Настройки

Укажите год
-

Небесная энциклопедия

Космические корабли и станции, автоматические КА и методы их проектирования, бортовые комплексы управления, системы и средства жизнеобеспечения, особенности технологии производства ракетно-космических систем

Подробнее
-

Мониторинг СМИ

Мониторинг СМИ и социальных сетей. Сканирование интернета, новостных сайтов, специализированных контентных площадок на базе мессенджеров. Гибкие настройки фильтров и первоначальных источников.

Подробнее

Форма поиска

Поддерживает ввод нескольких поисковых фраз (по одной на строку). При поиске обеспечивает поддержку морфологии русского и английского языка
Ведите корректный номера.
Ведите корректный номера.
Ведите корректный номера.
Ведите корректный номера.
Укажите год
Укажите год

Применить Всего найдено 2. Отображено 2.
14-07-2023 дата публикации

Cleaning system and method for coarse aggregate paste filling long-distance conveying pipeline

Номер: CN116422658A
Принадлежит:

The invention provides a coarse aggregate paste filling long-distance conveying pipeline cleaning system and method, and belongs to the technical field of mining. The system comprises a cleaning water system, a high-pressure air system and a process control system, firstly, full-tailing pumping cleaning is conducted, full-tailing paste is pumped through pressure, large-particle-size accumulated materials at a pipeline sudden change point are scoured and removed, and a fine sand cement caking layer on the inner wall of a pipeline is preliminarily abraded; then process water pumping cleaning is carried out, and all-tailing paste materials in the filling pipe network are removed and discharged by pumping clear water; and finally, high-pressure air-water combined cleaning is conducted, high-pressure air flow is used for conveying clean water to flush the pipeline, the pipeline cleaning time is guaranteed, meanwhile, the cleaning water consumption is reduced, and the underground environment ...

Подробнее
23-06-2023 дата публикации

Application of primer for detecting tRF expression in brain tissue in preparation of methylamphetamine addiction auxiliary diagnosis kit

Номер: CN116287186A
Принадлежит:

The invention relates to an application of a primer for detecting tRF expression in tissue in preparation of an auxiliary diagnostic kit for methamphetamine addiction, and is characterized in that the nucleotide sequence of tRF-132-Gly-GCC-2-M2 is as shown in SEQ ID NO: 1, and the specific expression of tRF-132-Gly-GCC-2-M2 in the tissue of a rat addiction to methamphetamine is reduced: the primer is F1: 5 'GATCGCATGGGTGGTCATAGT 3'; and R1: 5 'CTCTTCCGATCTAGGCGAGAAT 3'. Compared with the prior art, the molecular marker has the advantage that the specific expression of the down-regulated tRF-132-Gly-GCC-2-M2 in the tissues of the methamphetamine addiction rat can be used as a novel molecular marker for diagnosing the methamphetamine addiction.

Подробнее