claim 26 , as set forth in SEQ ID NO:1 claim 26 , SEQ ID NO:2 claim 26 , SEQ ID NO:3 claim 26 , SEQ ID NO:4 claim 26 , SEQ ID NO:5 claim 26 , SEQ ID NO: 6 claim 26 , SEQ ID NO:7 claim 26 , SEQ ID NO: 8 claim 26 , SEQ ID NO:9 claim 26 , and SEQ ID NO:10.28. The modified AAV capsid protein of claim 26 , wherein the non-serine amino acid residue is selected from the group consisting of phenylalanine (F) claim 26 , valine (V) claim 26 , histidine (H) claim 26 , isoleucine (I) claim 26 , alanine (A) claim 26 , leucine (L) aspartic acid (D) claim 26 , asparagine (N) claim 26 , glutamic acid (E) claim 26 ...

ADENO-ASSOCIATED VIRUS (AAV) SEROTYPE 8 SEQUENCES, VECTORS CONTAINING SAME, AND USES THEREFOR

Sequences of a serotype 8 adeno-associated virus and vectors and host cells containing these sequences are provided. Also described are methods of using such host cells and vectors in production of rAAV particles. 1. A recombinant nucleic acid molecule:(a) encoding an AAV8 vp1 capsid protein having a sequence comprising amino acids 1 to 738 of SEQ ID NO: 2; or(b) comprising nucleotides 2121 to 4334 of SEQ ID NO: 1, or a nucleotide sequence at least 99% identical to nucleotides 2121 to 4334 of SEQ ID NO: 1,wherein the recombinant nucleic acid molecule does not contain an AAV inverted terminal repeat.2. The recombinant nucleic acid molecule according to claim 1 , which further comprises a functional rep gene.3. The recombinant nucleic acid molecule according to claim 1 , wherein said recombinant nucleic acid molecule comprises a sequence selected from:vp1, nt 2121 to 4334;vp2, nt 2532 to 4334; orvp3, nt 2730 to 4334 of SEQ ID NO: 1.4. The recombinant nucleic acid molecule according to claim 1 , wherein said recombinant nucleic acid molecule is a plasmid.5. A host cell transfected with the recombinant nucleic acid molecule according to .6. The host cell according to claim 5 , which further comprises a functional rep gene claim 5 , a minigene comprising AAV inverted terminal repeats (ITRs) and a transgene claim 5 , and sufficient helper functions to permit packaging of the minigene into the AAV capsid.7. The host cell according to claim 6 , which further comprises a nucleic acid sequence '(b) comprising nucleotides 2532 to 4334 of SEQ ID NO: 1, or a nucleotide sequence at least 99% identical to nucleotides 2532 to 4334 of SEQ ID NO: 1.', '(a) encoding an AAV8 vp2 capsid protein having a sequence comprising amino acids 138 to 738 of SEQ ID NO: 2; or'}8. The host cell according to claim 6 , which further comprises a nucleic acid sequence(a) encoding an AAV8 vp3 capsid protein having a sequence comprising amino acids 204 to 738 of SEQ ID NO: 2; or(b) comprising nucleotides ...

Ancestral Virus Sequences and Uses Thereof

Methods are described for predicting ancestral sequences for viruses or portions thereof. Also described are predicted ancestral sequences for adeno-associated virus (AAV) capsid polypeptides. The disclosure also provides methods of gene transfer and methods of vaccinating subjects by administering a target antigen operably linked to the AAV capsid polypeptides.

AAV6 VARIANTS

This disclosure relates to variant AAV6 particles engineered to escape host neutralizing antibodies but retain or improve transduction efficiency, and their use as gene delivery vehicles. 1. A method comprising:administering to a subject that is seropositive for adeno-associated virus (AAV) of serotype 6 (AAV6) a recombinant AAV6 (rAAV6) particle comprising a capsid protein comprising a substituted amino acid at position 531, wherein the rAAV particle comprises a gene of interest.2. The method of claim 1 , wherein the subject has preexisting anti-AAV6 antibodies.3. The method of or claim 1 , further comprising determining whether the subject is seropositive for AAV6.4. The method of claim 3 , wherein determining whether the subject is seropositive for AAV6 comprises determining whether a subject has anti-AAV6 antibodies.5. The method of claim 4 , wherein determining whether the subject has anti-AAV6 antibodies comprises:incubating a sample of serum obtained from the subject with one or more AAV6 capsid antigens, andmeasuring the amount of anti-AAV6 antibodies bound to the one or more AAV6 capsid antigens.6. The method of claim 5 , wherein the one or more AAV6 capsid antigens are bound to a solid support.7. The method of any one of - claim 5 , wherein the AAV6 capsid antigens is a protein or peptide.8. The method of claim 7 , wherein the protein or peptide has a sequence that is comprised in AAV6 VP1 claim 7 , VP2 or VP3 capsid protein.9. The method of any one of the preceding claims claim 7 , wherein the rAAV6 particle comprises a capsid protein comprising amino acid sequence of a serotype other than serotype 6.10. The method of any one of the preceding claims claim 7 , wherein the substituted amino acid at position 531 is glutamic acid claim 7 , aspartic acid claim 7 , histidine claim 7 , tyrosine claim 7 , arginine claim 7 , methionine claim 7 , or leucine.11. The method of claim 10 , wherein the substituted amino acid at position 531 is glutamic acid claim 10 , ...

COMPOSITIONS AND METHODS FOR STUDYING THE TAT GENE

Disclosed are compositions and methods for studying a Tat gene. Specifically, the disclosure provides a vector comprising a double-stranded nucleic acid construct which comprises a Tat gene and a green fluorescent protein (GFP) reporter element, and further wherein the double-stranded nucleic acid construct comprising AAVS1 (adeno-associated virus integration site, a safe harbor locus) arms that flank on both sides of the Tat gene and the reporter element for integration at the human AAVS1 site by homologus recombination. Further provided are methods of using a cell comprising the vector for studying the effects of exogenous conditions on expression of the Tat gene. 1. (canceled)2. A vector comprising a double-stranded nucleic acid construct , wherein the double-stranded nucleic acid construct comprises a first strand and a second strand ,wherein the first strand comprises from 5′ to 3′ a 5′ ARM sequence, a GADE sequence and a 3′ ARM sequence;wherein the second strand comprises from 5′ to 3′ a 3′ ARM sequence, a GARE sequence and a 5′ ARM sequence; andwherein the first strand is complementary to the second strand.3. The vector of claim 2 , wherein the GADE sequence comprises from 5′ to 3′ a transcriptional control element operably linked to one or more driver elements and a 3′UTR claim 2 , wherein the 3′UTR comprises a barcode sequence claim 2 , wherein the barcode sequence of the GADE sequence is complementary to a barcode sequence in the 3′ UTR of the GARE sequence.4. The vector of claim 2 , wherein the GARE sequence comprises from 5′ to 3′ a transcriptional control element operably linked to one or more reporter elements and a 3′UTR claim 2 , wherein the 3′UTR comprises a barcode sequence claim 2 , wherein the barcode sequence of the GARE sequence is complementary to a barcode sequence in the 3′ UTR of the GADE sequence.5. The vector of claim 2 , wherein the GADE and GARE sequences both comprise a barcode sequence claim 2 , wherein the barcode sequence of the ...

VARIANT AAV AND COMPOSITIONS, METHODS AND USES FOR GENE TRANSFER TO CELLS, ORGANS AND TISSUES

The invention relates to adeno-associated virus (AAV) serotype AAV-Rh74 and related AAV vectors, and AAV-Rh74 and related AAV vector mediated gene transfer methods and uses. In particular, AAV-Rh74 and related AAV vectors target polynucleotides to cells, tissues or organs for expression (transcription) of genes encoding therapeutic proteins and peptides, and polynucleotides that function as or are transcribed into inhibitory nucleic acid sequences. 1. An AAV capsid sequence , wherein the sequence has an amino acid substitution at any one of amino acid positions 195 , 199 , 201 or 202 , of RH74 VP1 capsid sequence (SEQ ID NO:1) , or an amino acid substitution of an arginine for a lysine in RH74 VP1 capsid sequence (SEQ ID NO:1).2. The AAV capsid sequence of claim 1 , wherein the residues correspond to an A claim 1 , V claim 1 , P or N amino acid at any one of amino acid positions 195 claim 1 , 199 claim 1 , 201 or 202 of RH74 VP1 capsid sequence (SEQ ID NO:1).3. The AAV capsid sequence of claim 1 , wherein the sequence has an A residue at amino acid position 195; a V residue at amino acid positions 199 claim 1 , a P residue at amino acid position 201 claim 1 , or an N residue at amino acid position 202 of RH74 VP1 capsid sequence (SEQ ID NO:1).4. The AAV capsid sequence of claim 1 , wherein the sequence has any two of an A residue at amino acid position 195; a V residue at amino acid positions 199 claim 1 , a P residue at amino acid position 201 claim 1 , or an N residue at amino acid position 202 of RH74 VP1 capsid sequence (SEQ ID NO:1).5. The AAV capsid sequence of claim 1 , wherein the sequence has any three of an A residue at amino acid position 195; a V residue at amino acid positions 199 claim 1 , a P residue at amino acid position 201 claim 1 , or an N residue at amino acid position 202 of RH74 VP1 capsid sequence (SEQ ID NO:1).6. The AAV capsid sequence of claim 1 , wherein the sequence has an A residue at amino acid position 195; a V residue at amino acid ...

ADENO-ASSOCIATED VIRUS (AAV) CLADES, SEQUENCES, VECTORS CONTAINING SAME, AND USES THEREFOR

Sequences of novel adeno-associated virus capsids and vectors and host cells containing these sequences are provided. Also described are methods of using such host cells and vectors in production of rAAV particles. AAV-mediated delivery of therapeutic and immunogenic genes using the vectors of the invention is also provided. 1. A recombinant nucleic acid molecule:(a) encoding an AAVhu37 vp1 capsid protein having a sequence comprising amino acids 1 to 738 of SEQ ID NO: 88; or(b) comprising nucleotides 1 to 2214 of SEQ ID NO: 10, or a nucleotide sequence at least 99% identical to nucleotides 1 to 2214 of SEQ ID NO: 10,wherein the recombinant nucleic acid molecule does not contain an AAV inverted terminal repeat.2. The recombinant nucleic acid molecule according to claim 1 , which further comprises a functional rep gene.3. The recombinant nucleic acid molecule according to claim 1 , wherein said recombinant nucleic acid molecule comprises a sequence selected from:vp1 , nt 1 to 2214;vp2, nt 412 to 2214; orvp3, nt 610 to 2214 of SEQ ID NO: 10.4. The recombinant nucleic acid molecule according to claim 1 , wherein said recombinant nucleic acid molecule is a plasmid.5. A host cell transfected with the recombinant nucleic acid molecule according to .6. The host cell according to claim 5 , which further comprises a functional rep gene claim 5 , a minigene comprising AAV inverted terminal repeats (ITRs) and a transgene claim 5 , and sufficient helper functions to permit packaging of the minigene into the AAV capsid.7. The host cell according to claim 6 , which further comprises a nucleic acid sequence(a) encoding an AAVhu37 vp2 capsid protein having a sequence comprising amino acids 138 to 738 of SEQ ID NO: 88; or(b) comprising nucleotides 412 to 2214 of SEQ ID NO: 10, or a nucleotide sequence at least 99% identical to nucleotides 412 to 2214 of SEQ ID NO: 10.8. The host cell according to claim 6 , which further comprises a nucleic acid sequence(a) encoding an AAVhu37 vp3 ...

RECOMBINANT AAV VARIANTS AND USES THEREOF

The disclosure in some aspects relates to recombinant adeno-associated viruses having distinct tissue targeting capabilities. In some aspects, the disclosure relates to gene transfer methods using the recombinant adeno-associated viruses. In some aspects, the disclosure relates to isolated AAV capsid proteins and isolated nucleic acids encoding the same. 1. A recombinant expression vector comprising a sequence selected from the group consisting of: SEQ ID NO: 1 to 47 , or a fragment thereof that does not encode a peptide that is identical to a sequence of any one of SEQ ID NOs: 98 to 100.2. An isolated AAV capsid protein comprising an amino acid sequence selected from the group consisting of: SEQ ID NOs: 51 to 97.3. An isolated AAV capsid protein comprising a sequence selected from the group consisting of: SEQ ID NOs: 51 to 61 , wherein an amino acid of the sequence that is not identical to a corresponding amino acid of the sequence set forth as SEQ ID NO: 98 is replaced with a conservative substitution.4. An isolated AAV capsid protein comprising a sequence selected from the group consisting of: SEQ ID NOs: 62 to 67 , wherein an amino acid of the sequence that is not identical to a corresponding amino acid of the sequence set forth as SEQ ID NO: 99 is replaced with a conservative substitution.5. An isolated AAV capsid protein comprising a sequence selected from the group consisting of: SEQ ID NOs: 68 to 97 , wherein an amino acid of the sequence that is not identical to a corresponding amino acid of the sequence set forth as SEQ ID NO: 100 is replaced with a conservative substitution.6. A peptide fragment of the isolated AAV capsid protein of any one of to that is not identical to a sequence of any one of SEQ ID NOs: 98 to 100.7. An isolated AAV capsid protein comprising the peptide fragment of .8. An recombinant expression vector comprising a nucleic acid sequence encoding the isolated AAV capsid protein of any one of to .9. A composition comprising the isolated ...

GENE THERAPEUTICS FOR TREATING BONE DISORDERS

In some aspects, the disclosure relates to compositions and methods for modulating (e.g., increasing and/or decreasing) bone mass in a subject. In some aspects, the disclosure provides isolated nucleic acids, and vectors such as rAAV vectors, configured to express transgenes that promote (e.g., increase) or inhibit (e.g., decrease) activity, differentiation, or function of certain types of bone cells, for example osteoblasts, osteoclasts, osteocytes, etc. In some embodiments, the isolated nucleic acids and vectors described by the disclosure are useful for treating disorders and conditions associated with increased bone mass (e.g., osteopetrosis) or decreased bone mass (e.g., osteoporosis). 1. An isolated nucleic acid encoding:(i) a first region comprising a first adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof; and,(ii) a second region comprising a transgene encoding at least one bone metabolism modulating agent.2. The isolated nucleic acid of claim 1 , wherein the bone metabolism modulating agent is a bone formation promoting agent claim 1 , optionally wherein the bone formation promoting agent is selected from the group consisting of a protein that promotes osteoblast and/or osteocyte function or activity claim 1 , a protein that inhibits osteoclast function claim 1 , and an inhibitory nucleic acid that inhibits osteoclast expression or activity.3. The isolated nucleic acid of claim 1 , wherein the bone metabolism modulating agent is a bone formation inhibiting agent claim 1 , optionally wherein the bone formation inhibiting agent is selected from the group consisting of a protein that inhibits osteoblast and/or osteocyte function or activity claim 1 , a protein that promotes osteoclast function or activity claim 1 , and an inhibitory nucleic acid that inhibits osteoblast expression or activity.4. The isolated nucleic acid of claim 2 , wherein the transgene encodes a bone formation promoting agent selected from the group ...

Method of detecting and/or identifying adeno-associated virus (aav) sequences and isolating novel sequences identified thereby

Adeno-associated virus rh.20 sequences, vectors containing same, and methods of use are provided.

Novel recombinant adeno-associated virus capsids with enhanced human pancreatic tropism

The present invention relates to variant AAV capsid polypeptides, wherein the variant AAV capsid polypeptides exhibit increased transduction and/or tropism in human pancreatic tissue or human islets as compared non-variant parent capsid polypeptides.

RECOMBINANT AAV VARIANTS AND USES THEREOF

The disclosure in some aspects relates to recombinant adeno-associated viruses having distinct tissue targeting capabilities. In some aspects, the disclosure relates to gene transfer methods using the recombinant adeno-associated viruses. In some aspects, the disclosure relates to isolated AAV capsid proteins and isolated nucleic acids encoding the same. 142.-. (canceled)43. A recombinant adeno-associated viral (rAAV) particle comprising an AAV capsid and at least one transgene , wherein the AAV capsid comprises a protein comprising an amino acid sequence selected from any one of SEQ ID NOs: 79 to 87.44. A composition comprising the rAAV particle of claim 43 , and a pharmaceutically acceptable carrier.45. A method for delivering a transgene to a subject comprising administering the rAAV particle of to the subject claim 43 , wherein the rAAV particle infects cells of a target tissue of the subject.46. The method of claim 45 , wherein the at least one transgene is a protein coding gene.47. The method of claim 45 , wherein the at least one transgene encodes a small interfering nucleic acid selected from a miRNA or an shRNA.48. The method of claim 45 , wherein the target tissue is skeletal muscle claim 45 , heart claim 45 , liver claim 45 , pancreas claim 45 , spleen claim 45 , brain claim 45 , or lung.49. The method of claim 45 , wherein the target tissue is heart tissue.50. The method of claim 45 , wherein the rAAV particle is administered intravenously claim 45 , transdermally claim 45 , intraocularly claim 45 , intrathecally claim 45 , orally claim 45 , intramuscularly claim 45 , subcutaneously claim 45 , intranasally claim 45 , or by inhalation.51. A method for generating a somatic transgenic non-human animal model comprising administering the rAAV particle of to a non-human animal claim 43 , wherein the rAAV particle infects cells of a target tissue of the non-human animal.52. A somatic transgenic non-human animal model produced by the method of .53. A recombinant ...

Adeno-associated virus (aav) clades, sequences, vectors containing same, and uses therefor

Sequences of novel adeno-associated virus capsids and vectors and host cells containing these sequences are provided. Also described are methods of using such host cells and vectors in production of rAAV particles. AAV-mediated delivery of therapeutic and immunogenic genes using the vectors of the invention is also provided.

VIRAL VECTOR FOR THE TARGETED TRANSFER OF GENES IN THE BRAIN AND SPINAL CORD

The invention relates to novel peptides, polypeptides or proteins which bind specifically to brain cells and/or to the spinal cord. The peptides, polypeptides, or proteins can be components of a viral capsid and can be used to lead a recombinant viral vector selectively to the brain and/or spinal cord after systemic administration to a subject and to ensure tissue-specific expression of one or more transgenes there. The invention also relates to a recombinant viral vector, preferably an AAV vector, which comprises a capsid containing at least one of the claimed peptides, polypeptides, or proteins and which comprises at least one transgene packaged in the capsid. Said viral vector can be used, in particular for the therapeutic treatment of a disease or disorder of the brain and/or spinal cord. The invention further relates to cells and pharmaceutical compositions that comprise the viral vector according to the invention. 1. A peptide , polypeptide , or protein that specifically binds to cells of the brain and/or spinal cord , characterized in that it comprises the following:(a) the amino acid sequence of SEQ ID NO: 1,(b) an amino acid sequence which differs from the amino acid sequence of SEQ ID NO:1 by modification of one amino acid, or(c) the amino acid sequence of SEQ ID NO:6.2. (canceled)3. A peptide claim 12 , polypeptide claim 12 , or protein according to that specifically binds to cells of the brain and/or spinal cord claim 12 , characterized in that it comprisesone of the amino acid sequences of SEQ ID NO:2-5.4. The protein according to claim 1 , which is a capsid protein of a viral vector claim 1 , preferably a capsid protein of an adeno-associated virus (AAV).5. The protein according to claim 4 , which is a capsid protein of an AAV of a serotype selected from the group consisting of serotypes 2 claim 4 , 4 claim 4 , 6 claim 4 , 8 claim 4 , and 9.6. The protein according to claim 5 , which is a capsid protein of an AAV of serotype 2.7. The protein according ...

METHOD OF DETECTING AND/OR IDENTIFYING ADENO-ASSOCIATED VIRUS (AAV) SEQUENCES AND ISOLATING NOVEL SEQUENCES IDENTIFIED THEREBY

Adeno-associated virus rh.10 sequences, vectors containing same, and methods of use are provided. 1. A method for delivering a transgene product to a subject , said method comprising administering an adeno-associated virus (AAV) comprising an AAV capsid comprising vp1 , vp2 and vp3 proteins , said vp3 having the amino acid sequence of 204 to 738 of SEQ ID NO: 81 or an AAV vp3 protein having a sequence at least 95% identical to the full length amino acid sequence of 204 to 738 of SEQ ID NO: 81 , said AAV having packaged in the capsid a nucleic acid molecule comprising at least one AAV inverted terminal repeat (ITR) and a non-AAV nucleic acid sequence which encodes a gene product operably linked to sequences which direct expression thereof in a host cell.2. The method according to claim 1 , wherein the AAVrh10 capsid comprises vp1 proteins having an amino acid sequence of about amino acids 1 to 738 of SEQ ID NO:81.3. The method according to claim 1 , wherein the sequence is at least 97% identical to the vp1 and/or vp3 of SEQ ID NO: 814. The method according to claim 1 , wherein the sequence is at least 99% identical to the vp1 and/or vp3 of SEQ ID NO: 81.5. The method according to claim 1 , wherein the vp2 protein has an amino acid sequence of about amino acids 138 to 738 of SEQ ID NO:81.6. The method according to claim 1 , wherein the gene product is a vascular endothelial growth factor (VEGF).7. The method according to claim 1 , wherein the gene product is selected from β-glucuronidase (GUSB) and alpha-1 antitrypsin (A1AT).8. The method according to claim 1 , wherein the gene product is a factor IX protein.9. The method according to claim 1 , wherein the gene product is a factor VIII protein.10. The method according to claim 1 , wherein the gene product is erythropoietin.11. An isolated capsid protein comprising an AAVrh10 protein selected from the group consisting of:vp1 capsid protein, amino acids (aa) 1 to 738 of SEQ ID NO: 81;vp2 capsid protein, aa 138 to 738 of ...

CELL CULTURE METHODS INVOLVING HDAC INHIBITORS OR REP PROTEINS

The invention relates to methods of culturing cells, generating cell lines, and delivering polynucleotides to cells involving the use of HDAC inhibitors and/or adeno-associated virus (AAV) rep proteins. 1. A method of increasing recombinant AAV (rAAV) vector titer , the method comprising:a) co-delivering a rAAV vector with a rep mRNA to a eukaryotic cell culture; andb) harvesting rAAV from the eukaryotic cell culture, wherein the co-delivery with the rep mRNA increases the titer of the harvested rAAV.2. The method of claim 1 , wherein the rep mRNA is selected from the group consisting of rep68 mRNA and rep78 mRNA.3. The method of claim 1 , wherein the co-delivering comprises electroporation.4. The method of claim 1 , wherein the co-delivering involves magnetic beads.5. The method of claim 1 , wherein the co-delivering involves nanoparticles.6. The method of claim 1 , wherein the co-delivering comprises microinjection.7. The method of claim 1 , wherein the co-delivering comprises cell squeezing.8. The method of claim 1 , wherein the co-delivering comprises chemical-based transfection.9. The method of claim 8 , wherein the chemical-based transfection comprises exposure to lipids.10. The method of claim 8 , wherein the chemical-based transfection comprises exposure to calcium phosphate.11. The method of claim 8 , wherein the chemical-based transfection comprises exposure to cationic polymers.12. The method of claim 8 , wherein the chemical-based transfection comprises exposure to DEAE-dextran.13. The method of claim 8 , wherein the chemical-based transfection comprises exposure to activated dendrimers.14. A method of developing a cell line for producing recombinant AAV (rAAV) claim 8 , the method comprising:a) co-delivering a rAAV vector with a rep mRNA to a eukaryotic cell;b) identifying a eukaryotic cell that contains the rAAV vector sequence integrated into the eukaryotic cell genome; andc) optionally harvesting rAAV from a culture comprising the eukaryotic cell, ...

LIVER TROPIC RECOMBINANT AAV6 VECTORS THAT EVADE NEUTRALIZATION

As demonstrated herein, a modified recombinant AAV6 vector is provided that transduces the liver and has reduced neutralization of transduction of liver by ADK6 antibody. Accordingly, embodiments of the invention relate to liver tropic rAAV6 vectors that evade neutralization. 1. A modified recombinant AAV6 vector comprising an amino acid substitution at one or more amino acid residues selected from the group consisting of 5264 , G266 , N269 , H272 , Q457 , S588 and T589 corresponding to AAV6 VP1 numbering , wherein the rAAV6 vector transduces the liver and has reduced neutralization of transduction of liver by ADK6 antibody as compared to the rAAV6 vector lacking the one or more substitutions.2. The modified AAV6 vector of claim 1 , further comprising a lysine (K) or arginine (R) at an amino acid site corresponding to amino acid 531 of AAV6 VP1.3. The modified AAV6 vector of comprising a K at amino acid 531.4. The modified AAV6 vector of claim 2 , comprising a R at amino acid 531.5. The modified AAV6 vector of any of - claim 2 , wherein at least two of the one or more amino acids are substituted.6. The modified AAV6 vector of any of - claim 2 , wherein at least three of the one or more amino acids are substituted.7. The modified AAV6 vector of any of - claim 2 , wherein at least four of the one or more amino acids are substituted.8. The modified AAV6 vector of any of - claim 2 , wherein at least five of the one or more amino acids are substituted.9. The modified AAV6 vector of any of - claim 2 , wherein at least six of the one or more amino acids are substituted.10. The modified AAV6 vector of any of - claim 2 , wherein at least seven of the one or more amino acids are substituted.11. The modified AAV6 vector of any of - wherein the one or more substitutions comprise conserved substitutions.12. The modified AAV6 vector of any of - wherein the one or more substitutions comprise non-conserved substitutions.13. The modified rAAV6 vector of any of - claim 2 , further ...

Compositions and methods for transient delivery of nucleases

The disclosure in some aspects relates to recombinant adeno-associated viruses having nuclease grafted to one or more capsid proteins. In some aspects, the disclosure relates to isolated AAV capsid proteins having terminally grafted nucleases and isolated nucleic acids encoding the same. Recent approaches to delivering nucleases to cells for gene editing have focused on delivering of expression vectors engineered to express the nucleases in target cells. However, these approaches have proved to be problematic in many instances due to genotoxicity resulting from to prolonged expression of gene editing system in vivo. To prevent such off-target genotoxicity due to prolonged presence of a gene editing system, several studies explored delivery of mRNA or protein instead of delivering the gene coding for the nucleases in cell culture.

ADENO-ASSOCIATED VIRUS VIRIONS WITH VARIANT CAPSID AND METHODS OF USE THEREOF

The present disclosure provides adeno-associated virus (AAV) virions with altered capsid protein, where the AAV virions exhibit greater infectivity of retinal cells compared to wild-type AAV. The present disclosure further provides methods of delivering a gene product to a retinal cell in an individual, and methods of treating ocular disease. 1. A recombinant adeno-associated virus (rAAV) virion comprising:a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises an amino acid substitution at amino acids 319, 451, and 532 of the AAV6 capsid sequence as set forth in SEQ ID NO:1, or the corresponding positions in another AAV parental serotype, wherein the variant capsid protein confers increased infectivity of a retinal cell compared to the infectivity of the retinal cell by an AAV virion comprising a wild-type AAV capsid protein, and wherein the variant AAV capsid protein does not comprise an amino acid sequence present in a naturally occurring AAV capsid protein; andb) a heterologous nucleic acid comprising a nucleotide sequence encoding a gene product.2. The rAAV virion of claim 1 , wherein the retinal cell is a Müller glial cell.3. The rAAV virion of claim 1 , wherein the rAAV virion exhibits at least 5-fold increased infectivity of a retinal cell compared to the infectivity of the retinal cell by an AAV virion comprising the corresponding parental AAV capsid protein.4. The rAAV virion of claim 1 , wherein the rAAV virion exhibits at least 50-fold increased infectivity of a retinal cell compared to the infectivity of the retinal cell by an AAV virion comprising the corresponding parental AAV capsid protein.5. The rAAV virion of claim 1 , wherein gene product is a nucleic acid gene product.6. The rAAV virion of claim 5 , wherein the nucleic acid gene product is an interfering RNA claim 5 , a ribozyme claim 5 , an antisense nucleic acid claim 5 , or an aptamer.7. The rAAV virion of claim 1 , wherein the gene product is a polypeptide.8. The ...

Codon optimized rep1 genes and uses thereof

The present disclosure provides codon optimized nucleotide sequences encoding human REP1, vectors, and host cells comprising codon optimized REP1 sequences, and methods of treating retinal disorders such as choroideremia comprising administering to the subject a codon optimized sequence encoding human REP1.

RECOMBINANT ADENO-ASSOCIATED VIRUS VECTORS

AAV capsid proteins comprising a modification in the amino acid sequence and virus vectors comprising the modified AAV capsid protein are described. Also described are methods of administering the virus vectors and virus capsids to a cell or to a subject in vivo. 1. An adeno-associated virus (AAV) vector comprising (i) a recombinant capsid protein and (ii) a cargo nucleic acid encapsidated by the capsid protein , wherein the capsid protein comprises a peptide having the sequence of any one of SEQ ID NO: 12-20.2. The AAV vector of claim 1 , wherein the cargo nucleic acid comprises 5′ and 3′ AAV inverted terminal repeats.3. The AAV vector of or claim 1 , wherein the cargo nucleic acid comprises a transgene.4. The AAV vector of claim 3 , wherein the transgene encodes a therapeutic protein or RNA.5. The AAV vector of any one of - claim 3 , wherein the recombinant capsid protein has at least 90% claim 3 , at least 95% claim 3 , at least 96% claim 3 , at least 97% claim 3 , at least 98% claim 3 , or at least 99% sequence identity to the native sequence of the AAV1 claim 3 , AAV2 claim 3 , AAV3 claim 3 , AAV4 claim 3 , AAV5 claim 3 , AAV6 claim 3 , AAV7 claim 3 , AAV8 claim 3 , AAV9 claim 3 , AAV10 claim 3 , AAV11 claim 3 , AAV12 claim 3 , AAVrh.8 claim 3 , AAVrh.10 claim 3 , AAVrh32.33 claim 3 , AAVrh74 claim 3 , bovine AAV or avian AAV capsid.6. The AAV vector of claim 5 , wherein the recombinant capsid protein has at least 90% sequence identity to the native sequence of the AAV9 capsid.7. The AAV vector of any one of - claim 5 , wherein the peptide is located at the amino acid positions corresponding to amino acids 451-458 of the native AAV9 capsid claim 5 , or the equivalent amino acid residues in AAV1 claim 5 , AAV2 claim 5 , AAV3 claim 5 , AAV4 claim 5 , AAV5 claim 5 , AAV6 claim 5 , AAV7 claim 5 , AAV8 claim 5 , AAV10 claim 5 , AAV11 claim 5 , AAV12 claim 5 , AAVrh.8 claim 5 , AAVrh.10 claim 5 , AAVrh32.33 claim 5 , AAVrh74 claim 5 , bovine AAV or avian AAV claim 5 ...

METHODS AND COMPOSITIONS FOR ANTIBODY-EVADING VIRUS VECTORS

The present invention provides AAV capsid proteins comprising a modification in the amino acid sequence and virus vectors comprising the modified AAV capsid protein. The invention also provides methods of administering the virus vectors and virus capsids of the invention to a cell or to a subject in vivo. 1. An adeno associated virus (AAV) capsid protein , comprising one or more amino acid substitutions , wherein the one or more substitutions modify one or more antigenic sites on the AAV capsid protein.2. The AAV capsid protein of claim 1 , wherein the modification of the one or more antigenic sites results in inhibition of binding by an antibody to the one or more antigenic sites and/or inhibition of neutralization of infectivity of a virus particle comprising said AAV capsid protein.3207-. (canceled) This application claims the benefit, under 35 U.S.C. § 119 (e), of U.S. Provisional Application No. 62/234,016, filed Sep. 28, 2015, the entire contents of which are incorporated by reference herein.This invention was made with government funding under Grant Nos. HL112761, HL089221 and GM082946 awarded by the National Institutes of Health. The government has certain rights in the invention.The present invention relates to modified capsid proteins from adeno-associated virus (AAV) and virus capsids and virus vectors comprising the same. In particular, the invention relates to modified AAV capsid proteins and capsids comprising the same that can be incorporated into virus vectors to confer a phenotype of evasion of neutralizing antibodies without decreased transduction efficiency.Host-derived pre-existing antibodies generated upon natural encounter of AAV or recombinant AAV vectors prevent first time as well as repeat administration of AAV vectors as vaccines and/or for gene therapy. Serological studies reveal a high prevalence of antibodies in the human population worldwide with about 67% of people having antibodies against AAV1, 72% against AAV2, and about 40% against ...

ANTI-ANGIOGENIC MIRNA THERAPEUTICS FOR INHIBITING CORNEAL NEOVASCULARIZATION

The disclosure relates, in some aspects, to compositions and methods for treating corneal disease (e.g., corneal neovascularization. In some embodiments, the disclosure relates to rAAV-mediated delivery of an cornea-associated transgene to a subject. In some embodiments, the rAAV transduces the corneal tissue of a subject. 1. A method for delivering a transgene to ocular tissue , the method comprising:administering to ocular tissue of a subject an effective amount of rAAV, wherein the rAAV comprises (i) a capsid protein having a serotype selected from the group consisting of AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAVrh.10, AAVrh.39, and AAVrh.43, and (ii) a nucleic acid comprising a promoter operably linked to a transgene.2. The method of claim 1 , wherein the capsid protein comprises an amino acid sequence that is at least 70% claim 1 , at least 80% claim 1 , at least 90% claim 1 , at least 95% claim 1 , or at least 99% identical to any one of SEQ ID NO: 7-16.3. The method of or claim 1 , wherein the capsid protein comprises an amino acid sequence as set forth in SEQ ID NO: 14 or SEQ ID NO: 15.4. The method of any one of to claim 1 , wherein the capsid protein is AAVrh.10 capsid protein (SEQ ID NO: 14) or AAVrh.39 capsid protein (SEQ ID NO: 15).5. The method of any one of to claim 1 , wherein the transgene encodes a gene associated with an ocular disease.6. The method of claim 5 , wherein the ocular disease is selected from corneal neovascularization claim 5 , corneal dystrophy claim 5 , corneal inflammation claim 5 , and corneal fibrosis.7. The method of or claim 5 , wherein the gene encodes a miRNA claim 5 , an antagomir claim 5 , or a miRNA mimic.8. The method of claim 7 , wherein the gene encodes a miRNA claim 7 , optionally a TuD miRNA or a pri miRNA.9. The method of or claim 7 , wherein the transgene comprises a region of complementarity to a sequence selected from the group consisting of SEQ ID NO: 1 claim 7 , 2 claim 7 , 3 claim 7 , 27 claim 7 , 28 claim 7 , ...

ENHANCED AAV-MEDIATED GENE TRANSFER FOR RETINAL THERAPIES

Described herein are capsid proteins and adeno-associated viruses capable of targeting various types of ocular cells including bipolar and horizontal cells. Also described herein are methods of treating various ocular disorders in a subject in need thereof by administering to the subject an effective concentration of a composition comprising the recombinant adeno-associated virus (AAV) of the invention. 1. A recombinant AAV capsid protein characterized by a mutation in aa 587-595 as compared to the wild type AAV8 vp1 capsid sequence , or a mutation in the analogous region of another AAV capsid as compared to the corresponding AAV wild type capsid sequence.2. The capsid protein of claim 1 , wherein the wild type sequence is an AAV8 capsid sequence.3. The capsid protein of claim 1 , wherein the capsid is the vp1 claim 1 , vp2 or vp3 capsid protein.4. A nucleic acid sequence encoding the recombinant AAV capsid protein of .5. A recombinant AAV capsid protein comprising SEQ ID NO: 1 or SEQ ID NO: 2.6. An adeno-associated virus (AAV) having a recombinant AAV capsid comprising a mutation in aa 587-595 of the AAV8 capsid protein sequence as compared to the AAV8 wild type capsid sequence or a mutation in a corresponding region of another AAV capsid protein as compared to the corresponding wild type capsid sequence claim 1 , further comprising a minigene comprising AAV inverted terminal repeats and a heterologous nucleic acid sequence operably linked to regulatory sequences which direct expression of a product encoded by the heterologous nucleic acid sequence in a target cell.7. The AAV according to claim 6 , wherein the AAV capsid comprises the sequence of SEQ ID NO: 1 or SEQ ID NO: 2.8. The AAV according to claim 7 , wherein the product encoded by the heterologous nucleic acid sequence is an opsin selected from rhodopsin claim 7 , photopsin claim 7 , L/M wavelength opsin (red/green)-opsin claim 7 , short wavelength (S) opsin (blue) claim 7 , channelrhodopsin and ...

METHODS OF PREDICTING ANCESTRAL VIRUS SEQUENCES AND USES THEREOF

Methods are described for predicting ancestral sequences for viruses or portions thereof. Also described are predicted ancestral sequences for adeno-associated virus (AAV) capsid polypeptides. The disclosure also provides methods of gene transfer and methods of vaccinating subjects by administering a target antigen operably linked to the AAV capsid polypeptides. 1. An adeno-associated virus (AAV) capsid polypeptide having at least 95% sequence identity to the amino acid sequence shown in SEQ ID NOs: 23.2. The AAV capsid polypeptide of claim 1 , wherein the AAV capsid polypeptide or a virus particle comprising the AAV capsid polypeptide:exhibits a lower seroprevalence than does an AAV2 capsid polypeptide or a virus particle comprising an AAV2 capsid polypeptide, and wherein the AAV capsid polypeptide or a virus particle comprising the AAV capsid polypeptide exhibit about the same or a lower seroprevalence than does an AAV8 capsid polypeptide or a virus particle comprising an AAV8 capsid polypeptide; and/orare neutralized to a lesser extent by human serum than is an AAV2 capsid polypeptide or a virus particle comprising an AAV2 capsid polypeptide, and wherein the AAV capsid polypeptide or a virus particle comprising the AAV capsid polypeptide is neutralized to a similar or lesser extent by human serum as is an AAV8 capsid polypeptide or a virus particle comprising an AAV8 capsid polypeptide.3. The AAV capsid polypeptide of claim 1 , wherein the AAV capsid polypeptide is purified.4. The AAV capsid polypeptide of claim 1 , wherein the polypeptide has at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 23.5. The AAV capsid polypeptide of claim 1 , wherein the polypeptide has 100% sequence identity to the amino acid sequence shown in SEQ ID NO: 23.6. A virus particle comprising at least one of the AAV capsid polypeptides of .7. The virus particle of claim 6 , further comprising a transgene. This application is a Divisional application of, and ...

ADENO-ASSOCIATED VIRUS (AAV) CLADES, SEQUENCES, VECTORS CONTAINING SAME, AND USES THEREFOR

Sequences of novel adeno-associated virus capsids and vectors and host cells containing these sequences are provided. Also described are methods of using such host cells and vectors in production of rAAV particles. AAV-mediated delivery of therapeutic and immunogenic genes using the vectors of the invention is also provided. 1. A recombinant nucleic acid molecule:(a) encoding an AAV9 vp1 capsid protein having a sequence comprising amino acids 1 to 736 of SEQ ID NO: 123; or(b) comprising nucleotides 1 to 2208 of SEQ ID NO: 3, or a nucleotide sequence at least 99% identical to nucleotides 1 to 2208 of SEQ ID NO: 3,wherein the recombinant nucleic acid molecule does not contain an AAV inverted terminal repeat.2. The recombinant nucleic acid molecule according to claim 1 , which further comprises a functional rep gene.3. The recombinant nucleic acid molecule according to claim 1 , wherein said recombinant nucleic acid molecule comprises a sequence selected from:vp1, nt 1 to 2208;vp2, nt 412 to 2208; orvp3, nt 607 to 2208 of SEQ ID NO: 3.4. The recombinant nucleic acid molecule according to claim 1 , wherein said recombinant nucleic acid molecule is a plasmid.5. A host cell transfected with the recombinant nucleic acid molecule according to .6. The host cell according to claim 5 , which further comprises a functional rep gene claim 5 , a minigene comprising AAV inverted terminal repeats (ITRs) and a transgene claim 5 , and sufficient helper functions to permit packaging of the minigene into the AAV capsid.7. The host cell according to claim 6 , which further comprises a nucleic acid sequence(a) encoding an AAV9 vp2 capsid protein having a sequence comprising amino acids 138 to 736 of SEQ ID NO: 123; or(b) comprising nucleotides 412 to 2208 of SEQ ID NO: 3, or a nucleotide sequence at least 99% identical to nucleotides 412 to 2208 of SEQ ID NO: 3.8. The host cell according to claim 6 , which further comprises a nucleic acid sequence(a) encoding an AAV9 vp3 capsid protein ...

METHODS OF PREDICTING ANCESTRAL VIRUS SEQUENCES AND USES THEREOF

Methods are described for predicting ancestral sequences for viruses or portions thereof. Also described are predicted ancestral sequences for adeno-associated virus (AAV) capsid polypeptides. The disclosure also provides methods of gene transfer and methods of vaccinating subjects by administering a target antigen operably linked to the AAV capsid polypeptides. 1. An adeno-associated virus (AAV) capsid polypeptide having the amino acid sequence shown in SEQ ID NO: 15.2. The AAV capsid polypeptide of claim 1 , wherein the AAV capsid polypeptide or a virus particle comprising the AAV capsid polypeptide:exhibits a lower seroprevalence than does an AAV2 capsid polypeptide or a virus particle comprising an AAV2 capsid polypeptide, and wherein the AAV capsid polypeptide or a virus particle comprising the AAV capsid polypeptide exhibits about the same or a lower seroprevalence than does an AAV8 capsid polypeptide or a virus particle comprising an AAV8 capsid polypeptide; and/oris neutralized to a lesser extent by human serum than is an AAV2 capsid polypeptide or a virus particle comprising an AAV2 capsid polypeptide, and wherein the AAV capsid polypeptide or a virus particle comprising the AAV capsid polypeptide is neutralized to a similar or lesser extent by human serum than is an AAV8 capsid polypeptide or a virus particle comprising an AAV8 capsid polypeptide.3. The AAV capsid polypeptide of claim 1 , wherein the AAV capsid polypeptide is purified.4. The AAV capsid polypeptide of claim 1 , encoded by the nucleic acid sequence shown in SEQ ID NO: 16.5. A nucleic acid molecule encoding an adeno-associated virus (AAV) capsid polypeptide having the nucleic acid sequence shown in SEQ ID NO: 16.6. A vector comprising the nucleic acid molecule of .7. An isolated host cell comprising the vector of .8. A purified virus particle comprising the AAV capsid polypeptide of .9. The purified virus particle of claim 8 , further comprising a transgene. This application is a Divisional ...

METHOD OF INCREASING THE FUNCTION OF AN AAV VECTOR

A method of correcting singletons in a selected AAV sequence in order to increasing the packaging yield, transduction efficiency, and/or gene transfer efficiency of the selected AAV is provided. This method involves altering one or more singletons in the parental AAV capsid to conform the singleton to the amino acid in the corresponding position(s) of the aligned functional AAV capsid sequences. 1. (canceled)2. A recombinant adeno-associated virus (AAV) having an AAV capsid comprising Clade E vp1 capsid proteins having the amino acid sequence of 1 to 738 of SEQ ID NO:43 with a R697W modification or an amino acid sequence having at least 97% identity thereto , Clade E vp2 proteins and Clade E vp3 proteins , wherein said recombinant further comprises , packaged within the capsid , a nucleic acid molecule comprising at least one AAV inverted terminal repeat (ITR) and a non-AAV nucleic acid sequence encoding an enzyme operably linked to sequences which direct expression of the enzyme in a host cell.3. The recombinant AAV of in which the enzyme comprises ornithine transcarbamylase claim 2 , arginosuccinate synthetase claim 2 , arginosuccinate lyase claim 2 , arginase claim 2 , fumarylacetacetate hydrolase claim 2 , carbamoyl phosphate synthetase I claim 2 , branched chain ketoacid decarboxylase claim 2 , isovaleryl-coA dehydrogenase claim 2 , propionyl-CoA carboxylase claim 2 , methylmalonyl-CoA mutase claim 2 , glutaryl-CoA dehydrogenase (GCDH) claim 2 , pyruvate carboxylate claim 2 , hepatic phosphorylase claim 2 , phosphorylase kinase claim 2 , or glycine decarboxylase.4. The recombinant AAV of or in which the ITRs are from AAV2.5. A recombinant adeno-associated virus (AAV) comprising Clade E vp1 capsid proteins claim 2 , Clade E vp2 capsid proteins having the amino acid sequence of 138 to 738 of SEQ ID NO:43 with a R697W modification or an amino acid sequence having at least 97% identity thereto and Clade E vp3 capsid proteins wherein said recombinant further ...

MODIFIED AAV CAPSID PROTEINS AND USES THEREOF

Adeno associated viral (AAV) particles are emerging as a useful vehicle for gene delivery to various organs and tissues, one of them being the retina. Provided here are variant AAV (e.g., variant serotype 2 (AAV2)) capsid proteins and variant capsid protein containing particles with enhanced ability to transduce retinal cells. 172-. (canceled)74. The rAAV capsid protein of claim 73 , comprising (a) phenylalanine (F) claim 73 , serine (S) claim 73 , aspartic acid (D) claim 73 , isoleucine (I) claim 73 , aspartic acid (D) claim 73 , asparagine (N) claim 73 , methionine (M) claim 73 , alanine (A) claim 73 , aspartic acid (D) claim 73 , phenylalanine (F) claim 73 , aspartic acid (D) claim 73 , and glycine (G) at positions corresponding to amino acids 444 claim 73 , 450 claim 73 , 451 claim 73 , 454 claim 73 , 455 claim 73 , 459 claim 73 , 461 claim 73 , 492 claim 73 , 499 claim 73 , 500 claim 73 , 530 claim 73 , and 531 of AAV2 VP1 capsid protein claim 73 , respectively.75. The rAAV capsid protein of further comprising asparagine (N) and alanine (A) at positions corresponding to amino acids 263 and 264 of AAV2 VP1 capsid protein claim 74 , respectively.76. The rAAV capsid protein of claim 73 , comprising (b) phenylalanine (F) claim 73 , aspartic acid (D) claim 73 , serine (S) claim 73 , methionine (M) claim 73 , threonine (T) claim 73 , arginine (R) claim 73 , valine (V) claim 73 , phenylalanine (F) claim 73 , and aspartic acid (D) at positions corresponding to amino acids 444 claim 73 , 450 claim 73 , 454 claim 73 , 457 claim 73 , 459 claim 73 , 461 claim 73 , 491 claim 73 , 500 claim 73 , and 531 of AAV2 VP1 capsid protein claim 73 , respectively.77. The rAAV capsid protein of further comprising alanine (A) at positions corresponding to amino acids 263 and 264 of AAV2 VP1 capsid protein.78. The rAAV capsid protein of further comprising aspartic acid (D) claim 76 , glycine (G) claim 76 , and glutamic acid (E) at positions corresponding to amino acids 492 claim 76 , 493 ...

NOVEL ADENO-ASSOCIATED VIRUS (AAV) CLADE F VECTOR AND USES THEREFOR

A recombinant adeno-associated virus (rAAV) vector comprising an AAVhu68 capsid produced in a production system comprising a nucleotide sequence of SEQ ID NO: 1, or a sequence at least 75% identical thereto which encodes SEQ ID NO:2. The AAVhu68 capsid comprises subpopulations of highly deamidated asparagine residues in asparagine glycine pairs in the amino acid sequence of SEQ ID NO: 2. Also provided are compositions containing the rAAV and uses thereof. Additionally, rAAV having an engineered AAV capsid comprising at least one subpopulation of vp1 or vp2 proteins having a Val at amino acid position 157 with reference to the AAVhu68 vp1 numbering are provided. 1. A recombinant adeno-associated virus (rAAV) which comprises: [ a heterogenous population of AAVhu68 vp1 proteins selected from: vp1 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 736 of SEQ ID NO:2, vp1 proteins produced from SEQ ID NO:1, or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO:1 which encodes the predicted amino acid sequence of 1 to 736 of SEQ ID NO:2,', 'a heterogenous population of AAVhu68 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ NO:2, vp2 proteins produced from a sequence comprising at least nucleotides 411 to 2211 of SEQ ID NO:1, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 411 to 2211 of SEQ ID NO:1 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO:2, and', 'a heterogenous population of AAVhu68 vp3 proteins selected from: vp3 produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO:2, vp3 proteins produced from a sequence comprising at ...

COMPOSITIONS AND METHODS FOR INTRAVITREAL DELIVERY OF POLYNUCLEOTIDES TO RETINAL CONES

Methods and compositions are provided for intravitreally delivering a polynucleotide to cone photoreceptors. Aspects of the methods include injecting a recombinant adeno-associated virus comprising a polynucleotide of interest into the vitreous of the eye. These methods and compositions find particular use in treating ocular disorders associated with cone dysfunction and/or death. 1. A method for delivering a polynucleotide of interest to a cone photoreceptor in a subject , the method comprising:delivering into the vitreous of the eye an effective amount of recombinant adeno-associated virus (rAAV) variant comprising the polynucleotide of interest.2. The method according to claim 1 , wherein the rAAV variant comprises a variant AAV capsid protein comprising an insertion of an amino acid peptide in the GH loop of the parental AAV capsid protein.3. The method according to claim 2 , wherein the GH loop of the parental capsid protein consists essentially of amino acids 571-612 of AAV1 VP1 (SEQ ID NO:1) claim 2 , about amino acids 570-611 of AAV2 VP1 (SEQ ID NO:2) claim 2 , about amino acids 571-612 of AAV3 VP1 (SEQ ID NO:3) claim 2 , about amino acids 569-610 of AAV4 VP1 (SEQ ID NO:4) claim 2 , about amino acids 560-601 of AAV5 VP1 (SEQ ID NO:5) claim 2 , about amino acids 571 to 612 of AAV6 VP1 (SEQ ID NO:6) claim 2 , about amino acids 572 to 613 of AAV7 VP1 (SEQ ID NO:7) claim 2 , about amino acids 573 to 614 of AAV8 VP1 (SEQ ID NO:8) claim 2 , about amino acids 571 to 612 of AAV9 VP1 (SEQ ID NO:9) claim 2 , about amino acids 573 to 614 of AAV10 VP1 (SEQ ID NO:10); or the corresponding amino acid range of a variant thereof.4. The method according to claim 2 , wherein the parental capsid is AAV2 VP1 claim 2 , wherein the insertion site is between amino acids 580 and 581 claim 2 , amino acids 581 and 582 claim 2 , amino acids 582 and 583 claim 2 , amino acids 583 and 584 claim 2 , amino acids 584 and 585 claim 2 , amino acids 585 and 586 claim 2 , amino acids 586 and ...

MUTATED STRUCTURAL PROTEIN OF A PARVOVIRUS

The present invention is related to a structural protein of a parvovirus with an amino acid insertion at the insertion site I-453, a library comprising the protein, a multimeric structure comprising the protein, a nucleic acid encoding the protein, a vector, virus or cell comprising the nucleic acid, a process for the preparation of the protein, a medicament comprising the protein, nucleic acid or multimeric structure as well as methods and uses involving the protein, nucleic acid or multimeric structure. 151-. (canceled)52parvovirus. A method for vaccinating a mammal , the method comprising administering to the mammal a structural protein of a which comprises an amino acid insertion of one or more amino acids into I-453.53parvovirus.. The method of claim 52 , wherein the amino acid insertion is directly C-terminal to amino acid Gin the sequence of AAV-2 or the corresponding amino acid of any other54. The method of claim 52 , wherein the insertion is located on the surface of the capsid formed by the structural protein.55. The method of claim 52 , wherein the structural protein with the insertion is capable of particle formation.56parvovirus. The method of claim 52 , wherein the is an adeno-associated virus.57parvovirusparvovirusparvovirus. The method of claim 52 , wherein the is selected from the group consisting of AAV-1 claim 52 , AAV-2 claim 52 , AAV-3b claim 52 , AAV-4 claim 52 , AAV-5 claim 52 , AAV-6 claim 52 , AAV-7 claim 52 , AAV-8 claim 52 , AAV-9 claim 52 , AAV-10 claim 52 , AAV-11 claim 52 , AAV-12 claim 52 , b-AAV claim 52 , feline panleukopenia virus (FPV) claim 52 , canine (CPV) claim 52 , B19 claim 52 , goose (GPV) and minute virus of mice (MVM).58. The method of claim 52 , wherein the amino acid insertion has a length of about 4 to about 30 amino acids.59. The method of claim 52 , wherein the amino acid insertion is selected from the group consisting of an epitope claim 52 , a B-cell epitope claim 52 , and a tolerogen-derived epitope.60. The method ...

ADENO-ASSOCIATED VIRUS VARIANTS AND METHODS OF USE THEREOF

The present disclosure provides recombinant adeno-associated virus (rAAV) virions comprising a variant AAV capsid protein, e.g., an AAV capsid protein derived from an ancestral AAV capsid protein amino acid sequence. An rAAV virion of the present disclosure can exhibit greater infectivity of a target cell. The present disclosure also provides methods of delivering a gene product to a target cell in an individual by administering to the individual an rAAV of the present disclosure. The present disclosure also provides methods of generating rAAV virions that have a variant AAV capsid protein derived from an ancestral AAV capsid protein amino acid sequence. 1. A recombinant adeno-associated virus (rAAV) virion comprising:a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises an amino acid sequence having at least 95% amino acid sequence identity to the sequence set forth in SEQ ID NO: 16, wherein the amino acids at positions 264, 448, 459, 470, 495, 533, 547, 555, 557, 561, 563, 593, 596, 661, 662, 664, 718 and 723 are A, A, N, S, S, D, E, A, E, L, N, A, A, A, T, T, N and S, respectively; Q, S, N, A, S, E, Q, T, D, M, S, Q, T, A, V, S, S and S, respectively; or A, A, T, S, T, D, Q, A, D, I, N, A, T, T, V, S, S and T, respectively; andb) a heterologous nucleic acid comprising a nucleotide sequence encoding a gene product.2. A recombinant adeno-associated virus (rAAV) virion comprising:a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises an amino acid sequence having at least 95% amino acid sequence identity to the sequence set forth in SEQ ID NO: 13; andb) a heterologous nucleic acid comprising a nucleotide sequence encoding a gene product.3. A recombinant adeno-associated virus (rAAV) virion comprising:a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises an amino acid sequence having at least 95% amino acid sequence identity to the sequence set forth in SEQ ID NO: 14; andb) a ...

ADENO-ASSOCIATED VIRUS VARIANT CAPSIDS AND METHODS OF USE THEREOF

Provided herein are variant adeno-associated virus (AAV) capsid proteins having one or more modifications in amino acid sequence relative to a parental AAV capsid protein, which, when present in an AAV virion, confer increased infectivity of one or more types of retinal cells as compared to the infectivity of the retinal cells by an AAV virion comprising the unmodified parental AAV capsid protein. Also provided are recombinant AAV virions and pharmaceutical compositions thereof comprising a variant AAV capsid protein as described herein, methods of making these rAAV capsid proteins and virions, and methods for using these rAAV capsid proteins and virions in research and in clinical practice, for example in, e.g., the delivery of nucleic acid sequences to one or more cells of the retina for the treatment of retinal disorders and diseases. 1. A method for treating a human subject with choroideremia , the method comprising administering a therapeutically effective amount of an infectious recombinant adeno-associated virus (rAAV) particle , the rAAV particle comprising (i) a capsid comprising a capsid protein comprising a heterologous peptide with a length of 7-11 amino acids covalently inserted between amino acids corresponding to amino acids 587 and 588 of VP1 of AAV2 (SEQ ID NO:2) or the corresponding position in the capsid protein of another AAV serotype , the peptide insertion comprising the amino acid sequence ISDQTKH (SEQ ID NO:14) and having from 1 to 3 spacer amino acids (Y-Y) at the amino and/or carboxyl terminus of amino acid sequence ISDQTKH (SEQ ID NO:14) and (ii) a nucleic acid comprising a nucleotide sequence encoding a Rab escort protein-1 (REP1) , said nucleotide sequence operably linked to an expression control sequence , or administering a pharmaceutical composition comprising said infectious rAAV particle and a pharmaceutically acceptable excipient.2. The method according to claim 1 , wherein the capsid protein comprises a P34A amino acid ...

ADENO-ASSOCIATED VIRUS VARIANT CAPSIDS AND METHODS OF USE THEREOF

Provided herein are variant adeno-associated virus (AAV) capsid proteins having one or more modifications in amino acid sequence relative to a parental AAV capsid protein, which, when present in an AAV virion, confer increased infectivity of one or more types of retinal cells as compared to the infectivity of the retinal cells by an AAV virion comprising the unmodified parental AAV capsid protein. Also provided are recombinant AAV virions and pharmaceutical compositions thereof comprising a variant AAV capsid protein as described herein, methods of making these rAAV capsid proteins and virions, and methods for using these rAAV capsid proteins and virions in research and in clinical practice, for example in, e.g., the delivery of nucleic acid sequences to one or more cells of the retina for the treatment of retinal disorders and diseases. 1. A method for treating a human subject with X-linked retinitis pigmentosa , the method comprising administering a therapeutically effective amount of an infectious recombinant adeno-associated virus (rAAV) particle , said rAAV particle comprising (i) a capsid comprising a capsid protein comprising a heterologous peptide with a length of 7-11 amino acids covalently inserted between amino acids corresponding to amino acids 587 and 588 of VP1 of AAV2 (SEQ ID NO:2) or the corresponding position in the capsid protein of another AAV serotype , the peptide insertion comprising the amino acid sequence ISDQTKH (SEQ ID NO:14) and having from 1 to 3 spacer amino acids (Y-Y) at the amino and/or carboxyl terminus of amino acid sequence ISDQTKH (SEQ ID NO:14) and (ii) a nucleic acid comprising a nucleotide sequence encoding a retinitis pigmentosa GTPase regulator protein , said nucleotide sequence operably linked to an expression control sequence , or administering a pharmaceutical composition comprising said infectious rAAV particle and a pharmaceutically acceptable excipient.2. The method according to claim 1 , wherein the capsid protein ...

METHODS OF VIRAL NEUTRALIZING ANTIBODY EPITOPE MAPPING

Disclosed herein are methods of high-throughput mapping of viral neutralizing antibody epitopes. Also disclosed are in vitro immunoprecipitation-based adenoassociated virus Barcode-Seq-based methods of mapping viral neutralizing antibody epitopes. In some embodiments, a method of high-throughput mapping of viral NtAb conformational epitopes can be utilized, which may comprise HP scanning of mutant viral libraries, immunoprecipitation (IP), and/or next-generation sequencing (NGS) technology. In some embodiments, a method of identifying one or more dominant epitopes in a viral vector may comprise contacting a mutant capsid of a virus with serum from a subject previously exposed to the virus and immunopredpitating serum immunoglobulins from the serum. In various embodiments, the viral vector may be an AAV vector. 1. A method of identifying a dominant epitope in a viral vector , the method comprising:contacting a mutant capsid of a viral vector with serum from a subject previously exposed to the viral vector; andimmunoprecipitating serum immunoglobulins from the serum, wherein viral vector mutants bound to the serum immunoglobulins are identified as comprising a dominant epitope.2. The method of claim 1 , wherein the mutant capsid is included in a mutant capsid library and wherein the capsids in the mutant capsid library are barcoded.3. The method of claim 1 , wherein the viral vector is an adeno-associated virus (AAV) vector.4. The method of claim 3 , wherein the mutant capsid of the AAV vector is included in an AAV mutant capsid library claim 3 , and wherein the capsids in the AAV mutant capsid library are barcoded.5. An AAV1 viral vector comprising claim 3 , an antibody neutralizing mutation in amino acids 452-457 in an AAV1 capsid.6. The vector of claim 5 , wherein the antibody neutralizing mutation is a mutation to an alanine.7. An AAV9 viral vector comprising claim 5 , an antibody neutralizing mutation in amino acids 453-457 in an AAV9 capsid.8. The vector of ...

RESTRICTIVE INVERTED TERMINAL REPEATS FOR VIRAL VECTORS

This invention relates to modified parvovirus inverted terminal repeats (ITRs) that do not functionally interact with wild-type large Rep proteins, synthetic Rep proteins that functionally interact with the modified ITRs, and methods of using the same for delivery of nucleic acids to a cell or a subject. The modifications provide a novel Rep-ITR interaction that limits vector mobilization, increasing the safety of viral vectors. 177-. (canceled)78. A method of delivering a nucleic acid to a cell , comprising contacting the cell with a recombinant parvovirus particle , under conditions sufficient for the recombinant parvovirus particle to enter the cell , wherein the recombinant parvovirus comprises a genome comprising the nucleic acid and at least one parvovirus inverted terminal repeat (ITR) , a) a first structural element that functionally interacts with a large Rep protein from a first adeno-associated virus (AAV) but does not functionally interact with a large Rep protein from a second AAV; and', 'b) a second structural element that functionally interacts with the large Rep protein from the second AAV but does not functionally interact with the large Rep protein from the first AAV;, 'wherein the ITR compriseswherein the ITR functionally interacts with a synthetic AAV large Rep protein, and wherein one of the structural elements is a nicking stem.79. The method of claim 78 , wherein the genome comprises two parvovirus ITRs which flank the nucleic acid.80. The method of claim 78 , wherein said ITR does not functionally interact with any wild-type large Rep protein.81. The method of claim 78 , wherein said structural elements are selected from the group consisting of a nicking stem claim 78 , a Rep binding element (RBE) claim 78 , and an extended RBE.82. The method of claim 78 , wherein said first structural element is a nicking stem.83. The method of claim 78 , wherein said second structural element is a spacer claim 78 , a RBE or an extended RBE.84. The method of ...

Compositions and methods for the treatment of degenerative ocular diseases

The present invention provides compositions, e.g., pharmaceutical compositions, which include a recombinant adeno-associated viral (AAV) expression construct, AAV vectors, AAV particles, and methods of treating a subject having a degenerative ocular disorder, e.g., retinitis pigmentosa.

METHODS AND COMPOSITIONS FOR ANTIBODY-EVADING VIRUS VECTORS

The present invention provides AAV capsid proteins comprising a modification in the amino acid sequence and virus vectors comprising the modified AAV capsid protein. The invention also provides methods of administering the virus vectors and virus capsids of the invention to a cell or to a subject in vivo. 2. The cell of claim 1 , wherein the cell is ex vivo or in vitro.3. The cell of claim 1 , wherein the cell is in vivo.4. The cell of claim 1 , wherein the nucleic acid encodes a heterologous polypeptide.5. The cell of claim 1 , wherein the nucleic acid encodes a heterologous RNA.6. The cell of claim 4 , wherein the nucleic acid comprises one or more regulatory sequences which direct expression of the heterologous polypeptide in the cell.7. The cell of claim 6 , wherein the one or more regulatory sequences are inducible promoter or enhancer elements.8. The cell of claim 6 , wherein the one or more regulatory sequences are tissue-specific regulatory sequences.9. The cell of claim 6 , wherein the one or more regulatory sequences are operably linked to the nucleic acid encoding the heterologous polypeptide.10. The cell of claim 1 , wherein the capsid protein comprises a substitution which confers heparin and/or heparan sulfate binding.11. The cell of claim 10 , wherein a heparin binding domain is substituted into the capsid protein.12. The cell of claim 11 , wherein the heparin binding domain comprises the amino acid sequence BXXB (SEQ ID NO:163) claim 11 , wherein B is a basic residue and X is a neutral and/or hydrophobic amino acid residue.13. The cell of claim 1 , wherein the capsid protein comprises an RGD peptide sequence.14. A method of producing a recombinant AAV vector claim 1 , the method comprising maintaining the cell of under conditions wherein the nucleic acid is packaged within an AAV capsid comprising the capsid protein to produce the recombinant AAV vector.15. The method of claim 14 , wherein the method comprises lysing the cell and collecting the ...

THERAPEUTIC FOR TREATMENT OF DISEASES INCLUDING THE CENTRAL NERVOUS SYSTEM

The present disclosure provides filler or stuffer sequences, compositions thereof including expression cassettes and vectors, such as viral (e.g., AAV) vectors and methods of delivering a therapeutic agent to a mammal and/or treating a disease. 1. A vector filler or stuffer sequence comprising a nucleic acid between about 500 and 5000 nucleotides in length and having at least 75% identity to SEQ ID NO:1 (New stuffer).2. An AAV vector filler or stuffer sequence comprising a nucleic acid of about 500 to 5000 nucleotides in length and having at least 75% identity to SEQ ID NO:1 (New stuffer).3. The filler or stuffer sequence of or , wherein the nucleic acid comprises or consists essentially of about 500 to 5000 nucleotides.4. The filler or stuffer sequence of or , wherein the nucleic acid comprises or consists essentially of about 1000 to 5000 nucleotides.5. The filler or stuffer sequence of or , wherein the nucleic acid comprises or consists essentially of about 1500 to 5000 nucleotides.6. The filler or stuffer sequence of or , wherein the nucleic acid comprises or consists essentially of about 2000 to 5000 nucleotides.7. The filler or stuffer sequence of or , wherein the nucleic acid comprises or consists essentially of about 2500 to 5000 nucleotides.8. The filler or stuffer sequence of or , wherein the nucleic acid comprises or consists essentially of about 3000 to 5000 nucleotides.9. The filler or stuffer sequence of or , wherein the nucleic acid comprises or consists essentially of about 3500 to 5000 nucleotides.10. The filler or stuffer sequence of or , wherein the nucleic acid comprises or consists essentially of about 4000 to 5000 nucleotides.11. The filler or stuffer sequence of or , wherein the nucleic acid comprises or consists essentially of about 4000 to 4800 nucleotides.12. The filler or stuffer sequence of or , wherein the nucleic acid comprises or consists essentially of about 4200 to 4800 nucleotides.13. The filler or stuffer sequence of or , wherein ...

AAV HEPARIN MUTANTS THAT DISPLAY SIGNIFICANTLY IMPROVED EYE AND BRAIN TRANSDUCTION

Disclosed are methods of gene delivery using capsid-modified recombinant adeno-associated viral (rAAV) particles. Exemplary methods are provided employing rAAV particles that have altered affinity for heparin or heparin sulfate. Also provided by the disclosure are methods employing the rAAV vector-based compositions, virus particles, host cells, and pharmaceutical formulations in the expression of selected therapeutic genes, proteins, polypeptides, peptides, antisense oligonucleotides, and/or ribozymes in selected mammals, including organs, tissues, and human host cells. 1. A method of delivering a gene of interest to a cell of the brain or eye , the method comprising providing to the cell a composition comprising a recombinant adeno-associated virus (rAAV) particle comprising an amino acid substitution at one or more positions selected from R484 , R487 , K532 , R585 , and R588.2. The method of claim 1 , wherein the recombinant adeno-associated virus (rAAV) particle comprises an amino acid substitution selected from R484A claim 1 , R487A claim 1 , K532A claim 1 , R585A claim 1 , and R588A.3. The method of any of - claim 1 , wherein the rAAV particle is derived from an AAV2 serotype.4. The method of any of - claim 1 , wherein the rAAV particle is derived from an AAV1 or AAV3 serotype.5. The method of any of - claim 1 , wherein the rAAV particle comprises a nucleic acid encoding the gene of interest.6. The method of claim 5 , wherein the gene of interest is a therapeutic gene.7. The method of claim 6 , wherein the therapeutic gene encodes a therapeutic polypeptide or a therapeutic protein.8. The method of claim 6 , wherein the therapeutic gene encodes a therapeutic ribonucleic acid (RNA).9. The method of claim 8 , wherein the RNA comprises mRNA claim 8 , tRNA claim 8 , rRNA claim 8 , siRNA claim 8 , microRNA claim 8 , antisense RNA claim 8 , or a ribozyme.10. The method of claim 6 , wherein the therapeutic gene is a brain-specific gene or an eye-specific gene.11. The ...

RECOMBINANT ADENO-ASSOCIATED VIRAL VECTOR FOR GENE DELIVERY

Provided herein are recombinant AAV vectors, AAV viral vectors, and capsid proteins for improved gene therapy, and methods for their manufacture and use. 2. The nucleic acid of claim 1 , wherein the VR-I region comprises NSTSGGSS (SEQ ID NO: 53) or SSTSGGSS (SEQ ID NO. 87).3. The nucleic acid of or claim 1 , wherein the VR-I region comprises SASTGAS (SEQ ID NO: 52).4. The nucleic acid of any of to claim 1 , wherein the VP3 portion has the sequence of SEQ ID NO:41.5. The nucleic acid of claim 2 , wherein the encoded AAV capsid amino acid sequence is at least 95% identical to the amino acid sequence of SEQ NO:30 or SEQ ID NO:84.6. The nucleic acid of wherein the encoded AAV capsid amino acid sequence is at least 95% identical to the amino acid sequence of SEQ ID NO: 3 claim 3 , SEQ ID NO: 31 claim 3 , SEQ ID NO: 32 claim 3 , SEQ ID NO: 33 claim 3 , or SEQ ID NO: 34.7. The nucleic acid of claim 4 , wherein the nucleic acid sequence is at least 95% identical to the nucleotide sequence selected from SEQ ID NOS:18-23.8. The nucleic acid of claim 7 , wherein the nucleic acid sequence is 100% identical to the nucleotide sequence selected from SEQ ID NOS:18-23.9. A vector comprising the nucleic acid of to .10. An AAV capsid protein encoded by the nucleic acid of to .11. The AAV capsid protein of claim 10 , wherein the protein comprises the amino acid sequence of SEQ ID NO: 3 claim 10 , SEQ ID NO: 31 claim 10 , SEQ ID NO: 32 claim 10 , SEQ ID NO: 33 claim 10 , or SEQ ID NO: 34.12. An AAV viral vector comprising the AAV capsid protein encoded by the nucleic acid of to and an AAV vector claim 10 , wherein the AAV vector comprises in 5′ to 3′ orientation claim 10 ,(a) a first AAV inverted terminal repeat,(b) a promoter,(c) a heterologous nucleic acid,(d) a poly-A tail; and(e) a second AAV inverted terminal repeat.13. The AAV viral vector of claim 12 , wherein the heterologous nucleic acid is operably linked to a constitutive promoter.14. The AAV viral vector of claim 12 , ...

MODIFIED BACULOVIRUS SYSTEM FOR IMPROVED PRODUCTION OF CLOSED-ENDED DNA (ceDNA)

The present disclosure relates to a recombinant baculovirus expression vector (rBEV) for the production of closed-ended DNA (ceDNA) in insect cells.

METHODS AND COMPOSITIONS FOR CIRCULAR RNA MOLECULES

This invention is directed to AAV compositions for circular RNA expression and methods of expressing covalently closed, circular RNA. 1. An adeno-associated virus (AAV) genome encoding a circular RNA , wherein the AAV genome comprises , from 5′ to 3′:(a) a first inverted terminal repeat;(b) a first intronic element;(c) a nucleotide sequence of interest;(d) a second intronic element; and(d) a second inverted terminal repeat.2. The AAV genome of claim 1 , wherein the first intronic element and the second intronic element are capable of generating a covalently closed circular RNA.3. The AAV genome of claim 2 , wherein the first intronic element and the second intronic element are capable of facilitating formation of a covalently closed circular RNA following transcription of the AAV genome in a mammalian cell.4. The AAV genome of claim 1 , wherein the first intronic element and the second intronic element are derived from the human ZKSCAN1 claim 1 , HIPK3 claim 1 , EPHB4 claim 1 , or Laccase2 genes.5. The AAV genome of claim 1 , wherein the first intronic element and/or the second intronic element comprises the sequence of any one of SEQ ID NOs:13-24 or 29-32.6. The AAV genome of claim 1 , wherein the nucleotide sequence of interest encodes a non-coding RNA.7. The AAV genome of claim 1 , wherein the nucleotide sequence of interest encodes a translatable mRNA.8. The AAV genome of claim 7 , wherein the translatable mRNA encodes a therapeutic protein.9. The AAV genome of claim 7 , comprising an internal ribosome entry site (IRES) capable of diving translation of the translatable mRNA.10. The AAV genome of claim 9 , wherein the IRES is a viral IRES or a cellular IRES.11TriatomaSolenopsis invictaRhopalosiphum padiPlautia stali, Homalodisca coagulata, Homalodisca coagulataEctropis obliquaDrosophilaDrosophilaDrosophilaDrosophilaDrosophilaS. cerevisiaeS. cerevisiae. The AAV genome of claim 9 , wherein the IRES is from Taura syndrome virus claim 9 , virus claim 9 , Theiler's ...

RECOMBINANT ADENO-ASSOCIATED VECTORS FOR TARGETED TREATMENT

Novel adeno-associated virus (AAV) vectors in nucleotide and amino acid forms and uses thereof are provided. The isolates show specific tropism for certain target tissues, such as blood stem cells, liver, heart and joint tissue, and may be used to transduce stem cells for introduction of genes of interest into the target tissues. Certain of the vectors are able to cross tightly controlled biological junctions, such as the blood-brain barrier, which open up additional novel uses and target organs for the vectors, providing for additional methods of gene therapy and drug delivery. 120-. (canceled)21. A method for transduction of a cell , the method comprising contacting the cell with a recombinant adeno-associated virus (rAAV) vector comprising a capsid protein comprising an amino acid sequence having at least 95% sequence identity with the amino acid sequence of amino acids 203-736 of SEQ ID NO:2 , wherein the amino acid sequence of the capsid protein comprises one or more of the following amino acids: C at position 206; H at position 296; Q at position 312; A at position 346; N at position 464; S at position 468; I at position 501; R at position 505; R at position 590; G at position 626; Y at position 626; M at position 681; R at position 687; K at position 690; C at position 706; or , G at position 718.22. The method of claim 21 , wherein the amino acid sequence of the capsid protein comprises one of the following groups of amino acids: G at position 626 and G at position 718; H at position 296 claim 21 , N at position 464 claim 21 , R at position 505 claim 21 , and M at position 681; R at position 505 and R at position 687; A at position 346 and R at position 505; or claim 21 , I at position 501 claim 21 , R at position 505 claim 21 , and C at position 706.23. The method of claim 21 , wherein the capsid protein comprises the amino acid sequence of amino acids 203-736 of SEQ ID NOs: 2 claim 21 , 3 claim 21 , 4 claim 21 , 6 claim 21 , 7 claim 21 , 10 claim 21 , 11 ...

Mutant adeno-associated virus virions and methods of use thereof

The present invention provides mutant adeno-associated virus (AAV) that exhibit altered capsid properties, e.g., reduced binding to neutralizing antibodies in serum and/or altered heparin binding and/or altered infectivity of particular cell types. The present invention further provides libraries of mutant AAV comprising one or more mutations in a capsid gene. The present invention further provides methods of generating the mutant AAV and mutant AAV libraries, and compositions comprising the mutant AAV. The present invention further provides recombinant AAV (rAAV) virions that comprise a mutant capsid protein. The present invention further provides nucleic acids comprising nucleotide sequences that encode mutant capsid proteins, and host cells comprising the nucleic acids. The present invention further provides methods of delivering a gene product to an individual, the methods generally involving administering an effective amount of a subject rAAV virion to an individual in need thereof.

GENE THERAPIES FOR LYSOSOMAL DISORDERS

The disclosure relates, in some aspects, to compositions and methods for treatment of diseases associated with aberrant lysosomal function, for example Parkinson's disease (PD) and Gaucher disease. In some embodiments, the disclosure provides expression constructs comprising a transgene encoding beta-Glucocerebrosidase (GBA) or a portion thereof alone or in combination with one or more PD-associated genes. In some embodiments, the disclosure provides methods of Parkinson's disease by administering such expression constructs to a subject in need thereof. 1109.-. (canceled)110. A recombinant adeno-associated virus (AAV) vector comprising a nucleic acid comprising an expression construct comprising a promoter operably linked to a transgene insert encoding a Progranulin (PGRN) protein , wherein the PGRN protein is encoded by the nucleic acid sequence in SEQ ID NO: 68.111. The nucleic acid of claim 110 , wherein the promoter is a chicken beta actin (CBA) promoter.112. The nucleic acid of claim 110 , further comprising a CMV enhancer.113. The nucleic acid of claim 110 , further comprising a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE).114. The nucleic acid of claim 110 , further comprising a Bovine Growth Hormone polyA signal tail.115. The nucleic acid of claim 110 , wherein the expression construct comprises two adeno-associated virus inverted terminal repeats (ITR) sequences flanking the promoter operably linked to the transgene insert.116. The nucleic acid of claim 115 , wherein each ITR sequence is a wild-type AAV2 ITR sequence.117. The nucleic acid of claim 115 , wherein each ITR sequence comprises a “D” region (SEQ ID NO: 27) that is proximal to the transgene insert.118. The nucleic acid of claim 115 , wherein at least one of the ITR sequences comprises a “D” region (SEQ ID NO: 27) positioned on the outside of the ITR sequence relative to the transgene insert.119. The nucleic acid of claim 115 , wherein the ITR sequence positioned 5′ ...

ADENO-ASSOCIATED VIRUS VECTOR VARIANTS FOR HIGH EFFICIENCY GENOME EDITING AND METHODS THEREOF

Adeno-associated virus (AAV) Clade F vectors or AAV vector variants (relative to AAV9) for precise editing of the genome of a cell and methods and kits thereof are provided. Targeted genome editing using the AAV Clade F vectors or AAV vector variants provided herein occurred at frequencies that were shown to be 1,000 to 100,000 fold more efficient than has previously been reported. Also provided are methods of treating a disease or disorder in a subject by editing the genome of a cell of the subject via transducing the cell with an AAV Clade F vector or AAV vector variant as described herein and further transplanting the transduced cell into the subject to treat the disease or disorder of the subject. Also provided herein are methods of treating a disease or disorder in a subject by in vivo genome editing by directly administering the AAV Clade F vector or AAV vector variant as described herein to the subject. 1146-. (canceled)147. A replication-defective adeno-associated virus (AAV) comprising:(a) a correction genome comprising (i) an editing element for integration into a target locus of a chromosome in a cell, the editing element comprising a coding sequence of a gene operably linked to an exogenous promoter, (ii) a 5′ homologous arm nucleotide sequence 5′ of the editing element, having homology to a 5′ region of the chromosome relative to the target locus, and (iii) a 3′ homologous arm nucleotide sequence 3′ of the editing element, having homology to a 3′ region of the chromosome relative to the target locus; and(b) an AAV capsid comprising an AAV capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 16.148. The AAV of claim 147 , wherein the editing element comprises a polyadenylation sequence operably linked to the coding sequence.149. The AAV of claim 147 , wherein each of the 5′ and 3′ homologous arm nucleotide sequences independently has a nucleotide length of about 50 to 2000 nucleotides.150. The AAV of claim 147 , wherein ...

ADENO-ASSOCIATED VIRUSES AND THEIR USES FOR INNER EAR THERAPY

Provided herein are adeno-associated viruses and methods for using same to treat or prevent disorders that affect the inner ear of a subject. 1. A recombinant adeno-associated virus (AAV) virion comprising:a) a modified AAV capsid protein, wherein the modified AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, wherein the peptide insertion comprises the amino acid sequence LGETTRP (SEQ ID NO: 1), wherein the insertion in the modified AAV capsid protein is between amino acids corresponding to amino acids 587 and 588 of AAV2-VP1; andb) a heterologous nucleic acid that produces an expression product, wherein the expression product reduces hearing loss or dizziness.2. The recombinant AAV virion of claim 1 , wherein the expression product is a nucleic acid that decreases expression of a gene associated with hearing loss claim 1 , wherein the gene is selected from the group consisting of DIAPH1 claim 1 , KCNQ4 claim 1 , GJB3 claim 1 , IFNLR1 claim 1 , GJB2 claim 1 , GJB6 claim 1 , MYH1 claim 1 , CEACAM16 claim 1 , GSDME/DFNA5. WFS1 claim 1 , LMX1A claim 1 , TECTA claim 1 , COCH claim 1 , EYA4 claim 1 , MYO7A claim 1 , COL11A2 claim 1 , POU4F3 claim 1 , MYH9 claim 1 , ACTG1 claim 1 , MYO6 claim 1 , SIX1 claim 1 , SLC17A8 claim 1 , REST claim 1 , GRHL2 claim 1 , NLRP3 claim 1 , TMC1 claim 1 , COL11A1 claim 1 , CRYM claim 1 , P2RX2 claim 1 , CCDC50 claim 1 , MIRN96 claim 1 , TJP2 claim 1 , TNC claim 1 , SMAC/DIABLO claim 1 , TBC1D24 claim 1 , CD164 claim 1 , OSBPL2 claim 1 , HOMER2 claim 1 , KITLG claim 1 , MCM2 claim 1 , PTPRQ claim 1 , DMXL2 claim 1 , MYO3A and PDE1C3. The recombinant AAV virion of claim 1 , wherein the expression product is a polypeptide that reduces hearing loss claim 1 , wherein the polypeptide is selected from the group consisting of GJB2 claim 1 , GJB6 claim 1 , MYO7A claim 1 , MYO15A claim 1 , SLC26A4 claim 1 , TMIE claim 1 , TMC1 claim 1 , TMPRSS3 claim 1 , OTOF claim 1 , CDH23 claim 1 , GIPC3 ...

CAPSID

There is described an AAV capsid protein having an amino acid sequence which has at least 98% identity to the sequence of SEQ ID NO: 3 or at least 94% identity to the sequence of SEQ ID NO: 4. Also described is a pharmaceutical composition, an AAV capsid and a viral particle comprising the capsid protein, a recombinant AAV vector comprising a nucleotide sequence which encodes for the capsid protein, and a host cell and a transgenic animal comprising the capsid protein or the vector. In addition, there is described a method of transferring a nucleic acid of interest into a mammal comprising introducing a recombinant AAV vector into the mammal, wherein the recombinant AAV vector comprises a gene of interest which is encapsidated into a capsid comprising the capsid protein. 1. An AAV capsid protein having an amino acid sequence which has at least 99% identity to the sequence of SEQ ID NO: 3.2. The AAV capsid protein of claim 1 , wherein the amino acid sequence has at least 99.5% identity to the sequence of SEQ ID NO: 3.3. The AAV capsid protein of claim 1 , wherein the amino acid sequence has the sequence of SEQ ID NO. 3.4. (canceled)5. An AAV capsid comprising the capsid protein of .6. A viral particle comprising the capsid protein of .7. A nucleotide sequence which encodes for the capsid protein of .8. (canceled)9. A host cell comprising the capsid protein of .10. A non-human transgenic animal comprising cells comprising the capsid protein of .11. A pharmaceutical composition comprising the capsid protein of claim 1 , and one or more pharmaceutically acceptable excipients.12. The AAV capsid protein of claim 1 , wherein prevalence of antibodies to the AAV capsid protein in patients is lower than for an AAV capsid protein of serotype AAV8.13. The AAV capsid protein of claim 1 , wherein the AAV capsid protein has a higher tropism for human liver cells.14. A method of treating a disease or disorder by gene therapy claim 1 , the method comprising administering a ...

RECOMBINANT AAVS HAVING USEFUL TRANSCYTOSIS PROPERTIES

The disclosure in some aspects relates to recombinant adeno-associated viruses having distinct tissue targeting capabilities. In some aspects, the disclosure relates to gene transfer methods using the recombinant adeno-associate viruses. In some aspects, the disclosure relates to isolated AAV capsid proteins and isolated nucleic acids encoding the same. 1. A recombinant AAV (rAAV) comprising an AAV capsid protein that is encoded by an isolated nucleic acid comprising a sequence selected from the group consisting of: SEQ ID NOs: 10-14 , and at least one transgene.2. A composition comprising the rAAV of .3. The composition of further comprising a pharmaceutically acceptable carrier.46-. (canceled)7. A method for delivering a transgene to a subject comprising administering the rAAV of to a subject claim 1 , whereinthe rAAV infects cells of a target tissue of the subject.8. (canceled)9. The method of claim 7 , wherein the at least one transgene encodes a CNS-protein claim 7 , or a secreted tumor suppressor protein.10. The method of claim 9 , wherein the CNS-protein is aspartoacylase (ASPA) claim 9 , or wherein the secreted tumor suppressor protein is IGFBP7 or SRPX.1113-. (canceled)14. The method of claim 7 , wherein the transgene is an immunoglobulin heavy chain or light chain or fragment thereof.15. The method of claim 7 , wherein the at least one transgene encodes a miRNA claim 7 , miRNA sponge claim 7 , or TuD RNA.1617-. (canceled)18. The method of claim 15 , wherein the miRNA is expressed in a cell of the target tissue19. The method of claim of claim 7 , wherein the target tissue is skeletal muscle claim 7 , heart claim 7 , liver claim 7 , pancreas claim 7 , brain or lung.20. The method of claim 7 , wherein the transgene expresses a transcript that comprises at least one binding site for a miRNA claim 7 , wherein the miRNA inhibits activity of the transgene claim 7 , in a tissue other than the target tissue claim 7 , by hybridizing to the binding site.21. The ...

HIGHLY EFFICIENT TRANSDUCTION AND LATERAL SPREAD IN THE RETINA BY A NOVEL AAV VIRUS ENHANCED BY RATIONAL DESIGN

The disclosure provides rAAV particles comprising a new capsid variant, AAV44.9(E531D). The disclosure also provides rAAV particles comprising AAV44.9(E531D) for treatment of the eye, including treatment of retinal disorders. In particular embodiments, the disclosure provides rAAV particles comprising an AAV44.9(E531D) capsid that exhibits enhanced lateral spread after subretinal injection to a fovea of the subject, wherein detachment of the fovea is minimized. The disclosure further provides rAAV particles comprising an AAV44.9(E531D) capsid and a polynucleotide encoding a heterologous nucleic acid sequence. Methods of treatment comprising administering rAAV particles to a mammal in need thereof, and methods of transducing photoreceptor and RPE cells with rAAV particles, are also provided.

METHODS AND COMPOSITIONS FOR DUAL GLYCAN BINDING AAV2.5 VECTOR

Disclosed herein are methods and compositions comprising an adeno-associated virus 2.5 (AAV2.5) capsid protein, comprising one or more amino acids substitutions, (e.g., which does not contain a substitution at the position corresponding to amino acid 267 of AAV2.5, or does not contain a serine at the position corresponding to amino acid 267 of AAV2.5) wherein the substitutions introduce a new glycan binding site into the AAV capsid protein.

Methods and systems of pcr-based recombinant adeno-associated virus manufacture

The invention relates to methods of treating diseases comprising administering to a subject a composition comprising the recombinant adeno-associated virus (rAAV). The rAAV is produced by a method comprising: obtaining a template DNA sequence containing a [ITR-cargo-ITR] DNA sequence motif; designing a PCR primer pair such that the 3′ terminus of both the forward and reverse PCR primers overlap only about the last 2-8 bases of the A/A′ ITR sequences and the 5′ terminus of both the forward and reverse PCR primers extend into about 20-35 bases of the flanking sequences; performing PCR with cycling parameters comprising a combined annealing/extension step at a temperature greater than 70° C., thereby producing a plurality of amplicon polynucleotides containing the desired [ITR-cargo-ITR] DNA sequence motif; transfecting the amplicon polynucleotides containing the desired [ITR-cargo-ITR] DNA sequence motif into a packaging cell line; and purifying the lysed cells to collect a quantity of rAAV.

ASSEMBLY ACTIVATING PROTEIN (AAP) AND ITS USE FOR THE MANUFACTURE OF PARVOVIRUS PARTICLES ESSENTIALLY CONSISTING OF VP3

The present invention relates to nucleic acids encoding the novel parvoviral protein “assembly activating protein” (AAP), the encoded polypeptides, methods of producing the polypeptides, antibodies specific for AAP, the use of the nucleic acids for the preparation of the polypeptides, the use of the nucleic acids or the polypeptides for the preparation of the parvoviral particle and methods of producing parvoviral particles essentially consisting of VP3 by providing in addition to the coding sequence of the parvoviral structural protein VP3 a sequence fragment Z/a nucleic acid encoding AAP in the cell and expressing VP3 and fragment Z under control of a rep-independent promoter. Furthermore, the present invention relates to parvoviral particles essentially consisting of VP3 and/or obtainable by the above method as well as expression cassettes comprising (i) a heterologous promoter and (ii) VP3 coding sequence and/or fragment Z. The present invention further relates to a medicament, particularly a vaccine, comprising the parvoviral particles or expression cassettes and their use. 1. A nucleic acid encoding a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 2 , SEQ ID NO: 3 , SEQ ID NO:4 , SEQ ID NO: 5 , SEQ ID NO: 6 , SEQ ID NO: 7 , SEQ ID NO: 8 , SEQ ID NO: 9 , SEQ ID NO: 10 , SEQ ID NO: 11 , SEQ ID NO: 12 , SEQ ID NO: 13 , SEQ ID NO: 14 , SEQ ID NO: 15 , SEQ ID NO: 16 , SEQ ID NO: 17 , SEQ ID NO: 18 , SEQ ID NO: 19 , SEQ ID NO: 20 , SEQ ID NO: 21 , and SEQ ID NO: 22 , or encoding a polypeptide comprising a functionally active variant of any of these amino acid sequences , wherein the functionally active variant(i) has an amino acid sequence that is at least 60% identical to any of the amino acid sequences of SEQ ID NO: 1 to 22, and/or(ii) is encoded by a cDNA that hybridizes in 6×SSC, 5×Denhardt's solution, 0.5% SDS at 40° C. for 2 to 12 hours to a nucleic acid sequence selected from the group consisting ...

SELECTIVE RECOVERY

Provided herein are methods of selective screening. In addition, various targeting proteins and sequences, as well as methods of their use, are also provided. 1. An AAV polynucleotide comprising a capsid sequence , wherein said capsid sequence (a) encodes an AAV capsid protein , (b) has at least 99% identity to SEQ ID NO: 11 , and (c) comprises a nucleotide sequence which (i) comprises at least 12 nucleotides from the sequence ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51) and encodes at least 4 contiguous amino acids from the sequence TRTNPEA (SEQ ID NO: 56) , or (ii) comprises at least 12 nucleotides from the sequence AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO: 26) and encodes at least 4 contiguous amino acids from the sequence SVSKPFL (SEQ ID NO: 28).2. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises a nucleotide sequence which comprises at least 12 nucleotides from the sequence ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51) and encodes at least 4 contiguous amino acids from the sequence TRTNPEA (SEQ ID NO: 56).3. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises a nucleotide sequence which comprises at least 18 nucleotides from the sequence ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51) and which encodes at least 6 contiguous amino acids from the sequence TRTNPEA (SEQ ID NO: 56).4. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51).5. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51) inserted between two nucleotides in the capsid sequence which correspond to nucleotides 1764 and 1765 of SEQ ID NO: 11.6. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises a nucleotide sequence which comprises at least 12 nucleotides from the sequence AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO: 26) and encodes at least 4 contiguous amino acids from the sequence SVSKPFL (SEQ ID NO: 28).7. The AAV polynucleotide of claim 1 , wherein the ...

SYSTEMS FOR EVOLVED ADENO-ASSOCIATED VIRUSES (AAVS) FOR TARGETED DELIVERY

Methods for screening for an adeno-associated virus (AAV) capsid protein that can bind to a target protein (e.g., Ly6 protein) and related compositions are provided in aspects of the disclosure. 1. A method comprising:providing an adeno-associated virus (AAV) capsid protein;contacting the AAV capsid protein with a cell that expresses a protein of the lymphocyte antigen-6 (Ly6)/urokinase-type plasminogen activator receptor (uPAR) protein family attached to the surface of the cell; andselecting the AAV capsid protein if it specifically binds to the protein of the Ly6/uPAR protein family attached to the surface of the cell.2. The method of claim 1 , wherein the protein of the Ly6/uPAR protein family is expressed recombinantly in the cell.3. The method of claim 1 , wherein the protein of the Ly6/uPAR protein family is expressed endogenously in the cell.4. The method of any one of - claim 1 , wherein the AAV capsid protein is an AAV9 capsid protein.5. The method of claim 4 , wherein the AAV9 capsid protein contains an insertion at a position corresponding to the position between amino acids 586-592 of the sequence provided in SEQ ID NO: 730 or 731.6. The method of claim 5 , wherein the AAV9 capsid protein contains an insertion at a position corresponding to the position between amino acids 588-589 of the sequence provided in SEQ ID NO: 730 or 731.7. The method of any one of - claim 5 , wherein the AAV capsid protein is part of an AAV1 claim 5 , AAV2 claim 5 , AAV3 claim 5 , AAV4 claim 5 , AAV5 claim 5 , AAV6 claim 5 , AAV7 claim 5 , AAV8 claim 5 , AAV10 or AAV11.8. The method of any one of - claim 5 , wherein the protein of the Ly6/uPAR protein family is a human protein.9. The method of any one of - claim 5 , wherein the protein of the Ly6/uPAR protein family is expressed in the central nervous system.10. The method of any one of - claim 5 , wherein the protein of the Ly6/uPAR protein family is a Ly6 protein.11. The method of claim 9 , wherein the protein of the Ly6/uPAR ...

RESTRICTIVE INVERTED TERMINAL REPEATS FOR VIRAL VECTORS

This invention relates to modified parvovirus inverted terminal repeats (ITRs) that do not functionally interact with wild-type large Rep proteins, synthetic Rep proteins that functionally interact with the modified ITRs, and methods of using the same for delivery of nucleic acids to a cell or a subject. The modifications provide a novel Rep-ITR interaction that limits vector mobilization, increasing the safety of viral vectors. 128-. (canceled)29. A synthetic large Rep protein comprising a first portion that functionally interacts with a first structural element of a parvovirus ITR and a second portion that functionally interacts with a second structural element of a parvovirus ITR , wherein said first structural element functionally interacts with a large Rep protein from a first AAV but does not functionally interact with a large Rep protein from a second AAV and said second structural element functionally interacts with a large Rep protein from a second AAV but does not functionally interact with a large Rep protein from the first AAV.30. The protein of claim 29 , wherein said first structural element is a nicking stem.31. The protein of claim 29 , wherein said second structural element is a RBE.32. The protein of claim 29 , wherein said protein comprises a third portion that functionally interacts with a third structural element that functionally interacts with a large Rep protein from an AAV that is the same as or different from the first and/or second AAV.33. The protein of claim 29 , wherein said first portion comprises an amino acid sequence from about residue 97 to about residues 146-151 of a wild-type AAV5 Rep sequence.34. The protein of claim 29 , wherein said second portion comprises an amino acid sequence from about residue 149 to about residue 187 of a wild-type AAV2 Rep sequence.35. The protein of claim 29 , wherein said first portion comprises an amino acid sequence from about residue 97 to about residues 146-151 of a wild-type AAV5 Rep sequence and ...

FULLY-HUMAN POST-TRANSLATIONALLY MODIFIED ANTIBODY THERAPEUTICS

Provided are methods and compositions for the delivery of fully human post-translationally modified therapeutic monoclonal antibodies and antigen-binding fragments thereof. The fully human post-translationally modified therapeutic monoclonal antibodies may be preferably delivered by gene therapy methods, particularly as a recombinant adeno-associated virus (rAAV) vector to the appropriate tissue. Methods of manufacture of the AAV vectors, pharmaceutical compositions and methods of treatment are also provided. In addition, provided are methods of producing therapeutic antibodies that are “biobetters” as fully human post-translationally modified. These fully human post-translationally modified therapeutic antibodies may be administered to a subject in need of treatment with the therapeutic antibody. 1. A pharmaceutical composition for treating Alzheimer's disease , migraines , cluster headaches , or tauopathies including chronic traumatic encephalopathy , progressive supranuclear palsy , and frontotemporal dementia in a human subject in need thereof , comprising an adeno-associated virus (AAV) vector having:(a) a viral capsid that is at least 95% identical to the amino acid sequence of an AAV9 capsid (SEQ ID NO: 78) or AAVrh10 (SEQ ID NO: 80); and(b) an artificial genome comprising an expression cassette flanked by AAV inverted terminal repeats (ITRs), wherein the expression cassette comprises a transgene encoding an anti-amyloid beta, anti-Tau, or anti-CGRPR mAb, or an antigen-binding fragment thereof, operably linked to one or more regulatory sequences that control expression of the transgene in human CNS cells;wherein said AAV vector is formulated for intrathecal administration to the CNS of said subject.2. The pharmaceutical composition of claim 1 , wherein the anti-amyloid β mAb is aducanumab claim 1 , crenezumab claim 1 , BAN2401 claim 1 , or gantenerumab and the anti-Tau mAb is aTAU and the anti-CGRPR is erenumab claim 1 , eptinezumab claim 1 , fremanezumab ...

ADENO-ASSOCIATED VIRUS CAPSID VARIANTS AND METHODS OF USE THEREOF

The present disclosure provides recombinant adeno-associated virus virions with variant capsid protein, where the recombinant AAV (rAAV) virions exhibit one or more of increased ability to cross neuronal cell barriers, increased infectivity of a neural stem cell, increased infectivity of a neuronal cell, and reduced susceptibility to antibody neutralization, compared to a control AAV, and where the rAAV virions comprise a heterologous nucleic acid. The present disclosure provides methods of delivering a gene product to a neural stem cell or a neuronal cell in an individual. The present disclosure also provides methods of modifying a target nucleic acid present in a neural stem cell or neuronal cell. 1. A recombinant adeno-associated virus (rAAV) virion comprising: i) increased infectivity of a neural stem cell, compared to the infectivity of the neural stem cell by a control AAV virion comprising a wild-type AAV virion;', 'ii) increased infectivity of a neuronal cell, compared to the infectivity of the neuronal cell by a control AAV virion comprising a wild-type AAV virion;', 'iii) increased ability to cross a cellular barrier, compared to the ability of a control AAV virion comprising a wild-type AAV capsid to cross the cellular barrier;', 'iv) increased resistance to human AAV neutralizing antibodies, compared to the resistance exhibited by a control AAV virion comprising a wild-type AAV capsid; and, 'a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises at least 5 segments from at least 3 different AAV serotypes, wherein each segment has a length of from about 50 amino acids to about 160 amino acids, and wherein the variant capsid protein confers one or more of the following propertiesb) a heterologous nucleic acid comprising a nucleotide sequence encoding a heterologous gene product.2. The rAAV virion of claim 1 , wherein the variant AAV capsid protein comprises claim 1 , in order from N-terminus to C-terminus:a) a first segment ...

Ancestral Virus Sequences and Uses Thereof

Methods are described for predicting ancestral sequences for viruses or portions thereof. Also described are predicted ancestral sequences for adeno-associated virus (AAV) capsid polypeptides. The disclosure also provides methods of gene transfer and methods of vaccinating subjects by administering a target antigen opeiably linked to the AAV capsid polypeptides. 1. An adeno-associated virus (AAV) capsid polypeptide having the amino acid sequence shown in SEQ ID NO: 42.2. The AAV capsid polypeptide of claim 1 , wherein the AAV capsid polypeptide or a virus particle comprising the AAV capsid polypeptide exhibits about the same or a lower seroprevalence than does an AAV9 capsid polypeptide or a virus particle comprising an AAV9 capsid polypeptide.3. The AAV capsid polypeptide of claim 1 , wherein the AAV capsid polypeptide or a virus particle comprising the AAV capsid polypeptide is neutralized to a similar or lesser extent by human serum than is an AAV9 capsid polypeptide or a virus particle comprising an AAV9 capsid polypeptide.4. The AAV capsid polypeptide of claim 1 , wherein the AAV capsid polypeptide is purified.5. The AAV capsid polypeptide of encoded by the nucleic acid sequence shown in SEQ ID NO: 43.6. A nucleic acid molecule encoding an adeno-associated virus (AAV) capsid polypeptide having the nucleic acid sequence shown in SEQ ID NO: 43.7. A vector comprising the nucleic acid molecule of .8. A host cell comprising the vector of .9. A purified virus particle comprising the AAV capsid polypeptide of .10. The purified virus particle of claim 9 , further comprising a transgene.11. A method of gene transfer and/or vaccination with a transgene claim 9 , the method comprising{'claim-ref': {'@idref': 'CLM-00010', 'claim 10'}, 'administering the virus particle of to a subject in need of gene transfer or vaccination, wherein the virus particle exhibits about the same or a lower seroprevalence than does an AAV9 virus particle.'}12. The method of claim 11 , wherein ...

AAV VECTORS WITH HIGH TRANSDUCTION EFFICIENCY AND USES THEREOF FOR GENE THERAPY

The present invention provides AAV capsid proteins comprising modification of one or a combination of the surface-exposed lysine, serine, threonine and/or tyrosine residues in the VP3 region. Also provided are rAAV virions comprising the AAV capsid proteins of the present invention, as well as nucleic acid molecules and rAAV vectors encoding the AAV capsid proteins of the present invention. Advantageously, the rAAV vectors and virions of the present invention have improved efficiency in transduction of a variety of cells, tissues and organs of interest, when compared to wild-type rAAV vectors and virions. 1. An AAV VP3 protein comprising:(a) a non-lysine amino acid residue at a position that corresponds to K258, K321, K459, K490, K507, K527, K572, K532, K544, K549, K556, K649, K655, K665, or K706 of the wild-type AAV2 capsid protein of SEQ ID NO:2;(b) a non-lysine amino acid residue at a position that corresponds to K530, K547, or K569 of the wild-type AAV8 capsid protein of SEQ ID NO:8;(c) a non-serine amino acid residue at a position that corresponds to S261, S264, S267, S276, S384, S458, S468, S492, S498, S578, S658, S662, S668, S707, or S721 of the wild-type AAV2 capsid protein of SEQ ID NO:2;(d) a non-threonine amino acid residue at a position that corresponds to T251, T329, T330, T454, T455, T503, T550, T592, T581, T597, T491, T671, T659, T660, T701, T713, or T716 of the wild-type AAV2 capsid protein of SEQ ID NO:2; and/or(e) a non-tyrosine amino acid residue at a position that corresponds to Y252, Y272, Y444, Y500, Y700, Y704, or Y730 of the wild-type AAV2 capsid protein of SEQ ID NO:2.2. The AAV VP3 protein claim 1 , according to claim 1 , comprising a non-lysine amino acid residue at a position that corresponds to K459 claim 1 , K490 claim 1 , K532 claim 1 , K544 claim 1 , or K556 of the wild-type AAV2 capsid protein of SEQ ID NO:2.3. The AAV VP3 protein claim 1 , according to claim 1 , comprising a non-lysine amino acid residue at a position that ...

Aav polynucleotides, polypeptides and virions

The present disclosure relates generally to polypeptides derived from marsupial adeno-associated vims (AAV). The disclosure is also related to nucleic acid molecules encoding the polypeptides, and vectors comprising the nucleic acid molecules, and AAV vectors comprising the polypeptides. The disclosure also relates to uses of the nucleic acid molecules, polypeptides and AAV vectors, such as for capsid diversification.

NOVEL ADENO-ASSOCIATED VIRUS (AAV) VECTORS, AAV VECTORS HAVING REDUCED CAPSID DEAMIDATION AND USES THEREFOR

A recombinant adeno-associated virus (rAAV) vector comprising an AAV capsid having a heterogeneous population of vp1 proteins, a heterogeneous population of vp2 protein and a heterogeneous population of vp3 proteins. The capsid contains modified amino acids as compared to the encoded VP1 amino acid sequence, the capsid containing highly deamidated asparagine residues at asparagine-glycine pair, and further comprising multiple other, less deamidated asparagine and optionally glutamine residues. 1. A recombinant adeno-associated virus (rAAV) which comprises: [ a heterogeneous population of AAVrh79 vp1 proteins selected from: vp1 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 738 of SEQ ID NO:2, vp1 proteins produced from SEQ ID NO:1, or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO:1 which encodes the predicted amino acid sequence of 1 to 738 of SEQ ID NO:2,', 'a heterogeneous population of AAVrh79 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 738 of SEQ ID NO:2, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2214 of SEQ ID NO:1, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2214 of SEQ ID NO:1 which encodes the predicted amino acid sequence of at least about amino acids 138 to 738 of SEQ ID NO:2,', 'a heterogeneous population of AAVrh79 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 204 to 738 of SEQ ID NO:2, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2214 of SEQ ID NO:1, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2214 ...

Directed Evolution and In Vitro Panning of Virus Vectors

The present invention provides methods of achieving directed evolution of viruses by in vivo screening or “panning” to identify viruses comprising scrambled AAV capsids having characteristics of interest, e.g., tropism profile and/or neutralization profile (e.g., ability to evade neutralizing antibodies). The invention also provides scrambled AAV capsids and virus particles comprising the same. 141-. (canceled)42. A nucleic acid encoding an AAV capsid , the nucleic acid comprising an AAV capsid coding sequence selected from the group consisting of:{'figref': {'@idref': 'DRAWINGS', 'FIG. 6Q'}, '(a) the nucleotide sequence of (HH67) (SEQ ID NO:55);'}{'figref': {'@idref': 'DRAWINGS', 'FIG. 6Q'}, '(b) a nucleotide sequence that is at least 98% identical to the nucleotide sequence of (HH67) (SEQ ID NO:55);'}(c) a nucleotide sequence that encodes the AAV capsid encoded by the nucleotide sequence of (a) but that differs from the nucleotide sequence of (a) due to the degeneracy of the genetic code; and(d) a nucleotide sequence that encodes an AAV capsid that is at least 98% identical to the AAV capsid encoded by the nucleotide sequence of (a) and that substantially retains at least one property of the AAV capsid encoded by the nucleotide sequence of (a).43. The nucleic acid of claim 42 , wherein the nucleic acid is a plasmid claim 42 , phage claim 42 , viral vector claim 42 , bacterial artificial chromosome (BAC) claim 42 , or yeast artificial chromosome (YAC).44. The nucleic acid of claim 43 , wherein the nucleic acid is an AAV vector comprising the coding sequence.45. The nucleic acid of claim 44 , wherein the nucleic acid further comprises an AAV Rep coding sequence.46. A cell having the nucleic acid of stably incorporated into its genome.47. A virus particle comprising the nucleic acid of .48. The virus particle of claim 47 , wherein the virus particle is an AAV particle claim 47 , an adenovirus particle claim 47 , a herpesvirus particle claim 47 , or a baculovirus ...

FASL IMMUNOMODULATORY GENE THERAPY COMPOSITIONS AND METHODS FOR USE

Disclosed are compositions comprising a sequence encoding a non-self polypeptide of interest (POI), and a sequence encoding a non-cleavable FASL, wherein expression of the non-cleavable FASL in the presence of IL-6 or TNF-alpha eliminates WIC-mediated immunogenic peptides and helper T cells specific to the expression of the POI. Methods of making and methods of using compositions of the disclosure are also provided. For example, compositions of the disclosure may be used in the combined treatment of a disease or disorder in a subject and immune masking activity specific to the treatment. Exemplary disease or disorders of the disclosure include genetic and epigenetic diseases or disorders. 1. A composition comprising:(a) a sequence encoding a non-self polypeptide of interest (POI), and(b) a sequence encoding a non-cleavable Fas Ligand (FASL),wherein expression of the non-cleavable FASL eliminates MHC-mediated immunogenic peptides and helper T cells specific to the expression of the POI.2. The composition of claim 1 , wherein expression of the non-cleavable FASL selectively eliminates a T-cell that recognizes a MHC-peptide complex claim 1 , wherein the peptide is derived from the non-self polypeptide claim 1 , and wherein expression of FASL is in the presence of IL-6 or TNF-alpha.3. The composition of claim 1 , wherein the non-self POI is a nucleoprotein complex encoded by (i) a sequence comprising a guide RNA (gRNA) that specifically binds a target sequence within an RNA molecule claim 1 , and (ii) a sequence encoding an RNA-binding polypeptide.4. The composition of claim 1 , wherein a vector comprises the sequence of (a) and the sequence of (b).56.-. (canceled)7. The composition of claim 1 , wherein a promoter drives expression of the sequence of (a).8. The composition of claim 1 , wherein the promoter drives expression of the sequence of (b).9. The composition of claim 8 , wherein the promoter is a promoter regulated by the presence of IL-6 receptor or TNF-alpha ...

CAPSID

There is described an AAV capsid protein having an amino acid sequence which has at least 98% identity to the sequence of SEQ ID NO: 3 or at least 94% identity to the sequence of SEQ ID NO: 4. Also described is a pharmaceutical composition, an AAV capsid and a viral particle comprising the capsid protein, a recombinant AAV vector comprising a nucleotide sequence which encodes for the capsid protein, and a host cell and a transgenic animal comprising the capsid protein or the vector. In addition, there is described a method of transferring a nucleic acid of interest into a mammal comprising introducing a recombinant AAV vector into the mammal, wherein the recombinant AAV vector comprises a gene of interest which is encapsidated into a capsid comprising the capsid protein. 1. A protein comprising an amino acid sequence having at least 99% identity to SEQ ID NO: 3.2. The protein of claim 1 , wherein the amino acid sequence has at least 99.5% identity to SEQ ID NO: 3.3. The protein of claim 1 , wherein the amino acid sequence has the sequence of SEQ ID NO. 3.46.-. (canceled)7. A polynucleotide encoding the protein of claim 1 , or{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, 'an AAV capsid, a viral particle, a host cell, a transgenic animal, or a pharmaceutical composition comprising the protein of .'}811.-. (canceled)12. A method of treating a subject claim 1 , the method comprising:{'claim-ref': {'@idref': 'CLM-00007', 'claim 7'}, 'administering the polynucleotide, AAV capsid, viral particle, or pharmaceutical composition of to the subject.'} The invention relates to adeno-associated virus (AAV) capsid variants.Multiple recombinant gene transfer vectors based on different viruses have been developed in recent years. Gene transfer vectors based on adeno-associated virus (AAV), i.e., AAV vectors, are preferred due to their ability to transduce different types of dividing and non-dividing cells of different tissues and the ability to establish stable, long-term ...

Enhanced delivery of viral particles to the striatum and cortex

Provided herein are novel methods for delivering recombinant adeno-associated viral (rAAV) particles to the central nervous system of a mammal (e.g., a human). In aspects, the methods involve administering rAAV particles containing a heterologous nucleic acid to the striatum and causing expression of the heterologous nucleic acid in at least the cerebral cortex and the striatum of the mammal.

Fusion Proteins Comprising a Cell Surface Marker Specific VHH

The present invention relates to fusion proteins comprising a cell surface marker specific VHH. In particular, the invention relates to bispecific VHH adaptor proteins, i.e. fusion proteins comprising an adeno-associated virus (AAV) specific VHH linked to a cell surface marker specific VHH. Moreover, the invention relates to a recombinant AAV which comprises a fusion protein in which a cell surface marker specific VHH is integrated into a capsid protein of the AAV. Also nucleotide sequences encoding such fusion proteins, vectors are contemplated. The invention moreover refers to uses of the fusion proteins and nucleic sequences for gene therapy. 1. Fusion protein comprising a cell surface marker specific VHH.2. Fusion protein according to further comprising an adeno-associated virus (AAV) specific VHH.3. The fusion protein according to any one of the preceding claims claim 1 , wherein the serotype of the AAV is selected from the group consisting of AAV1 claim 1 , AAV2 claim 1 , AAV3 claim 1 , AAV4 claim 1 , AAV5 claim 1 , AAV6 claim 1 , AAV7 claim 1 , AAV8 claim 1 , AAV9 claim 1 , AAV10 claim 1 , AAV11 claim 1 , AAV12 claim 1 , AAVrh10 or variants thereof or a combination thereof.4. The fusion protein according to any one of the preceding claims claim 1 , wherein the serotype of the AAV is AAV1 and/or AAV2 or variants thereof.5. The fusion protein according to claim 4 , wherein the serotype of the AAV is AAV1.6. The fusion protein according to claim 5 , wherein the sequence of the adeno-associated virus (AAV) specific VHH is selected from the group consisting of SEQ ID NO: 20 to 24 or sequences having at least 80% identity thereto.7. The fusion protein according to claim 4 , wherein the serotype of the AAV is AAV1 or AAV2.8. The fusion protein according to claim 7 , wherein the sequence of the adeno-associated virus (AAV) specific VHH is selected from the group consisting of SEQ ID NO: 25 to 27 or sequences having at least 80% identity thereto.9. The fusion protein ...

RATIONAL POLYPLOID ADENO-ASSOCIATED VIRUS VECTORS AND METHODS OF MAKING AND USING THE SAME

The present invention provides a polyploid adeno-associated virus (AAV) capsid, wherein the capsid comprises capsid protein VP1, wherein said capsid protein VP1 is from one or more than one first AAV serotype, wherein said capsid protein VP2 is from one or more than one first AAV serotype and capsid protein VP3, wherein said capsid protein VP3 is from one or more than one second AAV serotype and wherein at least one of said first AAV serotype is different from at least one of said second AAV serotype and is different from at least one of said third AAV serotype, in any combination. 1. A substantially homogenous population of adeno-associated virus (AAV) virions having at least two viral structural proteins from the group consisting of AAV capsid proteins VP1 , VP2 , and VP3 , wherein the at least two viral structural proteins are sufficient to form an AAV virion that encapsidates an AAV genome , and wherein at least one of the at least two viral structural proteins present is from a single AAV serotype and is from a completely different serotype than the other viral structural protein , and wherein the VP1 is only from one serotype , the VP2 is only from one serotype , and the VP3 is only from one serotype , wherein the virions comprise a heterologous gene that encodes a protein to treat a disease or disorder , wherein the disease or disorder is hemophilia A , hemophilia B , diabetes mellitus , cancer , arthritis , muscle wasting , heart disease , a neurological disease or disorder , an autoimmune disease , a skeletal muscle disease , cystic fibrosis , thalassemia , phenylketonuria , LDL receptor deficiency , hyperammonemia , anemia , arthritis , a retinal degenerative disorder , or adenosine deaminase deficiency.2. The substantially homogenous population of claim 1 , wherein all three viral structural proteins are present.3. The substantially homogenous population of claim 2 , wherein all three viral structural proteins are from different serotypes.4. The ...

MODIFIED AAV CAPSID PROTEINS AND USES THEREOF

Adeno associated viral (AAV) particles are emerging as a useful vehicle for gene delivery to various organs and tissues, one of them being the retina. Provided here are variant AAV (e.g., variant serotype 2 (AAV2)) capsid proteins and variant capsid protein containing particles with enhanced ability to transduce retinal cells. 172-. (canceled)73. A variant recombinant adeno-associated virus (rAAV) capsid protein comprising a peptide inserted into the capsid protein between positions 585 and 588 of AAV2 VP1 capsid protein and comprising any one of the following combinations of amino acid substitutions:a. aspartic acid, glycine, glutamic acid, aspartic acid, phenylalanine, at positions corresponding to amino acids 492, 493, 494, 499 and 500 of AAV2 VP1 capsid protein, respectively;b. asparagine, alanine, aspartic acid, glycine, glutamic acid, aspartic acid, and phenylalanine at positions corresponding to amino acids 263, 264, 492, 493, 494, 499, and 500 of AAV2 VP1 capsid protein, respectively, and SAAGADXAXDS (SEQ ID NO: 5) at positions corresponding to amino acids 546-556 of AAV2 VP1 capsid protein;c. alanine, threonine, proline, aspartic acid, phenylalanine, and aspartic acid at positions corresponding to amino acids 263, 490, 492, 499, 500, and 530 of AAV2 VP1 capsid protein, respectively;d. asparagine, alanine, phenylalanine, alanine, asparagine, valine, threonine, arginine, aspartic acid, and aspartic acid at positions corresponding to amino acids 263, 264, 444, 451, 454, 455, 459, 527, 530, and 531 of AAV2 VP1 capsid protein, respectively; ande. aspartic acid, glycine, glutamic acid, aspartic acid, and phenylalanine at positions corresponding to amino acids 492, 493, 494, 499, and 500 of AAV2 VP1 capsid protein, respectively, and EDATENXIXXDR (SEQ ID NO: 4) at positions corresponding to amino acids 545-556 of AAV2 VP1 capsid protein;wherein each X corresponds to amino acids of a wild-type AAV2 VP1 capsid sequence as set forth in SEQ ID NO: 1, or homologous ...

ADENO-ASSOCIATED VIRUS PURIFICATION METHODS

Provided herein are methods of producing an adeno-associated virus (AAV) product and methods of purifying adeno-associated virus. AAV is loaded onto an affinity resin, wash steps are undertaken at room temperature, and AAV is eluted from the affinity resin at a lower temperature. Various buffers are disclosed for use in the wash steps and elution. 1. A method of purifying an adeno-associated virus (AAV) comprising(a) loading an AAV containing solution onto an affinity resin targeted against the AAV at room temperature and under conditions that allow binding between the AAV in the solution and the affinity resin;(b) undertaking at least one wash step at room temperature; and(c) eluting the AAV from the affinity resin at a temperature of less than 18° C.2. The method of claim 1 , wherein the temperature in step (c) is between 1° C. and 12° C.3. The method of claim 1 , wherein the temperature in step (c) is between 2° C. and 8° C.4. The method of any one of to claim 1 , further comprising contacting the AAV containing solution with an anion exchanger and eluting the AAV containing solution from the anion exchanger prior to loading the AAV containing solution onto the affinity resin.5. The method of any one of to claim 1 , wherein at least two wash steps are performed at room temperature.6. The method of any one of to claim 1 , wherein at least three wash steps are performed at room temperature.7. The method of any one of to claim 1 , wherein at least four wash steps are performed at room temperature.8. The method of claim 5 , wherein two wash steps are performed.9. The method of claim 6 , wherein three wash steps are performed.10. The method of claim 7 , wherein four wash steps are performed.11. The method of any one of to claim 7 , wherein the wash steps are performed in succession.12. The method of any one of to claim 7 , wherein at least one wash buffer comprises from about 10 mM to about 200 mM TrisHCl and from about 50 mM to about 500 mM salt.13. The method of ...

Modified AAV Capsid Proteins for Treatment of Arthritic Disease

The invention relates to recombinant adeno-associated virus (rAAV) virions for gene therapy, wherein the rAAV virions comprise a novel capsid protein. In particular, the invention relates to the use of such virions in gene therapy for the treatment of an arthritic disease, such as for example rheumatoid arthritis, or symptoms thereof, preferably by intraarticular administration. 118.-. (canceled)20. The method according to claim 19 , wherein the amino acid sequence Z is present at a location corresponding to a position 120-180 amino acid residues from the C terminus of a wild-type AAV capsid protein.21. The method according to claim 20 , wherein the amino acid sequence Z is present at a location corresponding to a position 130-170 amino acid residues from the C terminus of a wild-type AAV capsid protein.22. The method according to claim 21 , wherein the amino acid sequence Z is present at a location corresponding to a position 140-160 amino acid residues from the C terminus of a wild-type AAV capsid protein.23. The method according to claim 19 , wherein the IL-6 inhibitor is selected from the group consisting of an IL-6 receptor antagonist claim 19 , a humanized anti-IL-6 monoclonal antibody claim 19 , a chimeric anti-TL-6 monoclonal antibody claim 19 , a humanized rabbit anti-IL-6 monoclonal antibody claim 19 , and a soluble IL-6 receptor.24. The method according to claim 23 , wherein the IL-6 receptor antagonist is tocilizumab or sarilumab.25. The method according to claim 23 , wherein the humanized anti-IL-6 monoclonal antibody is olokizumab or sirukumab.26. The method according to claim 23 , wherein the chimeric anti-IL-6 monoclonal antibody is siltucimab.27. The method according to claim 23 , wherein the humanized rabbit anti-IL-6 monoclonal antibody is clazakizumab.28. The method according to claim 19 , wherein the promoter is a constitutive promoter or an inducible promoter.29. The method according to claim 28 , wherein the promoter is an NFκB responsive ...

COMPOSITIONS AND METHODS FOR TREATING DUCHENNE MUSCULAR DYSTROPHY

Described herein are triple-splice mutants of dystrophin or utrophin and methods of use thereof for treating Duchenne Muscular Dystrophy. Also provided are viral vectors which comprise a nucleic acid encoding a triple-splice mutant dystrophin or utrophin under the control of regulatory elements direct expression thereof. Compositions are also provided which contain such viral vectors formulated for delivery to a human patient. 1. A recombinant adeno-associated virus (rAAV) having an AAV capsid and a vector genome , wherein the vector genome comprises a nucleic acid sequence encoding a dystrophin superfamily mutant protein comprising a hybrid triple helical domain under control of regulatory sequences which direct expression thereof , the hybrid triple helical domain comprisinga first helix comprising an N-terminal portion of a helix A fused to a C-terminal portion of a helix A′;a second helix comprising an N-terminal portion of a helix B′ fused to a C-terminal portion of a helix B; anda third helix comprising an N-terminal portion of a helix C fused to a C-terminal portion of helix C′;wherein helices A, B, and C are present in a first triple helical repeat that is non-adjacent to a second triple helical repeat having helices A′, B′, and C′ in a native dystrophin superfamily protein.2. (canceled)3. The rAAV according to claim 1 , wherein the triple splice mutant protein is a triple splice mutant dystrophin and comprises a deletion in:(a) at least helical repeat 3 to helical repeat 21 of the full-length dystrophin;(b) at least helical repeat 3 to helical repeat 23 of the full-length dystrophin; or(c) at least helical repeat 2 to helical repeat 19 of the full-length dystrophin.4. (canceled)5. The rAAV according to claim 1 , wherein the triple splice mutant protein comprises the amino acid sequence of: SEQ ID NO: 1.67-. (canceled)8. The rAAV according to claim 1 , wherein the triple splice mutant protein comprises the amino acid sequence of SEQ ID NO: 22.9. (canceled)10 ...

HIGH-TRANSDUCTION-EFFICIENCY RAAV VECTORS, COMPOSITIONS, AND METHODS OF USE

The present invention provides AAV capsid proteins comprising modification of one or a combination of the surface-exposed lysine, serine, threonine and/or tyrosine residues in the VP3 region. Also provided are rAAV virions comprising the AAV capsid proteins of the present invention, as well as nucleic acid molecules and rAAV vectors encoding the AAV capsid proteins of the present invention. Advantageously, the rAAV vectors and virions of the present invention have improved efficiency in transduction of a variety of cells, tissues and organs of interest, when compared to wild-type rAAV vectors and virions. 1. An AAV VP3 protein comprising:(a) a non-lysine amino acid residue at a position that corresponds to K258, K321, K459, K490, K507, K527, K572, K532, K544, K549, K556, K649, K655, K665, or K706 of the wild-type AAV2 capsid protein of SEQ ID NO:2;(b) a non-lysine amino acid residue at a position that corresponds to K530, K547, or K569 of the wild-type AAV8 capsid protein of SEQ ID NO:8;(c) a non-serine amino acid residue at a position that corresponds to S261, S264, S267, S276, S384, S458, S468, S492, S498, S578, S658, S662, S668, S707, or S721 of the wild-type AAV2 capsid protein of SEQ ID NO:2;(d) a non-threonine amino acid residue at a position that corresponds to T251, T329, T330, T454, T455, T503, T550, T592, T581, T597, T491, T671, T659, T660, T701, T713, or T716 of the wild-type AAV2 capsid protein of SEQ ID NO:2; and/or(e) a non-tyrosine amino acid residue at a position that corresponds to Y252, Y272, Y444, Y500, Y700, Y704, or Y730 of the wild-type AAV2 capsid protein of SEQ ID NO:2.2. The AAV VP3 protein according to claim 1 , comprising a non-lysine amino acid residue at a position that corresponds to K459 claim 1 , K490 claim 1 , K532 claim 1 , K544 claim 1 , or K556 of the wild-type AAV2 capsid protein of SEQ ID NO:2.3. The AAV VP3 protein according to or claim 1 , comprising a non-lysine amino acid residue at a position that corresponds to K530 claim ...

MODIFIED AAV CAPSIDS AND USES THEREOF

The present disclosure provides adeno-associated virus (AAV) virions with altered capsid protein that binds heparan sulfate proteoglycans, where the AAV virions exhibit greater infectivity of retinal cells, altered tropism and/or the ability to bind and cross the inner limiting membrane following intravitreal injection. The present disclosure further provides methods of delivering a gene product to a retinal cell in an individual, and methods of treating ocular disease. 1. A non-naturally-occurring modified AAV capsid protein , comprising one or more amino acid modifications , wherein the modification confers heparan sulfate binding to the capsid protein.2. The modified AAV capsid protein of claim 1 , wherein the AAV is an AAV2.5T.3. The modified AAV capsid protein of claim 1 , wherein the AAV is an AAV2.5T/7m8.4. The modified AAV capsid protein of claim 3 , wherein the AAV2.5T/7m8 is an AAV2.5T/7m8(+3) claim 3 , an AAV2.5T/7m8(0) claim 3 , an AAV2.5T/7m8(−12) claim 3 , or an AAV2.5T/7m8(−3).5. The modified AAV2.5T capsid protein of claim 2 , wherein at least one of the one or more amino acid modifications comprises:(a) a S576R point mutation;(b) a T579R point mutation;(c) a substitution of amino acid residues 576-579 or 576-581 with the following amino acid residues: RGNRQA (SEQ ID NO:5);(d) a substitution of amino acid residues 576-581 with the following amino acid residues: RGNRQAAP (SEQ ID NO:6);(e) a substitution of amino acid residues 573-579, 573-581 or 573-584 with the following amino acid residues: NLQRGNRQAATA (SEQ ID NO:7); or(f) a substitution of amino acid residues 573-581 or 573-584 with the following amino acid residues: NLQRGNRQAATAAP (SEQ ID NO:8).6. The modified AAV2.5T/7m8 capsid protein of claim 3 , wherein at least one of the one or more amino acid modifications comprises:(a) a point mutation corresponding to a S576R point mutation in AAV2.5T;(b) a point mutation corresponding to a T579R point mutation in AAV2.5T;(c) a substitution corresponding ...

Enhanced transduction of aav vectors encoding micrornas

Provided herein are recombinant adeno-associated virus (rAAV) particles encoding microRNAs targeting the glucocorticoid receptor (GR) pathway, and in particular a microRNA17-92 (miR 17-92) cluster, and genes of interest. The modified genomes of these rAAV particles comprise heterologous nucleic acid sequences encoding microRNA structures. These particles exhibit enhanced transduction efficiencies in mammalian cells. Also provided herein are compositions of nucleic acids encoding the miR 17-92 cluster and nucleic acids encoding a gene of interest. Further provided herein are methods for administering these nucleic acid compositions to enhance transduction efficiencies.

ADENO-ASSOCIATED VIRUS VIRIONS WITH VARIANT CAPSIDS AND METHODS OF USE THEREOF

The present disclosure provides recombinant adeno-associated virus (AAV) virions with altered capsid protein, where the recombinant AAV (rAAV) virions exhibit greater ability to cross barriers between intravitreal fluid and retinal cells, and thus greater infectivity of a retinal cell compared to wild-type AAV, and where the rAAV virions comprise a heterologous nucleic acid. The present disclosure provides methods of delivering a gene product to a retinal cell in an individual. 1. A recombinant adeno-associated virus (rAAV) virion comprising:a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises an insertion of a heterologous peptide of any one of Formulas I-VI, and wherein the variant capsid protein confers increased infectivity of a retinal cell compared to the infectivity of the retinal cell by a control AAV virion comprising the corresponding parental AAV capsid protein; andb) a heterologous nucleic acid comprising a nucleotide sequence encoding a heterologous gene product.2. The rAAV virion of claim 1 , wherein the rAAV virion exhibits at least 5-fold increased infectivity of a retinal cell compared to the infectivity of the retinal cell by a control AAV virion comprising the corresponding parental AAV capsid protein.3. (canceled)4. The rAAV virion of claim 1 , wherein the insertion of the heterologous peptide replaces a contiguous stretch of from 5 amino acids to 20 amino acids of the parental AAV capsid protein.5. The rAAV virion of claim 1 , wherein the insertion site is between amino acids corresponding to amino acids 570 and 611 of VP1 of AAV2 claim 1 , or the corresponding position in the capsid protein of another AAV serotype.6. (canceled)7. The rAAV virion of any one of - claim 1 , wherein gene product is an interfering RNA claim 1 , an aptamer claim 1 , or a polypeptide.8. (canceled)9. The rAAV virion of claim 7 , wherein the polypeptide is a neuroprotective polypeptide claim 7 , an anti-angiogenic polypeptide claim 7 , or a ...

CHIMERIC CAPSIDS

The present invention relates to viral vectors and methods of their production and use. 1. A viral particle comprising a chimeric capsid protein encoded by a comprising:(a) a first nucleotide sequence region, said first nucleotide sequence region derived from a donor sequence; and(b) a second nucleotide sequence region, said second nucleotide sequence region being derived from an acceptor sequence.2. The viral particle of claim 1 , wherein said first or said second nucleotide sequence regions comprise a variable region (VR) or portion thereof.3. The viral particle of claim 2 , wherein the variable region is selected from the group consisting of VRI-CNS claim 2 , VRII-CNS claim 2 , VRIII-CNS claim 2 , VRIV-CNS claim 2 , VRV-CNS claim 2 , VRVI-CNS claim 2 , VRVII-CNS claim 2 , VRVII-CNS claim 2 , VRIX-CNS claim 2 , VRX-CNS claim 2 , VRXI-CNS claim 2 , VRXII-CNS and HI loop in .4. The viral particle of claim 2 , wherein the variable region is selected from the group consisting of VRI claim 2 , VRII claim 2 , VRIII claim 2 , VRIV claim 2 , VRV claim 2 , VRVI claim 2 , VRVII claim 2 , VRVIII claim 2 , VRIX and HI loop in .5. The viral particle of claim 2 , wherein the donor or acceptor sequence is selected from any of those listed in Tables 1-6.6. The viral particle of claim 1 , wherein the sequences are derived from a sequence selected from the group consisting of AAV1 claim 1 , AAV2 claim 1 , AAV3 claim 1 , AAV4 claim 1 , AAV5 claim 1 , AAV6 claim 1 , AAV7 claim 1 , AAV8 claim 1 , AAV9 claim 1 , AAV10 claim 1 , AAV11 claim 1 , AAV12 claim 1 , AAVrh8 claim 1 , AAVrh10 and AAV-DJ.7. The viral particle of claim 6 , wherein the sequence is derived from AAV2.8. (canceled)9. (canceled)10. (canceled)11. (canceled)12. (canceled)13. The viral particle of claim 1 , comprising an adeno-associated viral (AAV) polynucleotide encoding at least one transgene or payload.14. The viral particle of claim 13 , wherein said at least one transgene or payload encodes a therapeutic protein ...

CAPSID-MODIFIED RAAV VECTOR COMPOSITIONS AND METHODS THEREFOR

Disclosed are capsid-modified rAAV expression vectors, as well as infectious virions, compositions, and pharmaceutical formulations containing them. Also provided are methods of preparing and using the disclosed capsid-protein-mutated rAAV constructs in a variety of diagnostic and therapeutic modalities, including, inter alia, as mammalian cell-targeting delivery agents, and as human gene therapy vectors. Also disclosed are large-scale production methods for capsid-modified rAAV expression vectors, viral particles, and infectious virions having improved transduction efficiencies over those of the corresponding, un-modified, rAAV vectors, as well as use of the disclosed compositions in the manufacture of medicaments for a variety of in vitro and/or in vivo applications. 125-. (canceled)26. A modified AAV VP3 capsid protein , comprising:(A) a non-tyrosine amino acid residue at (i) one or more positions corresponding to Y445, Y705 and Y731 of the wild-type AAV6 capsid protein as set forth in SEQ ID NO:6; or (ii) one or more positions corresponding to Y444, Y500 and Y730 of the wild-type AAV2 capsid protein as set forth in SEQ ID NO:2;(B) a non-serine amino acid residue at a position corresponding to S663 of the wild-type AAV6 capsid protein as set forth in SEQ ID NO:6;(C) a non-threonine amino acid residue at a position corresponding to T492 of the wild-type AAV6 capsid protein as set forth in SEQ ID NO:6;(D) a combination of two or more amino acid substitutions listed in (A), (B), and (C); each with a non-native amino acid; or(E) a combination of tree or more amino acid substitutions listed in (A), (B), and (C); each with a non-native amino acid;or alternatively, wherein each of the amino acid substitutions is at an equivalent amino acid position corresponding thereto in any one of the other wild-type vector serotypes selected from the group consisting of AAV1, AAV3, AAV4, AAV5, AAV7, AAV9, and AAV10, as set forth in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, ...

ADENO-ASSOCIATED VIRUS VARIANT CAPSIDS AND METHODS OF USE THEREOF

Provided herein are variant adeno-associated virus (AAV) capsid proteins having one or more modifications in amino acid sequence relative to a parental AAV capsid protein, which, when present in an AAV virion, confer increased infectivity of one or more types of retinal cells as compared to the infectivity of the retinal cells by an AAV virion comprising the unmodified parental AAV capsid protein. Also provided are recombinant AAV virions and pharmaceutical compositions thereof comprising a variant AAV capsid protein as described herein, methods of making these rAAV capsid proteins and virions, and methods for using these rAAV capsid proteins and virions in research and in clinical practice, for example in, e.g., the delivery of nucleic acid sequences to one or more cells of the retina for the treatment of retinal disorders and diseases. 1. An infectious recombinant adeno-associated virus (rAAV) particle comprising (i) a capsid comprising a capsid protein comprising a heterologous peptide with a length of 7-11 amino acids covalently inserted between amino acids corresponding to amino acids 587 and 588 of VP1 of AAV2 (SEQ ID NO:2) or the corresponding position in the capsid protein of another AAV serotype , the peptide insertion comprising the amino acid sequence ISDQTKH (SEQ ID NO:14) and having from 1 to 3 spacer amino acids (Y-Y) at the amino and/or carboxyl terminus of amino acid sequence ISDQTKH (SEQ ID NO:14) and (ii) a nucleic acid comprising a nucleotide sequence encoding an interfering RNA that inhibits expression of a rhodopsin gene associated with autosomal dominant retinitis pigmentosa and optionally comprising a nucleotide sequence encoding a rhodopsin (RHO) protein operably linked to an expression control sequence.2. The infectious rAAV particle according to claim 1 , wherein the capsid protein comprises a P34A amino acid substitution relative to VP1 of AAV2 (SEQ ID NO:2) or the corresponding substitution in the capsid protein of another AAV serotype.3. ...

Adeno-Associated Virus Virions for Treatment of Epilepsy

Provided is a novel gene therapy means for neurological diseases including epilepsy. The present invention provides: a recombinant adeno-associated virus vector for use in the treatment of neurological diseases including epilepsy, which comprises a polynucleotide encoding a protein capable of improving the excitation-inhibiting function of an inhibitory synapse in vivo, preferably neuroligin-2 protein; a pharmaceutical composition comprising said recombinant vector; and others. The present invention also provides a method for treating a disease such as epilepsy using the recombinant vector. 112-. (canceled)13: A method for treatment of epilepsy in a subject , which comprises administrating to the subject a pharmaceutical composition comprising a recombinant adeno-associated virus vector , wherein the vector comprises:a polynucleotide comprising a nucleotide sequence encoding a neuroligin 2 protein which comprises the amino acid sequence of SEQ ID NO: 2, 4 or 6, anda capsid protein having a variant amino acid sequence which has the amino acid sequence of SEQ ID NO:11, and optionally one or more tyrosine residues in the sequence substituted with phenylalanine.14: The method according to claim 13 , which is administered intracerebrally.15: The method according to claim 13 , which is administered intrathecally.16: The method according to claim 13 , which is administered peripherally.17: The method according to claim 13 , which is used in combination with a chemotherapeutic agent for a neuropsychiatric disease.18: The method according to claim 13 , wherein the polynucleotide comprises a promoter sequence selected from the group consisting of a synapsin I promoter sequence claim 13 , a myelin basic protein promoter sequence claim 13 , a neuron specific enolase promoter sequence claim 13 , a calcium/calmodulin-dependent protein kinase II (CMKII) promoter sequence claim 13 , a tubulin al promoter sequence claim 13 , a platelet-derived growth factor β chain promoter sequence ...

ADENO-ASSOCIATED VIRUS (AAV) SEROTYPE 8 SEQUENCES, VECTORS CONTAINING SAME, AND USES THEREFOR

Sequences of a serotype 8 adeno-associated virus and vectors and host cells containing these sequences are provided. Also described are methods of using such host cells and vectors in production of rAAV particles. 1. An adeno-associated virus (AAV)8 viral vector comprising an AAV8 capsid having packaged therein a heterologous gene operably linked to regulatory sequences which direct its expression , wherein the heterologous gene encodes factor IX , wherein the AAV8 capsid comprises a vp3 capsid protein having the sequence of aa 203 to 737 of SEQ ID NO: 2 , or a sequence which is at least 95% identical to said sequence of aa 203 to 737 of SEQ ID NO: 2.2. The vector according to claim 1 , further comprising one or more AAV inverted terminal repeat (ITR) sequence from an AAV heterologous to AAV8.3. The vector according to claim 2 , wherein the one or more AAV ITR is from AAV2.4. A composition comprising the vector according to and a pharmaceutically acceptable carrier.5. A host cell containing the vector according to in culture.6. A method for treating hemophilia B claim 1 , said method comprising the step of contacting a cell with a vector according to claim 1 , wherein said vector directs expression of factor IX.7. The method according to claim 6 , wherein said vector is delivered via intravenous administration.8. An adeno-associated virus (AAV)8 viral vector comprising an AAV8 capsid having packaged therein a heterologous gene operably linked to regulatory sequences which direct its expression claim 6 , wherein the heterologous gene encodes ornithine transcarbamylase (OTC) claim 6 , wherein the AAV8 capsid comprises a vp3 capsid protein having the sequence of aa 203 to 737 of SEQ ID NO: 2 claim 6 , or a sequence which is at least 95% identical to said sequence of aa 203 to 737 of SEQ ID NO: 2.9. The vector according to claim 8 , wherein said OTC is human OTC.10. The vector according to claim 8 , further comprising one or more AAV inverted terminal repeat (ITR) ...

METHODS OF PREDICTING ANCESTRAL VIRUS SEQUENCES AND USES THEREOF

Methods are described for predicting ancestral sequences for viruses or portions thereof. Also described are predicted ancestral sequences for adeno-associated virus (AAV) capsid polypeptides. The disclosure also provides methods of gene transfer and methods of vaccinating subjects by administering a target antigen operably linked to the AAV capsid polypeptides. 1. An adeno-associated virus (AAV) capsid polypeptide having the amino acid sequence shown in SEQ ID NO: 15.2. The AAV capsid polypeptide of claim 1 , wherein the AAV capsid polypeptide or a virus particle comprising the AAV capsid polypeptide:exhibits a lower seroprevalence than does an AAV2 capsid polypeptide or a virus particle comprising an AAV2 capsid polypeptide, and wherein the AAV capsid polypeptide or a virus particle comprising the AAV capsid polypeptide exhibits about the same or a lower seroprevalence than does an AAV8 capsid polypeptide or a virus particle comprising an AAV8 capsid polypeptide; and/oris neutralized to a lesser extent by human serum than is an AAV2 capsid polypeptide or a virus particle comprising an AAV2 capsid polypeptide, and wherein the AAV capsid polypeptide or a virus particle comprising the AAV capsid polypeptide is neutralized to a similar or lesser extent by human serum than is an AAV8 capsid polypeptide or a virus particle comprising an AAV8 capsid polypeptide.3. The AAV capsid polypeptide of claim 1 , wherein the AAV capsid polypeptide is purified.4. The AAV capsid polypeptide of claim 1 , encoded by the nucleic acid sequence shown in SEQ ID NO: 16.5. A nucleic acid molecule encoding an adeno-associated virus (AAV) capsid polypeptide having the nucleic acid sequence shown in SEQ ID NO: 16.6. A vector comprising the nucleic acid molecule of .7. An isolated host cell comprising the vector of .8. A purified virus particle comprising the AAV capsid polypeptide of .9. The purified virus particle of claim 8 , further comprising a transgene. This application is a Divisional ...

VECTORS WITH MODIFIED INITIATION CODON FOR THE TRANSLATION OF AAV-REP78 USEFUL FOR PRODUCTION OF AAV

The present invention relates nucleic acid constructs for the production of recombinant parvoviral (e.g. adeno-associated viral) vectors in insect cells, to insect cells comprising such constructs and to methods wherein the cells are used to produce recombinant parvoviral virions. The insect cells preferably comprise a first nucleotide sequence encoding the parvoviral rep proteins whereby the initiation codon for translation of the parvoviral Rep78 protein is a suboptimal initiation codon that effects partial exon skipping upon expression in insect cells. The insect cell further comprises a second nucleotide sequence comprising at least one parvoviral (AAV) inverted terminal repeat (ITR) nucleotide sequence and a third nucleotide sequence comprising a sequences coding for the parvoviral capsid proteins. 1. A nucleic acid molecule comprising:(a) a first nucleotide sequence that comprises a single open reading frame (ORF) encoding parvoviral Rep78 and Rep52 proteins, with a translation initiation site of the Rep78 protein being a suboptimal initiation codon selected from the group consisting of ACG, TTG, CTG and GTG; and(b) an expression control sequence that comprises nonanucleotide sequence SEQ ID NO:7 upstream of the translation initiation site operably linked to the single ORF.2. The nucleic acid molecule according to claim 1 , wherein the parvoviral Rep proteins are AAV Rep proteins.3. The nucleic acid molecule according to claim 1 , wherein one or more false translation initiation sites between the Rep78 initiation site and the Rep52 initiation site have been deleted.4. A nucleic acid construct comprising a first nucleotide sequence that comprises a single open reading frame (ORF) encoding parvoviral Rep78 and Rep52 proteins claim 1 , with a translation initiation site of the Rep78 protein being a suboptimal initiation codon selected from the group consisting of ACG claim 1 , TTG claim 1 , CTG and GTG claim 1 ,wherein an expression control sequence for ...