VERFAHREN UND VORRICHTUNG FÜR GLOBALISIERTE PORTIERBARE INSASSENFAHRZEUGEINSTELLUNGEN

Ein System beinhaltet einen Prozessor, der zum Empfangen eines Satzes von fahrzeugspezifischen, benutzerspezifizierten physischen Fahrzeugsystemeinstellungen für ein erstes Fahrzeug konfiguriert ist. Der Prozessor ist ebenfalls konfiguriert zum Verwenden einer ersten physischen Fahrzeugkonfiguration zum Umwandeln der Systemeinstellungen in benutzerzentrische Einstellungen, die mindestens einen Abstand zwischen physischen Komponenten darstellen, der in dem ersten Fahrzeug durch die Systemeinstellungen erreicht wird. Der Prozessor ist ferner konfiguriert zum Speichern der umgewandelten benutzerzentrischen Einstellungen in Bezug auf ein Benutzerprofil.

Herstellung von Kaugummi mittels kontinuierlichem Mischer mit hohem Wirkungsgrad

Verwaltung des Stromverbrauchs eines Prozessors

Es werden im allgemeinen Techniken beschrieben, die sich auf die Verwaltung des Stromverbrauchs eines Prozessors beziehen. Ein beispielhaftes Verfahren kann umfassen: Festlegen einer Betriebszielvorgabe und eines ersten Betriebsparameters; Bestimmen eines zweiten Betriebsparameters auf der Basis der Betriebszielvorgabe und des ersten Betriebsparameters; Bewerten einer tatsächlichen Betriebsvorgabe; Vergleichen der Betriebszielvorgabe und der tatsächlichen Betriebsvorgabe; und Einstellen des ersten Betriebsparameters sowie des zweiten Betriebsparameters des Prozessors auf der Basis eines Vergleiches zwischen der Betriebszielvorgabe und der tatsächlichen Betriebsvorgabe, wobei die Betriebszielvorgabe keine Schlimmstfall-Betriebsvorgabe ist. Andere Beispiele für Verfahren, Systeme und Computerprogramme, die sich auf die Verwaltung des Stromverbrauches eines Prozessors beziehen, werden ebenfalls in Erwägung gezogen.

System und Verfahren zur Beseitigung einer harten Scheuerstelle und zur Optimierung eines Spülstroms in einer Gasturbine

Es sind ein System und Verfahren zur Beseitigung einer harten Scheuerstelle und Optimierung eines Spülstroms in einer Gasturbine bereitgestellt. Die Gasturbine weist eine Leitschaufel auf, die dafür eingerichtet ist, den Strom eines einströmenden Gases zu leiten. Die Gasturbine weist auch eine Laufschaufel auf, die dafür eingerichtet ist, das einströmende Gas zu expandieren und dem einströmenden Gas kinetische Energie zu entziehen. Die Gasturbine weist ferner einen Spülstrom auf, der von einem Verdichter entnommen wird und dafür eingerichtet ist, die Temperatur eines Radzwischenraums durch Begrenzung des Ansaugens des einströmenden Gases zu senken. Die Gasturbine weist auch einen Engelsflügel auf, der zwischen der Laufschaufel und der Leitschaufel angeordnet und dafür eingerichtet ist, als Dichtfläche zwischen der Laufschaufel und der Leitschaufel zu dienen. Die Gasturbine weist ferner ein Umwälzerblatt auf, das an einer Fläche des Engelsflügels in einer axialen Position angeordnet und ...

Artikel und Substrate, die eine verbesserte Leistungsfähigkeit durckbarer Elektronik bereitstellen

Diese Erfindung betrifft Substrate und Artikel, die diese Substrate nutzen, welche eine verbesserte Leistungsfähigkeit druckbarer Elektronik auf Polymersubstraten bereitstellen. Der Artikel umfasst ein Elastomer- oder thermoplastisches Elastomerfilmsubstrat, das mit einer Lösungsmittellösung oder wasserbasierten Dispersion eines Elastomers oder thermoplastischen Elastomers beschichtet ist, und einen elastischen elektrischen Leiter, der auf der Beschichtung abgeschieden ist. Das Aufbringen einer dünnen polymeren Beschichtung auf den Polymerfilm stellt eine verbesserte Leistungsfähigkeit der aufgedruckten Leiter bereit.

Leitfähige Pastenzusammensetzung und daraus hergestellte Halbleitervorrichtungen

Leitfähige Pastenzusammensetzung, die (i) ein mindestens ein leitfähiges Pulver umfassendes anorganisches Pulver, (ii) mindestens ein Mikrogelpolymer und (iii) ein Lösungsmittel umfasst. Die Pastenzusammensetzung kann in einem Verfahren zur Herstellung einer elektrischen Vorrichtung eingesetzt werden, das Folgendes umfasst: Herstellen eines Substrats; Auftragen der leitfähigen Paste auf das Substrat in einem vorgewählten Muster; und Erhitzen der aufgetragenen leitfähigen Paste zur Bildung einer leitfähigen Struktur, die eine Elektrode zum Verbinden der Vorrichtung bereitstellt. Die Pastenzusammensetzung ermöglicht nutzbringend die Bildung von schmalen Merkmalen mit hohem Aspektverhältnis in der leitfähigen Struktur.

Abschwächung einer stochastischen Frühzündung (SPI) unter Verwendung eines adaptiven SPI-Skalierers

Ein System umfasst ein Steuermodul und ein Modul für eine stochastische Frühzündung (SPI-Modul). Das Steuermodul steuert zumindest einen Leistungsparameter eines Motors eines Fahrzeugs. Das SPI-Modul detektiert SPI-Ereignisse, ermittelt einen Skalierungsfaktor basierend auf den detektierten SPI-Ereignissen und stellt eine Grenze, die dem zumindest einen Leistungsparameter zugeordnet ist, basierend auf dem Skalierungsfaktor ein. Das Steuermodul steuert den zumindest einen Leistungsparameter basierend auf der Grenze.

STRECKBARE POLYMER-DICKFILM-RUSSZUSAMMENSETZUNG FÜR TRAGBARE HEIZGERÄTE

Eine Polymer-Dickfilm-Rußzusammensetzung, umfassend 6 bis 13 Gew.-% eines leitenden Rußpulvers; und 87 bis 94 Gew.-% organisches Medium, umfassend thermoplastisches Polyurethanharz, das in einem organischen Lösungsmittel aufgelöst ist, kann verwendet werden, um das Widerstandselement von Heizgeräten in Anwendungen zu bilden, bei denen ein signifikantes Strecken erforderlich ist, insbesondere auf Substraten, die stark verlängert werden können und die insbesondere in tragbaren Kleidungsstückanwendungen verwendet werden können.

ANSTRICHMITTEL ZUM AUFTRAGEN UNTER VERWENDUNG EINES APPLIKATORS MIT HOHEM AUFTRAGSWIRKUNGSGRAD UND VERFAHREN UND SYSTEME DAFÜR

Es wird hierin ein System für das Auftragen eines Anstrichmittels beschrieben. Das System umfasst einen ersten Applikator mit hohem Auftragswirkungsgrad, der eine erste Düsenöffnung definiert und einen zweiten Applikator mit hohem Auftragswirkungsgrad, der eine zweite Düsenöffnung definiert. Das System umfasst ferner ein Reservoir. Das System enthält ferner einen Untergrund, der einen ersten Zielbereich und einen zweiten Zielbereich definiert. Der erste Applikator mit hohem Auftragswirkungsgrad und der zweite Applikator mit hohem Auftragswirkungsgrad sind so konfiguriert, dass sie das Anstrichmittel aus dem Vorratsbehälter aufnehmen und das Anstrichmittel durch die erste Düsenöffnung in den ersten Zielbereich des Untergrunds und durch die zweite Düsenöffnung in den zweiten Zielbereich des Untergrunds abgeben.

Motoranordnung und Verfahren zum Schätzen der Menge an Stickoxiden in dem Abgas eines Motors

Motoranordnung, umfassend:einen Motor (10), der so konfiguriert ist, dass der Motor (10) selektiv Abgas erzeugt, und durch eine Motordrehzahl, die einen Wert für selektiv variable Motordrehzahl aufweist, ein Äquivalenzverhältnis (204), das einen Wert für selektiv variables Äquivalenzverhältnis aufweist, und variable Betriebsbedingungen gekennzeichnet ist, die jeweils einen jeweiligen Wert für selektiv variable Betriebsbedingung besitzen;ein Abgassystem (78) mit einer Leitung (82), die einen Durchgang (86) definiert und funktionell mit dem Motor (10) verbunden ist, so dass das Abgas in den Durchgang (86) eintritt;ein Datenspeichermedium (128), das eine erste Datenbank (132) speichert, die für eine Mehrzahl verschiedener Kombinationen aus Motordrehzahlwert und Äquivalenzverhältniswert eine jeweilige geschätzte Menge an Stickoxiden (NOx) in dem Abgas dafür aufweist, wenn die Werte der variablen Betriebsbedingung bei vorbestimmten Referenzwerten liegen;einen Controller (114), der funktionell ...

Engine assembly comprises engine, which is configured, such that engine selectively generates exhaust gas and by engine speed, which has value for selectively variable engine speed

The engine assembly comprises an engine (10), which is configured, such that the engine selectively generates the exhaust gas and by an engine speed, which has a value for selectively variable engine speed. An exhaust system (78) is provided, which has a line (82) that defines a passageway (86) and operatively connected to the engine. A data storage unit (128) is provided storing a database (132) for multiple different combinations of engine speed value and estimated quantity of nitrogen oxides in exhaust gas. An independent claim is also included for a method for estimating the quantity of nitrogen oxides in the exhaust gas of an engine.

VERFAHREN ZUR HERSTELLUNG VON VERZWEIGTEM POLYESTERHARZ

Verfahren zur Herstellung eines verzweigten Polyesterharzes. Das Verfahren schließt insbesondere eine Alkoxylierungsreaktion ein, die das Reagieren eines Bisphenol A-(BPA)-Monomers mit einem zyklischen Alkylencarbonat einschließt.

Einrichtung und Verfahren für eine Brennkammereinrichtung

Eine Brennkammereinrichtung (14) enthält eine Endabdeckung (22) und eine stromabwärts der Endabdeckung (22) angeordnete Brennkammer (28). Die Brennkammereinrichtung (14) enthält ferner Düsen (24), die radial in der Endabdeckung (22) angeordnet sind, und einen Mantel (36), der mindestens eine der Düsen (24) umgibt, und der sich stromabwärts in die Brennkammer (28) erstreckt. Der Mantel (36) weist eine innere Wandfläche (38) und eine äußere Wandfläche (40) auf. Ein Verfahren zum Betrieb einer Brennkammereinrichtung (14) beinhaltet die Schritte: Leiten von verdichtetem Arbeitsfluid durch die Düsen (32, 34) in eine Brennkammer (28), Leiten von Brennstoff durch jede Düse (32) in einem ersten Teilsatz der Düsen (32) in die Brennkammer (28), und Zünden des von jeder Düse (32) in dem ersten Teilsatz von Düsen (32) stammenden Brennstoffs in der Brennkammer (28). Darüber hinaus beinhaltet das Verfahren die Schritte, einen gesonderten Mantel (36) um jede Düse (34) in einem zweiten Teilsatz der Düsen ...

Emulsion Aggregate-Toner, der ein Hybrid-Latex umfasst

Ein Toner umfasst einen Kern, umfassend eine homogenisierte Mischung eines ersten Polyester-Latex, ein Styrol/Acrylat-Latex und ein kompatibilisierendes Latexmittel, das ein Graft-Polyester-Styrol/Acrylat-Copolymer und eine Hülle umfasst, die einen Polyester-Latex umfasst. Ein Prozess umfasst (1) Homogenisieren einer Mischung zur Bildung einer Mehrzahl von Kernpartikeln, wobei die Mischung einen ersten Polyester-Latex, einen Styrol/Acrylat-Latex und ein kompatibilisierendes Latexmittel umfasst, umfassend ein Graft-Polyester-Styrol/Acrylat-Copolymer umfasst, und (2) Zugabe eines Hüll-Polyester-Latex zu der Mehrzahl von Kernpartikeln, um eine Mehrzahl von Kern-Hüll-Strukturen zu bilden.

PROZESSORKERNKOMMUNIKATION BEI MEHRKERNPROZESSOREN

Die Ausführungsformen der Offenbarung legen im Allgemeinen Techniken zum Handhaben von Kommunikationen zwischen Prozessorkernen dar. Einige beispielhafte Mehrkernprozessoren umfassen einen ersten Satz von Prozessorkernen in einem ersten Bereich des Mehrkernprozessors, der konfiguriert ist, um dynamisch eine erste Versorgungsspannung und ein erstes Taktsignal zu empfangen, einen zweiten Satz von Prozessorkernen in einem zweiten Bereich des Mehrkernprozessors, der konfiguriert ist, um dynamisch eine zweite Versorgungsspannung und ein zweites Taktsignal zu empfangen, und einen Schnittstellenblock, der mit dem ersten Satz von Prozessorkernen und mit dem zweiten Satz von Prozessorkernen gekoppelt ist, wobei der Schnittstellenblock konfiguriert ist, um Kommunikationen zwischen dem ersten Satz von Prozessorkernen und dem zweiten Satz von Prozessorkernen zu erleichtern.

Türöffner

Die Erfindung betrifft einen Türöffner (1) und ein Verfahren, durchgeführt in einem Türöffnersystem (100), mit einem Türöffner (1), der mit mindestens einem Türblatt (5) verbunden und hergerichtet ist, dieses zwischen einer geöffneten und einer geschlossenen Position zu bewegen. Der Türöffner (1) hat eine Steuereinheit (3), die konfiguriert ist, die Bewegung des mindestens einen Türblattes (5) zu steuern, wobei das Verfahren hat: Erhalten (S100) einer Sequenz von Inputdaten einer oder mehrerer Komponenten des Türöffners (1) oder des mindestens einen Türblattes (5) in einem Schlafmodus des Türöffnersystems (100), Empfangen (S110) der Sequenz von Inputdaten von der einen oder den mehreren Komponenten in der Steuereinheit (3) des Türöffners (1), und Auswerten (S120) der Sequenz von Inputdaten und Bewerten (S130) der Wahrscheinlichkeit, dass die Sequenz von Inputdaten einem Einbruchsversuch gegen das Türöffnersystem (100) korrespondiert.

Styrol/Acrylat-Polyester-Hybridtoner

Die vorliegende Offenbarung beschreibt Tonerpartikel mit einem Polyesterharz und einem Styrol/Acrylatharz im Kern.

Abschaltverteiler

Abschaltverteiler (10) mit einem Verteilerkörper (11), der mit einem Sockelschaft (14, 15) verbunden ist, wobei der Sockelschaft (14, 15) eine Vielzahl von Drehschiebern (16a16f, 17a17f) durchläuft, wobei jeder Drehschieber (16a16f, 17a17f) mit einem Druckgeber (18a18f, 19a19f) verbunden ist, wobei der Sockelschaft (14, 15) zwei Anschlussleitungen, nämlich eine Gebereingangsanschlussleitung (21a, 21b, 22a, 22b) und eine Ablassanschlussleitung (23a, 23b, 24a, 24b), umfasst, wobei die Drehschieber (16a16f, 17a17f) jeweils einen Strömungstrakt (25) umfassen; wobei der Verteilerkörper (11) eine Flüssigkeitsverbindung zwischen einer Eingangsquelle und der Gebereingangsanschlussleitung (21a, 21b, 22a, 22b) des Sockelschafts (14, 15) bereitstellt und der Verteilerkörper (11) auch eine Verbindung zwischen der Ablassanschlussleitung (23a, 23b, 24a, 24b) des Sockelschafts (14, 15) und einer Ablassöffnung (42) bereitstellt; wobei die Drehschieber (16a16f, 17a17f) jeweils unabhängig zwischen zwei Positionen ...

Verfahren und Vorrichtung zur Herstellung von Behältern aus thermoplastischem Material

Die Erfindung betrifft ein Verfahren zur Herstellung von Behältern (14) aus Vorformlingen (12) aus thermoplastischem Material mittels einer Blasmaschine (10) aufweisend mindestens eine Temperiervorrichtung (26) und eine Umformvorrichtung mit mindestens zwei Umformstationen (16), wobei die Vorformlinge (12) mittels der Temperiervorrichtung (26) anhand vorgebbarer erster Steuerparameter temperiert werden, und wobei jeweils ein temperierter Vorformling (12) mittels einer der Umformstationen (16) anhand vorgebbarer zweiter Steuerparameter in einen Behälter (14) umgeformt wird, dadurch gekennzeichnet, dass wenigstens einer der zweiten Steuerparameter für jede der Umformstationen (16) individuell vorgegeben werden, wobei mindestens eine Eigenschaft eines fertiggestellten Behälters (14) kontinuierlich messtechnisch erfasst wird, und wobei die erfasste Eigenschaft mit einer Referenzeigenschaft verglichen wird und anhand des Vergleichs zwischen der erfassten Eigenschaft und der Referenzeigenschaft ...

Last- unabhängiges Bewegungssteuerungssystem

Ein Bewegungssteuerungssystem, welches ausgelegt ist, die Bewegung eines Lastobjekts unabhängig vom Lastobjekt zu steuern, weist ein Hauptgehäuse auf, mit einer inneren Mutter, welche mit Bezug auf eine Längsachse des Hauptgehäuses befestigt ist, und ein mit einem Gewinde versehenes Schraubenrad, welches beweglich in dem Hauptgehäuse befestigt ist. Das mit einem Gewinde versehene Schraubenrad weist ein Ende auf, welches ausgelegt ist, funktionsmäßig an dem Lastobjekt befestigt zu werden. Das mit einem Gewinde versehene Schraubenrad ist mit der inneren Mutter in Schraubeingriff. Eine oder beide einer ersten Reibungskraft zwischen dem Schraubenrad und der Mutter und einer zweiten Reibungskraft zwischen der Mutter und mindestens einem Teil des Hauptgehäuses liefert eine Widerstandskraft, welche die Bewegung des Lastobjekts steuert.

WÄRMEMANAGEMENT IN MEHRKERNPROZESSOR

Die hierin beschriebenen Techniken betreffen im Allgemeinen Mehrkernprozessoren, die zwei oder mehr Prozessorkerne enthalten. Ausführungsbeispiele können Vorrichtungen, Verfahren und Computerprogramme in Bezug auf das Wärmemanagement im Mehrkemprozessor darlegen. Einige beispielhafte Verfahren können das Abrufen eines ersten Temperaturanzeigewerts für den ersten Prozessorkern während eines Zeitsteuerungsintervalls, Abrufen eines zweiten Temperaturanzeigewerts für den zweiten Prozessorkern ebenfalls während des Zeitsteuerungsintervalls und Zuweisen zum ersten Prozessorkern einer auszuführenden ersten Aufgabe auf der Basis eines Vergleichs des ersten Temperaturanzeigewerts und des zweiten Temperaturanzeigewerts umfassen, die während des Zeitsteuerungsintervalls abgerufen werden.

Vorabfüllen eines Cachespeichers bei Threadmigration

Es werden allgemein Verfahren zum Vorabfüllen eines mit einem zweiten Kern verknüpften Cachespeichers vor der Migration eines Threads von einem ersten Kern zu dem zweiten Kern offengelegt. Die vorliegende Erfindung zieht in Betracht, dass einige Computersysteme eine Vielzahl von Prozessorkernen umfassen können und dass einige Kerne Hardwareeigenschaften aufweisen können, die sich von anderen Kernen unterscheiden, dass eine Thread-/Kern-Zuordnung eingesetzt werden kann, um Threads geeigneten Kernen zuzuweisen, und dass in einigen Fällen ein Thread von einem Kern einem weiteren Kern neu zugewiesen werden kann. In einer probabilistischen Erwartung, dass ein Thread möglicherweise von einem ersten Kern zu einem zweiten Kern migriert wird, kann ein mit dem zweiten Kern verknüpfter Cachespeicher vorab gefüllt werden (er kann z. B. mit einigen Daten gefüllt werden, bevor der Thread auf den zweiten Kern umgeschichtet wird). Ein derartiger Cachespeicher kann zum Beispiel ein lokaler Cachespeicher ...

ANSTRICHMITTEL ZUM AUFTRAGEN UNTER VERWENDUNG EINES APPLIKATORS MIT HOHEM AUFTRAGSWIRKUNGSGRAD UND VERFAHREN UND SYSTEME DAFÜR

Hier wird ein System zum Auftragen eines ersten und eines zweiten Anstrichmittels vorgestellt. Das System umfasst einen ersten Applikator mit hohem Auftragswirkungsgrad, der eine erste Düsenöffnung definiert und einen zweiten Applikator mit hohem Auftragswirkungsgrad, der eine zweite Düsenöffnung definiert. Das System umfasst außerdem ein erstes Reservoir und ein zweites Reservoir. Das System enthält ferner einen Untergrund, der einen ersten Zielbereich und einen zweiten Zielbereich definiert. Der erste Applikator mit hohem Auftragswirkungsgrad ist so konfiguriert, dass er das erste Anstrichmittel aus dem ersten Vorratsbehälter aufnimmt und das erste Anstrichmittel durch die erste Düsenöffnung in den ersten Zielbereich des Untergrunds abgibt. Der zweite Applikator mit hohem Auftragswirkungsgrad ist so konfiguriert, dass er das zweite Anstrichmittel aus dem zweiten Vorratsbehälter aufnimmt und das zweite Anstrichmittel durch die zweite Düsenöffnung in den Zielbereich des Untergrunds abgibt ...

TONERTEILCHEN MIT ERHÖHTER OBERFLÄCHENHÄRTE UND TONER DAVON

Die vorliegenden Ausführungsformen betreffen Tonerteilchen mit erhöhter Oberflächenhärte und Toner, welche diese Tonerteilchen umfassen. Insbesondere betreffen die vorliegenden Ausführungsformen Tonerteilchen mit einer mittleren Oberflächenhärte von etwa 130 mPa bis etwa 250 Mpa, die einen Kern umfassen, der von einem Mantel umgeben ist, wobei der Mantel ein kristallines Harz umfasst.

Routing über Multi-Core-Netzwerke unter Verwendung von Realweltdaten oder modellierten Daten

System für Routing von Daten über ein Netz von Multi-Core-Prozessoren, das umfasst:ein Array (102) von Multi-Core-Prozessoren mit einer Vielzahl von Prozessorkernen (104);einen Speicher (120) zum Speichern von Daten, die sich auf ein Objekt beziehen, das modelliert wird, wobei die Daten Koordinateninformationen, die eine physikalische Position eines Teils des Objekts innerhalb eines zumindest dreidimensionalen Koordinatensystems angeben, und Objektdaten, die sich auf den Teil des modellierten Objekts beziehen, umfassen; undeinen Controller (116), der dazu konfiguriert ist,die Objektdaten auf Basis der mit den Objektdaten verknüpften zumindest dreidimensionalen Koordinateninformationen von dem Speicher (120) zu einem oder mehreren der Vielzahl von Prozessorkernen (104) des Array von Multi-Core-Prozessoren zu routen,einen nächsten oder mehrere nächste der Vielzahl von Prozessorkernen (104) auf Basis einer zeitabhängigen Änderung der Koordinateninformationen vorherzusagen, zu dem oder zu denen ...

HYPERPIGMENTIERTER MAGENTA-TONER

Ein hyperpigmentierter Magenta-Toner, der von einem Standard- oder herkömmlichen Magenta-Toner nicht zu unterscheiden ist, enthält PR122 und PR260 in einem Gewichtsverhältnis von 56:44 und kann mit einem reduziertem TMA im Vergleich zu einem herkömmlichen Magenta-Toner verwendet werden.

System und Verfahren beinhaltend eine Umfangsdichtungsanordnung zur Erleichterung der Abdichtung in einer Turbine

Geschaffen sind ein Verfahren und System mit einer Umfangsdichtungsanordnung zum Abdichten zwischen Bauteilen in einer Turbine. Eine Umfangsdichtungsanordnung ist in einem Schlitz angeordnet, der sich um den Umfang eines innenliegenden Zylinders erstreckt. Die Dichtungsanordnung weist eine erste Anpassungsschicht und mindestens eine zusätzliche Anpassungsschicht auf, die in einem überlappenden gestapelten Aufbau angeordnet sind, um die Endabschnitte jedes der Anpassungssegmente, die durch die Anpassungsschichten definiert sind, relativ zueinander und in Umfangsrichtung um die Dichtungsanordnung zu staffeln. Eine oder mehrere Gewebeschichten sind angeordnet, um die erste Anpassungsschicht und die wenigstens eine zusätzliche Anpassungsschicht zu umhüllen, um ein Dichtungselement zu bilden, das eine erste Dichtungsfläche und eine zweite Dichtungsfläche aufweist. Die Anordnung enthält ferner eine Grundplatte, wobei das Dichtungselement auf einer Oberseite der Grundplatte angeordnet ist, um ...

Entfeuchter mit einer verbesserten Fluidhandhabung sowie assoziierte Verfahren zur Verwendung und Herstellung

Es werden Entfeuchter mit einem verbesserten Luftfluss und verbesserten Fluidhandhabungsmerkmalen angegeben. Ein gemäß einer Ausführungsform konfigurierter Entfeuchter umfasst ein Gehäuse, eine Feuchtigkeit entfernende Komponente und einen Luftflussrichter. Das Gehäuse definiert wenigstens teilweise einen sich durch dasselbe erstreckenden Luftflusspfad. Die Feuchtigkeit entfernende Komponente ist in dem Gehäuse entlang eines Teils des Luftflusspfads angeordnet, wobei der Luftflusspfad in einer ersten Richtung in die Feuchtigkeit entfernende Komponente eintritt. Der Luftflussrichter erstreckt sich in Nachbarschaft zu der Feuchtigkeit entfernenden Komponente in einer Ebene, die allgemein parallel zu der ersten Richtung ist.

HYPERPIGMENTIERTER NIEDRIG SCHMELZENDER TONER

Ein niedrig schmelzender Toner umfasst einen Kern, welcher ein Kern-Polystyrolbutylacrylatharz, ein kristallines Polyesterharz, ein Pigment, welches in einer Menge von etwa 7 Gew.-% bis etwa 20 Gew.-% des niedrig schmelzenden Toners vorhanden ist, und ein Paraffinwachs aufweist; wobei ein Verhältnis des Polystyrolbutylacrylatharzes zu dem kristallinen Polyesterharz in einem Bereich von etwa 5:1 bis etwa 7:1 liegt; und eine über dem Kern angeordnete Hülle, die ein Hüllen-Polystyrolbutylacrylatharz umfasst.

DATA AND CONTROL ENCRYPTION

Secure communication of data between devices includes encrypting unencrypted data at a first device by reordering unencrypted bits provided in parallel on a device bus, including data and control bits, from an unencrypted order to form encrypted data including a plurality of encrypted bits in parallel in an encrypted order defined by a key. The encrypted data may be transmitted to another device where the encrypted data is decrypted by using the key to order the encrypted bits to restore the unencrypted order thereby to reform the unencrypted data. 1. A method of encryption , comprising:receiving on a device bus of a first device unencrypted data including a plurality of unencrypted bits, wherein the device bus of the first device includes a first plurality of wires defining a plurality of unencrypted bit positions and wherein each of the unencrypted bits is provided on one of the first plurality of wires in parallel in an unencrypted order;reordering, by the first device, the unencrypted bits provided on the device bus of the first device to form encrypted data, wherein the encrypted data includes a plurality of encrypted bits in parallel in an encrypted order defined by a key; andtransmitting the encrypted data to a second device.2. The method of further comprising:receiving at the second device the encrypted data; andordering at the second device the encrypted bits using the key to reform the unencrypted data on a device bus of the second device by restoring the order of the encrypted bits to the unencrypted order of the unencrypted bits, wherein the device bus of the second device includes a second plurality of wires and wherein each of the unencrypted bits is provided on one of the second plurality of wires.3. The method of further comprising periodically providing a new key to the first device and to the second device.4. The method of claim 1 , wherein the key defines a random encryption pattern.5. The method of further comprising providing a seed at the first ...

FUS/TLS-BASED COMPOUNDS AND METHODS FOR DIAGNOSIS, TREATMENT AND PREVENTION OF AMYOTROPHIC LATERAL SCLEROSIS AND RELATED MOTOR NEURON DISEASES

The invention provides novel FUS/TLS nucleic acids and proteins that comprise one or more genetic markers (for example, single nucleotide polymorphisms) and methods of use thereof including methods relating to the diagnosis of ALS or other related motor neuron disease by virtue of the presence of the mutant FUS/TLS sequence(s). 1. A method for diagnosing ALS or related motor neuron disease in a subject comprisingdetecting in a sample obtained from an individual one or more genetic markers in a FUS/TLS nucleic acid or fragment thereof,wherein the one or more genetic markers are selected from the group consisting of C1551G, C1561G, G1542T, G1543T, C1561T, G1562A, A1564G or G1572C, andwherein the presence of the one or more markers indicates that the individual has ALS or a related motor neuron disease or has a genetic predisposition or susceptibility for ALS or a related motor neuron disease.2. The method of claim 1 , wherein the mutation(s) is/are in exon 15 of FUS/TLS.3. The method of claim 1 , wherein one or more of the genetic markers encodes an amino acid change in the FUS/TLS protein (relative to wild type).4. The method of claim 4 , wherein the amino acid change is at H517Q claim 4 , R521G claim 4 , R514S claim 4 , G515C claim 4 , R521C claim 4 , R521H claim 4 , R522G claim 4 , or R524S.5. The method of claim 1 , wherein the method comprises detecting a haplotype comprising all 8 markers.6. The method of claim 1 , wherein the nucleic acid is DNA claim 1 , genomic DNA claim 1 , RNA claim 1 , cDNA claim 1 , hnRNA or mRNA.7. The method of claim 1 , wherein the detection is accomplished by sequencing claim 1 , hybridization claim 1 , restriction fragment analysis claim 1 , oligonucleotide ligation assay or allele specific PCR.8. The method of claim 1 , wherein the one or more genetic markers are identified using an antibody or antigen-binding fragment thereof that binds selectively to the mutant FUS/TLS protein.9. A diagnostic kit and/or a research kit claim 1 , ...

Performance of Emerging Applications in a Virtualized Environment Using Transient Instruction Streams

A method, system and computer-usable medium are disclosed for managing transient instruction streams. Transient flags are defined in Branch-and-Link (BRL) instructions that are known to be infrequently executed. A bit is likewise set in a Special Purpose Register (SPR) of the hardware (e.g., a core) that is executing an instruction request thread. Subsequent fetches or prefetches in the request thread are treated as transient and are not written to lower-level caches. If an instruction is non-transient, and if a lower-level cache is non-inclusive of the L1 instruction cache, a fetch or prefetch miss that is obtained from memory may be written in both the L1 and the lower-level cache. If it is not inclusive, a cast-out from the L1 instruction cache may be written in the lower-level cache. 1. A computer-implemented method for managing transient instruction streams , comprising:inserting a transient hint into an instruction request stream to indicate a transient instruction;processing the instruction request stream to identify the transient instruction;setting a transient instruction bit in a Special Purpose Register (SPR) when the transient instruction is identified;storing the transient instruction in a high-level cache; andprocessing the transient instruction, wherein the transient instruction is not stored in a lower-level cache.2. The method of claim 1 , wherein the transient hint is inserted in a Branch-and-Link (BRL) instruction.3. The method of claim 1 , wherein a non-transient hint is inserted into a Return (RET) instruction.4. The method of claim 3 , wherein the transient bit in the SPR is reset when the RET instruction containing the non-transient hint is processed.5. The method of claim 4 , wherein subsequent instructions are processed as non-transient instructions and are written to the lower-level cache after the transient bit is reset.6. The method of claim 1 , wherein subsequent instructions are processed as non-transient instructions and are written to ...

COLLECTOR FOR CAPTURING FLOW DISCHARGED FROM A SUBSEA BLOWOUT

A collector for capturing flow discharged from a subsea blowout includes a tubular housing having a containment chamber; a seal connected to the housing; a tubular chimney connected to the housing, having a portion of a subsea connector, and having a diameter less than a diameter of the containment chamber; and a head connected to the housing and the chimney. 1. A collector for capturing flow discharged from a subsea blowout , comprising:a tubular housing having a containment chamber;a seal connected to the housing;a tubular chimney connected to the housing, having a portion of a subsea connector, and having a diameter less than a diameter of the containment chamber; anda head connected to the housing and the chimney.2. The collector of claim 1 , wherein the seal is a grommet having a diameter corresponding to the chamber diameter.3. The collector of claim 1 , wherein the seal is an overshot or lip seal having a diameter greater than chamber diameter.4. The collector of claim 1 , wherein:the housing has a doorway formed in a side thereof, andthe seal lines the doorway.5. The collector of claim 1 , further comprising a second seal extending from an inner surface of the housing toward the doorway.6. The collector of claim 1 , further comprising:a conical landing guide connected to or formed into a lower portion of the housing;one or more pads connected to an inner surface of the landing guide.7. The collector of claim 6 , further comprising a sprayer ring connected to the landing guide and having outlets spaced therearound.8. The collector of claim 7 , further comprising a control panel operable by a remotely operated vehicle (ROV) claim 7 , the control panel having a port in fluid communication with the sprayer ring.9. The collector of claim 6 , further comprising:a support ring connected to the landing guide and having a diameter corresponding to a major diameter of the landing guide;a weight disposed in an annulus formed between the support ring and the landing ...

EFFICIENT STORAGE OF INDIVIDUALS FOR OPTIMIZATION SIMULATION

Candidate solutions to an optimization problem comprise a set of potential values that can be applied to variables in a problem description. Candidate solutions can be large because of the complexity of optimization problems and large number of variables. The populations of candidate solutions may also be large to ensure diversity and effectiveness in computing a solution. When the populations and the candidate solutions are large for an optimization problem, computing a solution to the optimization problem consumes a large amount of memory. In some instances, several generations of candidate solutions are stored in memory. Compression of the candidate solutions can minimize the memory space consumed to compute a solution to an optimization problem. 1. A method comprising:determining a difference comparison key for a plurality of individuals, wherein each of the individuals comprises a candidate solution for an optimization problem;computing logical differences between the difference comparison key and the plurality of individuals;compressing each of the logical differences to generate a plurality of compressed individuals; andusing the plurality of compressed individuals in an optimization simulation to generate a solution for the optimization problem.2. The method of claim 1 , wherein said determining the difference comparison key for the plurality of individuals comprises one of selecting one of the individuals as the difference comparison key claim 1 , generating the difference comparison key based on the individuals claim 1 , and generating the difference comparison key based on a second plurality of individuals.3. The method of claim 2 , wherein said selecting the difference comparison key comprises one of randomly selecting one of the individuals and selecting a first individual.4. The method of claim 2 , wherein said generating the difference comparison key based on the individuals comprises:determining a plurality of common values in the individuals; ...

Systems and methods for media stream processing

Portions of streaming media are selectively removed for storage and/or delivery over a computer network medium. The amount of data in a media stream itself may be selectively reduced for and, the amount of data in the media stream may be selected for delivery and/or storage so that it is reduced in a manageable and consistent fashion. Data within a media stream of a given temporal duration may be selected for delivery and/or storage in such a way that leads to a proportional increase in the maximum speed at which data from the given temporal duration of the media stream may be transmitted and reviewed while simultaneously providing the benefit of reducing overall storage capacity requirements. 1. A method for processing streaming media including frames , the method comprising:selectively removing at least one frame from the streaming media to form an altered media stream of reduced data size based upon a mode parameter that identifies which frames within a group of frames should be included in the altered media stream; andtransmitting the altered media stream over a computer network medium such that a speed of delivery of the streaming media is increased without an increase in associated network bandwidth.2. The method of claim 1 , wherein selectively removing frames is also based upon a play parameter that specifies a number of consecutive groups of frames to include in the altered media stream before removing at least one frame.3. The method of claim 1 , wherein selectively removing frames is also based upon a skip parameter that specifies a number of consecutive groups of frames to be excluded from the altered media stream.4. The method of claim 1 , wherein selectively removing frames is also based upon a rate parameter that specifies the frame rate at which the altered media stream is transmitted.5. The method of claim 1 , wherein the mode parameter is implemented using a real time streaming protocol (RTSP) uniform resources locator (URL).6. The method of claim ...

HIGH BIOAVAILABILITY ORAL PICOPLATIN ANTI-CANCER THERAPY

The invention provides a method of treatment of cancer, wherein a individual doses of picoplatin, each of less than about 200 mg picoplatin content, the individual doses having high oral bioavailability, are administered to a patient in need thereof. The oral bioavailability can be greater than about 50%, or greater than about 75%, or greater than about 90%, depending upon the particular dosage form and dosing regimen used. The invention provides a quasi-metronomic dosing schedule including drug dosing intervals and drug intermission intervals, optionally including fasting periods prior to and following administration of each individual dose of picoplatin. 1. A method of treating cancer in a human patient afflicted therewith , comprising administering orally to the patient one or more individual doses per day each comprising picoplatin , wherein each individual dose comprises less than about 200 mg of picoplatin , wherein an aggregate daily dose comprises a sum of the one or more individual doses administered within a single day , provided that when more than one individual dose makes up a aggregate daily dose , each individual dose is administered non-concurrently with each other individual dose over the course of the day.2. The method of wherein an oral bioavailability of each individual dose is greater than about 50%.3. The method of wherein a daily average oral bioavailability of the picoplatin to the patient from the daily aggregate dose is greater than about 50%.4. The method of further comprising administration of the individual doses claim 1 , each comprising a maintenance dose of less than about 200 mg of picoplatin claim 1 , throughout a drug dosing interval comprising a successive or intermittent plurality of days.5. The method of further comprising quasi-metronomic dosing comprising administering the picoplatin to the patient throughout a plurality of drug administration cycles comprising a duration of treatment claim 1 , each cycle comprising ...

Application Performance with Support for Re-Initiating Unconfirmed Software-Initiated Threads in Hardware

A method, system and computer-usable medium are disclosed for managing prefetch streams in a virtual machine environment. Compiled application code in a first core, which comprises a Special Purpose Register (SPR) and a plurality of first prefetch engines, initiates a prefetch stream request. If the prefetch stream request cannot be initiated due to unavailability of a first prefetch engine, then an indicator bit indicating a Prefetch Stream Dispatch Fault is set in the SPR, causing a Hypervisor to interrupt the execution of the prefetch stream request. The Hypervisor then calls its associated operating system (OS), which determines prefetch engine availability for a second core comprising a plurality of second prefetch engines. If a second prefetch engine is available, then the OS migrates the prefetch stream request from the first core to the second core, where it is initiated on an available second prefetch engine. 1. A computer-implemented method for managing prefetch streams in a virtual machine environment , comprising:polling registers in a plurality of processor cores to determine the availability of a corresponding plurality of prefetch engines;initiating a prefetch stream request on a first processor core comprising a first prefetch engine and a special purpose register (SPR);determining the first prefetch engine is unavailable to process the prefetch stream request;setting an indicator bit in the SPR to indicate a prefetch system dispatch fault;determining if a second prefetch engine in a second processor core is available to process the prefetch stream request; andmigrating the prefetch stream request from the first processor core to the second processor core if the second prefetch engine is available.2. The method of claim 1 , wherein a hypervisor generates a call to an operating system when the indicator bit is set in the SPR.3. The method of claim 2 , wherein the operating system receives and processes the call to determine the availability of the ...

OPTICALLY CLEAR DIAPHRAGM FOR AN ACOUSTIC TRANSDUCER AND METHOD FOR MAKING SAME

The present disclosure relates to a diaphragm that may be used with a mechanical-to-acoustical transducer. The diaphragm may include a layer of optically clear film, a damping layer and another layer of optically clear film. The damping layer may be an adhesive. The diaphragm may also comprise two optically clear films, optionally including a damping layer, wherein the films indicate a desired coefficient of linear thermal expansion in one or both of the machine and transverse directions. 170-. (canceled)71. An acoustic transducer that converts a mechanical motion in to acoustic energy , the acoustic transducer comprising:a diaphragm comprising a damping layer;at least one support on at least a portion of the diaphragm; andat least one actuator operatively coupled to the diaphragm, wherein movement of the actuator causes movement of the diaphragm in a direction that is generally transverse to the direction of the movement of the actuator.72. The transducer according to claim 71 , wherein the diaphragm is an optically clear diaphragm.73. The transducer according to claim 72 , wherein the diaphragm comprises first and second optically clear layers.74. The transducer according to claim 73 , wherein diaphragm is configured such that the damping layer is between the first and second optically clear layers.75. The transducer according to claim 71 , wherein the diaphragm and the support comprise substantially the same coefficient of linear thermal expansion.76. The diaphragm of claim 71 , wherein said diaphragm has a damping value of tan delta equal to or greater than 0.06 in the frequency range of 500 Hz to 2000 Hz at 30° C.77. The diaphragm of claim 71 , wherein said diaphragm has a damping value of tan delta equal to or greater than 0.08 in the frequency range of 500 Hz to 2000 Hz at 30° C.78. The diaphragm of claim 71 , where the thickness of the damping layer is in the range of 1 μm to 200 μm.79. The diaphragm of claim 71 , wherein said damping layer is an adhesive ...

METHOD AND APPARATUS FOR MINIMIZING CACHE CONFLICT MISSES

A method for minimizing cache conflict misses is disclosed. A translation table capable of facilitating the translation of a virtual address to a real address during a cache access is provided. The translation table includes multiple entries, and each entry of the translation table includes a page number field and a hash value field. A hash value is generated from a first group of bits within a virtual address, and the hash value is stored in the hash value field of an entry within the translation table. In response to a match on the entry within the translation table during a cache access, the hash value of the matched entry is retrieved from the translation table, and the hash value is concatenated with a second group of bits within the virtual address to form a set of indexing bits to index into a cache set. 1. A method for minimizing cache conflict misses , said method comprising:providing a translation table having a plurality of entries, wherein each entry includes a page number field and a hash value field;generating a hash value from a first group of bits within a virtual address;storing said hash value in said hash value field of an entry within said translation table; andin response to a match on said entry within said translation table during a cache access, retrieving said hash value of said matched entry from said translation table, and concatenating said hash value with a second group of bits within said virtual address to form a set of indexing bits to index into a cache set.2. The method of claim 1 , wherein said first group of bits is a plurality of most significant bits (MSBs).3. The method of claim 1 , wherein said second group of bits is a plurality of page bits within said virtual address.4. The method of claim 3 , wherein said second group of bits is the five most significant page bits.5. The method of claim 1 , wherein said hash value is represented by at least five bits.6. The method of claim 1 , wherein said translation table facilitates the ...

Technique for preserving memory affinity in a non-uniform memory access data processing system

Techniques for preserving memory affinity in a computer system is disclosed. In response to a request for memory access to a page within a memory affinity domain, a determination is made if the request is initiated by a processor associated with the memory affinity domain. If the request is not initiated by a processor associated with the memory affinity domain, a determination is made if there is a page ID match with an entry within a page migration tracking module associated with the memory affinity domain. If there is no page ID match, an entry is selected within the page migration tracking module to be updated with a new page ID and a new memory affinity ID. If there is a page ID match, then another determination is made whether or not there is a memory affinity ID match with the entry with the page ID field match. If there is no memory affinity ID match, the entry is updated with a new memory affinity ID; and if there is a memory affinity ID match, an access counter of the entry is incremented. 110-. (canceled)11. A computer readable medium having a computer program product for preserving memory affinity in a non-uniform memory access data processing system , said computer readable medium comprising:program code for, in response to a request for memory access to a page within a first memory affinity domain, determining whether or not said request is initiated by a processor associated with said memory affinity domain;program code for, in response to the determination that said request is not initiated by a processor associated with said memory affinity domain, determining whether or not there is a page ID match with an entry within a page migration tracking module associated with said memory affinity domain;program code for, in response to the determination that there is no page ID match with any entry within said page migration tracking module, selecting an entry within said page migration tracking module and providing said entry with a new page ID and a new ...

Partial Line Cache Write Injector for Direct Memory Access Write

A cache within a computer system receives a partial write request and identifies a cache hit of a cache line. The cache line corresponds to the partial write request and includes existing data. In turn, the cache receives partial write data and merges the partial write data with the existing data into the cache line. In one embodiment, the existing data is “modified” or “dirty.” In another embodiment, the existing data is “shared.” In this embodiment, the cache changes the state of the cache line to indicate the storing of the partial write data into the cache line. 1. A computer-implemented method comprising:receiving a partial write request at a cache;identifying a cache hit of a cache line in the cache, wherein the cache line corresponds to the partial write request and includes modified data;receiving partial write data at the cache that corresponds to the partial write request; andmerging, by the cache, the partial write data with the modified data into the cache line.2. The method of wherein the merging is independent of a memory controller.3. The method of wherein the cache line includes first order byte locations and second order byte locations claim 1 , the method further comprising:receiving a partial address bit value;determining, at the cache, that the partial address bit value corresponds to the first order byte locations; andstoring, by the cache, the partial write data in the first order byte locations in response to the determination.4. The method of further comprising:in response to the determining, re-circulating the modified data stored in the second order byte locations, wherein the re-circulating includes re-storing the modified data back into the second order byte locations.5. The method of wherein the partial write data and the partial address bit value is received from an I/O controller.6. The method of wherein the partial write request is received at a plurality of caches claim 1 , the method further comprising:identifying the cache hit of ...

DEVICE AND METHOD FOR TENSIONING AN ELONGATE MEMBER

An elongate member having a fixed end is passed through a plurality of grippers that impart tension in the elongate member and prevent the tension from being released. At least one gripper is movable while at least one other can be fixed. The movable gripper travels along the elongate member toward the fixed end then reverses direction, grips the elongate member, and carries the elongate member away from the fixed end, thereby creating tension in the elongate member. At least one gripper prevents the tension from being released. In some embodiments, the elongate member passes through a rotatable shaft with a lumen. The shaft can be in communication with a crank, whereby operation of the crank rotates the shaft. 1. A elongate member tensioning device comprising:a body with a distal end and a proximal end, a trigger linkedly connected to at least one of a first gripper and a second gripper, and', 'the second gripper being in communication with a spring coupled to an indicator;, 'a tensioning feature comprisinga handle; and an offset rod, a rotatable shaft with a lumen at the distal end of the body, a rotatable crank at the proximal end of the body,', 'a first set of gears in communication with the crank and the offset rod, and a second set of gears in communication with the shaft and the offset rod., 'a rotating feature comprising2. The device of claim 1 , wherein the rotating feature operates independently of the tensioning feature.3. The device of claim 1 , wherein the trigger is linkedly connected to the first gripper and the second gripper.4. The device of claim 1 , wherein moving the trigger proximally moves the second gripper distally.5. The device of claim 1 , further comprising a mechanism that releases the second gripper's grip on the elongate member.6. The device of claim 1 , wherein the distal end of the shaft is configured to interface a compressible implant.7. The device of claim 1 , wherein the first and second grippers are aligned with the shaft lumen ...

DETERMINING SERVER WRITE ACTIVITY LEVELS TO USE TO ADJUST WRITE CACHE SIZE

Provided are a computer program product, system, and method for determining server write activity levels to use to adjust write cache size. Information on server write activity to the cache is gathered. The gathered information on write activity is processed to determine a server write activity level comprising one of multiple write activity levels indicating a level of write activity. The determined server write activity level is transmitted to a storage server having a write cache, wherein the storage server uses the determined server write activity level to determine whether to adjust a size of the storage server write cache. 117-. (canceled)18. A method , comprising:gathering information on server write activity at a server;processing the gathered information on write activity to determine a server write activity level comprising one of multiple write activity levels indicating a level of write activity; andtransmitting the determined server write activity level to a storage server having a write cache, wherein the storage server uses the determined server write activity level to determine whether to adjust a size of the storage server write cache.19. The method of claim 18 , wherein the gathered server write activity is gathered on a per page basis for multiple memory pages which are accessed in the server claim 18 , wherein determining the server write activity level comprises determining a page write activity level for each of the pages being accessed in the server claim 18 , further comprising:processing the page write activity level of each page to determine the server write activity level.20. The method of claim 18 , wherein the gathered write activity information includes a number of writes to pages and a number of accesses to pages claim 18 , wherein processing the gathered information comprises comparing a calculation based on the number of writes and the number of accesses to at least one threshold to determine the server write activity level.21. A ...

Vibration-Powered Floating Object

A vibration-powered device adapted for flotation and propulsion on an upper surface in a liquid. The device having a body with a top side adapted to be at least partially disposed above the surface of the liquid, and a bottom side adapted to be at least partially submerged below the surface of the liquid. A vibration mechanism is disposed in the body. A propulsion fin is connected to the body. The fin includes a top side adapted to be disposed at least partially above the liquid surface, a bottom side adapted to be disposed at least partially below the surface. The vibration mechanism is adapted to oscillate the free distal end of the propulsion fin upward and downward. 1. A vibration-powered device adapted for flotation and propulsion on an upper surface in a liquid , said device comprising:a body having a longitudinal axis, a front end portion and a rear end portion, a top side and a bottom side, said top side adapted to be at least partially disposed above the surface of the liquid, said bottom side adapted to be at least partially submerged below the surface of the liquid;a vibration mechanism connected to the body;a propulsion fin, said fin having a proximal end connected to the body, said fin having a free distal end opposite the proximal end, said fin having a top side adapted to be disposed at least partially above the surface of the liquid, said fin having a bottom side adapted to be disposed at least partially below the surface of the liquid;wherein said vibration mechanism is adapted to oscillate the free distal end of the propulsion fin upward and downward.2. The vibration-powered device of wherein the vibration mechanism is adapted to oscillate the free distal end of the propulsion fin by flexing of the fin at a flex axis in an upward and downward flexure movement of the free distal end relative to the flex axis.3. The vibration-powered device of wherein the vibration mechanism is adapted to induce an oscillation in the device about an axis passing ...

ANTI-BACK OFF DEVICE FOR DOWN HOLE TOOLS AND DRIVE SYSTEMS

A percussion drilling assembly for drilling a borehole, the assembly including a tubular casing having a central axis defined therethrough and a lower end, a driver sub having an upper end threadingly engaged with the lower end of the tubular casing, and an annular locking member disposed between the tubular easing and the driver sub. The annular locking member is configured to engage the tubular casing and the driver sub, and is configured to prevent separation of the driver sub from the tubular casing. The annular locking member includes a deformable elongate member. 1. A percussion drilling assembly for drilling a borehole , the assembly comprising:a tubular casing having a central axis defined therethrough and a lower end;a driver sub having an upper end threadingly engaged with the lower end of the tubular casing; andan annular locking member disposed between the tubular casing and the driver sub, the annular locking member comprising a deformable elongate member,wherein the annular locking member is configured to engage the tubular casing and the driver sub, and is configured to prevent separation of the driver sub from the tubular casing.2. The assembly of claim 1 , wherein the tubular casing has an inner surface including a first groove claim 1 ,the driver sub has an outer surface including a second groove, andthe first groove of the tubular casing and the second groove of the driver sub are axially aligned.3. The assembly of claim 2 , wherein the annular locking member is disposed in a space formed between the first groove of the tubular casing and the second groove of the driver sub.4. The assembly of claim 1 , further comprising a hammer bit extending coaxially through the driver sub.5. The assembly of claim 3 , wherein the first groove of the tubular casing extends circumferentially within the inner surface of the tubular casing claim 3 , and the second groove of the driver sub extends circumferentially within the outer surface of the driver sub.6. The ...

OFF-LOADING OF PROCESSING FROM A PROCESSOR BLADE TO STORAGE BLADES

A processor blade determines whether a selected processing task is to be off-loaded to a storage blade for processing. The selected processing task is off-loaded to the storage blade via a planar bus communication path, in response to determining that the selected processing task is to be off-loaded to the storage blade. The off-loaded selected processing task is processed in the storage blade. The storage blade communicates the results of the processing of the off-loaded selected processing task to the processor blade. 1. A method , comprising:storing, in a storage blade, indicators that indicate whether the storage blade is idle or below a programmable threshold in processing activity and whether there is enough available cache in the storage blade for executing a job; anddetermining whether to off-load at least one job from a processor blade to the storage blade, based on the stored indicators.2. The method of claim 1 , wherein selected indicators set by the processor blade indicate:that the processor blade is transferring data and text of a job to the storage blade;that an image of the job has been completely sent by the processor blade, and the storage blade may execute the job; andthat the storage blade should transfer a final job image back to the processor blade.3. The method of claim 1 , wherein selected indicators set by the storage blade indicate:that a processor blade job is currently running in the storage blade;that the storage blade has paused execution of the processor blade job;that the processor blade job has completed successfully; andthat the processor blade job running on the storage blade encountered an I/O instruction that is to be processed by the processor blade.4. The method of claim 1 , wherein the indicators are set by the storage blade.5. The method of claim 1 , wherein:a plurality of storage blades and the processor blade are plugged into a chassis planar of a blade system; andthe plurality of storage blades are configured to perform ...

VARIABLE CACHE LINE SIZE MANAGEMENT

According to one aspect of the present disclosure, a system and technique for variable cache line size management is disclosed. The system includes a processor and a cache hierarchy, where the cache hierarchy includes a sectored upper level cache and an unsectored lower level cache, and wherein the upper level cache includes a plurality of sub-sectors, each sub-sector having a cache line size corresponding to a cache line size of the lower level cache. The system also includes logic executable to, responsive to determining that a cache line from the upper level cache is to be evicted to the lower level cache: identify referenced sub-sectors of the cache line to be evicted; invalidate unreferenced sub-sectors of the cache line to be evicted; and store the referenced sub-sectors in the lower level cache. 17-. (canceled)8. A system , comprising:a processor;a cache hierarchy coupled to the processor, the cache hierarchy including a sectored upper level cache and an unsectored lower level cache, wherein the upper level cache includes a plurality of sub-sectors, each sub-sector having a cache line size corresponding to a cache line size of the lower level cache; and identify referenced sub-sectors of the cache line to be evicted;', 'invalidate unreferenced sub-sectors of the cache line to be evicted; and', 'store the referenced sub-sectors in the lower level cache., 'logic executable to, responsive to determining that of a cache line from the upper level cache is to be evicted to the lower level cache9. The system of claim 8 , wherein the logic is executable to store an identifier associated with the upper level cache indicating referenced sub-sectors of a cache line of the upper level cache.10. The system of claim 9 , wherein the logic is executable to identify referenced sub-sectors of the cache line to be evicted by accessing the stored identifier.11. The system of claim 8 , wherein the logic is executable to:responsive to identifying a cache miss in the upper level ...

VARIABLE CACHE LINE SIZE MANAGEMENT

According to one aspect of the present disclosure, a method and technique for variable cache line size management is disclosed. The method includes: determining whether an eviction of a cache line from an upper level sectored cache to an unsectored lower level cache is to be performed, wherein the upper level cache includes a plurality of sub-sectors, each sub-sector having a cache line size corresponding to a cache line size of the lower level cache; responsive to determining that an eviction is to be performed, identifying referenced sub-sectors of the cache line to be evicted; invalidating unreferenced sub-sectors of the cache line to be evicted; and storing the referenced sub-sectors in the lower level cache. 1. A method for data processing in a data processing system , comprising:determining whether an eviction of a cache line from an upper level sectored cache to an unsectored lower level cache is to be performed, wherein the upper level cache includes a plurality of sub-sectors, each sub-sector having a cache line size corresponding to a cache line size of the lower level cache;responsive to determining that an eviction is to be performed, identifying referenced sub-sectors of the cache line to be evicted;invalidating unreferenced sub-sectors of the cache line to be evicted; andstoring the referenced sub-sectors in the lower level cache.2. The method of claim 1 , further comprising storing an identifier associated with the upper level cache indicating referenced sub-sectors of a cache line of the upper level cache.3. The method of claim 2 , wherein identifying referenced sub-sectors of the cache line to be evicted comprises accessing the stored identifier.4. The method of claim 1 , further comprising:responsive to identifying a cache miss in the upper level cache, determining whether requested data resides in the lower level cache; andresponsive to determining that the requested data resides in the lower level cache, storing at least one cache line of the ...

APPARATUS, SYSTEM, AND METHOD FOR AMMUNITION CARTRIDGE CASE ANNEALING

An apparatus, system, and method are disclosed for annealing an ammunition cartridge that include an inductive coil, the inductive coil substantially encompassing the sides of an annealing chamber, the inductive coil including a first portion comprising a first diameter and a second portion comprising a second diameter, wherein the first diameter is larger than the second diameter. Apparatus, system and method may also include an insert, the insert encompassing the sides of the annealing chamber, and a cartridge case that is unevenly heated such that the cartridge case obtains at least a first hardness at a first location and a second hardness at a second location, the first hardness different from the second hardness. 1. A method for heating a cartridge case blank , the method comprising:receiving a single cartridge case at a time in a first direction into an annealing chamber through a first opening;passing an alternating current through an inductive coil for a certain time period to heat the cartridge case; andreleasing the cartridge case from the annealing chamber in the first direction through a second opening.2. The method of claim 1 , wherein the cartridge case is unevenly heated such that the cartridge case obtains at least a first hardness at a first location and a second hardness at a second location claim 1 , the first hardness different from the second hardness.3. The method of claim 1 , wherein the first direction comprises a substantially downward vertical direction.4. The method of claim 1 , wherein the certain time period during which an alternating current is passed through the inductive coil is less than about two seconds.5. The method of claim 1 , wherein the certain time period during which an alternating current is passed through the inductive coil is between about 500 milliseconds and 800 milliseconds.6. The method of claim 1 , wherein passing an alternating current through an inductive coil comprises balancing a plurality of factors to get a ...

PERFORMANCE OF PROCESSORS IS IMPROVED BY LIMITING NUMBER OF BRANCH PREDICTION LEVELS

A method utilizes information provided by performance monitoring hardware to dynamically adjust the number of levels of speculative branch predictions allowed (typically 3 or 4 per thread). for a processor core. The information includes cycles-per-instruction (CPI) for the processor core and number of memory accesses per unit time. If the CPI is below a CPI threshold; and the number of memory accesses (NMA) per unit time is above a prescribe threshold, the number of levels of speculative branch predictions is reduced per thread for the processor core. Likewise, the number of levels of speculative branch predictions could be increased, from a low level to maximum allowed, if the CPI threshold is exceeded or the number of memory accesses per unit time is below the prescribed threshold. 1. A method implemented in a computer system that includes a processor having at least one processor core that includes a defined number of speculative branches , said method comprising:monitoring said processor core to determine a state of utilization phase within said processor core; andadjusting the predefined number of speculative branches based on the state of the utilization phase so determined within said processor core.2. The method of wherein the predefined number of speculative branches is reduced claim 1 , if the state of utilization phase indicates that the utilization of the core is relatively high.3. The method of wherein the predefined number of speculative branches is increased claim 1 , if the state of utilization phase indicates that the utilization of the core is relatively low.4. The method of wherein the state of utilization phase of said monitored core is determined by setting a first threshold representative of a desired level of utilization within said core; obtaining a count for cycles-per-instruction (CPI) for said processor core; comparing the count for the CPI with the first threshold; and indicating the state of utilization phase which indicates utilization ...

DYNAMIC PRIORITIZATION OF CACHE ACCESS

Some embodiments of the inventive subject matter are directed to determining that a memory access request results in a cache miss and determining an amount of cache resources used to service cache misses within a past period in response to determining that the memory access request results in the cache miss. Some embodiments are further directed to determining that servicing the memory access request would increase the amount of cache resources used to service cache misses within the past period to exceed a threshold. In some embodiments, the threshold corresponds to reservation of a given amount of cache resources for potential cache hits. Some embodiments are further directed to rejecting the memory access request in response to the determining that servicing the memory access request would increase the amount of cache resources used to service cache misses within the past period to exceed the threshold. 1. A method comprising:determining that a first memory access request results in a cache miss;determining an amount of cache resources used to service cache misses within a past period in response to determining that the first memory access request results in the cache miss;determining that servicing the first memory access request would increase the amount of cache resources used to service cache misses within the past period to exceed a threshold, wherein the threshold corresponds to reservation of a given amount of cache resources for potential cache hits;rejecting the first memory access request in response to the determining that servicing the first memory access request would increase the amount of cache resources used to service cache misses within the past period to exceed the threshold; andtentatively accepting a second memory access request after rejecting the first memory access request.2. The method of claim 1 , wherein the determining that servicing the first memory access request would increase the amount of cache resources used to service cache ...

DYNAMIC PRIORITIZATION OF CACHE ACCESS

Some embodiments of the inventive subject matter are directed to a cache comprising a tracking unit and cache state machines. In some embodiments, the tracking unit is configured to track an amount of cache resources used to service cache misses within a past period. In some embodiments, each of the cache state machines is configured to, determine whether a memory access request results in a cache miss or cache hit, and in response to a cache miss for a memory access request, query the tracking unit for the amount of cache resources used to service cache misses within the past period. In some embodiments, the each of the cache state machines is configured to service the memory access request based, at least in part, on the amount of cache resources used to service the cache misses within the past period according to the tracking unit. 16.-. (canceled)7. A cache comprising:a cache directory;a cache array; and a tracking unit configured to track an amount of cache resources used to service cache misses within a past period, and', determine whether a memory access request results in a cache miss or cache hit,', 'in response to a cache miss for a memory access request, query the tracking unit for the amount of cache resources used to service cache misses within the past period, and', 'service the memory access request based, at least in part, on the amount of cache resources used to service the cache misses within the past period according to the tracking unit., 'a plurality of cache state machines, wherein each of the plurality of cache state machines is configured to,'}], 'a cache controller coupled to the cache directory and the cache array, the cache controller comprising,'}8. The cache of wherein the tracking unit comprises at least one shift register and at least one counter claim 7 , wherein the at least one shift register comprises a number of flip flops equivalent to a number of clock cycles that comprise the past period claim 7 , wherein the at least one shift ...

APPARATUS, SYSTEM, AND METHOD FOR MANUFACTURING AMMUNITION CARTRIDGE CASES

The present disclosure relates to a system for forming a cartridge case, the system including a series of stages, each stage comprising a sequential location in the system, and each stage comprising a process step, wherein each process step is synchronized to occur within a substantially simultaneous stage interval, the stages including: an annealing stage, a head forming stage, and a taper stage. The present disclosure also relates to a method for manufacturing a cartridge case, the method including: receiving a single cartridge case at a time in a first direction into an annealing chamber through a first opening, passing an alternating current through an inductive coil for a certain time period to heat the cartridge case, releasing the cartridge case from the annealing chamber in the first direction through a second opening, and performing a forming step on the cartridge case. 1. A system for forming a cartridge case comprising: an annealing stage where an annealing step is performed,', 'a head forming stage where a head forming step is performed, and', 'a taper stage where a taper forming step is performed,, 'a series of stages, each stage comprising a sequential location in the system, and each stage comprising a process step, wherein each process step is synchronized to occur within a substantially simultaneous stage interval, the stages comprising'}wherein the cartridge case is sequentially transferred through the series of stages and wherein the cartridge case is maintained with a controlled orientation within and between the series of stages.2. The system of claim 1 , wherein the distance traveled between stages is less than twelve feet.3. The system of claim 1 , wherein the head forming step comprises press forming a head of the cartridge case with a press claim 1 , the press actuated by a servo motor.4. The system of claim 3 , wherein the cartridge case is seated in a die nest during press forming claim 3 , and wherein the die nest is monitored by a load ...

HYBRID STORAGE SUBSYSTEM WITH MIXED PLACEMENT OF FILE CONTENTS

A storage subsystem combining solid state drive (SSD) and hard disk drive (HDD) technologies provides low access latency and low complexity. Separate free lists are maintained for the SSD and the HDD and blocks of file system data are stored uniquely on either the SSD or the HDD. When a read access is made to the subsystem, if the data is present on the SSD, the data is returned, but if the block is present on the HDD, it is migrated to the SSD and the block on the HDD is returned to the HDD free list. On a write access, if the block is present in the either the SSD or HDD, the block is overwritten, but if the block is not present in the subsystem, the block is written to the HDD. 1. A computer-performed method of managing a storage subsystem including a lower-latency block storage device and a higher-latency block storage device , the method comprising:receiving a file read access operation request implicating multiple blocks of a single file corresponding to the file read access operation, wherein if the file implicated by the file access operation request is present in the storage subsystem, individual ones of the multiple blocks are stored exclusively either on the lower-latency block storage device or the higher-latency block storage device, wherein a first set of the multiple blocks corresponding to a first portion of the file are stored on the lower-latency block storage device, and wherein a second set of the multiple blocks corresponding to a second portion of the file and exclusive of the first portion of the file are stored on the higher-latency block storage device simultaneously with the first set of the multiple blocks being stored on the lower-latency block storage device;specifying a next block in the file implicated by the request as a given block;determining whether the given block is present in the lower-latency block storage device;responsive to determining that the given block is present in the lower-latency block storage device, accessing the ...

PACKING ASSEMBLY FOR A PUMP

A header ring for use in a stuffing box comprising an annular body portion of an elastomeric material, an annular radially inward projecting sealing lip portion formed on said body portion and an annular, axially facing pedestal portion formed on said body portion, said pedestal portion defining an annularly extending radially inwardly facing pedestal surface, the sealing lip portion defining an annularly extending, radially inward facing sealing surface, the sealing surface and the pedestal surface forming a juncture, at least a portion of the pedestal portion adjacent the juncture and forming the pedestal surface and at least a portion of the sealing lip portion adjacent the juncture and forming a portion of the sealing surface being comprised of a layer of reinforced elastomeric material bonded to the body portion. 1. A positive displacement reciprocating plunger-type pump , the pump adapted to displace a fluid within a subterranean well , the pump comprising:a housing having a generally cylindrical bore extending therethrough and forming a generally radially inwardly facing housing cylindrical surface;a plunger adapted to be movably positioned in the bore, such that an annulus is formed between the housing cylindrical surface and the plunger;at least one annular sealing ring adapted to be positioned in the annulus; a radially inwardly extending first surface adjacent the opening,', 'an axially extending second surface adjacent the opening,', 'an axially extending third surface opposite the opening,', 'a radially extending fourth surface extending between the second surface and the third surface,', 'an axially extending bead opposite the fourth surface, the bead being adjacent the first surface,', 'a fifth surface extending between the third surface and the bead, and', 'a layer of reinforced elastomeric material comprising a first section bonded to the first surface, a second section bonded to the second surface, a third section bonded to the fourth surface, a ...

LADDER RACK SYSTEM

A ladder rack includes: a frame assembly mountable on a vehicle, the frame assembly having at least two cross bows each including a principal length extending between opposite first and second ends; a pivot bracket pivotally coupled to the first ends of each cross bow, each pivot bracket adapted to support one side rail of a ladder, and each pivot bracket being pivotally moveable between a first position corresponding to the stowage position and a second position corresponding to the loading/unloading position; a stationary bracket disposed on each cross bow intermediate the first and second ends thereof, each stationary bracket adapted to abut another side rail of a ladder in the stowage position; a torsion bar interconnecting the pivot brackets; and a manually operable handle coupled to one of the torsion bar or a pivot bracket for moving the pivot brackets between the stowage position and the loading/unloading position. 1. A ladder rack for a vehicle comprising;a frame assembly mountable to the vehicle, and having at least two cross bows extending longitudinally between opposite first and second ends;a pivot bracket pivotally coupled to the first end of each of the cross bows to support one side rail of a ladder, and each pivot bracket is pivotally moveable between a first position corresponding to the stowage position and a second position corresponding to the loading/unloading position;a stationary bracket disposed on each of the cross bows intermediate the first and second ends thereof, wherein each stationary bracket abuts another side rail of a ladder in the stowage position;a torsion bar interconnecting the pivot brackets; anda manually operable handle coupled to one of the torsion bar or the pivot bracket for moving the pivot brackets between the stowage position and the loading/unloading position.2. The vehicle ladder rack according to claim 1 , further comprising a spring interconnecting each of the cross bows and said pivot p claim 1 , wherein the ...

ENERGY-AWARE JOB SCHEDULING FOR CLUSTER ENVIRONMENTS

A job scheduler can select a processor core operating frequency for a node in a cluster to perform a job based on energy usage and performance data. After a job request is received, an energy aware job scheduler accesses data that specifies energy usage and job performance metrics that correspond to the requested job and a plurality of processor core operating frequencies. A first of the plurality of processor core operating frequencies is selected that satisfies an energy usage criterion for performing the job based, at least in part, on the data that specifies energy usage and job performance metrics that correspond to the job. The job is assigned to be performed by a node in the cluster at the selected first of the plurality of processor core operating frequencies. 1. A method comprising:accessing data that specifies energy usage and job performance metrics that correspond to a job and a plurality of processor core operating frequencies, wherein the job has been requested of a cluster;selecting a first of the plurality of processor core operating frequencies that satisfies an energy usage criterion for performing the job based, at least in part, on the data that specifies energy usage and job performance metrics that correspond to the job;determining coefficients of an energy model based on the performance metrics and energy usage;estimating energy usage and performance metrics for the job at the first of the plurality of processor core operating frequencies based on the coefficients and the energy model;storing the estimated energy usage and performance metrics for the job at the first of the plurality of processor core operating frequencies;associating the stored estimated energy usage and performance metrics with the job and with the first of the plurality of processor core operating frequencies; andassigning the job to be performed by a node in the cluster at the selected first of the plurality of processor core operating frequencies.2. The method of further ...

PERFORMANCE-DRIVEN CACHE LINE MEMORY ACCESS

According to one aspect of the present disclosure a system and technique for performance-driven cache line memory access is disclosed. The system includes: a processor, a cache hierarchy coupled to the processor, and a memory coupled to the cache hierarchy. The system also includes logic executable to, responsive to receiving a request for a cache line: divide the request into a plurality of cache subline requests, wherein at least one of the cache subline requests comprises a high priority data request and at least one of the cache subline requests comprises a low priority data request; service the high priority data request; and delay servicing of the low priority data request until a low priority condition has been satisfied. 17-. (canceled)8. A system , comprising:a processor;a cache hierarchy coupled to the processor;a memory coupled to the cache hierarchy; and divide the request into a plurality of cache subline requests, wherein at least one of the cache subline requests comprises a high priority data request and at least one of the cache subline requests comprises a low priority data request;', 'service the high priority data request; and', 'delay servicing of the low priority data request until a low priority condition has been satisfied., 'logic executable to, responsive to receiving a request for a cache line9. The system of claim 8 , wherein the logic is executable to:place the low priority data request into a queue;initiate a timer; andresponsive to expiration of the timer, service the low priority data request.10. The system of claim 8 , wherein the logic is executable to:place the low priority data request into a queue;determine bus utilization; andresponsive to the bus utilization being below a threshold, service the low priority data request.11. The system of claim 8 , wherein the logic is executable to:place the low priority data request into a queue; andresponsive to the processor cancelling the low priority data request, remove the low priority ...

PERFORMANCE-DRIVEN CACHE LINE MEMORY ACCESS

According to one aspect of the present disclosure, a method and technique for performance-driven cache line memory access is disclosed. The method includes: receiving, by a memory controller of a data processing system, a request for a cache line; dividing the request into a plurality of cache subline requests, wherein at least one of the cache subline requests comprises a high priority data request and at least one of the cache subline requests comprises a low priority data request; servicing the high priority data request; and delaying servicing of the low priority data request until a low priority condition has been satisfied. 1. A method , comprising:receiving, by a memory controller of a data processing system, a request for a cache line;dividing the request into a plurality of cache subline requests, wherein at least one of the cache subline requests comprises a high priority data request and at least one of the cache subline requests comprises a low priority data request;servicing the high priority data request; anddelaying servicing of the low priority data request until a low priority condition has been satisfied.2. The method of claim 1 , further comprising:placing the low priority data request into a queue;initiating a timer; andresponsive to expiration of the timer, servicing the low priority data request.3. The method of claim 1 , further comprising:placing the low priority data request into a queue;determining bus utilization; andresponsive to the bus utilization being below a threshold, servicing the low priority data request.4. The method of claim 1 , further comprising:placing the low priority data request into a queue; andresponsive to a processor core cancelling the low priority data request, removing the low priority data request from the queue.5. The method of claim 1 , further comprising:placing the low priority data request into a low priority queue; andresponsive to receiving a sector address request corresponding to the low priority data ...

Vibration-Powered Floating Object

A vibration-powered device adapted for flotation and propulsion on an upper surface in a liquid. The device having a body with a top side adapted to be at least partially disposed above the surface of the liquid, and a bottom side adapted to be at least partially submerged below the surface of the liquid. A vibration mechanism is disposed in the body. A propulsion fin is connected to the body. The fin includes a top side adapted to be disposed at least partially above the liquid surface, a bottom side adapted to be disposed at least partially below the surface. The vibration mechanism is adapted to oscillate the free distal end of the propulsion fin upward and downward. 1. A method of propelling a vibration-powered device floating on an upper surface in a liquid , said method comprising:providing a device having a body with an internal water-resistant cavity and an external surface, the body further having a longitudinal axis, a front end portion and a rear end portion, a top side and a bottom side;providing a flotation member, the flotation member having a recess configured to directly secure to a portion of the external surface of the body, the flotation member having a shape configured to substantially maintain a portion of the top side of the body above the surface of the liquid and further configured to substantially maintain a portion of the bottom side of the body below the surface of the liquid when the flotation member is secured to the portion of the external surface of the body;vibrating a vibration mechanism disposed within the internal water resistant cavity and the vibration mechanism having a rotational motor adapted to rotate an eccentric load; andoscillating a free distal end of a propulsion fin upward and downward in response to the actuation of the vibration mechanism, and wherein said fin having a proximal end opposite the free distal end and the proximal end being connected to the body, said fin having a top side adapted to be disposed at least ...

MODULATION OF SPTLC1 VIA RECOMBINANT ADENO-ASSOCIATED VECTORS

The disclosure provides, in some aspects, compositions (e.g., isolated nucleic acids and rAAVs) comprising a transgene which encodes at least one inhibitory nucleic acid which decreases expression of a gene encoding a serine palmitoyltransferase protein (e.g., SPTLC1). In some aspects, the disclosure relates to methods of treating hereditary sensory and autonomic neuropathy 1 (HSAN1) by administering the compositions described by the disclosure to a cell or subject. 1. An isolated nucleic acid comprising a transgene encoding at least one inhibitory nucleic acid , wherein the at least one inhibitory nucleic acid reduces expression of a gene encoding a serine palmitoyltransferase subunit , and wherein the transgene is flanked by inverted terminal repeats (ITRs) derived from adeno-associated virus (AAV).2. The isolated nucleic acid of claim 1 , further comprising a second transgene encoding a selectable marker protein or a reporter protein.3. The isolated nucleic acid of claim 2 , wherein the selectable marker protein is selected from the group consisting of: ampicillin resistance claim 2 , neomycin resistance claim 2 , geneticin resistance claim 2 , and hygromycin resistance.4. The isolated nucleic acid of claim 2 , wherein the reporter protein is selected from the group consisting of: GFP claim 2 , YFP claim 2 , RFP claim 2 , beta-galactosidase claim 2 , and Luciferase.5. The isolated nucleic acid of any one of - claim 2 , wherein the transgene encoding the at least one inhibitory nucleic acid is located upstream of the transgene encoding the selectable marker protein or the reporter protein.6. The isolated nucleic acid of any one of - claim 2 , wherein the transgene encoding the selectable marker protein or the reporter protein is located upstream of the transgene encoding the at least one inhibitory nucleic acid.7. The isolated nucleic acid of any one of - claim 2 , wherein the inhibitory nucleic acid is a microRNA claim 2 , an artificial microRNA (amiRNA) claim 2 ...

SYSTEM AND METHOD FOR ADDING DATA TO A PRINTED PUBLICATION

Systems and methods for adding data to a printed publication are provided. One method includes receiving variable data and controlling an energy source to at least partially ablate the printed publication based on the variable data. The printed publication is printed on the substrate using the commercial printing press based on fixed data. Controlling the energy source to at least partially ablate the printed publication includes, after the printed publication has been printed on the substrate by the commercial printing press based on the fixed data, controlling the energy source to remove a portion of the printed publication based on the variable data. 1. A method of adding data to a printed publication printed on a substrate by a commercial printing press as the substrate travels through the commercial printing press , comprising:receiving variable data, wherein the variable data comprises, for a print run during which a plurality of copies of the printed publication are printed, data changed between at least two of the copies; andcontrolling an energy source to at least partially ablate the printed publication based on the variable data;wherein the printed publication is printed on the substrate using the commercial printing press based on fixed data, wherein the fixed data comprises data common to all of the copies of the printed publication printed during the print run; andwherein controlling the energy source to at least partially ablate the printed publication comprises, after the printed publication has been printed on the substrate by the commercial printing press based on the fixed data, controlling the energy source to remove a portion of the printed publication based on the variable data.2. The method of claim 1 , wherein the printed publication comprises a signature claim 1 , a book claim 1 , a mail piece claim 1 , a blown card claim 1 , a pamphlet claim 1 , an insert or an onsert.3. The method of claim 1 , wherein the energy source comprises a co2 ...

PRINTING USING COLOR CHANGEABLE MATERIAL

Systems and methods for printing data on a substrate including a color-changeable material are provided. One system includes a processing circuit and a device including an energy source. At least a portion of a printed publication is printed on the substrate using a commercial printing press based on fixed data. The device including the energy source is configured to add variable data to the substrate. The processing circuit is configured to receive the variable data and to control the energy source to change a color of the color-changeable material based on the variable data to provide at least a portion of the printed publication. The processing circuit is configured to control the energy source to change the color of the color-changeable material in-line with a flow of the substrate through one of a printing line, a finishing line, or a packaging line of the commercial printing press. 1. A method for printing data on a substrate comprising a color-changeable material using a printing press , the method comprising:receiving data representative of an image to be printed in the color-changeable material on the substrate, the image comprising a plurality of different colors; controlling a first parameter of light emitted by a first diode of the plurality of diodes to cause a first portion of the color-changeable material to change to a first color of the plurality of colors; and', 'controlling a second parameter of light emitted by a second diode of the plurality of diodes to cause a second portion of the color-changeable material to change to a second color of the plurality of colors, wherein the first parameter and the second parameter each comprise at least one of a wavelength, a frequency, or a power of the emitted light., 'controlling, using the input data, a laser diode array to illuminate the substrate to generate at least a portion of the image on the substrate using the color-changeable material, the laser diode array comprising a plurality of diodes ...

MEMORY MANAGEMENT SYSTEM, METHOD AND COMPUTER PROGRAM PRODUCT

According to one aspect of the present disclosure a method and technique for managing memory access is disclosed. The method includes setting a memory databus utilization threshold for each of a plurality of processors of a data processing system to maintain memory databus utilization of the data processing system at or below a system threshold. The method also includes monitoring memory databus utilization for the plurality of processors and, in response to determining that memory databus utilization for at least one of the processors is below its threshold, reallocating at least a portion of unused databus utilization from the at least one processor to at least one of the other processors. 1. A method comprising:setting a memory databus utilization system threshold for a data processing system;setting a memory databus utilization processor threshold for each of a plurality of processors of the data processing system to maintain a memory databus utilization of the data processing system at or below the system threshold;monitoring memory databus utilization for the plurality of processors; andin response to determining that memory databus utilization for at least one of the processors is below its threshold, reallocating at least a portion of unused databus utilization from the at least one processor to at least one of the other processors.2. The method of claim 1 , wherein reallocating comprises equally reallocating the unused databus utilization among the other processors.3. The method of claim 1 , wherein reallocating comprises reallocating the unused databus utilization to at least one other processor operating at its memory databus utilization threshold.4. The method of claim 1 , further comprising:analyzing historic databus utilization for the plurality of processors; andreallocating the unused databus utilization to at least one of the other processors based on the historic databus utilization for the one other processor.5. The method of claim 1 , wherein ...

RAAV-BASED COMPOSITIONS AND METHODS FOR TREATING AMYOTROPHIC LATERAL SCLEROSIS

The invention relates to inhibitory nucleic acids and rAAV-based compositions, methods and kits useful for treating Amyotrophic Lateral Sclerosis. 150.-. (canceled)51. A method of modulating expression of genes associated with amyotrophic lateral sclerosis (ALS) in a subject in need thereof , the method comprising administering to the subject an effective amount of a synthetic miRNA that targets a C9orf72 RNA transcript , wherein the synthetic miRNA specifically binds to a nucleic acid sequence of the RNA transcript encoded by a nucleic acid sequence set forth in SEQ ID NO: 2 , 6 , or 7.52. The method of claim 51 , wherein the synthetic miRNA further comprises flanking regions of miR-155.53. The method of claim 52 , wherein the RNA transcript is a pre-mRNA transcript.54. The method of claim 52 , wherein the RNA transcript comprises a GChexanucleotide repeat.55. The method of claim 53 , wherein the pre-mRNA transcript is a C9orf72 Visoform transcript.56. The method of claim 53 , wherein the pre-mRNA transcript is a C9orf72 Visoform transcript.57. The method of claim 53 , wherein the pre-mRNA transcript is not a C9orf72 Visoform transcript.58. The method of claim 51 , wherein the RNA transcript comprises an intron.59. A method of modulating expression of genes associated with amyotrophic lateral sclerosis (ALS) in a subject in need thereof claim 51 , the method comprising administering to the subject an effective amount of a recombinant nucleic acid encoding a synthetic miRNA that targets a C9orf72 RNA transcript claim 51 , wherein the synthetic miRNA specifically binds to a nucleic acid sequence of the RNA transcript encoded by a nucleic acid sequence set forth in SEQ ID NO: 2 claim 51 , 6 claim 51 , or 7 claim 51 , flanked by AAV inverted terminal repeats (ITRs).60. The method of claim 59 , wherein the recombinant nucleic acid further comprises a promoter operably linked with a region encoding the synthetic miRNA.61. The method of claim 60 , wherein the promoter is ...

ROTARY PERCUSSIVE DEVICE

Repeated percussive forces may be provided using various devices, systems, assemblies, and methods. Example rotary percussive devices may be used in a downhole environment, including within a drilling system that includes a percussive hammer drill bit. The rotary percussive device may include a rotational translator to convert drilling fluid pressure into a rotational force. An axial translator coupled to the rotational translator may convert the rotational force into an axial percussive force. This conversion may be done using magnets arranged in arrays of alternating polarities. The rotational translator may longitudinally overlap the axial translator. The rotational translator may include a rotational stator rotationally fixed within a bottomhole assembly. The rotational stator may include a shaft of a positive displacement motor. 1. A rotary percussive device , comprising:a rotational translator having a rotational rotor and a rotational stator; andan axial translator having an axial stator, the axial translator being concentric with the rotational translator.2. The device of claim 1 , wherein the rotational translator comprises a positive displacement motor claim 1 , an electric motor claim 1 , or a turbine.3. The device of claim 1 , wherein the rotational translator is concentrically within the axial translator and is shorter than the axial translator.4. The device of claim 1 , wherein the axial translator further comprises an axial rotor.5. The device of claim 4 , wherein the axial rotor and axial stator each comprise angularly and longitudinally offset magnets of alternating polarity.6. The device of claim 1 , wherein the rotational rotor is at least partially integrally formed with an axial rotor.7. The device of claim 1 , further comprising a plurality of magnets coupled to the axial translator.8. The device of claim 7 , wherein the axial translator further comprises a non-magnetic body in which the plurality of magnets are held.9. The device of claim 8 , ...

Multicore Processor and Method of Use That Configures Core Functions Based on Executing Instructions

A multiprocessor system having plural heterogeneous processing units schedules instruction sets for execution on a selected of the processing units by matching workload processing characteristics of processing units and the instruction sets. To establish an instruction set's processing characteristics, the homogeneous instruction set is executed on each of the plural processing units with one or more performance metrics tracked at each of the processing units to determine which processing unit most efficiently executes the instruction set. Instruction set workload processing characteristics are stored for reference in scheduling subsequent execution of the instruction set. 1. A method for processing information , the method comprising:simultaneously initiating execution of homogeneous instructions at each of plural processing units, the processing units having heterogeneous characteristics;monitoring one or more performance metrics associated with execution of the instructions at each of the plural processing units;comparing the performance metrics to determine one of the processing units having a desired performance; andselecting the processing unit having the desired performance to execute the instructions.2. The method of wherein monitoring one or more performance metrics further comprises:monitoring one or more performance metrics with a performance sensor built into each processing unit; andreporting the performance metrics to an operating system running on one or more of the processing units.3. The method of further comprising releasing the unselected processing units for execution of other instructions.4. The method of wherein each processing unit has plural cores and wherein the heterogeneous characteristics comprise different combinations of specialized cores associated with each processing unit.5. The method of wherein a combination of specialized cores comprises at least one processing unit having disproportionately greater number of floating point cores ...

Packing Assembly for a Pump

A header ring for use in a stuffing box comprising an annular body portion of an elastomeric material, an annular radially inward projecting sealing lip portion formed on said body portion and an annular, axially facing pedestal portion formed on said body portion, said pedestal portion defining an annularly extending radially inwardly facing pedestal surface, the sealing lip portion defining an annularly extending, radially inward facing sealing surface, the sealing surface and the pedestal surface forming a juncture, at least a portion of the pedestal portion adjacent the juncture and forming the pedestal surface and at least a portion of the sealing lip portion adjacent the juncture and forming a portion of the sealing surface being comprised of a layer of reinforced elastomeric material bonded to the body portion. 1. A header ring for use in a reciprocating plunger-type pump , the pump adapted to displace a fluid , a housing having a generally cylindrical bore extending therethrough and forming a generally radially inwardly facing housing cylindrical surface;', 'a plunger reciprocally extending through the housing;', 'at least one annular sealing ring positioned in the housing; and', 'the header ring, wherein the header ring is positioned in the housing and engaged with one of the at least one annular sealing ring;, 'wherein the pump comprises an opening through which the plunger extends;', 'an elastomeric body that does not contain layers of cloth;', 'a radially inwardly facing annularly extending sealing lip adjacent the opening;', 'a radially inwardly facing cylindrical surface adjacent the opening;', 'an annular radially outwardly facing cylindrical surface opposite the opening;', 'an annular axially extending pedestal extending between the radially inwardly facing cylindrical surface and the annular radially outwardly facing cylindrical surface;', 'an annular axially extending surface extending between the annular radially outwardly facing cylindrical ...

PRINTING USING COLOR CHANGEABLE MATERIAL

Systems and methods for printing data on a substrate including a color-changeable material are provided. One system includes a processing circuit and a device including an energy source. At least a portion of a printed publication is printed on the substrate using a commercial printing press based on fixed data. The device including the energy source is configured to add variable data to the substrate. The processing circuit is configured to receive the variable data and to control the energy source to change a color of the color-changeable material based on the variable data to provide at least a portion of the printed publication. The processing circuit is configured to control the energy source to change the color of the color-changeable material in-line with a flow of the substrate through one of a printing line, a finishing line, or a packaging line of the commercial printing press. 1. A system for printing data on a substrate comprising a color-changeable material , the system comprising:a processing circuit; anda device comprising an energy source;wherein at least a portion of each of a plurality of printed publications is printed on the substrate using a commercial printing press based on fixed data, and wherein the fixed data comprises data common to the plurality of printed publications;wherein the device comprising the energy source is configured to add variable data to the substrate, wherein the processing circuit is configured to receive the variable data and to control the energy source to change a color of the color-changeable material based on the variable data to provide at least a portion of the plurality of printed publications, and wherein the variable data comprises data changed between at least two of the plurality of printed publications; andwherein the processing circuit is configured to control the energy source to change the color of the color-changeable material in-line with a flow of the substrate through one of a printing line, a ...

Apparatus and System for Mining Billing Data From a Device, and Corresponding Method Thereof

Apparatuses, systems, and methods for mining time data are provided. Implementations consistent with the present disclosure provide for mining devices for time spent on behalf of clients-time that would otherwise be un-captured, unbilled time and money, and ensure that a user is properly compensated for all they do. Operations consistent with the present disclosure include selecting at least one billing criteria by a user of a mobile device, searching the mobile device for stored electronic communication data related to the at least one billing criteria, returning at least one matched electronic communication from among the stored electronic communication data related to the at least one billing criteria, assigning at least one of a time value and a billing value to the at least one matched electronic communication, and performing at least one of timekeeping and billing based up-on the assigned at least one time value and billing value. 1. A non-tangible computer-readable storage medium having instructions stored thereon , which when executed by a processor perform the steps of:selecting at least one billing criteria by a user of a mobile device;searching for stored electronic communication data related to the at least one billing criteria;returning at least one matched electronic communication from among the stored electronic communication data relates to the at least one billing criteria;assigning at least one of a time value and a billing value to the at least one matched electronic communication; andperforming at least one of timekeeping and billing based upon the assigned at least one time value and billing value.2. The non-tangible computer-readable storage medium of claim 1 , wherein the searching for stored electronic communication data comprises searching the mobile device for locally-stored electronic communication data.3. The non-tangible computer-readable storage medium of claim 2 , wherein the stored electronic communication data includes telephone call ...

ROLLER CONE DRILL BIT

A roller cone drill bit having a bit body. The bit body has a journal bearing coupled to an end portion thereof. A roller cone is coupled to the journal bearing. A first cutting element is coupled to the roller cone. A ratio of a radius of curvature of a crest portion of the first cutting element to a diameter of the first cutting element is between about 0.3:1 and about 0.8:1. A second cutting element is coupled to the roller cone. A ratio of a radius of curvature of a crest portion of the second cutting element to a diameter of the second cutting element is between about 0.05:1 and about 0.3:1. A height of the second cutting element is greater than the height of the first cutting element h between about 0.1 mm and about 6 mm. 1. A roller cone drill bit , comprising:a bit body;a roller cone rotationally coupled to the bit body;a first cutting element coupled to the roller cone, a ratio of a radius of curvature of a crest portion of the first cutting element to a diameter of the first cutting element being between about 0.3:1 and about 0.8:1; anda second cutting element coupled to the roller cone, a ratio of a radius of curvature of a crest portion of the second cutting element to a diameter of the second cutting element being between about 0.05:1 and about 0.3:1, the second cutting element having a height between about 0.1 mm and about 6 mm greater than a height of the first cutting element, as measured from an outer surface of the roller cone.2. The roller cone drill bit of claim 1 , the ratio of the radius of curvature of the crest portion of t le first cutting element to the diameter of the first cutting element being between about 0.4:1 and about 0.7:1.3. The roller cone drill bit claim 1 , the first cutting element being a semi-round top cutting element.4. The roller cone drill bit of claim 1 , the ratio of the radius of curvature of the crest portion of the second cutting; element to the diameter of the second cutting element being between about 0.14:1 and ...

PISTON STRIKE FACE AND BIT INTERFACE FOR PERCUSSION HAMMER DRILL

A percussion drilling assembly includes a housing with a hammer bit disposed in the lower end portion thereof and configured to move longitudinally within the housing. The hammer bit includes an annular bit shank having a bit strike face and a cutting structure at a lower end portion thereof. An annular piston having a piston strike face arranged and designed to strike the bit strike face is also disposed in the housing. At least one of the bit strike face and the piston strike face has a toroidal curvature profile. A method includes one or more of lowering the percussion drilling assembly into a borehole, engaging the cutting structure with a formation, and impacting the bit strike face of the annular bit shank with the piston strike face of the annular piston. 1. A percussion drilling assembly , comprising:a housing capable of being coupled to a drill string;a hammer bit coupled to a lower end portion of the housing and configured to move longitudinally relative to the housing, the hammer bit including an annular bit shank having a bit strike face at an upper end portion thereof and a cutting structure at a lower end portion thereof; andan annular coupled to the housing, the annular piston having a piston strike face at a lower end portion thereof arranged and designed to strike the bit strike face, at least one of the piston strike face or the bit strike face having a toroidal curvature profile.2. The percussion drilling assembly of claim 1 , the bit strike face having a convex toroidal curvature profile.3. The percussion drilling assembly of claim 2 , the piston strike face having a flat profile.4. The percussion drilling assembly of claim 2 , the piston strike face having a convex toroidal curvature profile.5. The percussion drilling assembly of claim 2 , the piston strike face having a concave toroidal curvature profile and a radius of curvature of the concave toroidal curvature profile greater than or equal to a radius of curvature of the convex toroidal ...

PERCUSSION DRILL BIT WITH CONICAL CUTTING ELEMENTS

A percussion drill bit for drilling a borehole. The drill bit includes a bit body having a bit face disposed on an axial end portion thereof. First and second cutting elements are disposed on the bit face. A cutting plane is defined in tangential contact with crest portion of the first and second cutting elements. A third cutting element on the bit face is at least partially positioned between the first and second cutting elements. The third cutting element is at least partially conical, and a crest portion of the third cutting element is offset from the cutting plane. 1. A percussion drill bit for drilling a borehole , comprising:a bit body having a bit face;first and second cutting elements on the bit face, the first and second cutting elements defining a cutting plane in tangential contact with a crest portion of each of the first and second cutting elements; anda conical cutting element on the bit face and positioned at least partially between the first and second cutting elements, the conical cutting element having a crest portion offset from the cutting plane.2. The percussion drill bit of claim 1 , the crest portion of the conical cutting element extending beyond the cutting plane by a distance up to about 70% of a total height of the conical cutting element as measured from the bit face.3. The percussion drill bit of claim 1 , the crest portion of the conical cutting element being below the cutting plane by a distance up to about 25% of a total height of the conical cutting element as measured from the bit face.4. The percussion drill bit of claim 1 , the first and second cutting elements being semi-round top cutting elements.5. The percussion drill bit of claim 1 , the first and second cutting elements being at least partially conical.6. The percussion drill bit of claim 1 , a radius of curvature of the crest portion of the conical cutting element being less than a radius of curvature of the crest portions of the first and second cutting elements.7. The ...

CUTTING INSERT FOR PERCUSSION DRILL BIT

A cutting insert for a percussion hammer bit. The cutting insert includes a base portion for coupling to a bit face of the percussion hammer bit. An extension portion is coupled to the base portion and axially offset therefrom along a longitudinal axis extending through the base portion and the extension portion. The extension portion includes at least three lobes that are circumferentially offset from one another around the longitudinal axis. The lobes extend axially away from the base portion, and the lobes extend radially outward from the longitudinal axis. 1. A cutting insert for a bit , comprising:a base portion adapted to be coupled to a bit face of the bit; andan extension portion coupled to the base portion and axially offset therefrom along a longitudinal axis extending through the base portion and the extension portion, the extension portion including at least three lobes that are circumferentially offset from one another around the longitudinal axis, the at least three lobes extending axially away from the base portion and radially outward from the longitudinal axis.2. The cutting insert of claim 1 , the extension portion including three lobes.3. The cutting insert of claim 2 , at least two of the three lobes being circumferentially offset from one another by an angle between about 100° and about 140° with respect to the longitudinal axis.4. The cutting insert of claim 1 , the extension portion including four lobes.5. The cutting insert of claim 4 , at least two of the four lobes being circumferentially offset from one another by an angle between about 70° and about 110° with respect to the longitudinal axis.6. The cutting insert of claim 1 , the extension portion further including a relief between two of the at least three lobes claim 1 , an outer surface of the extension portion proximate the relief being positioned nearer the base portion than an outer surface of the at least three lobes.7. The cutting insert of claim 1 , a width of the at least three ...

COMPOSITIONS AND METHODS FOR MODULATING DYSFERLIN EXPRESSION

Aspects of the disclosure relate to methods of altering RNA splicing in a subject. In some embodiments, methods are provided for correcting splicing in a cell that contains a DYSF gene having a mutation that results in defective splicing. 1. A method of modulating splicing in a cell that contains a DYSF gene comprising a c.4886+1249 (G>T) mutation , the method comprising:delivering to the cell an antisense nucleic acid that targets a pre-messenger RNA expressed from the DYSF gene and alters splicing of the pre-messenger RNA such that exons 44 and 45 of the pre-messenger RNA are spliced together without an intervening pseudoexon.2. The method of claim 1 , wherein the cell is heterozygous for the c.4886+1249 (G>T) point mutation.3. The method of claim 1 , wherein the cell is homozygous for the c.4886+1249 (G>T) point mutation.4. The method of claim 2 , wherein the cell contains a second DYSF gene encoding a wild-type DYSF protein.5. The method of claim 2 , wherein the cell contains a second DYSF gene comprising a mutation that causes a premature stop codon.6. The method of claim 5 , wherein the premature stop codon is within a region encoding the C2D domain of DYSF protein.7. The method of claim 6 , wherein the second DYSF gene is a human DYSF gene claim 6 , and wherein the mutation that causes the premature stop codon is a c.3444_3445delTGinsAA mutation.8. The method of any one of to claim 6 , wherein the cell is in vitro.9. The method of any one of to wherein the cell is in vivo.10. The method of any one of to claim 6 , wherein the cell is a non-human cell engineered to contain the DYSF gene comprising the c.4886+1249 (G>T) mutation.11. The method of any one of to claim 6 , wherein the cell is a human cell.12. The method of claim 11 , wherein the human cell is engineered to contain the DYSF gene comprising the c.4886+1249 (G>T) mutation.13. The method of claim 11 , wherein the human cell is from a subject having a muscular dystrophy that is associated at least in ...

UDP GLYCOSYLTRANSFERASE INHIBITORS AND METHODS OF USE

Described herein is a compound of Formula (I), 3. The compound of claim 1 , wherein Ris hydrogen claim 1 , Calkyl (e.g. claim 1 , methyl) or halo (e.g. claim 1 , fluoro claim 1 , chloro or bromo).4. The compound of claim 1 , wherein Ris Calkyl (e.g. claim 1 , methyl) or hydrogen.5. The compound of claim 1 , wherein Y is CN claim 1 , —C(O)R claim 1 , Calkyl claim 1 , —NR—C(O)—R claim 1 , heteroaryl claim 1 , Y is —C(O)OR claim 1 , or —C(O)NRR.7. The compound of claim 1 , wherein Ris hydrogen claim 1 , —OH claim 1 , halo claim 1 , Chaloalkyl claim 1 , Calkoxy claim 1 , Chaloalkoxy claim 1 , —NH(Calkyl) claim 1 , —N(Calkyl) claim 1 , Ccycloalkyl or heterocycloalkyl.9. The compound of claim 1 , wherein the Ais —O— claim 1 , Calkylene claim 1 , a bond claim 1 , —O—C(O)— claim 1 , —C(O)— claim 1 , —NR— or —NR—Calkylene.15. The compound of claim 1 , wherein Ais a bond claim 1 , —C(O)—O— claim 1 , —OC(O)—NR— claim 1 , —OC(O)— claim 1 , —O— claim 1 , —C(O)— claim 1 , —NR—C(O)—O— claim 1 , —NR—C(O)—NR— claim 1 , —C(O)—NR— claim 1 , —Calkyl-C(O)—NR— claim 1 , —Calkyl-O—C(O)—NR— claim 1 ,—O—C(O)—O— claim 1 , —NR—C(O)— claim 1 , —NR— claim 1 , —S(O)— claim 1 , —Calkyl-C(O)— claim 1 , —Calkyl-NR— claim 1 , —Calkyl-NR—S(O)— or —Calkyl-C(O)—O—.16. The compound of claim 15 , wherein Ais a bond claim 15 , —C(O)—O— claim 15 , —OC(O)—NR— claim 15 , —OC(O)— claim 15 , —O— claim 15 , —NR—C(O)—O— claim 15 , —Calkyl-C(O)—NR— claim 15 , —Calkyl-O—C(O)—NR— or —NR—.17. The compound of claim 1 , wherein Ris hydrogen claim 1 , —OH claim 1 , Calkyl substituted with 0-5 occurrences of R claim 1 , heterocycloalkyl claim 1 , cycloalkyl or heteroaryl.18. The compound of claim 1 , wherein Ris halo claim 1 , Calkyl claim 1 , Calkoxy claim 1 , Chaloalkyl claim 1 , —O—Chaloalkyl claim 1 , cyano claim 1 , Ccycloalkyl claim 1 , Calkyl-Ccycloalkyl claim 1 , —O—Calkyl-Ccycloalkyl or heterocycloalkyl claim 1 , wherein each cycloalkyl claim 1 , aryl claim 1 , heteroaryl or heterocycloalkyl is substituted with ...

RAAV-BASED COMPOSITIONS AND METHODS FOR TREATING AMYOTROPHIC LATERAL SCLEROSIS

The invention relates to inhibitory nucleic acids and rAAV-based compositions, methods and kits useful for treating Amyotrophic Lateral Sclerosis. 1. A method of inhibiting C9orf72 expression in a cell , the method comprising:delivering to the cell an inhibitory nucleic acid that targets both pre-mRNA and mRNA encoded by a C9orf72 gene.2. The method of claim 1 , wherein the cell expresses C9orf72 having GCexpansions of up to 50 claim 1 , up to 90 claim 1 , up to 160 claim 1 , or up to 200 repeats.3. The method of claim 1 , wherein the level of a mRNA encoding isoform B of C9orf72 in the cell is greater than the level of a mRNA encoding isoform A of C9orf72 protein in the cell.4. The method of any one of to claim 1 , wherein the cell is a cell of the central nervous system.5. The method of claim 4 , wherein the cell is a neuron.6. The method of any one of to claim 4 , wherein claim 4 , prior to being exposed to the inhibitory nucleic acid claim 4 , the cell contains intranuclear GCfoci.7. The method of claim 6 , wherein delivery of the inhibitory nucleic acid to the cell results in a reduction in intranuclear GCfoci.8. The method of any one of to claim 6 , wherein claim 6 , prior to being exposed to the inhibitory nucleic acid claim 6 , the cell contains C9 RAN proteins.9. The method of claim 8 , wherein delivery of the inhibitory nucleic acid to the cell results in a reduction in C9 RAN protein levels.10. The method of any one of to claim 8 , wherein the cell is in vivo.11. The method of any one of to claim 8 , wherein the cell is in vitro.12. The method of any one of to claim 8 , wherein the cell is of a subject having one or more symptoms of FTD or ALS.13. The method of any one of to claim 8 , wherein the cell is of a subject suspected of having FTD or ALS.14. A method of inhibiting C9orf72 expression in the central nervous system (CNS) of a subject claim 8 , the method comprising:administering to the CNS of the subject an inhibitory nucleic acid that targets an ...

Pallet Lifting System

A pallet lifter for raising and lowering a pallet. The pallet lifter includes a pallet platform and a movement mechanism that controllably causes the pallet platform to raise and lower. The pallet platform includes a top surface designed to support a pallet, two side walls, and a back wall. The movement mechanism includes a motor and a threaded rod. The electric motor is designed to cause the threaded rod to rotate in a clockwise and counterclockwise direction to cause said pallet platform to raise and lower.

Systems, Methods, and Apparatuses for Producing and Packaging Fluids

A system for producing and packaging fluid may comprise a water distillation device. The system may further comprise a mixing circuit coupled to an output of the water distillation device and including a source of concentrate. The mixing circuit may include a plurality of flow controllers configured to adjust the flow of fluid through the mixing circuit so as to generate a preset fluid. The system may further comprise an enclosure including an antechamber and a packaging compartment. The system may further comprise a reservoir dispenser in the packaging compartment having a feed plate and a housing block. The reservoir dispenser may include a bias member which urges the feed plate toward the housing block. The system may further comprise a filling station in the packaging compartment including a filling nozzle coupled to the mixing circuit. The system may further comprise a sealing station in the packaging compartment having a ram and a sealing member dispenser. The system may further comprise a quarantine repository in the packaging compartment having a plurality of reservoir holders. The system may further comprise a labeler in the packaging compartment. The system may further comprise an output chute from the packaging compartment to an exterior of the enclosure. 1. A system for producing and packaging fluid comprising:a water distillation device;a mixing circuit coupled to an output of the water distillation device and including a source of concentrate, the mixing circuit configured to adjust the flow of fluid through the mixing circuit so as to generate a fluid of a predefined composition;an enclosure including an antechamber and a packaging compartment;a reservoir dispenser at least partially in the packaging compartment having a reservoir magazine and an outlet end, the reservoir dispenser including an actuator configured to drive a follower of the reservoir magazine toward the outlet end of the reservoir dispenser;a filling station in the packaging ...

DETERMINING SERVER WRITE ACTIVITY LEVELS TO USE TO ADJUST WRITE CACHE SIZE

Provided are a computer program product, system, and method for determining server write activity levels to use to adjust write cache size. Server write activity information on server write activity to the cache is gathered. The server write activity information is processed to determine a server write activity level comprising one of multiple write activity levels indicating a level of write activity. The determined server write activity level is transmitted to a storage server having a write cache, wherein the storage server uses the determined server write activity level to determine whether to adjust a size of the storage server write cache. 1. A computer program product comprising a code module implementing code for indicating a server write activity level for a server in communication with a storage server having a write cache , wherein the code executes to perform operations , the operations comprising:gathering server write activity information on server write activity to the cache;processing the server write activity information to determine a server write activity level comprising one of multiple write activity levels indicating a level of write activity; andtransmitting the determined server write activity level to the storage server, wherein the storage server uses the determined server write activity level to determine whether to adjust a size of the storage server write cache.2. The computer program product of claim 1 , wherein the server write activity information includes a number of writes to pages and a number of accesses to pages claim 1 , wherein the processing the server write activity information comprises comparing a calculation based on the number of writes and the number of accesses to at least one threshold to determine the server write activity level.3. The computer program product of claim 2 , wherein the server write activity information further includes a number of prefetch streams to the pages claim 2 , wherein the processing the ...

HIGH TEMPERATURE RESISTANT PRESSURE SENSITIVE ADHESIVE WITH LOW THERMAL IMPEDANCE

A high temperature resistant thermally conductive pressure sensitive adhesive composition comprising a first silicon resin, a second silicon resin, a first thermally conductive filler, a second thermally conductive filler, a catalytically effective amount of a curing agent, an optional defoaming agent, and an optional drying agent, wherein said thermally conductive filler has a volume weighted mean particle size in the range of 8 to 20 μm. 2. The composition of claim 1 , wherein the first silicone resin is a phenyl based siloxane gum and the second silicone resin is a silicate tackifying resin.3. The composition of claim 1 , wherein the thermally conductive fillers are selected from the group consisting of a metal claim 1 , aluminum claim 1 , copper claim 1 , silver claim 1 , nickel claim 1 , magnesium claim 1 , and brass claim 1 , metal oxide claim 1 , alumina claim 1 , magnesium oxide claim 1 , zinc oxide claim 1 , titanium oxide claim 1 , ceramic claim 1 , inorganic material claim 1 , boron nitride claim 1 , aluminum nitride claim 1 , silicon carbide claim 1 , silicon nitride claim 1 , boron carbide claim 1 , titanium diboride claim 1 , titanium carbide claim 1 , and aluminum silicon carbide claim 1 , carbon material claim 1 , graphite claim 1 , diamond powder claim 1 , carbon nanotubes claim 1 , carbon black claim 1 , and combinations thereof.4. The composition of claim 1 , wherein the thermally conductive filler is a mixture of graphite and boron nitride.5. The composition of claim 4 , wherein the graphite is present in the range of about 5 to about 18% by weight and the boron nitride is present in the range of about 5 to about 18% by weight.6. The composition of claim 1 , further comprising one or more of a defoaming agent claim 1 , a drying agent claim 1 , and a dispersing agent.7. The composition of claim 1 , wherein the curing agent is selected from the group consisting of benzoyl peroxide and 2 claim 1 ,4-dichlorobenzoyl peroxide8. The composition of claim ...

COLLECTOR FOR CAPTURING FLOW DISCHARGED FROM A SUBSEA BLOWOUT

A collector for capturing flow discharged from a subsea blowout includes a tubular housing having a containment chamber; a seal connected to the housing; a tubular chimney connected to the housing, having a portion of a subsea connector, and having a diameter less than a diameter of the containment chamber; and a head connected to the housing and the chimney. 1. A method for capturing flow discharged from a subsea blowout , comprising:lowering a collector from a mobile offshore drilling unit (MODU) onto a seafloor at a location distant from subsea equipment blowing production fluid;connecting a workstring to the collector;injecting an inert gas through the workstring;moving the MODU and connected collector to the subsea equipment and landing the collector onto the equipment while maintaining injection of the inert gas;halting injection of the inert gas; androuting a top of the workstring to surface collection equipment, thereby directing the blowing production fluid from the subsea equipment into a chimney of the collector, wherein the chimney is connected to the MODU by the workstring.2. The method of claim 1 , further comprising:connecting an injection line to the collector; andinjecting hydrates inhibitor through the injection line and into the collector.3. The method of claim 1 , wherein:the collector has one or more vents, andthe method further comprises closing the vents.4. The method of claim 3 , further comprising injecting dispersant into the vents or adjacent a bottom of the collector.5. The method of claim 3 , wherein a check valve prevents flow of seawater into each vent.6. The method of claim 1 , further comprising:separating crude oil from the blowing production fluid; andstoring the separated crude oil.7. The method of claim 1 , further comprising delivering the production fluid to a production facility or flare.8. The method of claim 1 , wherein the collector forms a siphon seal with the subsea equipment.9. The method of claim 8 , wherein the ...

SYSTEM AND METHOD FOR DISTRIBUTING AND PROCESSING COUPONS

A coupon distribution and processing platform (CDPP) allows its members/constituents to receive services associated with the purchase of consumer products. Specifically, a shopper, registered with the CDPP, accesses an account and electronically selects one or more coupons to be associated with a coupon card. Thereafter, when the shopper's coupon card is scanned or credit card is scanned at a particular grocer entity, the accounts associated with the shopper and grocer entity are credited, while the account associated with the manufacturer is debited. Further, the shopper, the manufacturer, and the grocer entity, each having a corresponding account, may select one or more services provided by the CDPP utilizing by a CDPP website. 1. A method , comprising:maintaining, by a coupon distribution and processing platform (CDPP) having at least one processor and a memory, one or more webpages;establishing a shopper account associated with a shopper based on a first registration process utilizing the one or more web pages;establishing a grocer account associated with a grocer entity based on a second registration process utilizing the one or more web pages:establishing a manufacturer account associated with a manufacturer based on a third registration process utilizing the one or more web pages; determining, by the CDPP, an amount to credit the shopper account associated with the card device, wherein the amount credited to the shopper account is based on a value of the at least one coupon;', 'crediting, by the CDPP, the grocer account associated with the grocer entity that sells the product to the shopper; and', 'debiting, by the CDPP, the manufacturer account associated with the manufacturer of the product, and providing the amount debited from the manufacturer account to a financial account associated with the CDPP., 'scanning a card device at a point of service (POS) node for a product, where the POS node is maintained at the grocer entity and includes hardware and ...

Reamer Assembly

Embodiments of a reamer of the present invention generally include a substantially tubular body sub, a substantially planar base plate having one or more receiving cavities disposed therein, one or more gussets, a fluid chamber, and a plurality of leg/cone assemblies having a leg end and a cone end; wherein the base plate is disposed around the body sub and stabilized by the gussets, and each leg end comprises an exterior surface geometry complementary to the interior surface geometry of a base plate receiving cavity and is insertable into and affixable therein. The receiving cavities are constructed in defined locations and orientations in the base plate and the leg/cone assemblies are precisely formed such that insertion of the leg end into the receiving cavity accurately and precisely disposes the cutting component about the reamer. Embodiments of methods of providing and using an apparatus of the present invention are also provided. 1. A reamer assembly for horizontal directional drilling comprising:a substantially tubular component;a substantially planar base plate;one or more gussets;one or more cutting assemblies; andone or more fluid chambers; said tubular component comprises one or more orifices in the exterior surface thereof;', one or more receiving cavities disposed therein, each said receiving cavity comprising an interior surface;', 'one or more fluid conduits extending there through; and', 'a central orifice extending there through; and, 'said base plate comprises, 'each said cutting assembly comprises a cutter segment and a leg segment, each said leg segment comprising an outer surface, at least a portion of which is complementary to at least a portion of said interior surface of one said receiving cavity, whereby said leg segment is adapted and configured to be fittingly inserted in said one said receiving cavity from a top side of said base plate;', 'said tubular component extends through said central orifice, thereby disposing said base plate ...

SYSTEM, METHOD AND COMPUTER PROGRAM PRODUCT FOR DATA TRANSFER MANAGEMENT

According to one aspect of the present disclosure a method and technique for managing data transfer includes receiving and storing a plurality of different data patterns anticipated to be encountered by a processor unit of a data processing system corresponding to a particular application being processed. Responsive to receiving a read request for data, the requested data is read from a memory subsystem, and the read data is compared by the memory subsystem to the stored data patterns. Responsive to determining that the read data matches at least one of the stored data patterns, the memory subsystem replaces the matching read data with a pattern tag corresponding to the matching data pattern. The pattern tag is transmitted to the processor unit instead of the requested data as a response to the read request, and the processor unit replaces the pattern tag with the corresponding data pattern. 1. A method comprising:receiving and storing a plurality of different data patterns anticipated to be encountered by a processor unit of a data processing system corresponding to a particular application being processed;responsive to receiving a read request for data, reading the requested data from a memory subsystem;comparing by the memory subsystem the read data to the stored data patterns;responsive to determining that the read data matches at least one of the stored data patterns, replacing by the memory subsystem the matching read data with a pattern tag corresponding to the matching data pattern;transmitting the pattern tag to the processor unit instead of the requested data as a response to the read request; andresponsive to receiving the pattern tag at the processor unit, replacing the pattern tag with the corresponding data pattern.2. The method of claim 1 , further comprising:accessing, by a memory buffer, a memory device;reading the requested data out of the memory device; andcomparing by the memory buffer the read data to the stored data patterns.3. The method of ...

DYNAMIC PRIORITIZATION OF CACHE ACCESS

Some embodiments of the inventive subject matter are directed to operations that include determining that an access request to a computer memory results in a cache miss. In some examples, the operations further include determining an amount of cache resources used to service additional cache misses that occurred within a period prior to the cache miss. Furthermore, in some examples, the operations further include servicing the access request to the computer memory based, at least in part, on the amount of the cache resources used to service the additional cache misses within the period prior to the cache miss.

Skin-Contacting Tubular Fabric Underlay For Use Beneath A Therapeutic or Prosthetic Device

A skin-contacting fabric underlay for use beneath a therapeutic or prosthetic device on a human or animal body part is formed as a tube of knitted fabric. The yarns forming the fabric have a core of elastic material surrounded by moisture-transporting filaments of substantially non-elastic material, the yarn having elasticity, the fabric having a warp-knitted structure characterized by an artificial terry surface on an inner skin-contacting surface of the tube. The artificial terry surface is formed by underlaps of the yarn, in which the elasticity of the yarn causes the underlaps to draw up and form artificial terry loops that contact the skin of the body part about which the tube is sleeved. The artificial terry loops serve to space overlaps of the yarn from the skin and to move moisture away from the skin. 1. A skin-contacting fabric underlay for use beneath a therapeutic or prosthetic device on a human or animal body part , comprising:a tube of knitted fabric formed on a knitting machine from two sets of yarns, the yarns having a core of elastic material surrounded by moisture-transporting filaments of substantially non-elastic material, the yarns having elasticity, the fabric having a knitted structure characterized by an artificial terry surface on an inner skin-contacting surface of the tube, the artificial terry surface being formed by underlaps of the yarns, the elasticity of the yarns causing the underlaps to draw up and form artificial terry loops that contact the skin of the body part about which the tube is sleeved, the artificial terry loops serving to space overlaps of the yarns from the skin and to move moisture away from the skin.2. The skin-contacting fabric underlay of claim 1 , wherein the filaments are air-jet-entangled about the core of the yarn claim 1 , the filaments comprising a synthetic polymer material.3. The skin-contacting fabric underlay of claim 2 , wherein the filaments define one or more grooves in an outer surface of each filament ...

Fus/tls-based compounds and methods for diagnosis, treatment and prevention of amyotrophic lateral sclerosis and related motor neuron diseases

The invention provides novel FUS/TLS nucleic acids and proteins that comprise one or more genetic markers (for example, single nucleotide polymorphisms) and methods of use thereof including methods relating to the diagnosis of ALS or other related motor neuron disease by virtue of the presence of the mutant FUS/TLS sequence(s).

System and Method For Internal AC Coupling With Active DC Restore and Adjustable High-Pass Filter for a PAM 2/4 Receiver

A receiver termination circuit includes an internal AC coupling capacitor and an adjustable resistor forming an adjustable high-pass filter (HPF) at a receiver side of a transmission medium, and a digital-to-analog converter (DAC) coupled to the adjustable HPF, the DAC configured to provide a signal having a low-pass filter response to the adjustable HPF to provide a DC restore function. 1. A receiver termination circuit , comprising:an internal AC coupling capacitor and an adjustable resistor forming an adjustable high-pass filter (HPF) at a receiver side of a transmission medium; anda digital-to-analog converter (DAC) coupled to the adjustable HPF, the DAC configured to provide a signal having a low-pass filter response to the adjustable HPF to provide a DC restore function.2. The circuit of claim 1 , wherein the DAC provides a signal having an adjustable amplitude to the adjustable HPF.3. The circuit of claim 2 , wherein a high pass cutoff frequency of the low-pass filter response provided by the DAC is determined by the adjustable high-pass filter (HPF).4. The circuit of claim 3 , wherein the DC restore function provided by the DAC comprises digital feedback inserting receive data at frequencies in the range from DC to the high pass cutoff frequency set by the adjustable high-pass filter (HPF).5. The circuit of claim 4 , wherein the low-pass filter response provided by the DAC and the high pass cutoff frequency are modulated together.6. The circuit of claim 5 , wherein the DAC is controlled by an eight bit control word to operate in a PAM 2 modality.7. The circuit of claim 5 , wherein the DAC is controlled by two eight bit control words to operate in a PAM 4 modality.8. A method for operating a receiver circuit claim 5 , comprising:forming an adjustable-pass filter (HPF) at a receiver side of a transmission medium, the adjustable high-pass filter (HPF) comprising an internal AC coupling capacitor and an adjustable resistor;receiving a differential signal in the ...

Expandable Interbody Spacer

Embodiments of the present disclosure relate to devices and methods for treating one or more damaged, diseased, or traumatized portions of the spine, including intervertebral discs, to reduce or eliminate associated back pain. In one or more embodiments, the present disclosure relates to an expandable interbody spacer. The expandable interbody spacer may comprise a first jointed arm comprising a plurality of links pivotally coupled end to end. The expandable interbody spacer further may comprise a second jointed arm comprising a plurality of links pivotally coupled end to end. The first jointed arm and the second jointed arm may be interconnected at a proximal end of the expandable interbody spacer. The first jointed arm and the second jointed arm may be interconnected at a distal end of the expandable interbody spacer. 1. A system for treating a vertebral condition , the system comprising: a first arm including a first end and a second end, wherein the first arm is defined by a plurality of links coupled to one another;', 'a second arm including a first end and a second end, wherein the second arm is defined by a plurality of links coupled to one another;', 'a proximal component coupled to the first ends of the first and second arms; and', 'a distal component coupled to the second ends of the first and second arms;, 'an interbody implant configured to transition between a first configuration and a second configuration, wherein the interbody implant comprises an elongate member defining a distal end and a lumen extending therethrough, wherein the elongate member is configured to releaseably engage the proximal component of the interbody implant; and', 'a shaft member disposed within the lumen of the elongate member and configured to releasably engage the distal component, wherein actuation of the insertion tool moves the elongate member relative to shaft member to transition the implant between first configuration and the second configuration, 'an insertion tool for ...

VIRTUAL UNIFIED INSTRUCTION AND DATA CACHES

Execution of a store instruction to modify an instruction at a memory location identified by a memory address is requested. A cache controller stores the memory address and the modified data in an associative memory coupled to a data cache and an instruction cache. In addition, the modified data is stored in a second level cache without invalidating the memory location associated with the instruction cache. 1. A method comprising:receiving a request to execute a store instruction to modify data at a memory location identified by a memory address;storing the memory address and the modified data in an associative memory coupled to a data cache and an instruction cache; andstoring the modified data in a second level cache and bypassing invalidating the memory location associated with the instruction cache.2. The method of claim 1 , wherein executing the store instruction includes executing a store instruction having an indicator that the modified data comprises an instruction.3. The method of claim 1 , further comprising:receiving a request to fetch an instruction at the memory location identified by a memory address;in response to receiving the request to fetch the instruction, determining if the memory address is included in the associative memory.4. The method of claim 3 , further comprising:in response to determining that the memory address is included in the associative memory, protecting the memory location from instruction fetches until the instruction is written to the instruction cache.5. The method of claim 4 , wherein protecting the memory location from instruction fetches includes stalling an instruction pipeline.6. The method of claim 3 , further comprising:in response to determining that the memory address is included in the associative memory, returning the modified data for the memory location from the associative memory.7. An apparatus comprising:a data cache;an instruction cache;one or more cache controllers coupled to the data cache and the ...

ELECTROSTATIC DISSIPATIVE SURFACE COATING AND HIGH TEMPERATURE LABEL EMPLOYING SAME

An electrostatic dissipative coating composition comprises a phenoxy-epoxy resin system comprising from 40-80 parts by weight to 5-20 parts by weight of an epoxy resin. Carbon nanotubes are dispersed in the phenoxy-epoxy resin system. The coating composition includes at least one isocyanate crosslinking agent and at least one metal catalyst. In a further aspect, a label construction comprising the electrostatic dissipative coating composition is provided. 1. An electrostatic dissipative coating composition comprising:a phenoxy-epoxy resin system comprising from 40 parts by weight to 80 parts by weight of an epoxy resin and from 5 parts by weight to 20 parts by weight of a phenoxy resin;carbon nanotubes dispersed in the phenoxy-epoxy resin system;at least one isocyanate crosslinking agent; andat least one metal catalyst.2. The electrostatic dissipative coating composition of claim 1 , wherein the carbon nanotubes comprise 1 to 5% by weight based on the total weight of the phenoxy and epoxy resins in the coating composition.3. The electrostatic dissipative coating composition of claim 1 , further comprising an inorganic filler.4. The electrostatic dissipative coating composition of claim 3 , wherein the inorganic filler comprises titanium dioxide.5. The electrostatic dissipative coating composition of claim 4 , wherein the titanium dioxide comprises 30 to 50% by weight based on the total weight of the phenoxy and epoxy resins in the coating composition.6. The electrostatic dissipative coating composition of claim 1 , wherein the at least one isocyanate crosslinking agent is a blocked polymeric isocyanate copolymer.7. The electrostatic dissipative coating composition of claim 1 , further comprising at least one anionic surfactant.8. The electrostatic dissipative coating composition of claim 1 , further comprising at least one solvent.9. An electrostatic dissipative label construction claim 1 , comprising:a polymer film substrate having an upper surface and a lower ...

ACTIVE VIBRATION CONTROL OF A ROTORCRAFT

An aircraft includes an airframe having an extending tail, and a counter rotating, coaxial main rotor assembly located at the airframe including an upper rotor assembly and a lower rotor assembly. A translational thrust system is positioned at the extending tail and providing translational thrust to the airframe. An active vibration control (AVC) system is located and the airframe and includes a plurality of AVC actuators configured to generate forces to dampen aircraft component vibration, and an AVC controller configured to transmit control signals to the plurality of AVC actuators thereby triggering force generation by the plurality of AVC actuators. A method of damping vibration of an aircraft includes receiving a vibration signal at an AVC controller, communicating a control signal from the AVC controller to a plurality of AVC actuators, generating a force at the AVC actuators, and damping vibration of the aircraft via the generated force. 1. An aircraft comprising:an airframe having an extending tail;a counter rotating, coaxial main rotor assembly disposed at the airframe including an upper rotor assembly and a lower rotor assembly and which produces aircraft component vibrations;a translational thrust system positioned at the extending tail and providing translational thrust to the airframe; and a plurality of AVC actuators configured to generate forces to dampen the aircraft component vibration; and', 'an AVC controller configured to transmit control signals to the plurality of AVC actuators to produce force generation by the plurality of AVC actuators to dampen the aircraft component vibration on the aircraft., 'an active vibration control (AVC) system disposed at the airframe including2. The aircraft of claim 1 , further comprising a plurality of AVC sensors positioned at the airframe to sense vibration of one or more aircraft components claim 1 , the AVC controller configured to receive the sensed vibration signals and transmit the control signals claim 1 ...

ANTISENSE OLIGONUCLEOTIDES TO RESTORE DYSFERLIN PROTEIN EXPRESSION IN DYSFERLINOPATHY PATIENT CELLS

The relates, in some aspects, to antisense oligonucleotide compositions and methods for modifying pre-mRNA splicing in a DYSF gene using the same. In some embodiments, the DYSF gene comprises a novel mutation that results in a pseudoexon between exons 50 and 51. 1. A method of modulating splicing in a cell that contains a DYSF gene comprising a c.5668-824 (C>T) mutation , the method comprising:delivering to the cell an antisense nucleic acid that targets a pre-messenger RNA expressed from the DYSF gene and alters splicing of the pre-messenger RNA such that exons 50 and 51 of the pre-messenger RNA are spliced together without an intervening pseudoexon.2. The method of claim 1 , wherein the cell is heterozygous for the c.5668-824 (C>T) point mutation.3. The method of claim 2 , wherein the cell contains a second DYSF gene encoding a wild-type DYSF protein.4. The method of claim 2 , wherein the cell contains a second DYSF gene comprising a mutation that causes a premature stop codon.5. The method of claim 4 , wherein the premature stop codon is within a region encoding the C2G domain of DYSF protein.6. The method of claim 5 , wherein the second DYSF gene is a human DYSF gene claim 5 , and wherein the mutation that causes the premature stop codon is a c.3444_3445delTGinsAA mutation.7. The method of any one of to claim 5 , wherein the cell is in vitro.8. The method of any one of to claim 5 , wherein the cell is in vivo.9. The method of any one of to claim 5 , wherein the cell is a non-human cell engineered to contain the DYSF gene comprising the c.5668-824 (C>T) mutation.10. The method of any one of to claim 5 , wherein the cell is a human cell.11. The method of claim 10 , wherein the human cell is engineered to contain the DYSF gene comprising the c.5668-824 (C>T) mutation.12. The method of claim 10 , wherein the human cell is from a subject having a muscular dystrophy that is associated at least in part with the DYSF gene comprising the c.5668-824 (C>T) mutation.13. The ...

RAAV-BASED COMPOSITIONS AND METHODS FOR TREATING AMYOTROPHIC LATERAL SCLEROSIS

The invention relates to inhibitory nucleic acids and rAAV-based compositions, methods and kits useful for treating Amyotrophic Lateral Sclerosis. 150.-. (canceled)51. A method of inhibiting expression of C9orf72 in a subject in need thereof , the method comprising administering to the subject an effective amount of a synthetic microRNA (miRNA) that targets a C9orf72 RNA transcript , wherein the synthetic miRNA specifically binds to a nucleic acid sequence of the RNA transcript , wherein the nucleic acid sequence of the RNA transcript bound by the synthetic miRNA is encoded by a nucleic acid sequence as set forth in any one of SEQ ID NO: 1 , 3 , 4 , 5 , or 8.52. The method of claim 51 , wherein the synthetic miRNA further comprises flanking regions of miR-155.53. The method of claim 52 , wherein the RNA transcript is a pre-mRNA transcript.54. The method of claim 52 , wherein the RNA transcript comprises a GChexanucleotide repeat.55. The method of claim 53 , wherein the pre-mRNA transcript is a C9orf72 Visoform transcript.56. The method of claim 53 , wherein the pre-mRNA transcript is a C9orf72 Visoform transcript.57. The method of claim 53 , wherein the pre-mRNA transcript is not a C9orf72 Visoform transcript.58. The method of claim 51 , wherein the RNA transcript comprises an intron.59. A synthetic microRNA (miRNA) that targets a C9orf72 RNA transcript claim 51 , wherein the synthetic miRNA specifically binds to a nucleic acid sequence of the RNA transcript claim 51 , wherein the nucleic acid sequence of the RNA transcript bound by the synthetic miRNA is encoded by a nucleic acid sequence as set forth in any one of SEQ ID NO: 1 claim 51 , 3 claim 51 , 4 claim 51 , 5 claim 51 , or 8 claim 51 , and wherein the synthetic miRNA further comprises flanking regions of miR-155.60. The synthetic miRNA of claim 59 , wherein the RNA transcript is a pre-mRNA transcript.61. The synthetic miRNA of claim 59 , wherein the RNA transcript comprises a GChexanucleotide repeat.62. The ...

USES OF MODIFIED MULLERIAN INHIBITING SUBSTANCE (MIS) PROTEINS FOR THE TREATMENT OF NEURODEGENERATIVE DISEASES

The present invention relates to methods to treat a neurodegenerative disease or disorder, e.g., a motor neuron disease in a subject, whereby the subject is administered a recombinant human Mullerian Inhibiting Substance (MIS) protein as disclosed herein, wherein the recombinant human MIS protein comprises a modified Kex cleavage site for increased cleavage. The recombinant human MIS protein can be produced from a pre-proprotein comprising a non-MIS leader sequence or a functional fragment thereof in place of the MIS leader sequence. 1. A method for treating a subject with a neurodegenerative disease or disorder , comprising administering a composition comprising a recombinant Mullerian Inhibiting Substance (MIS) protein , wherein the recombinant MIS protein comprises a modification of at least one amino acid between residues 448-452 of SEQ ID NO: 1.2. The method of claim 1 , wherein the modification increases cleavage as compared to in the absence of the modification claim 1 , wherein the recombinant MIS protein has increased cleavage and increased yield of production in vitro as compared to wild-type MIS protein corresponding to amino acid residues of SEQ ID NO: 1.3. The method of claim 1 , wherein the recombinant MIS protein is produced from a pre-proprotein comprising a non-MIS leader sequence or a functional fragment thereof in place of the MIS leader sequence of amino acids 1-25 of SEQ ID NO: 1.4. (canceled)5. The method of claim 1 , wherein one or more neurons from the subject express the MIS type II receptor or a homologue or functional fragment thereof.6. (canceled)7. The method of claim 1 , wherein the neurodegenerative disease is selected from the group of: amyotrophic lateral sclerosis (ALS) claim 1 , progressive bulbar palsy claim 1 , pseudobulbar palsy; primary lateral sclerosis (PLS); progressive muscular atrophy; spinal muscular atrophy (SMA claim 1 , including SMA type I claim 1 , SMA type II claim 1 , and SMA type III); Fazio-Londe disease; ...

EXPANDABLE INTERBODY SPACER

Embodiments of the present disclosure relate to devices and methods for treating one or more damaged, diseased, or traumatized portions of the spine, including intervertebral discs, to reduce or eliminate associated back pain. In one or more embodiments, the present disclosure relates to an expandable interbody spacer. The expandable interbody spacer may comprise a first jointed arm comprising a plurality of links pivotally coupled end to end. The expandable interbody spacer further may comprise a second jointed arm comprising a plurality of links pivotally coupled end to end. The first jointed arm and the second jointed arm may be interconnected at a proximal end of the expandable interbody spacer. The first jointed arm and the second jointed arm may be interconnected at a distal end of the expandable interbody spacer. 1. A system for treating a vertebral condition , the system comprising:an interbody implant configured to transition between a first configuration and a second configuration, wherein the interbody implant comprises:a first arm including a first end and a second end, wherein the first arm is defined by a plurality of links coupled to one another;a second arm including a first end and a second end, wherein the second arm is defined by a plurality of links coupled to one another;a proximal component coupled to the first ends of the first and second arms; anda distal component coupled to the second ends of the first and second arms,wherein each one of the plurality of links includes an extension that interacts with an extension of an adjacent one of the plurality of links,wherein the extensions of each of the plurality of links includes gear teeth configured to engage with gear teeth of adjacent extensions of each of the plurality of links.2. The system of claim 1 , wherein the first configuration is a collapsed configuration and the second configuration is an expanded configuration.3. The system of claim 1 , wherein one or both of the proximal and ...

Thermosyphon Configuration for Cascade Refrigeration Systems

The present application provides a thermosyphon for use with a refrigeration system. The thermosyphon may include a primary flow inlet, an angled secondary flow inlet, and a mixed flow outlet. The angled secondary flow inlet may include an angle θ of about forty-five degrees or less with respect to the mixed flow outlet. 1. A thermosyphon for use with a refrigeration system , comprising:a primary flow inlet;an angled secondary flow inlet; anda mixed flow outlet;{'b': '1', 'wherein the angled secondary flow inlet comprises an angle θ of about forty-five degrees or less with respect to the mixed flow outlet.'}2. The thermosyphon of claim 1 , wherein the primary flow inlet comprises a tank inlet in communication with a liquid vapor separator tank.3. The thermosyphon of claim 1 , wherein the secondary flow inlet comprises a compressor inlet in communication with one or more compressors.4. The thermosyphon of claim 1 , wherein the merged flow outlet comprises a cascade outlet in communication with a cascade evaporator-condenser.5. The thermosyphon of claim 1 , wherein the primary flow inlet comprises an angled primary flow inlet.62. The thermosyphon of claim 5 , wherein the angled primary flow inlet comprises an angle θ of about forty-five degrees or less with respect to the mixed flow outlet.7. The thermosyphon of claim 5 , wherein the angled primary flow inlet claim 5 , the angled secondary flow inlet claim 5 , and the mixed flow outlet comprise a substantial Y-like shape.812. The thermosyphon of claim 6 , wherein angle θ equals angle θ.912. The thermosyphon of claim 6 , wherein angle θ is different from angle θ.101. The thermosyphon of claim 1 , wherein angle θ is thirty degrees or less with respect to the mixed flow outlet.111. The thermosyphon of claim 1 , wherein angle θ is eleven degrees or less with respect to the mixed flow outlet.12. The thermosyphon of claim 1 , wherein the angled secondary flow inlet comprises a variable diameter angled secondary flow inlet. ...

CONTROLLING E-MAIL MESSAGE ORGANIZATION IN AN E-MAIL SYSTEM WHEN RECEIVED BY BCC

When a new message is received in a recipient's mailbox, it is examined to determine whether it was sent via the blind carbon copy (Bcc) field. If so, the recipient's mailbox is examined to determine whether the received message is in reply to another message in the user's mailbox. If so, the message is organizationally relocated (moved to a folder or tagged) based upon the prior message that the received message is in reply to.

Quantifying Net Axonal Transport in Motor Neuron Pathologies

Methods of monitoring and diagnosing subjects with motor neuron pathology such as motor neuron disorders (including but not limited to amyotrophic lateral sclerosis (ALS)) and neuropathies, based on imaging of a labeled fragment of tetanus toxin, e.g., tetanus toxin C fragment. 1. A method of diagnosing pathology in motor neurons in a subject , the method comprising:locally administering to a muscle of the subject a radiolabeled agent comprising tetanus toxic C fragment;obtaining a first image of the agent in the subject prior to the muscle injection at a first time point;obtaining at least a second image of the agent in the subject at a subsequent time point, and optionally multiple additional images at later time points;determining at each time point after injection the total amount of the agent that is taken up into the motor neurons in the pool that innervates the injected muscle, to determine net total transport at that time point; andusing the net total transport at the time points to calculate the rate of uptake, to determine net total axonal transport rate; anddiagnosing the subject as having a motor neuron pathology, when the net total transport and net axonal transport rate are reduced relative to reference net total transport and net axonal transport rate.2. The method of claim 1 , further comprising administering a treatment for a motor neuron disease to the subject.3. The method of claim 2 , wherein the treatment is administration of riluzole claim 2 , radicut claim 2 , Edaravone claim 2 , or inosine.4. The method of claim 2 , wherein the treatment is administration of stem cells.5. A method of monitoring a motor neuron pathology in a subject claim 2 , the method comprising:determining net total transport and/or net axonal transport rate in the subject at a first time point;determining net total transport and/or net axonal transport rate in the subject at a second time point;comparing net total transport and/or net axonal transport rate in the subject ...

OIL LINE CONTROL SYSTEM

The present application provides a refrigeration system. The refrigeration system may include a suction header, a compressor, a suction header oil return line in communication with the suction header and the compressor, and an oil line control system. The oil line control system may include a sensor and a valve to open and shut the suction header oil return line in response to the sensor. 1. A refrigeration system , comprising:a suction header;a compressor;a suction header oil return line in communication with the suction header and the compressor; andan oil line control system;wherein the oil line control system comprises a sensor and a valve to open and shut the suction header oil return line in response to the sensor.2. The refrigeration system of claim 1 , further comprising a refrigerant line in communication with the compressor and the suction header.3. The refrigeration system of claim 1 , wherein the suction header comprises refrigerant therein.4. The refrigeration system of claim 1 , wherein the suction header comprises oil therein.5. The refrigeration system of claim 1 , wherein the valve comprises a solenoid valve.6. The refrigeration system of claim 1 , wherein the sensor comprises a temperature sensor.7. The refrigeration system of claim 1 , wherein the oil line control system comprises a control in communication with the valve and the sensor.8. The refrigeration system of claim 1 , wherein the oil line control system comprises a manual control valve on the suction header oil return line.9. The refrigeration system of claim 8 , wherein the manual control valve comprises a ball valve.10. The refrigeration system of claim 1 , wherein the oil line control system comprises a pneumatic valve on the suction header oil return line.11. The refrigeration system of claim 10 , wherein the pneumatic valve comprises a Schrader valve.12. The refrigeration system of claim 1 , further comprising an oil separator downstream of the compressor.13. The refrigeration system ...

SYSTEM AND METHOD FOR ADDING DATA TO A PRINTED PUBLICATION

Systems and methods for adding data to a printed publication are provided. One method includes receiving variable data and controlling an energy source to at least partially ablate the printed publication based on the variable data. The printed publication is printed on the substrate using the commercial printing press based on fixed data. Controlling the energy source to at least partially ablate the printed publication includes, after the printed publication has been printed on the substrate by the commercial printing press based on the fixed data, controlling the energy source to remove a portion of the printed publication based on the variable data. 1. A system comprising:an image capturing device configured to capture an image of a printed product on a printing press; and process the captured image into a processed image accurate to within a tolerance in a color space to indicate the visual appearance of one or more colors, wherein the color space is a standardized color space,', 'transmit the processed image to a display located remote from the image capturing device, and', 'receive an input signal from a remote input device indicating input from the user with respect to the displayed processed image., 'a processing circuit in communication with the image capturing device and configured to2. The system of claim 1 , wherein the tolerance is not greater than 4 ΔE of a color on the printed product.3. The system of claim 1 , wherein the tolerance is not greater than 2 ΔE of a color on the printed product.4. The system of claim 1 , wherein the color space is a sRGB or a CIELAB color space.5. The system of claim 1 , wherein the input from the user indicates whether the user has approved or rejected the displayed processed image for printing on the printing press.6. The system of claim 1 , wherein the processed image comprises information from greater than three channels in a visible light spectrum.7. The system of claim 1 , wherein the processing circuit is ...

Cooling System

An apparatus includes a compressor, a load, a heat exchanger, and a heater. The compressor compresses a refrigerant. The load uses the refrigerant to remove heat from a space proximate the load. The load sends the refrigerant to the compressor. The heat exchanger receives the refrigerant from the compressor. The heat exchanger transfers heat from a fluid to the refrigerant. The heat exchanger discharges the refrigerant to the compressor. The heater adds heat to the fluid. 1. An apparatus comprising:a compressor configured to compress a refrigerant; use the refrigerant to remove heat from a space proximate the load; and', 'send the refrigerant to the compressor;, 'a load configured to receive the refrigerant from the compressor;', 'transfer heat from a fluid to the refrigerant; and', 'discharge the refrigerant to the compressor; and, 'a heat exchanger, configured toa heater configured to add heat to the fluid.2. The apparatus of claim 1 , further comprising a pump configured to circulate the fluid between the heater and the heat exchanger.3. The apparatus of claim 1 , further comprising:a first temperature sensor configured to measure a first temperature of the fluid;a second temperature sensor configured to measure a second temperature of the fluid; and calculate a differential between the measured first temperature and the measured second temperature;', 'compare the differential to a set point; and', 'increase a flow of the fluid based on the comparison of the calculated differential and the set point., 'a controller communicatively coupled to the first temperature sensor and the second temperature sensor, the controller configured to4. The apparatus of claim 1 , further comprising:a pressure sensor configured to measure a pressure of the refrigerant;a temperature sensor configured to measure a temperature of the refrigerant; anda controller communicatively coupled to the pressure sensor and the temperature sensor, the controller configured to increase a flow of ...

Cooling System

An apparatus includes a first compressor, a first load, a second compressor, a second load, and a heat exchanger. The first compressor compresses a first refrigerant. The first load uses the first refrigerant to remove heat from a space proximate the first load. The first load sends the first refrigerant to the first compressor. The second compressor compresses a second refrigerant. The second load uses the second refrigerant to remove heat from a space proximate the second load. The second load sends the second refrigerant to the second compressor. The heat exchanger receives the first refrigerant from the first compressor and receives the second refrigerant from the second compressor. The heat exchanger transfers heat from the first refrigerant to the second refrigerant. The heat exchanger discharges the first refrigerant to the first load and discharges the second refrigerant to the second compressor. 1. An apparatus comprising:a first compressor configured to compress a first refrigerant; use the first refrigerant to remove heat from a space proximate the first load; and', 'send the first refrigerant to the first compressor;, 'a first load configured toa second compressor configured to compress a second refrigerant; use the second refrigerant to remove heat from a space proximate the second load; and', 'send the second refrigerant to the second compressor; and, 'a second load configured to receive the first refrigerant from the first compressor;', 'receive the second refrigerant from the second compressor;', 'transfer heat from the first refrigerant to the second refrigerant;', 'discharge the first refrigerant to the first load; and', 'discharge the second refrigerant to the second compressor., 'a heat exchanger, configured to2. The apparatus of claim 1 , further comprising: receive the first refrigerant from the first compressor; and', 'remove heat from the first refrigerant; and, 'a high side heat exchanger configured toa part load path coupled to the heat ...

Cooling System

An apparatus includes a first compressor, a first load, a second compressor, a second load, a first heat exchanger, and a second heat exchanger. The first compressor compresses a first refrigerant. The first load uses the first refrigerant to remove heat from a space proximate the first load. The first load sends the first refrigerant to the first compressor. The second compressor compresses a second refrigerant. The second load uses the second refrigerant to remove heat from a space proximate the second load. The second load sends the second refrigerant to the second compressor. The first heat exchanger receives the first refrigerant from the first compressor. The first heat exchanger transfers heat from the first refrigerant to a fluid. The second heat exchanger receives the second refrigerant from the second compressor. The second heat exchanger transfers heat from the fluid to the second refrigerant. 1. An apparatus comprising:a first compressor configured to compress a first refrigerant; use the first refrigerant to remove heat from a space proximate the first load; and', 'send the first refrigerant to the first compressor;, 'a first load configured toa second compressor configured to compress a second refrigerant; use the second refrigerant to remove heat from a space proximate the second load; and', 'send the second refrigerant to the second compressor;, 'a second load configured to receive the first refrigerant from the first compressor; and', 'transfer heat from the first refrigerant to a fluid; and, 'a first heat exchanger, configured to receive the second refrigerant from the second compressor; and', 'transfer heat from the fluid to the second refrigerant., 'a second heat exchanger, configured to2. The apparatus of claim 1 , further comprising: receive the first refrigerant from the first compressor; and', 'remove heat from the first refrigerant; and, 'a high side heat exchanger configured toa part load path coupled to the first heat exchanger and the ...

Split Nut Valve Seat Puller

The invention is an improved tool for pulling a valve seat from a valve in a fluid end. The invention replaces the standard threaded nut and stem commonly used in such tools with a split nut comprising a plurality of removeably engageable split nut segments placed within a base and a stem configured to be used with the plurality of removeably engageable split nut segments. In the preferred embodiment, each split nut segment possesses a center-facing surface relative to the longitudinal axis of the invention comprising a set of horizontal v-grooves suitable to be disposed against complementary v-grooves of the stem. The base permits the plurality of split nut segments to be placed in an engaged position permitting the v-grooves of the split nut segments to removeably engage the v-grooves of the stem securely or to be placed in a disengaged position. The base containing the split nut segments is durable enough to be used in oil field work but lightweight enough to be used by individual or groups of workers safely. 1. An apparatus for holding and lifting a valve seat stem used to pull a valve seat from a valve in oil field equipment , comprising:a plurality of split nut segments arranged in a ring shape within a multi-part casing a center face onto which is disposed a set of horizontal grooves able to be mated to a set of complementary horizontal grooves on a valve seat stem', 'a ramped surface suitable to permit radial movement by the split nut segment, 'in which each split nut segment further comprises'} a ramped base, the slope of which ramped base matches the ramp slope on each of the plurality of split nut segments and', 'a top which can be compressed against the plurality of split nut segments within the base in which such compression impels the plurality of split nut segments down the ramp in the base and toward the central axis of the invention, 'in which the plurality of split nut segments are placed in a casing further comprising a'}thereby causing the ...

Integrated Suction Header Assembly

The present application provides a refrigeration system. The refrigeration system may include an evaporator assembly, a suction header assembly with a suction header heat exchanger therein, and a liquid header in communication with the suction header heat exchanger. 1. A refrigeration system , comprising:an evaporator assembly;a suction header assembly;the suction header assembly comprising a suction header heat exchanger therein; anda liquid header in communication with the suction header heat exchanger.2. The refrigeration system of claim 1 , wherein the evaporator assembly comprises one or more evaporator coils and an evaporator fan.3. The refrigeration system of claim 1 , further comprising an expansion valve upstream of the evaporator assembly and downstream of the liquid header.4. The refrigeration system of claim 1 , wherein the suction header assembly receives one or more evaporator flows of a refrigerant from the evaporator assembly.5. The refrigeration system of claim 1 , further comprising one or more compressors downstream of the suction header assembly.6. The refrigeration system of claim 5 , wherein the one or more compressors receive one or more compressor flows of a refrigerant from the suction header assembly.7. The refrigeration system of claim 5 , further comprising a condenser assembly downstream of the one or more compressors.8. The refrigeration system of claim 7 , wherein the condenser assembly comprises one or more condenser coils and a condenser fan.9. The refrigeration system of claim 1 , further comprising a receiver upstream of the suction header heat exchanger.10. The refrigeration system of claim 9 , further comprising a receiver flow of a refrigerant flowing from the receiver claim 9 , through the suction line heat exchanger claim 9 , and to the liquid header.11. The refrigeration system of claim 10 , wherein the receiver flow of a refrigerant in the suction line heat exchanger exchanges heat with an evaporator flow of a refrigerant ...

INTERIOR LADDER RACK

A mounting system for detachably storing ladders comprising at least one elongate member with a length and opposed first and second ends. The system also includes a ledge adapted to be movable along the length of the elongate member. A securing latch is provided which is adapted to be movable along the length of the elongate member. The securing latch is pivotally carried on the elongate member, The securing latch can have a gas spring with a body pivotally attached to the elongate member and a rod pivotally attached to the latch. The latch has a profile complimentary to a surface of said ladder. 1. A mounting system for detachably storing ladders , comprising:at least one elongate member vertically mountable to an interior wall of a vehicle;a ledge extending outwardly from the elongate member and adapted to be movable along and securable to the elongate member; anda latch adapted to be movable and securable along the elongate member, the latch being pivotably secured to the elongate member and including a rear leg portion extending downwardly from a central portion to facilitate engagement with a ladder to cause rotation of the latch, and a forward leg portion extending downwardly from the central portion to engage a forward top portion of a ladder to secure a ladder on the mounting system.2. The system of claim 1 , in which the latch is operably engaged with a gas spring secured to the elongate member to assist in rotating an upper end of a ladder outwardly upon unlatching of the latch from a ladder. This application claims priority to U.S. Provisional Patent Application No. 61/947,734 filed on Mar. 4, 2014, which is hereby incorporated by reference in its entirety.This disclosure relates to vehicle racks that facilitate loading and unloading of a ladder, and more particularly to a ladder rack that is mounted within the interior of a vehicle.Transporting ladders in vehicles has been a persistent issue in the field. It is known to transport ladders on vehicles when ...

SYSTEM, METHOD AND COMPUTER PROGRAM PRODUCT FOR DATA TRANSFER MANAGEMENT

According to one aspect of the present disclosure a method and technique for managing data transfer includes receiving and storing a plurality of different data patterns anticipated to be encountered by a processor unit of a data processing system corresponding to a particular application being processed. Responsive to receiving a read request for data, the requested data is read from a memory subsystem, and the read data is compared by the memory subsystem to the stored data patterns. Responsive to determining that the read data matches at least one of the stored data patterns, the memory subsystem replaces the matching read data with a pattern tag corresponding to the matching data pattern. The pattern tag is transmitted over a communication link in response to the request. 1. A method comprising:receiving and storing a plurality of different data patterns;responsive to receiving a request for data, determining whether any portions of the data match at least one of the data patterns;responsive to determining that at least some portion of the data matches at least one of the data patterns, determining whether the data pattern is repeated in the data;responsive to determining that the data pattern is repeated in the data, identifying a first pattern tag corresponding to the matching data pattern;identifying a second pattern tag representing repeated instances of the first pattern tag;and transmitting the second pattern tag along with non-matching data over a communication link in response to the request.2. The method of claim 1 , further comprising:accessing, by a memory buffer, a memory device;reading the requested data out of the memory device; andcomparing by the memory buffer the read data to the stored data patterns.3. The method of claim 1 , further comprising:receiving at a memory buffer the second pattern tag from a processor unit;determining the data corresponding to the second pattern tag; andwriting the corresponding data to a memory device.4. The method ...

Optically clear diaphragm for an acoustic transducer and method for making same

The present disclosure relates to a diaphragm that may be used with a mechanical-to-acoustical transducer. The diaphragm may include a layer of optically clear film, a damping layer and another layer of optically clear film. The damping layer may be an adhesive. The diaphragm may also comprise two optically clear films, optionally including a damping layer, wherein the films indicate a desired coefficient of linear thermal expansion in one or both of the machine and transverse directions.

PRINTING USING COLOR CHANGEABLE MATERIAL

Systems and methods for printing data on a substrate including a color-changeable material are provided. One system includes a processing circuit and a device including an energy source. At least a portion of a printed publication is printed on the substrate using a commercial printing press based on fixed data. The device including the energy source is configured to add variable data to the substrate. The processing circuit is configured to receive the variable data and to control the energy source to change a color of the color-changeable material based on the variable data to provide at least a portion of the printed publication. The processing circuit is configured to control the energy source to change the color of the color-changeable material in-line with a flow of the substrate through one of a printing line, a finishing line, or a packaging line of the commercial printing press. 1. A printing press for printing data on a substrate comprising a color-changeable material , the printing press comprising:a laser diode array comprising a plurality of diodes;a housing to which the laser diode array is mounted, the housing disposing the laser diode array across at least a portion of the substrate; anda processing circuit configured to control a parameter of light emitted by each of the plurality of diodes to generate an image comprising a plurality of different colors in the color-changeable material on the substrate, and wherein, for each of the plurality of diodes, the parameter comprises at least one of a wavelength, a frequency, or a power of the light emitted by the diode and the color of a portion of the color-changeable material on which the light is emitted by the diode is determined based at least in part on the parameter of the light.2. The printing press of claim 1 , wherein the laser diode array spans across an entire width of a printing area of the substrate.3. The printing press of claim 2 , wherein the laser diode array spans across at least eighty ...

Nesting baking oven racks

A nesting bakery oven rack has first and second vertical side panels extending between the front and the rear of the rack. The rack has a generally x-shaped base comprising a first diagonal brace extending from a point adjacent the front of the first side panel to a point adjacent the rear of the second side panel. A first slot in the first side panel extends from the rear of the first side panel toward the front to accommodate the first brace of another nesting bakery oven rack nested with the nesting bakery oven rack at the rear. A second slot in the second side panel extends from the front of the second side panel toward the rear of the second side panel to accommodate the first diagonal brace of another nesting bakery oven rack nested with the nesting bakery oven rack at the front. A second diagonal brace extending from a point adjacent the front of the second side panel to a point adjacent the rear of the first side panel, the ends of the second diagonal brace being out of the horizontal plane of first brace.

FUS/TLS-BASED COMPOUNDS AND METHODS FOR DIAGNOSIS, TREATMENT AND PREVENTION OF AMYOTROPHIC LATERAL SCLEROSIS AND RELATED MOTOR NEURON DISEASES

The invention provides novel FUS/TLS nucleic acids and proteins that comprise one or more genetic markers (for example, single nucleotide polymorphisms) and methods of use thereof including methods relating to the diagnosis of ALS or other related motor neuron disease by virtue of the presence of the mutant FUS/TLS sequence(s). 117.-. (canceled)18. A nucleic acid , comprising at least 10 contiguous nucleotides of SEQ ID NO:3 , or a complementary sequence thereof , wherein said nucleic acid comprises the nucleotide corresponding to position 1551 , 1542 , 1543 , 1561 , 1562 , 1564 , and/or 1572 of SEQ ID NO:3 , wherein the nucleic acid comprises a detectable label.19. The nucleic acid of claim 18 , wherein the nucleic acid comprises at least 15 contiguous nucleotides of SEQ ID NO:3 claim 18 , or a complementary sequence thereof.20. The nucleic acid of claim 18 , wherein the detectable label is selected from a fluorescent label claim 18 , a radioactive label claim 18 , an optical or electron density label claim 18 , an energy transfer label claim 18 , an epitope tag claim 18 , or an enzymatic label.21. A kit comprising at least one nucleic acid according to .22. The kit of claim 21 , wherein the at least one nucleic acid is immobilized to a substrate.23. A microarray comprising at least one nucleic acid according to .24. A nucleic acid claim 18 , comprising at least 10 contiguous nucleotides of SEQ ID NO:3 claim 18 , or a complementary sequence thereof claim 18 , except for said nucleic acid comprising: a G at the position corresponding to position 1551 of SEQ ID NO:3; a G at the position corresponding to position 1561 of SEQ ID NO:3; a T at the position corresponding to position 1542 of SEQ ID NO:3; a T at the position corresponding to position 1543 of SEQ ID NO:3; an A at the position corresponding to position 1562 of SEQ ID NO:3; a G at the position corresponding to position 1564 of SEQ ID NO: 3; and/or a C at the position corresponding to position 1572 of SEQ ID NO ...

SYSTEM AND METHOD FOR CODED TRANSACTION PROCESSING

An coupon distribution and processing platform system allows its members/constituents to receive services associated with the purchase of consumer products. Specifically, a user, registered with the system, accesses an account and electronically selects one or more coupons to be associated with a card device. Thereafter, when the user's card device is scanned at a particular retail entity, the accounts associated with the user and retail entity are credited, while the account associated with the manufacturer is debited. Further, the user, the manufacturer, and the retail entity, each having a corresponding account, may select one or more services provided by with the system website. 1. A method for conducting a transaction to purchase a product or service , comprising:scanning a user identification code from a code stored on a card device at a point of sale node using a scanner, wherein the user identification code is associated with each user, and wherein the scanned identification code is associated by the point of sale system to a list of products and coupons scanned and recorded as part of a transaction;retrieving from the point of sale system to a discount data processing system a record of the transaction, comprising identification of the retail entity, a list of products scanned and associated discount data at the point of sale system as part of the transaction, including the scanned user identification code;extracting from the data record of the transaction the identification code of the user and using the identification code to reference stored information related to the user;retrieving a list of available discount incentives for the user at a transaction time; anddetermining for which of the available discount incentives the user has met eligibility requirements as stated in a plurality of rules specified with each discount incentive, by matching user purchases in the current transaction against purchase requirements specified in the rules.2. The method of ...

RAAV-BASED COMPOSITIONS AND METHODS FOR TREATING AMYOTROPHIC LATERAL SCLEROSIS

The invention relates to inhibitory nucleic acids and rAAV-based compositions, methods and kits useful for treating Amyotrophic Lateral Sclerosis. 1. A synthetic miRNA comprising 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 or 21 consecutive nucleotides encoded by a sequence set forth in any one of SEQ ID NOs: 1 to 8 , or 15 to 17.2. The synthetic miRNA of further comprising flanking regions of miR-155.3. A composition comprising the synthetic miRNA of .4. A recombinant nucleic acid comprising a sequence set forth in any one of SEQ ID NOs: 1 to 8 claim 1 , or 15 to 17 and further comprising an inverted terminal repeat (ITR) of an AAV serotype.5. The recombinant nucleic acid of claim 4 , wherein the AAV serotype is selected from the group consisting of AAV1 claim 4 , AAV2 claim 4 , AAV5 claim 4 , AAV6 claim 4 , AAV6.2 claim 4 , AAV7 claim 4 , AAV8 claim 4 , AAV9 claim 4 , AAVRh10 claim 4 , AAV11 and variants thereof.6. The recombinant nucleic acid of claim 5 , further comprising a promoter operably linked with a region(s) encoding the miRNA.7. The recombinant nucleic acid of claim 6 , wherein the promoter is a tissue-specific promoter.8. The recombinant nucleic acid of claim 7 , wherein the promoter is a polymerase II promoter claim 7 , such as a β-actin promoter.9. The recombinant nucleic acid of claim 7 , wherein the promoter is a polymerase III promoter claim 7 , such as a U6 promoter.10. A composition comprising the recombinant nucleic acid of .11. A recombinant Adeno-Associated Virus (AAV) comprising a recombinant nucleic acid encoding a miRNA comprising 5 claim 4 , 6 claim 4 , 7 claim 4 , 8 claim 4 , 9 claim 4 , 10 claim 4 , 11 claim 4 , 12 claim 4 , 13 claim 4 , 14 claim 4 , 15 claim 4 , 16 claim 4 , 17 claim 4 , 18 claim 4 , 19 claim 4 , 20 or 21 consecutive nucleotides encoded by a sequence as set forth in any one of SEQ ID NOs: 1 to 8 claim 4 , or 15 to 17 and further comprising an inverted terminal repeat (ITR) of an AAV ...

EXPANDABLE INTERBODY SPACER

Embodiments of the present disclosure relate to devices and methods for treating one or more damaged, diseased, or traumatized portions of the spine, including intervertebral discs, to reduce or eliminate associated back pain. In one or more embodiments, the present disclosure relates to an expandable interbody spacer. The expandable interbody spacer may comprise a first jointed arm comprising a plurality of links pivotally coupled end to end. The expandable interbody spacer further may comprise a second jointed arm comprising a plurality of links pivotally coupled end to end. The first jointed arm and the second jointed arm may be interconnected at a proximal end of the expandable interbody spacer. The first jointed arm and the second jointed arm may be interconnected at a distal end of the expandable interbody spacer. 1. A system for treating a vertebral condition , the system comprising: a first arm including a first end and a second end, wherein the first arm is defined by a plurality of links coupled to one another;', 'a second arm including a first end and a second end, wherein the second arm is defined by a plurality of links coupled to one another;', 'a proximal component coupled to the first ends of the first and second arms, wherein the proximal component includes a lumen with threads;', 'a distal component coupled to the second ends of the first and second arms; and', 'a locking feature received in the lumen, wherein the locking feature includes threads that engage the threads of the lumen; and, 'an interbody implant configured to transition between a first configuration and a second configuration, wherein the interbody implant comprises a handle assembly comprising a holder element;', 'an elongate member received in the holder element, wherein the elongate member includes a fork-like end for grasping the interbody implant;', 'a sleeve positioned over the elongate member;', 'an actuator assembly operably attached to a proximal portion of the elongate ...

PERFORMANCE-DRIVEN CACHE LINE MEMORY ACCESS

A system and technique for cache line memory access includes a processor, a sectored cache, a memory, a memory controller, and logic. The logic is executable to, responsive to a miss in the cache of a sector address requested by the processor, request a cache line from the memory. The cache line request is divided into first and second cache subline requests. A determination is made as to which of the first and second cache subline requests corresponds to the requested sector address. Responsive to determining that the first cache subline request corresponds to the requested sector address, the first cache subline request is placed into a high priority queue of the memory controller and the second cache subline request is placed into a low priority queue of the memory controller. Requests from the high priority queue are serviced before requests from the low priority queue. 1. A system , comprising:a processor;a sectored cache;a memory;a memory controller; and request a cache line from the memory;', 'divide the cache line request into a first cache subline request and a second cache subline request;', 'determine which of the first and second cache subline requests corresponds to the requested sector address;', 'responsive to determining that the first cache subline request corresponds to the requested sector address, place the first cache subline request into a high priority queue of the memory controller;', 'place the second cache subline request into a low priority queue of the memory controller; and', 'service requests from the high priority queue before servicing requests from the low priority queue., 'logic executable to, responsive to a miss in the cache of a sector address requested by the processor2. The system of claim 1 , wherein the logic is executable to:responsive to placing the second cache subline request in the low priority queue, initiate a timer; andresponsive to expiration of the timer, service the second cache subline request.3. The system of ...

RAAV-BASED COMPOSITIONS AND METHODS FOR TREATING AMYOTROPHIC LATERAL SCLEROSIS

The invention relates to inhibitory nucleic acids and rAAV-based compositions, methods and kits useful for treating Amyotrophic Lateral Sclerosis. 150-. (canceled)51. A synthetic miRNA that targets a C9orf72 RNA transcript , wherein the synthetic miRNA specifically binds to a nucleic acid sequence of the RNA transcript encoded by a nucleic acid sequence set forth in SEQ ID NO: 2 , 6 , or 7.52. The synthetic miRNA of claim 51 , further comprising flanking regions of miR-155.53. The synthetic miRNA of claim 51 , wherein the RNA transcript is a pre-mRNA transcript.54. The synthetic miRNA of claim 51 , wherein the RNA transcript comprises a GChexanucleotide repeat.55. The synthetic miRNA of claim 53 , wherein the pre-mRNA transcript is a C9orf72 Visoform transcript.56. The synthetic miRNA of claim 53 , wherein the pre-mRNA transcript is a C9orf72 Visoform transcript.57. The synthetic miRNA of claim 53 , wherein the pre-mRNA transcript is not a C9orf72 Visoform transcript.58. The synthetic miRNA of claim 51 , wherein the RNA transcript comprises an intron.59. A recombinant nucleic acid encoding a synthetic miRNA that targets a C9orf72 RNA transcript claim 51 , wherein the synthetic miRNA specifically binds to a nucleic acid sequence of the RNA transcript encoded by a nucleic acid sequence set forth in SEQ ID NO: 2 claim 51 , 6 claim 51 , or 7 claim 51 , flanked by AAV inverted terminal repeats (ITRs).60. The recombinant nucleic acid of claim 59 , further comprising a promoter operably linked with a region encoding the synthetic miRNA.61. The recombinant nucleic acid of claim 60 , wherein the promoter is a tissue-specific promoter.62. The recombinant nucleic acid of claim 60 , wherein the promoter is an RNA polymerase II promoter claim 60 , optionally wherein the polymerase II promoter is a chicken (3-actin (CBA) promoter.63. The recombinant nucleic acid of claim 60 , wherein the promoter is an RNA polymerase III promoter claim 60 , optionally wherein the polymerase III ...

Packing Assembly for a Pump

A header ring for use in a stuffing box comprising an annular body portion of an elastomeric material, an annular radially inward projecting sealing lip portion formed on said body portion and an annular, axially facing pedestal portion formed on said body portion, said pedestal portion defining an annularly extending radially inwardly facing pedestal surface, the sealing lip portion defining an annularly extending, radially inward facing sealing surface, the sealing surface and the pedestal surface forming a juncture, at least a portion of the pedestal portion adjacent the juncture and forming the pedestal surface and at least a portion of the sealing lip portion adjacent the juncture and forming a portion of the sealing surface being comprised of a layer of reinforced elastomeric material bonded to the body portion. 1. A header ring comprising:an opening;a radially inwardly facing annularly extending sealing surface adjacent the opening;a generally radially inwardly facing surface adjacent the opening;a radially outwardly facing surface opposite the opening;a radially extending surface extending between the generally radially inwardly facing surface and the radially outwardly facing surface;an axially extending surface extending between the radially outwardly facing surface and the radially inwardly facing annularly extending sealing surface; andat least a section of the radially inwardly facing annularly extending sealing surface and at least a section of the generally radially inwardly facing surface comprising fabric reinforced elastomeric material.2. The header ring of claim 1 , wherein the fabric reinforced elastomeric material comprises woven fabric.3. The header ring of claim 1 , wherein the fabric reinforced elastomeric material forms a barrier blocking operational nibbling away of the header ring at a junction of the radially inwardly facing annularly extending sealing surface and the generally radially inwardly facing surface.4. The header ring of claim ...

PRINTING USING COLOR CHANGEABLE MATERIAL

Systems and methods for printing data on a substrate including a color-changeable material are provided. One system includes a processing circuit and a device including an energy source. At least a portion of a printed publication is printed on the substrate using a commercial printing press based on fixed data. The device including the energy source is configured to add variable data to the substrate. The processing circuit is configured to receive the variable data and to control the energy source to change a color of the color-changeable material based on the variable data to provide at least a portion of the printed publication. The processing circuit is configured to control the energy source to change the color of the color-changeable material in-line with a flow of the substrate through one of a printing line, a finishing line, or a packaging line of the commercial printing press.

Instrumented percussion hammer bit

A percussion drilling assembly includes a housing and a drill bit within a lower end of the housing. At least one of a piston or an anvil is within the housing above the drill bit. The drilling assembly also includes at least one sensor in at least one of the housing, the piston, or the anvil. A method of drilling includes drilling a formation with a percussion drilling assembly, the percussion drilling assembly having at least one sensor located in a component thereof. The at least one sensor may measure at least one property of the percussion drilling assembly while drilling. The measurements taken by the at least one sensor may be analyzed and a new percussion drilling assembly designed based on the analysis.

PACKING ASSEMBLY FOR A PUMP

A header ring for use in a stuffing box comprising an annular body portion of an elastomeric material, an annular radially inward projecting sealing lip portion formed on said body portion and an annular, axially facing pedestal portion formed on said body portion, said pedestal portion defining an annularly extending radially inwardly facing pedestal surface, the sealing lip portion defining an annularly extending, radially inward facing sealing surface, the sealing surface and the pedestal surface forming a juncture, at least a portion of the pedestal portion adjacent the juncture and forming the pedestal surface and at least a portion of the sealing lip portion adjacent the juncture and forming a portion of the sealing surface being comprised of a layer of reinforced elastomeric material bonded to the body portion. 1. A positive displacement reciprocating plunger-type pump , the pump adapted to displace a fluid within a subterranean well , the pump comprising:a housing having a generally cylindrical bore extending therethrough and forming a generally radially inwardly facing housing cylindrical surface;a plunger reciprocally positioned in the bore, such that an annulus is formed between the housing cylindrical surface and the plunger;at least one annular sealing ring positioned in the annulus; a radially inwardly extending first annular portion adjacent the opening, an axially extending second annular portion adjacent the opening,', 'an axially extending third annular portion opposite the opening,', 'a radially extending fourth annular portion extending between the second and third annular portions,', 'an axially extending annular bead opposite the fourth annular portion, the bead being adjacent the first annular portion,, 'a header ring positioned in the annulus and engaged with one of the at least one annular sealing ring, the header ring defining an opening through which the plunger extends, the header ring having a resilient body comprising 'a layer of ...

EXPANDABLE INTERBODY SPACER

Embodiments of the present disclosure relate to devices and methods for treating one or more damaged, diseased, or traumatized portions of the spine, including intervertebral discs, to reduce or eliminate associated back pain. In one or more embodiments, the present disclosure relates to an expandable interbody spacer. The expandable interbody spacer may comprise a first jointed arm comprising a plurality of links pivotally coupled end to end. The expandable interbody spacer further may comprise a second jointed arm comprising a plurality of links pivotally coupled end to end. The first jointed arm and the second jointed arm may be interconnected at a proximal end of the expandable interbody spacer. The first jointed arm and the second jointed arm may be interconnected at a distal end of the expandable interbody spacer. 1. A system for treating a vertebral condition , the system comprising:an interbody implant configured to transition between a first configuration and a second configuration, wherein the interbody implant comprises:a first arm including a first end and a second end, wherein the first arm is defined by a plurality of links coupled to one another;a second arm including a first end and a second end, wherein the second arm is defined by a plurality of links coupled to one another;a proximal component coupled to the first ends of the first and second arms; anda distal component coupled to the second ends of the first and second arms,a locking feature configured and dimensioned to be received within a lumen of the proximal component,wherein each one of the plurality of links includes an extension that interacts with an extension of an adjacent one of the plurality of links,{'b': 2760', '2704', '2704', '2705', '2760', '2764', '2705', '2704', '2764', '2760', '2704', '2705', '2704', '2705', '2704', '2760', '2704', '2762', '2704', '2762', '2704, 'i': 'a', 'In one embodiment, an external surface of locking feature may include suitable geometric features for ...

ANTI-C9ORF72 OLIGONUCLEOTIDES AND RELATED METHODS

The present disclosure provides antisense compounds, methods, and compositions for silencing C9ORF72 transcripts. The present disclosure provides antisense compounds, methods, and compositions for the treatment, prevention, or amelioration of diseases, disorders, and conditions associated with C9ORF72 in a subject in need thereof. Also contemplated are antisense compounds and methods for the preparation of a medicament for the treatment, prevention, or amelioration of a disease, disorder, or condition associated with C9ORF72. 1. An antisense oligonucleotide comprising a region of complementarity to a C9ORF72 antisense transcript sequence of 5′ GAAAGUAAAAAUGCGUCGAG 3′ (SEQ ID NO:1) , 5′ CUCCUUGUUUUCUUCUGGUU 3′ (SEQ ID NO: 2) , 5′ CAGGUCUUUUCUUGUUCACC 3′ (SEQ ID NO: 3) , or 5′ CCUCCUUGUUUUCUUCUGGU 3′ (SEQ ID NO: 4).2. The antisense oligonucleotide of claim 1 , wherein the antisense oligonucleotide comprises 8 to 80 nucleotides in length or 10 to 30 nucleotides in length and wherein the antisense oligonucleotide comprises one or more modified nucleotides claim 1 , optionally wherein the one or more modified nucleotides each independently comprise a modification of a ribose group claim 1 , a phosphate group claim 1 , a nucleobase claim 1 , or a combination thereof claim 1 , optionally wherein:{'sub': '2', 'sup': 'N', 'each modification of the ribose group is 2′-O-methyl, 2′-fluoro, 2′-H, 2′-O-(2-methoxyethyl) (MOE), 2′-O-alkyl, 2′-O-alkoxy, 2′-O-alkylamino, 2′-NH, or a constrained nucleotide, wherein the constrained nucleotide is optionally a locked nucleic acid (LNA), an ethyl-constrained nucleotide, a 2′-(S)-constrained ethyl (S-cEt) nucleotide, a constrained MOE, a 2′-0,4′-C-aminomethylene bridged nucleic acid (2′4-BNAC), an alpha-L-locked nucleic acid, a tricyclo-DNA, or any combination thereof;'}each modification of the phosphate group is a phosphorothioate, phosphonoacetate (PACE), thiophosphonoacetate (thioPACE), amide, triazole, phosphonate, or phosphotriester ...

INTEGRATED SUCTION HEADER ASSEMBLY

The present application provides a refrigeration system. The refrigeration system may include an evaporator assembly, a suction header assembly with a suction header heat exchanger therein, and a liquid header in communication with the suction header heat exchanger. 1. A refrigeration system , comprising:an evaporator assembly;a suction header assembly coupled to an outlet of the evaporator assembly for receiving one or more evaporator flows of a refrigerant from the evaporator assembly;a suction header heat exchanger disposed within a reservoir of the suction header assembly, wherein the suction header heat exchanger is configured to sub-cool a flow of refrigerant passing through the suction header heat exchanger with a counter flow of at least one evaporator flow from the evaporator assembly flowing through the reservoir;a hot gas diversion assembly comprising a diversion heat exchanger line extending along the suction header assembly;a temperature sensor disposed within the reservoir of the suction header assembly and electrically coupled to at least one valve, the at least one valve is configured to control passage of refrigerant into the hot gas diversion assembly in response to temperature measured by the temperature sensor; anda liquid header configured to receive a direct refrigerant flow from the suction header heat exchanger.2. The refrigeration system of claim 1 , wherein the evaporator assembly comprises one or more evaporator coils and an evaporator fan.3. The refrigeration system of claim 1 , wherein the suction header assembly is configured to reduce a potential for slugging due to low superheat and to provide energy savings due to liquid sub-cooling.4. The refrigeration system of claim 1 , wherein the liquid header is functionally coupled between an inlet of the evaporator assembly and an outlet of the suction header heat exchanger claim 1 , the liquid header configured to divide a received liquid into a plurality of flows.5. The refrigeration system ...

Bioassay and biomolecular identification, sorting, and collection methods using magnetic microspheres

The present invention is directed to processes of separating, analyzing and/or collecting selected species within a target sample by use of magnetic microspheres including magnetic particles, the magnetic microspheres adapted for attachment to a receptor agent that can subsequently bind to selected species within the target sample. The magnetic microspheres can be sorted into a number of distinct populations, each population with a specific range of magnetic moments and different receptor agents can be attached to each distinct population of magnetic microsphere.

Cone erosion protection for roller cone drill bits

A method of forming a drill bit structure, the method including fixing spacers to the drill bit structure. The spacers are arranged at preselected locations on an outer surface of the drill bit structure. A hardfacing material is then applied to the drill bit structure, and the spacers are removed. Holes are machined in the drill bit structure at the preselected locations, and drilling inserts are positioned in each hole. A method of forming a drill bit structure, the method including applying a hardfacing material to selected surfaces of the drill bit structure. The hardfacing material includes a perforated carbide infiltrated material and a perforated powder infiltrated material. The perforations in the powder infiltrated material correspond to the perforations in the carbide infiltrated material. Holes are machined in the drill bit structure at the locations of the perforations, and drilling inserts are positioned in each hole.

Cutting tool assembly with replaceable spray nozzle

A cutting tool assembly includes a support block having a concealable outer surface portion, first and second bores, and first and second fluid passages. The first fluid passage is in fluid communication with the first bore and the second fluid passage. The second fluid passage has an axis and extends between the concealable outer surface portion and the second bore. Furthermore, the second bore and the second fluid passage are configured such that the axis may be extended through the second bore and beyond the support block without intersecting the support block. The cutting tool assembly also includes a replaceable spray nozzle having a body that extends into the first bore such that the spray nozzle is in fluid communication with the first fluid passage.

Optically clear diaphragm for an acoustic transducer and method for making same

The present disclosure relates to a diaphragm that may be used with a mechanical-to-acoustical transducer. The diaphragm may include a layer of optically clear film, a damping layer and another layer of optically clear film. The damping layer may be an adhesive. The diaphragm may also comprise two optically clear films, optionally including a damping layer, wherein the films indicate a desired coefficient of linear thermal expansion in one or both of the machine and transverse directions.