Настройки

Укажите год
-

Небесная энциклопедия

Космические корабли и станции, автоматические КА и методы их проектирования, бортовые комплексы управления, системы и средства жизнеобеспечения, особенности технологии производства ракетно-космических систем

Подробнее
-

Мониторинг СМИ

Мониторинг СМИ и социальных сетей. Сканирование интернета, новостных сайтов, специализированных контентных площадок на базе мессенджеров. Гибкие настройки фильтров и первоначальных источников.

Подробнее

Форма поиска

Поддерживает ввод нескольких поисковых фраз (по одной на строку). При поиске обеспечивает поддержку морфологии русского и английского языка
Ведите корректный номера.
Ведите корректный номера.
Ведите корректный номера.
Ведите корректный номера.
Укажите год
Укажите год
Применить Всего найдено 41722. Отображено 100.
11-04-2019 дата публикации

Дозированная форма для выделения днк

Номер: RU0000188424U1
Автор: Важа Хутаевич Пация, Вахтанг Почхуа, Гиоргий Жгенти, Марина Почхуа, Мераб Георгиевич Чикобава, Олег Васильевич Рубальский, Ульрих Мартин
Принадлежит: Важа Хутаевич Пация, Вахтанг Почхуа, Гиоргий Жгенти, Марина Почхуа, Мераб Георгиевич Чикобава, Олег Васильевич Рубальский, Ульрих Мартин

Полезная модель относится к медицине и биологии и предназначена для использования при производстве наборов для выделения ДНК, применяемых при проведении молекулярно-генетических исследований. Дозированная форма для выделения ДНК включает ядро, содержащее совместно спрессованные мочевину, натрия хлорид и диоксид кремния, а также сплошную оболочку, состоящую, по меньшей мере, из одного гидрофобного ингредиента, выбранного из ряда: парафин и воск, и выполнена в виде глобулы или таблетки, при этом глобула имеет предпочтительный диаметр 2,0-4,0 мм, а таблетка имеет предпочтительный диаметр 2,0-4,0 мм и предпочтительную толщину 2,0-4,0 мм, причем содержание мочевины, натрия хлорида и диоксида кремния в ядре составляет, мас. %: мочевина - 67,5-80,0, натрия хлорид - 10,0-25,5 и диоксид кремния - 7,0-10,0. Техническим результатом полезной модели является увеличение срока хранения дозированной формы, предотвращение перекрестной контаминации реакционных смесей и обеспечение их пароизоляции. РОССИЙСКАЯ ФЕДЕРАЦИЯ (19) RU (11) (13) 188 424 U1 (51) МПК C12M 3/02 (2006.01) C12N 15/10 (2006.01) C12Q 1/68 (2006.01) ФЕДЕРАЛЬНАЯ СЛУЖБА ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ (12) ОПИСАНИЕ ПОЛЕЗНОЙ МОДЕЛИ К ПАТЕНТУ (52) СПК C12M 3/02 (2019.02); C12N 15/1003 (2019.02); C12Q 1/68 (2019.02) (21) (22) Заявка: 2018128273, 02.08.2018 (24) Дата начала отсчета срока действия патента: 02.08.2018 11.04.2019 (45) Опубликовано: 11.04.2019 Бюл. № 11 Адрес для переписки: 414004, г. Астрахань, ул. Софьи Перовской, 64, кв. 56, Рубальскому Олегу Васильевичу R U 1 8 8 4 2 4 U 1 (56) Список документов, цитированных в отчете о поиске: US 2017/0081704 A1, 23.03.2017. US 5405951 A, 11.04.1995. RU 2539030 C1, 10.01.2015. RU 2116795 C1, 10.08.1998. BY 15648 C1, 30.04.2012. (54) ДОЗИРОВАННАЯ ФОРМА ДЛЯ ВЫДЕЛЕНИЯ ДНК (57) Реферат: Полезная модель относится к медицине и предпочтительный диаметр 2,0-4,0 мм, а таблетка биологии и предназначена для использования при имеет предпочтительный диаметр 2,0-4,0 мм и производстве ...

Подробнее
Номер записи: 1
05-01-2012 дата публикации

Animal model for parkinson's disease

Номер: US20120005765A1
Автор: Michael Panneton, Vijaya Kumar, William Burke
Принадлежит: St Louis University

Disclosed are methods and compositions for an animal model of Parkinson's disease. In particular, disclosed is the use of antisense compounds to inhibit the expression of ALDH1A1 in the substantia nigra of an animal brain for the purpose of creating an animal that will displays the symptoms of a human with Parkinson's Disease, including various biochemical, histological, and behavioral characteristics. Also disclosed are methods for using the animal model for Parkinson's disease to test potential therapeutic agents for Parkinson's disease.

Подробнее
Номер записи: 2
31-01-2022 дата публикации

Устройство для выделения и очистки нуклеиновых кислот и/или макромолекул из биологического образца

Номер: RU0000209043U1
Автор: Александр Николаевич Неваленный, Анна Леонидовна Ясенявская, Гиоргий Александрович Ростошвили, Игорь Юрьевич Алексанян, Кристина Шотаевна Арнаудова, Любовь Михайловна Титова, Марина Александровна Самотруева, Мария Романовна Копылова, Ольга Александровна Башкина, Юрий Александрович Максименко
Принадлежит: Федеральное государственное бюджетное образовательное учреждение высшего образования "Астраханский государственный медицинский университет" Министерства здравоохранения Российской Федерации (ФГБОУ ВО Астраханский ГМУ Минздрава России), Федеральное государственное бюджетное образовательное учреждение высшего образования Астраханский государственный технический университет, ФГБОУ ВО "АГТУ"

Полезная модель относится к области молекулярной биологии, биотехнологии и биохимии и может быть использована в медицине. Полезная модель представляет собой устройство для выделения и очистки магнитных наночастиц при экстракции и очистке нуклеиновых кислот (ДНК и РНК) сорбентным методом из различного биологического материала.Технический результат - повышение эффективности работы устройства при его использовании.Устройство имеет верхнюю и нижнюю пластины, держатель пробирок с ручками для переноски, расположенный на верхней пластине, который имеет отверстия и оптические окна, неподвижно закрепленные на нижней пластине вертикальные стойки, оснащенные фиксаторами для ограничения движения по ним в вертикальной плоскости верхней пластины, на стойках жестко фиксированы две горизонтальные оси, с горизонтальными осями связана движущаяся по ним направляющая с жестко закрепленными на ней магнитами в форме стержней, каждый магнит снабжен жестко закрепленной на нем защитной крышкой из пластикового коррозионностойкого материала, держатель пробирок выполнен из отдельных сегментов, имеющих один ряд отверстий для пробирок. РОССИЙСКАЯ ФЕДЕРАЦИЯ (19) RU (11) (13) 209 043 U1 (51) МПК C12M 1/00 (2006.01) C12N 15/10 (2006.01) ФЕДЕРАЛЬНАЯ СЛУЖБА ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ (12) ОПИСАНИЕ ПОЛЕЗНОЙ МОДЕЛИ К ПАТЕНТУ (52) СПК C12M 1/00 (2021.08); C12N 15/10 (2021.08) (21)(22) Заявка: 2021125218, 25.08.2021 (24) Дата начала отсчета срока действия патента: Дата регистрации: 31.01.2022 (45) Опубликовано: 31.01.2022 Бюл. № 4 2 0 9 0 4 3 R U (73) Патентообладатель(и): Федеральное государственное бюджетное образовательное учреждение высшего образования Астраханский государственный технический университет, ФГБОУ ВО "АГТУ" (RU), Федеральное государственное бюджетное образовательное учреждение высшего образования "Астраханский государственный медицинский университет" Министерства здравоохранения Российской Федерации (ФГБОУ ВО Астраханский ГМУ Минздрава России) (RU) (56) Список документов, ...

Подробнее
Номер записи: 3
12-01-2012 дата публикации

Preservation of Bioactive Materials By Spray Drying

Номер: US20120009248A1
Автор: Binh Pham, Vu Truong-Le
Принадлежит: MEDIMMUNE LLC

This invention provides methods and compositions to preserve bioactive materials in a matrix of powder particles. Methods provide high-pressure gas spraying and/or near supercritical spraying of formulations followed by drying in a stream of conditioned gas to form stable powder particles containing bioactive materials.

Подробнее
Номер записи: 4
19-01-2012 дата публикации

Nucleic acid aptamers

Номер: US20120014875A1
Автор: Anton P. Mccaffrey, James O. McNamara, Paloma H. Giangrande
Принадлежит: University of Iowa Research Foundation UIRF

The present invention relates to optimized aptamers and methods of using these aptamers.

Подробнее
Номер записи: 5
19-01-2012 дата публикации

Methods for generation of rna and (poly)peptide libraries and their use

Номер: US20120015840A1
Автор: Michael Lebens
Принадлежит: Individual

The present invention relates to a method for generating an RNA library or a (poly)peptide library comprising the steps of: (a) providing one or more nucleic acid molecules each comprising i) two or more coding elements (A) each giving rise to an RNA molecule upon transcription and/or a (poly)peptide upon transcription and translation; and ii) linking elements (B) arranged according to the general formula of B(AB) 2+n , wherein said linking elements comprise one or more sequence motifs not found in said two or more coding elements allowing specific disruption of the linking elements (B); (b) cloning the nucleic acid molecule of step (a) into a vector; (c) transforming a host cell with the vector obtained in step (b) and propagating said transformed cell; (d) preparing vector DNA from the transformed and propagated cells of step (c); (e) (i) disrupting the vector DNA obtained in step (d) with one or more agents recognizing said one or more sequence motifs of the linking elements or (ii) performing an amplification step with the vector DNA obtained in step (d) and primers hybridizing to the sequence of said linking elements so that the sequences comprising the coding elements (A) are specifically amplified; (f) cloning the resulting coding elements (A) of step (e) into vectors; (g) transforming the vectors obtained in step (f) into host cells and establishing clonal colonies; and (h) culturing said clonal colonies under conditions suitable to express the coding elements. Also, the method relates to an RNA library or a (poly)peptide library obtainable or obtained according to the method of the invention. Moreover, the invention relates to a method for identifying a (poly)peptide epitope recognized by an antibody or a (poly)peptide-binding compound and a method for identifying a (poly)peptide epitope recognized by antibodies in serum. Further, the invention relates to a method for generating protein variants. Finally, the invention relates to a nucleic acid molecule a ...

Подробнее
Номер записи: 6
19-01-2012 дата публикации

Novel inhibitors of retroviral reverse transcriptace

Номер: US20120015874A1
Автор: Daniel Michalowski, Donald H. Burke-Aguero
Принадлежит: University of Missouri System

Disclosed are nucleic acid molecules, and methods of their use, which have a specific structure including a double helical domain and a G-quadruplex domain physically connected by a linker domain which may be nucleosidic or non-nucleosidic. These aptamers demonstrate potent inhibition of phylogenetically diverse primate lentiviral reverse transcriptases, which effect is largely independent of aptamer sequence provided that the aptamer has the specified structure.

Подробнее
Номер записи: 7
19-01-2012 дата публикации

Isolated novel nucleic acid and protein molecules from corn and methods of using those molecules to generate transgene plants with enhanced agronomic traits

Номер: US20120017292A1
Автор: Bo-Xing Qiu, David K. Kovalic, Jack E. Tabaska, Wei Wu
Принадлежит: MONSANTO TECHNOLOGY LLC

This disclosure provides purified nucleic acids and polypeptides. Also provided are transgenic plants, seeds, and plant cells containing DNA for expression of the proteins that are useful for imparting enhanced agronomic trait(s) to transgenic crop plants, methods of making such plants and methods of making agricultural commodity including seeds and hybrid seeds from such plants.

Подробнее
Номер записи: 8
26-01-2012 дата публикации

MHC-less cells

Номер: US20120020939A1
Автор: Edward K.Y. Jung, Elizabeth A. Sweeney, Eric C. Leuthardt, Gary L. McKnight, Lowell L. Wood, JR., Muriel Y. Ishikawa, Roderick A. Hyde, Stephen L. Malaska, Wayne R. Kindsvogel
Принадлежит: SEARETE LLC

The present disclosure relates to compositions, methods, systems, computer-implemented methods, and computer program products thereof that relate to biological cells for delivery of at least one therapeutic agent to a biological tissue or subject.

Подробнее
Номер записи: 9
26-01-2012 дата публикации

Folate targeting of nucleotides

Номер: US20120022245A1
Автор: Christopher Paul Leamon, Iontcho Radoslavov Vlahov, Longwu Qi, Mini Thomas, Paul Joseph Kleindl, Philip Stewart Low
Принадлежит: Endocyte Inc, PURDUE RESEARCH FOUNDATION

The present invention relates to compounds, compositions, kits, and methods of use in targeting nucleotides, such as siRNA's, to cancer cells or to immune system cells involved in inflammation. More particularly, the invention is directed to receptor binding ligand-nucleotide delivery conjugates for use in specifically targeting the conjugates to cancer cells or to immune system cells, methods of treatment with these conjugates, methods of preparation of these conjugates, and methods of reducing the expression of a gene in vitro or in vivo with the conjugates described herein.

Подробнее
Номер записи: 10
02-02-2012 дата публикации

Compositions and methods for treating or preventing inflammatory bowel disease and colon cancer

Номер: US20120027799A1
Автор: Cynthia L. Sears, Drew M. Pardoll, Franck Housseau, Shaoguang Wu
Принадлежит: JOHNS HOPKINS UNIVERSITY

The invention provides compositions and methods for useful for the diagnosis of inflammatory bowel disease, ETBF-induced colitis, colonic hyperplasia and/or colon carcinogenesis in a subject in biological samples (e.g., stool, urine, blood, serum, tissue). The invention further provides compositions and methods for the treatment or prevention of colitis, colon cancer, or inflammatory bowel disease (e.g., Crohn's disease).

Подробнее
Номер записи: 11
16-02-2012 дата публикации

Isolation of factors that associate directly or indirectly with chromatin

Номер: US20120040857A1
Автор: Jerome Dejardin, MATTHEW SIMON, Robert Kingston
Принадлежит: General Hospital Corp

Methods for isolating non-coding nucleic acids that are associated with chromatin at a target genomic locus are provided. The methods comprise the steps of obtaining a sample that comprises a target genomic DNA sequence and one or more non-coding nucleic acids associated with that DNA sequence; contacting the sample with at least one oligonucleotide probe that comprises a sequence that is complimentary to and capable of hybridising with at least a portion of the target DNA sequence, wherein the oligonucleotide probe comprises at least one modified nucleotide analogue and wherein the oligonucleotide probe further comprises at least one affinity label; allowing the at least one oligonucleotide probe and the target DNA sequence to hybridise with each other so as to form a probe-target hybrid; isolating the probe-target hybrid from the sample by immobilizing the probe-target hybrid through a molecule that binds to the at least one affinity label; and eluting the one or more non-coding nucleic acids that are associated with the target genomic DNA sequence. Also provided are probes suitable for use in the methods of the invention. The methods and probes of the invention are suited to identification of non-coding RNAs including microRNAs and snoRNAs that are associated with chromatin remodelling.

Подробнее
Номер записи: 12
16-02-2012 дата публикации

Target substance detection method using aptamer

Номер: US20120040865A1
Автор: So Youn Kim
Принадлежит: Industry Academic Cooperation Foundation of Dongguk University

The present invention relates to a method and kit of detecting a target material using an aptamer, and more particularly to a method and kit for detecting a target material, in which a sample and a second aptamer are added to a first aptamer immobilized on a solid phase so as to form a bond sandwiched between the first aptamer, the target material and the second aptamer, to an FET sensor-based method and kit for detecting a target material, and to an AAO sensor-based method and kit for detecting a target material. The inventive method for a target material using an aptamer can detect even low-molecular-weight materials which were difficult to detect in the prior art, thereby enabling detection of disease-related metabolites, environmental pollutants and food toxins in solutions. In addition, the detection method of the present invention is a direct and simple method and is highly cost-effective, because it uses the aptamer which can be consistently reproduced and can be produced at low costs. Thus, the present invention is very useful.

Подробнее
Номер записи: 13
22-03-2012 дата публикации

Use of myeloid cell biomarkers for the diagnosis of cancer

Номер: US20120070461A1
Автор: Harpreet Singh, Regina MENDRZYK, Steffen Walter, Susanna Mandruzzato, Vincenzo Bronte
Принадлежит: IMMATICS BIOTECHNOLOGIES GMBH

The present invention relates to the use of myeloid cell biomarkers for the differential diagnosis, prognosis, and monitoring of renal cell carcinoma (RCC) or colorectal cancer (CRC). The present invention furthermore relates to monitoring the effect of a treatment against renal cell carcinoma (RCC) or colorectal cancer (CRC), and establishing a prognosis of the outcome of the treatment of renal cell carcinoma (RCC) or colorectal cancer (CRC). The present invention furthermore relates to panels of cellular biomarkers for use in the above methods, in particular multicolor panels for measuring said biomarkers.

Подробнее
Номер записи: 14
29-03-2012 дата публикации

Control of Gene Expression Using a Complex of an Oligonucleotide and a Regulatory Peptide

Номер: US20120077270A1
Автор: Andrew C.G. Porter, Boris Tumi PuFong, John David Jenkinson, Laki Buluwela, Patrick Kanda, Satu Vainikka, Simak Ali, Stephen Hart
Принадлежит: Imperial College Innovations Ltd

A method for suppressing the expression of a selected gene in a cell, the method comprising introducing into the cell a molecule comprising (1) a nucleic acid binding portion which binds to a site or associated with the selected gene which site is present in a genome and (2) an expression repressor portion, wherein the nucleic acid binding portion comprises an oligonucleotide or oligonucleotide mimic or analogue, and wherein the repressor portion comprises a polypeptide or peptidomimetic. Molecules for use in the methods of the invention are provided. The repressor may be a portion of a histone deacetylase or DNA methylase or polypeptide capable of recruiting a histone deacetylase or DNA methylase.

Подробнее
Номер записи: 15
05-04-2012 дата публикации

Enrichment of Low Molecular Weight DNA

Номер: US20120083597A1
Автор: Jan Lawrence Godoski, JR., Patricia Okamoto, Thomas Scholl
Принадлежит: Esoterix Genetic Laboratories LLC

The present invention provides, among other things, a simple, reproducible, and cost-effective method for enriching fetal or other low molecular weight nucleic acids in a biological sample. In certain embodiments, methods are provided for enriching fetal nucleic acids (e.g., fetal DNAs), typically comprising steps of adding a polymer such as PEG to a heterogeneous biological sample containing fetal DNA and high molecular weight non-fetal DNA such that the PEG precipitates substantially the high molecular weight non-fetal DNA, and purifying the fetal DNA from supernatant, thereby enriching the fetal DNA.

Подробнее
Номер записи: 16
10-05-2012 дата публикации

Anti-MicroRNA Oligonucleotide Molecules

Номер: US20120115220A1
Автор: Gunter Meister, Markus Landthaler, Sebastien Pfeffer, Thomas Tuschl
Принадлежит: ROCKEFELLER UNIVERSITY

The invention relates to isolated anti-microRNA molecules. In another embodiment, the invention relates to an isolated microRNA molecule. In yet another embodiment, the invention provides a method for inhibiting microRNP activity in a cell.

Подробнее
Номер записи: 17
10-05-2012 дата публикации

Compositions and their uses directed to hepcidin

Номер: US20120115930A1
Автор: Brett P. Monia, C. Frank Bennett, Robert Mckay, Trisha Lockhart, William A. Gaarde
Принадлежит: ISIS PHARMACEUTICALS INC

Disclosed herein are compounds, compositions and methods for modulating the expression of hepcidin in a cell, tissue or animal or preventing, ameliorating or treating anemia. Also provided are methods for prevention, amelioration or treatment of anemia, and for increasing red blood cell count in an animal. Also provided are methods for the prevention, amelioration and/or treatment of low serum iron levels, low red blood cell count and other clinical endpoints of anemia in an animal. These methods may be achieved by administration of compounds or compositions including antisense compounds targeted to a nucleic acid that expresses hepcidin polypeptide combined with an erythropoiesis stimulating agent.

Подробнее
Номер записи: 18
17-05-2012 дата публикации

Nucleic acid ligands to ll37

Номер: US20120121533A1
Автор: George W. Jackson
Принадлежит: Biotex Inc

The present invention is directed to nucleic acid ligands to LL37, methods for producing said nucleic acid ligands, and methods for utilizing said nucleic acid ligands. In one exemplary embodiment, for example, this invention relates to nucleic acid ligands exhibiting high specific binding affinity to LL37 peptides, precursors and/or portions thereof. Further, the nucleic acid ligands may bind competitively with native ligands of LL37 and may also inhibit and/or interfere with LL37 function, such as by binding to LL37.

Подробнее
Номер записи: 19
17-05-2012 дата публикации

Compositions and methods for immunostimulatory rna oligonucleotides

Номер: US20120121551A1
Автор: Gunther Hartmann, Veit Hornung
Принадлежит: Gunther Hartmann

The present invention provides 4-nucleotide (4mer) RNA motifs that confer immunostimulatory activity, in particular, IFN-α-inducing activity to a RNA oligonucleotide. The present invention also provides RNA oligonucleotides, including siRNA, with high or low immunostimulatory activity. The present invention further provides the use of the RNA oligonucleotides of the invention for therapeutic purposes.

Подробнее
Номер записи: 20
17-05-2012 дата публикации

METHODS AND COMPOSITIONS FOR REDUCING TARGET GENE EXPRESSION USING COCKTAILS OF siRNAS OR CONSTRUCTS EXPRESSING siRNAS

Номер: US20120122217A1
Автор: David Brown, Lance P. Ford, Rich Jarvis
Принадлежит: APPLIED BIOSYSTEMS LLC

The present invention concerns methods and compositions involving the production or generation of siRNA mixtures or pools capable of triggering RNA-mediated interference (RNAi) in a cell. Compositions of the invention include kits that include reagents for producing or generating siRNA pools. The present invention further concerns methods using polypeptides with RNase III activity for generating siRNA mixtures or pools that effect RNAi, including the generation of a number of RNA molecules to the same target gene.

Подробнее
Номер записи: 21
07-06-2012 дата публикации

Modified siNA

Номер: US20120142011A1
Автор: Alexander Azzawi, Eric fat Lader, Jie Kang, Peter Hahn, Wolfgang Bielke
Принадлежит: QIAGEN GmbH

The present invention pertains to the use of at least one abasic modification within the first 8 nucleotide positions of the 5′ region of the antisense strand of a small interfering nucleic acid (siNA) molecule for reducing off-target effects. Provided are suitable modified siNAs, compositions and methods for producing respective siNAs, as well as kits comprising respective siNAs.

Подробнее
Номер записи: 22
07-06-2012 дата публикации

Sphingosine-bound siRNA

Номер: US20120142765A1
Автор: Ana Isabel JIMÉNEZ, Anna Avino, Clara Caminal, Gema Panizo, Ramon Eritja, Santiago Grijalvo, Tamara MARTÍNEZ
Принадлежит: Sylentis SA

The invention relates to novel oligomer analogues and their use in oligonucleotide-based therapies. More specifically, the invention concerns oligonucleotides carrying lipid molecules and their use as potential inhibitors of gene expression.

Подробнее
Номер записи: 23
14-06-2012 дата публикации

Method and System for Monitoring Nutritional Uptake as a Function of Microflora Intestinal Gas Levels

Номер: US20120150153A1
Автор: Cholwon Koh, Inyoung Sa, John Gavin MacDonald, Jose K. Abraham, Sridhar Ranganathan
Принадлежит: Kimberly Clark Worldwide Inc

Systems and methods for monitoring nutritional uptake of an individual are disclosed. The method can include monitoring microflora intestinal gas concentration levels associated with a patient and adjusting the volume of nutrient provided by the patient with an artificial feeding device based at least in part on the microflora intestinal gas levels associated with the patient. A microflora intestinal gas sensor can be used to monitor the microflora intestinal gas associated with the patient. The microflora intestinal gas sensor can monitor the microflora intestinal gas in a patient's exhaled breath or in the patient's digestive tract. The microflora intestinal gas sensor be included as part of an enteral feeding system at the distal end or outside end of an enteral feeding tube. Systems and methods for monitoring nutritional uptake of an infant based on microflora intestinal gas levels associated with the infant are also disclosed.

Подробнее
Номер записи: 24
21-06-2012 дата публикации

Recombinant mycobacterium strain expressing a mycobacterial fap protein under the control of a promoter active under hypoxia and its application for cancer therapy

Номер: US20120156169A1
Автор: Gilles Marchal, Mohammad Abolhassani
Принадлежит: Institut Pasteur de Lille

The invention relates to a recombinant vector comprising a mycobacterial FAP protein coding sequence under the transcriptional control of a promoter active under hypoxia conditions and its use for the prevention and the treatment of epithelial tumors.

Подробнее
Номер записи: 25
21-06-2012 дата публикации

Foxm1 peptides and vaccines containing the same

Номер: US20120156231A1
Автор: Ryuji Ohsawa, Sachiko Yoshimura, Takuya Tsunoda, Tomohisa Watanabe
Принадлежит: ONCOTHERAPY SCIENCE INC

The present invention provides isolated peptides having the amino acid sequence of SEQ ID NO: 34 or fragments thereof, which bind to HLA antigen and induce cytotoxic T lymphocyte (CTL). The present invention further provides peptides which include one, two, or several amino acid insertions, substitution or addition to the aforementioned peptides or fragments, but still have the cytotoxic T cell inducibility. Further provided are nucleic acids encoding any of these aforementioned peptides as well as pharmaceutical substances or compositions including any of the aforementioned peptides or nucleic acids. The peptides, nucleic acids, pharmaceutical substances or compositions of the present invention may be used for treating cancer or tumor.

Подробнее
Номер записи: 26
21-06-2012 дата публикации

Composition for diagnosis of liver metastasis of colorectal cancer and the use thereof

Номер: US20120156681A1
Автор: Ho-Kyung Chun, Woo Yong Lee, Yong Beom Cho
Принадлежит: SAMSUNG LIFE PUBLIC WELFARE FOUNDATION

The present invention relates to a composition for diagnosis of liver metastasis of colorectal cancer and the use thereof, and more particularly to a composition for diagnosis of liver metastasis of colorectal cancer, which comprises either a substance for measuring the mRNA level of CCL7 (Chemokine (C-C motif) ligand 7) gene or a substance for measuring the level of a protein which is encoded by the gene. According to the present invention, whether liver metastasis of colorectal cancer occurred can be diagnosed by measuring the mRNA expression level of the CCL7 gene or the expression level of the CCL7 protein, and the use of the composition comprising an inhibitor of CCL7 gene allows the treatment of colorectal cancer or the liver metastasis of colorectal cancer.

Подробнее
Номер записи: 27
21-06-2012 дата публикации

Antibody identifying an antigen-bound antibody and an antigen-unbound antibody, and method for preparing the same

Номер: US20120157663A1
Автор: Hisao Takizawa, Takachika Azuma
Принадлежит: Otsuka Pharmaceutical Co Ltd, Tokyo University of Science

The present invention relates to an antibody that recognizes a first antibody, the antibody specifically recognizing one of a free first antibody and an antigen-binding first antibody. More specifically, the above antibody is a domino antibody that specifically recognizes and binds to an antigen-binding first antibody, or an antibody-unlocking antibody that specifically recognizes and binds to a free first antibody.

Подробнее
Номер записи: 28
28-06-2012 дата публикации

Spinal muscular atrophy (sma) treatment via targeting of smn2 splice site inhibitory sequences

Номер: US20120165394A1
Автор: Elliot J. Androphy, Natalia N. Singh, Nirmal K. Singh, Ravindra N. Singh
Принадлежит: University of Massachusetts UMass

The present invention is directed to methods and compositions capable of blocking the inhibitory effect of a newly-identified intronic inhibitory sequence element, named ISS-N1 (for “intronic splicing silencer”), located in the SMN2 gene. The compositions and methods of the instant invention include oligonucleotide reagents (e.g., oligoribonucleotides) that effectively target the SMN2 ISS-N1 site in the SMN2 pre-mRNA, thereby modulating the splicing of SMN2 pre-mRNA to include exon 7 in the processed transcript. The ISS-N1 blocking agents of the invention cause elevated expression of SMN protein, thus compensating for the loss of SMN protein expression commonly observed in subjects with spinal muscular atrophy (SMA).

Подробнее
Номер записи: 29
26-07-2012 дата публикации

Method of producing a medical composition

Номер: US20120189663A1
Автор: Hiroshi Takaku, Kazuo Wakabayashi, Myint Oo Chang, Norio Yamamoto, Tomoyuki Suzuki
Принадлежит: Chiba Institute of Technology

The present invention aims to produce a safe and reliable medical composition, which efficiently boosts nonspecific immunity of antigen-presenting cells and thereby promotes an antitumor activity. To produce the medical composition, antigen-presenting cells such as dendritic cells are exposed to an activating reagent containing baculoviruses. Then, the antigen-presenting cells are separated from the activating reagent. The antigen-presenting cells are optionally cultured after the separation. Furthermore, an absence of the baculoviruses in the composition are optionally checked. The medical composition produced by the present invention is expected to have an outstanding therapeutic effect.

Подробнее
Номер записи: 30
26-07-2012 дата публикации

Treatment of patients after stent implantation or balloon dilatation and drug eluting stents

Номер: US20120190580A1
Автор: Thomas Boettger, Thomas Braun
Принадлежит: Max Planck Gesellschaft zur Foerderung der Wissenschaften eV

The present invention relates to a nucleic acid molecule for use in the treatment or preventive treatment of a patient after stent implantation or balloon dilatation, wherein the nucleic acid molecule is selected from (a) a single-stranded nucleic acid molecule comprising or consisting of the sequence of SEQ ID NO: 1, 2, 3 or 4 or a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 1, 2, 3 or 4; (b) a hairpin RNA, wherein one of the regions forming the double-stranded portion of said hairpin RNA comprises or consists of the sequence of SEQ ID NO: 1, 2, 3 or 4 or a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 1, 2, 3 or 4; (c) an at least partially double-stranded RNA comprising two separate single strands, wherein a region within one of the strands, said region being located within the double-stranded portion of said double-stranded RNA, comprises or consists of the sequence of SEQ ID NO: 1, 2, 3 or 4 or a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 1, 2, 3 or 4; (d) a nucleic acid molecule encoding the nucleic acid molecule of (a) or the RNA (b); and (e) a nucleic acid molecule or a two nucleic acid molecules encoding the two separate single strands of the RNA of (c). The present invention also relates to a drug eluting stent comprising the nucleic acid molecule according to the invention.

Подробнее
Номер записи: 31
16-08-2012 дата публикации

Therapeutic compositions and methods for antibody and fc-containing targeting molecule-based targeted delivery of bioactive molecules by bacterial minicells

Номер: US20120207754A1
Автор: Matthew J. Giacalone, Michael J. Newman
Принадлежит: Vaxiion Therapeutics LLC

The present application relates to the use of bacterial minicells as targeted delivery agents in vivo and in vitro. Described herein are genetically engineered eubacterial minicells designed to preferentially target and deliver therapeutically relevant agents using a minicell surface coupling molecule capable of binding and displaying antibodies or other Fc-containing targeting moiety fusions and conjugates.

Подробнее
Номер записи: 32
16-08-2012 дата публикации

Exon skipping therapy for dysferlinopathies

Номер: US20120208865A1
Автор: Luis Garcia, Marc Bartoli, Martin Krahn, Nicolas Levy
Принадлежит: Institut National de la Sante et de la Recherche Medicale INSERM, Universite de la Mediterranee Aix Marseille II

The present invention relates to methods for restoring the function of a mutated dysferlin comprising the step of preventing splicing of one or more exons which encode amino acid sequences that cause said dysferlin dysfunction. Particularly, the splicing of exon 32 is prevented. The present invention also relates to a method for treating a dysferlinopathy in a patient in need thereof, comprising the step of administering to said patient antisense oligonucleotides complementary to nucleic acid sequences that are necessary for correct splicing of one or more exons which encode amino acid sequences that cause said dysfunction. Particularly, the splicing of exon 32 is prevented.

Подробнее
Номер записи: 33
23-08-2012 дата публикации

Modulation of factor 7 expression

Номер: US20120214862A1
Автор: Brett P. Monia, Chenguang Zhao, Hong Zhang, Jeffrey R. Crosby, Susan M. Freier
Принадлежит: ISIS PHARMACEUTICALS INC

Disclosed herein are antisense compounds and methods for decreasing Factor 7 and treating or preventing thromboembolic complications in an individual in need thereof. Examples of disease conditions that can be ameliorated with the administration of antisense compounds targeted to Factor 7 include thrombosis, embolism, and thromboembolism, such as, deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke. Antisense compounds targeting Factor 7 can also be used as a prophylactic treatment to prevent individuals at risk for thrombosis and embolism.

Подробнее
Номер записи: 34
23-08-2012 дата публикации

Modified L-Nucleic Acid

Номер: US20120214868A1
Автор: Bernd Eschgfäller, Christian Lange, Sven Klussmann
Принадлежит: NOXXON PHARMA AG

A modified L-nucleic acid, containing an L-nucleic acid part conjugated to a non-L-nucleic acid part is described. The conjugate has extended retention time in and demonstrates a delayed elimination from an organism.

Подробнее
Номер записи: 35
30-08-2012 дата публикации

Complex of a protein comprising zinc oxide-binding peptides and zinc oxide nanoparticles, and use thereof

Номер: US20120219504A1
Автор: Ji Hyun Min, Jun Hua Wu, Nam-Hyuk Cho, Seung-Yong Seong, Taek-Chin Cheong, Young-Keun Kim
Принадлежит: KOREA UNIVERSITY RESEARCH AND BUSINESS FOUNDATION, SNU R&DB FOUNDATION

The present invention relates to a complex of a protein comprising zinc oxide-binding peptides and zinc oxide nanoparticles, to the use thereof as a drug delivery carrier for manufacturing medicines, and to a vaccine composition and a contrast agent comprising the composite. The protein comprising zinc oxide-binding peptides significantly improves the in vivo availability of zinc oxide-binding peptides, and therefore the complex of the present invention can be used not only as a drug delivery carrier for in vivo drug delivery or intracellular drug delivery, but also for in vivo imaging or cell imaging. The complex can be used for producing separating agents for effectively separating biological materials, therapeutic agents for hyperthermia, etc., contrast agents for MRI, and beads applicable to biosensors.

Подробнее
Номер записи: 36
30-08-2012 дата публикации

Immunologically modified carbon nanotubes for cancer treatment

Номер: US20120220921A1
Автор: Wei R. Chen
Принадлежит: University of Central Oklahoma

A method for constructing a compound of immunologically modified nanotubes and method for using the compound to deliver immunoadjuvants to tumor cells and to produce targeted, synergistic photophysical and immunological reactions for cancer treatment. To prepare the immunologically modified nanotubes, carbon nanotubes are dissolved in a solution of glycated chitosan, an immunostimulant, hence using glycated chitosan as a surfactant for rendering the aqueous solution of nanotubes stable. The compound can be used for treatment of cancer. The method includes steps of intratumorally administering immunologically modified nanotubes and administering laser irradiation of the target tumor. The nanotube serves as a carrier to deliver immunoadjuvants to the tumor cells and serves as a light-absorbing agent in a cell body of a tumor in a host. Upon laser irradiation of target tumor cells, immunologically modified nanotubes inside the tumor cells can produce spatially and temporally synchronized photothermal and immunological reactions for cancer treatment.

Подробнее
Номер записи: 37
06-09-2012 дата публикации

Immunizing composition for reducing streptococcal infections

Номер: US20120225079A1
Автор: Bengt Guss, Jan-Ingmar Flock, Lars Frykberg, Margareta Flock
Принадлежит: INTERVACC AB

An antigenic composition comprises at least one antigen, wherein said at least one antigen comprises at least part of a protein selected from EndoSe of Streptococcus equi subsp. Equi, EndoSz of Streptococcus equi subsp. zooepidemicus, and Endo S of Streptococcus pyogenes, and wherein said at least part of said protein comprises at least one antigenic epitope. A vaccine composition comprising the antigenic composition as immunizing component, methods for producing the antigeninc composition and the vaccine composition, use of the vaccine composition for prophylactic and therapeutic treatment, and an antibody preparation comprising monoclonal or polyclonal antibodies specific for an antigen or antigens of the antigenic composition are also disclosed.

Подробнее
Номер записи: 38
13-09-2012 дата публикации

Highly Pure Plasmid DNA Preparations

Номер: US20120231537A1
Автор: Li Chen, Nancy Smyth Templeton
Принадлежит: Gradalis Inc

The present disclosure generally relates to highly pure plasmid compositions having low, or undetectable, levels of colanic acid and other contaminants made by a process that comprises purifying plasmid DNA by chromatography, treating the purified plasmid DNA with a polypeptide that digests colanic acid under conditions that digest the colonic acid, and separating the plasmid DNA from the digested colonic acid.

Подробнее
Номер записи: 39
27-09-2012 дата публикации

Riboswitch based inducible gene expression platform

Номер: US20120244601A1
Автор: Carolyn R. Bertozzi, Jessica C. Seeliger, Justin P. Gallivan, Shana Topp
Принадлежит: UNIVERSITY OF CALIFORNIA

The present disclosure provides a synthetic translation regulator, as well as gene expression cassettes and gene expression constructs comprising the synthetic translation regulator. The present disclosure further provides genetically modified bacterial host cells comprising a subject synthetic translation regulator; and methods of regulating gene expression in such host cells.

Подробнее
Номер записи: 40
27-09-2012 дата публикации

Plant regulatory elements and uses thereof

Номер: US20120246763A1
Автор: Stanislaw Flasinski
Принадлежит: MONSANTO TECHNOLOGY LLC

The present invention provides novel DNA molecules and constructs, including their nucleotide sequences, useful for modulating gene expression in plants and plant cells. The invention also provides transgenic plants, plant cells, plant parts, seeds, and commodity products comprising the DNA molecules operably linked to heterologous transcribable polynucleotides, along with methods of their use.

Подробнее
Номер записи: 41
18-10-2012 дата публикации

Adenovirus library and methods

Номер: US20120264192A1
Автор: Masato Yamamoto, Yoshiaki Miura
Принадлежит: University of Minnesota

Described herein is a method that generally includes infecting a host cell with a rescue adenovirus, wherein the rescue adenovirus genome comprises a loxP site and encodes at least one marker, and wherein the host cell comprises a library of polynucleotides that complement the adenovirus genome marker and encode a detectable polypeptide; incubating the infected host cell under conditions effective to permit recombination between the adenovirus genome and one or more of the library polynucleotides and the production of recombinant adenovirus particles comprising at least on detectable polypeptide; and detecting the at least one detectable polypeptide. Also described are adenovirus libraries constructed using such a method.

Подробнее
Номер записи: 42
18-10-2012 дата публикации

Reversible platelet inhibition

Номер: US20120264815A1
Автор: Bruce A. Sullenger, Nanette Que-Gewirth, Sabah Oney, Shahid Nimjee
Принадлежит: Duke University

The present invention relates, in general, to receptors and to platelet aggregation and, in particular, to a method of inhibiting platelet aggregation using an aptamer that binds to and inhibits the activity of a receptor, such as glycoprotein IIb/IIIa (gpIIb/IIIa), and to aptamers suitable for use in such a method. The invention also relates to antidotes to antiplatelet agents and to methods of using such antidotes to reverse aptamer-induced platelet inhibition. The invention further relates to von Willebrand Factor (VWF) inhibitors, and antidotes therefore, and to methods of using same.

Подробнее
Номер записи: 43
25-10-2012 дата публикации

Methods of modulating the ox40 receptor to treat cancer

Номер: US20120269825A1
Автор: Tomoki Ito, Yong-Jun Liu
Принадлежит: University of Texas System

Numerous disease states, such as human allergic, autoimmune, and autoimmune diseases, and cancer, may be treated by targeting OX40/OX40L. OX40L inhibits the generation of Tr1 cells from naïve and memory CD4+ T cells. This unique function of OX40L is not shared by two other costimulatory TNF-family members, GITR-ligand and 4-1BB-ligand. It has been shown that signaling the OX40-receptor on human T cells by antibodies, small molecules, or the OX40L modulates the generation and function of IL-10 producing Foxp3 + Treg immunosuppressive T cells and blocks Foxp3 + Treg function. Further, provided are high throughput methods for identifying compounds that can inhibit the immunosuppressive function of IL-10 producing Tr1 cells.

Подробнее
Номер записи: 44
25-10-2012 дата публикации

Methods of sequencing fluorophore-quencher FRET-aptamers

Номер: US20120270221A1
Автор: John G. Bruno, Joseph Chanpong
Принадлежит: PRONUCLEOTEIN BIOTECHNOLOGIES LLC

The present invention describes methods for the production and selecting of single chain (single-stranded) fluorescence resonance energy transfer (“FRET”) DNA or RNA aptamers containing fluorophores (F) and quenchers (Q) at various loci within their structures, such that when its specific matching analyte is bound and the FRET-aptamers are excited by specific wavelengths of light, the fluorescence intensity of the system is modulated (increased or decreased) in proportion to the amount of analyte added. F and Q are covalently linked to nucleotide triphosphates (NTPs), which are incorporated by various nucleic acid polymerases such as Taq polymerase during the polymerase chain reaction (PCR) and then selected by affinity chromatographic, size-exclusion or molecular sieving, and fluorescence techniques. Further separation of related FRET-aptamers can be achieved by ion-pair reverse phase high performance liquid chromatography (HPLC) or other types of chromatography. Finally, FRET-aptamer structures and the specific locations of F and Q within FRET-aptamer structures are determined by digestion with exonucleases and mass spectral nucleotide sequencing analysis. Alternatively, single DNA or RNA intrachain FRET-aptamers can be sequenced and the locations of F and Q within the structure can be determined by nanopore sequencing and the locations of F and Q within the structure can be verified by nucleic acid “combing” coupled to high-powered fluorescence microscopy.

Подробнее
Номер записи: 45
25-10-2012 дата публикации

Compositions and methods related to synchronous selection of homing peptides for multiple tissues by in vivo phage display

Номер: US20120270808A1
Автор: Mikhail Kolonin, Renata Pasqualini, Wadih Arap
Принадлежит: Individual

Embodiments of the invention include methods for selecting in parallel (i.e., synchronously or simultaneously) peptides that target a number of organs, in which each peptide targets distinct tissues or organs. Typically, the methods of the invention provide for peptide selection in a Minimal number of subjects and still provides a selectively binding peptide. In certain aspects, methods of identifying peptides that bind to multiple selected tissues or organs of an organism may comprise the steps of administering a phage display library to a first subject; obtaining a sample of two or more selected tissues; obtaining phage displaying peptides that bind to the samples from the first subject; enriching for peptides by administering phage isolated from the samples of the first subject to a second subject; obtaining a sample of two or more selected tissues from the second subject; and identifying the peptides displayed.

Подробнее
Номер записи: 46
25-10-2012 дата публикации

Methods and compositions for dysferlin exon-skipping

Номер: US20120270930A1
Автор: Annemieke Aartsma-Rus, Garrit-Jan B. van Ommen, Isabella Houweling-Gazzoli, Johannes T. den Dunnen, Silvère Maria VAN DER MAAREL
Принадлежит: Leids Universitair Medisch Centrum LUMC

The disclosure provides methods and compositions for inducing exon-skipping in a dysferlin pre-mRNA useful, e.g., in restoring function in a dysferlin deficiency. The disclosure also provides improved methods and compositions for generally inducing exon-skipping in a pre-mRNA.

Подробнее
Номер записи: 47
29-11-2012 дата публикации

Focused libraries of genetic packages

Номер: US20120302463A1
Автор: Robert Charles Ladner
Принадлежит: Dyax Corp

Focused libraries of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of antibody peptides, polypeptides or proteins and collectively display, display and express, or comprise at least a portion of the focused diversity of the family. The libraries have length and sequence diversities that mimic that found in native human antibodies.

Подробнее
Номер записи: 48
20-12-2012 дата публикации

T cell therapy for b cell lymphoma

Номер: US20120321666A1
Автор: Cassie A. Hartline, Colleen M. O'Connor, Heather Wilson-Robles, Laurence J. N. Cooper, Sabina Sheppard
Принадлежит: TEXAS A&M UNIVERSITY SYSTEM, University of Texas System

Disclosed are methods and compositions for improving anti-tumor response and survivability in patients with cancer, such as non-Hodgkin lymphoma. In certain aspects, methods are provided for infusing lymphoma patients with T cells that are propagated ex vivo. Also provided are methods and compositions for propagating canine T cells ex vivo for infusion into cancer patients.

Подробнее
Номер записи: 49
27-12-2012 дата публикации

Novel compounds

Номер: US20120328622A1
Автор: Catherine Defrenne, Christine Delmelle, Jean-Louis Ruelle
Принадлежит: GLAXOSMITHKLINE BIOLOGICALS SA

The invention provides BASB082, BASB083, BASB091, BASB092 and BASB101 polypeptides and polynucleotides encoding BASB082, BASB083, BASB091, BASB092 and BASB101 polypeptides and methods for producing such polypeptides by recombinant techniques. Also provided are diagnostic, prophylactic and therapeutic uses.

Подробнее
Номер записи: 50
03-01-2013 дата публикации

Use of Plant Lectins to Target Leukocytes

Номер: US20130004579A1
Автор: Christopher DAVITT, Darren Thomas Ruane, Edel McNeela, Edward C. Lavelle, Karen Misstear
Принадлежит: Individual

The present invention provides compositions and methods for targeting an antigen to leukocytes, delivering an antigen to leukocytes, increasing antigen uptake by leukocytes, and/or enhancing an immune response. In some embodiments, compositions and methods of the present invention comprise a conjugate comprising an antigen and a plant lectin or a mimetic thereof.

Подробнее
Номер записи: 51
03-01-2013 дата публикации

Ovary Tumor Markers and Methods of Use Thereof

Номер: US20130004955A1
Автор: Alberto Grandi, Andrea Pierleoni, Matteo Parri, Piero Pileri, Renata Grifantini, Renzo Nogarotto, Susanna Campagnoli
Принадлежит: Externautics SpA

Newly identified proteins as markers for the detection of ovary tumors, or as therapeutic targets for treatment thereof; affinity ligands capable of selectively interacting with the newly identified markers, methods for tumor diagnosis and therapy using the same.

Подробнее
Номер записи: 52
03-01-2013 дата публикации

Two-way, portable riboswitch mediated gene expression control device

Номер: US20130004980A1
Автор: Jian-Dong Huang, Ye Jin
Принадлежит: University of Hong Kong HKU

A regulatable gene expression construct comprising a nucleic acid molecule comprising a two-way riboswitch operably linked to a target sequence. Also provided is a library screening strategy for efficient creation of target-specific riboswitches. A theophylline-repressible and IPTG-inducible riboswitch device achieves portable control of gene expression control in a ‘two-way’ manner. The default state of target genes is ON; the targets are switched off by adding theophylline, and switched back to the ON-state by adding IPTG without changing growth medium. The riboswitch device regulates gene expression in a portable, adjustable, and two-way manner with a variety of scientific and biotechnological applications.

Подробнее
Номер записи: 53
24-01-2013 дата публикации

Nucleic-acid extraction method and nucleic-acid extraction cartridge

Номер: US20130020201A1
Автор: Kazumine Ito, Michihiro Ohnishi, Naohisa Sakamoto, Tasuku Yotoriyama, Tomohiko Nakamura, Tomoteru Abe
Принадлежит: Sony Corp

The present disclosure provides a nucleic-acid extraction method for carrying out the following procedures in the same cell, the procedures including: performing an ultrasonic process on a sample containing a nucleic acid; adsorbing substances contained in the sample by making use of an adsorption carrier; and condensing the nucleic acid by damming the nucleic acid moving in an electrophoresis phenomenon. In accordance with the nucleic-acid extraction method, it is possible to carry out an ultrasonic process, an adsorption process and an electrophoresis process in the same cell. Thus, it is possible to eliminate an operation to transfer the sample from one cell to another one for each of the processes.

Подробнее
Номер записи: 54
24-01-2013 дата публикации

Use of Ribozymes in the Detection of Adventitious Agents

Номер: US20130022964A1
Автор: Matthew C. Coffey
Принадлежит: Oncolytics Biotech Inc

The present invention provides a method of detecting adventitious agents in a composition comprising a microorganism by using ribozyme-expressing indicator cells, as well as indicator cells useful in such detection.

Подробнее
Номер записи: 55
24-01-2013 дата публикации

Methods and compositions for targeted mutagenesis in bacteria

Номер: US20130023053A1
Автор: John C. March, Matthew S. Russell
Принадлежит: CORNELL UNIVERSITY

This disclosure provides methods and compositions for targeted mutagenesis of specific genes in a bacterial strain. By inducibly over-expressing error-prone polymerases such as Pol IV or Pol V in conjunction with nickase in a bacterial strain, and housing the targeted gene(s) on an episome or plasmid which contains one or more nickase recognition sequences, the targeted gene(s) can be selectively mutated at rates significantly greater than genes contained on the chromosome. The methods disclosed herein are useful for engineering desirable bacterial phenotypes and novel strains, including for example strains useful for treating or degrading waste and/or environmental contaminants, for optimizing bioprocesses, and for converting low-value feed-stock into value-added products.

Подробнее
Номер записи: 56
24-01-2013 дата публикации

Method for selective isolation and purification of nucleic acids

Номер: US20130023656A1
Автор: Jörg HUCKLENBROICH, Mario Scherer
Принадлежит: QIAGEN GmbH

The present invention relates to a gentle method for isolating and purifying nucleic acids from a biological cell comprising sample comprising at least DNA, RNA, and proteins, comprising at least the steps of 1. mixing the sample with a lysis buffer, 2. incubating the sample at a temperature within a range between 45° C. and 59° C. to obtain DNA as well as RNA or within a range between 60° C. and 70° C., to obtain DNA essentially free of RNA and 3. separating the nucleic acids from any contaminants.

Подробнее
Номер записи: 57
31-01-2013 дата публикации

Glycine riboswitches, methods for their use, and compositions for use with glycine riboswitches

Номер: US20130029342A1
Автор: Jeffrey Barrick, Maumita Mandal, Ronald R. Breaker
Принадлежит: YALE UNIVERSITY

Riboswitches are structural elements in mRNA that change state when bound by a trigger molecule, and are thus able to regulate gene expression. They can be dissected into two separate domains: one that selectively binds the target (aptamer domain) and another that influences genetic control (expression platform domain). Bacterial glycine riboswitches consist of two tandem aptamer domains which cooperatively bind glycine to regulate the expression of downstream genes. These natural switches are targets for antibiotics and other small molecule therapies. Modified versions of these natural riboswitches can be employed as designer genetic switches that are controlled by specific effector compounds. Disclosed are isolated and recombinant riboswitches, and compositions and methods for selecting and identifying compounds that can activate, inactivate, or block a riboswitch.

Подробнее
Номер записи: 58
31-01-2013 дата публикации

Method for isolating and purifying nucleic acids

Номер: US20130030163A1
Автор: Jörg HUCKLENBROICH, Mario Scherer, Markus Müller, Roland Fabis
Принадлежит: QIAGEN GmbH

The present invention relates to a method for isolating and purifying nucleic acids, preferably comprising genomic DNA, from biological samples comprising the steps of lysing the sample using a lysis buffer comprising a source of anionic surfactant ions, optionally disintegrating the RNA present in the lysate, precipitating the surfactant ions from the lysate, and separating the nucleic acids from the precipitate and further contaminants by size-exclusion chromatography. The invention furthermore relates to a lysis buffer, a method of lysing cells and a kit for the isolation and purification of nucleic acids.

Подробнее
Номер записи: 59
31-01-2013 дата публикации

Regulatory region having increased expression and method of using same

Номер: US20130031664A1
Автор: Celine Hayden, John Howard
Принадлежит: Applied Biotechnology Institute Inc

An enhanced globulin-1 regulatory region is shown, a nucleotide sequence of which includes at least one additional copy of a region of the globulin-1 regulatory region which includes at least one transcriptional factor binding domain, combined with a transcription initiation site and translation start site. The promoter provides improved seed preferred, and particularly embryo preferred expression in plants. Methods of use are also shown in preferentially expressing a heterologous protein to the embryo tissue of a plant.

Подробнее
Номер записи: 60
28-02-2013 дата публикации

Fragment switch: a reverse genetic approach

Номер: US20130053552A1
Автор: Mohan Balasubramanian, Xie Tang
Принадлежит: Temasek Life Sciences Laboratory Ltd

The present invention relates to the field of reverse genetics. More particularly, the present invention relates to a novel reverse genetic approach termed “fragment switch” which is used to generate an allelic series in genes of interest which are useful for functional analysis.

Подробнее
Номер записи: 61
07-03-2013 дата публикации

Methods of treatment using ex vivo expansion of cord blood t cells

Номер: US20130058909A1
Автор: Paul Szabolcs
Принадлежит: Duke University

Provided are methods of enhancing ex vivo proliferation of a T cell population, the methods comprising contacting the T cell population with IL-7 and anti-CD3/CD28 antibody to activate and expand the T cell population. Further provided are methods of generating an antigen-specific cytotoxic T cell population comprising priming a CD3/CD28-expanded T cell population against an antigen (e.g., a cancer cell) in the presence of at least one of IL-7, IL-12, and IL-15, or a combination thereof. Further provided are methods of treating T cell lymphopenia in a subject, comprising administering a CD3/CD28-expanded T cell population to the subject.

Подробнее
Номер записи: 62
07-03-2013 дата публикации

Anti-pdef antibodies and uses thereof

Номер: US20130058966A1
Автор: Ashwani Sood
Принадлежит: Individual

The present invention relates to an isolated antibody or antigen-binding fragment thereof that specifically binds with high affinity to at least a portion of a segment of human prostate-derived Ets transcription factor (PDEF). The anti-PDEF antibody of the present invention is effective in prognostic and diagnostic assays for detecting PDEF with immunohistochemistry. The present invention also relates to methods of making the anti-PDEF antibody disclosed herein. The present invention further relates to vaccines against cancers associated with positive expression of PDEF, as well as methods for treating those cancers. Vectors, diagnostic kits, and hybridomas are also disclosed.

Подробнее
Номер записи: 63
14-03-2013 дата публикации

Modulating production traits in avians

Номер: US20130067606A1
Автор: Andrew Henrik Sinclair, Craig Allen SMITH, John William Lowenthal, Robert John Moore, Timothy James Doran
Принадлежит: Australian Poultry CRC Pty Ltd

The present invention relates to methods of modulating traits, particularly production traits, in avians such as chickens. In particular, the invention relates to the in ovo delivery of a dsRNA molecule, especially siRNAs, to modify production traits in commercially important birds.

Подробнее
Номер записи: 64
28-03-2013 дата публикации

METHODS FOR DETECTING AND REGULATING ALOPECIA AREATA AND GENE COHORTS THEREOF

Номер: US20130078244A1
Автор: CHRISTIANO ANGELA M., Clynes Raphael
Принадлежит:

The invention provides for methods for controlling hair growth by administering a HLDGC modulating compound to a subject. The invention further provides for a method for screening compounds that bind to and modulate polypeptides encoded by HLDGC genes. The invention also provides methods of detecting the presence of or a predisposition to a hair-loss disorder in a human subject as well as methods of treating such disorders. 1. A method for detecting the presence of or a predisposition to a hair-loss disorder in a human subject , the method comprising:(a) obtaining a biological sample from a human subject; and(b) detecting whether or not there is an alteration in the level of expression of an mRNA or a protein encoded by a HLDGC gene in the subject as compared to the level of expression in a subject not afflicted with a hair-loss disorder.2. A method for detecting the presence of or a predisposition to a hair-loss disorder in a human subject , the method comprising:(a) obtaining a biological sample from a human subject; and(b) detecting the presence of one or more nucleotide polymorphisms (SNPs) in a chromosome region containing a HLDGC gene in the subject, wherein the SNP is selected from the SNPs listed in Table 2.3. The method of claim 1 , wherein the detecting comprises determining whether mRNA expression or protein expression of the HLDGC gene is increased or decreased as compared to expression in a normal sample.4. The method of claim 1 , wherein the detecting comprises determining in the sample whether expression of at least 2 HLDGC proteins claim 1 , at least 3 HLDGC proteins claim 1 , at least 4 HLDGC proteins claim 1 , at least 5 HLDGC proteins claim 1 , at least 6 HLDGC proteins claim 1 , at least 6 HLDGC proteins claim 1 , at least 7 HLDGC proteins claim 1 , or at least 8 HLDGC proteins is increased or decreased as compared to expression in a normal sample.5. The method of claim 1 , wherein the detecting comprises determining in the sample whether ...

Подробнее
Номер записи: 65
28-03-2013 дата публикации

Anti-MicroRNA Oligonucleotide Molecules

Номер: US20130078715A1
Автор: Landthaler Markus, Meister Gunter, Pfeffer Sebastien, Tuschl Thomas H.
Принадлежит: ROCKEFELLER UNIVERSITY

The invention relates to isolated anti-microRNA molecules. In another embodiment, the invention relates to an isolated microRNA molecule. In yet another embodiment, the invention provides a method for inhibiting microRNP activity in a cell. 1. An isolated molecule comprising a maximum of fifty moieties , wherein each moiety comprises a base bonded to a backbone unit , said molecule comprising the microRNA molecule identified in SEQ ID NO: 142 or its corresponding anti-micro RNA molecule identified in SEQ ID NO: 448.2. A molecule according to claim 1 , wherein the molecule is modified for increased nuclease resistance.3. The molecule according to claim 1 , wherein at least one of the moieties is a modified ribonucleotide moiety.4. The molecule according to claim 3 , wherein the modified ribonucleotide is substituted at the 2′ position.5. The molecule according to claim 4 , wherein the substituent at the 2′ position is a Cto Calkyl group.6. The molecule according to claim 5 , wherein the alkyl group is methyl.7. The molecule according to claim 5 , wherein the alkyl group is allyl.8. The molecule according to claim 4 , wherein the substituent at the 2′ position is a Cto Calkoxy-Cto Calkyl group.9. The molecule according to claim 8 , wherein the Cto Calkoxy-Cto Calkyl group is methoxyethyl.10. The molecule according to claim 1 , wherein at least one of the moieties is a 2′-fluororibonucleotide moiety.11. The molecule according to claim 3 , wherein the modified ribonucleotide has a methylene bridge between the 2′-oxygen atom and the 4′-carbon atom.12. The molecule according to claim 1 , wherein the molecule comprises at least one modified moiety on the 5′ end.13. The molecule according to claim 1 , wherein the molecule comprises at least two modified moieties at the 5′ end.14. The molecule according to claim 1 , wherein the molecule comprises at least one modified moiety on the 3′ end.15. The molecule according to claim 1 , wherein the molecule comprises at least two ...

Подробнее
Номер записи: 66
28-03-2013 дата публикации

Methods and Compositions for Modulating Gene Expression Using Oligonucleotide Based Drugs Administered in vivo or in vitro

Номер: US20130079382A1
Автор: Smith Larry J.
Принадлежит:

Compositions and methods for down modulating target gene expression with RNA interference, as well as methods for administering said compositions are disclosed. The method comprises administering a first strand to a cell, incubating the cell for a time period suitable for uptake of the first oligo prior to administering a second strand, wherein the first strand and said second strand form an intracellular duplex which is effective to catalyze degradation of gene target mRNA or inhibit translation of said mRNA. 138-. (canceled)39. A method of inhibiting expression of a gene target comprising contacting a cell expressing said gene target with an effective amount of a nucleic acid compound , said compound being effective to degrade mRNA or inhibit translation of mRNA encoding a protein produced by said gene target , wherein said compound comprises two complementary strands , said method comprisinga) administering a first strand to said cell,b) incubating said cell for a time period suitable for uptake of said first oligo into said cell, andc) administering a second strand to said cell, said first strand and said second strand forming an intracellular duplex which is effective to catalyze degradation of gene target mRNA or inhibit translation of said mRNA.40. The method of claim 39 , wherein step c) is carried out between about 4 and about 48 hours after step a).41. The method of claim 39 , wherein said compound is effective to inhibit the expression of a gene listed in Table 2.42. The method of claim 39 , wherein said oligo comprises at least one modified backbone linkage selected from the group consisting of phosphorothioate linkages claim 39 , methylphosphonate linkages claim 39 , ethylphosphonate linkages claim 39 , boranophosphate linkages claim 39 , sulfonamide claim 39 , carbonylamide claim 39 , phosphorodiamidate claim 39 , phosphorodiamidate linkages comprising a positively charged side group claim 39 , phosphorodithioates claim 39 , aminoethylglycine claim 39 ...

Подробнее
Номер записи: 67
28-03-2013 дата публикации

BIVALENT ANTISENSE OLIGONUCLEOTIDES

Номер: US20130079505A1
Автор: Moeller Thorleif, Udesen Christina
Принадлежит: MIRRX THERAPEUTICS A/S

The present invention provides bivalent molecules comprising a first oligonucleotide linked to a second oligonucleotide. The first and the second oligonucleotide are preferably linked via a linking moiety. Preferably, both the first and/or the second oligonucleotide comprise an antisense sequence complementary to a cellular RNA such as mRNA or microRNA. 1) A bivalent molecule comprising a first oligonucleotide linked to a second oligonucleotide , wherein the first and the second oligonucleotide is not an aptamer , siRNA , ribozyme , RNase H activating antisense oligonucleotide , full unmodified RNA oligonucleotide or full unmodified DNA oligonucleotide and is incapable of recruiting the RNAi machinery and incapable of activating RNase H and wherein the first and second oligonucleotide is linked via a linking moiety with a length of at least 10 angstrom.2) The molecule of claim 1 , wherein the first and the second oligonucleotide is between 5 and 20 nucleotides in length and at least 50% of the nucleotides of the first and or second oligonucleotide is selected from the group consisting of: DNA units but no more than 4 units in succession claim 1 , RNA units modified in the 2-O-position (e.g. 2′-0-(2-methoxyethyl)-RNA claim 1 , 2′O-methyl-RNA claim 1 , 2′0-fluoro-RNA) claim 1 , locked nucleic acid (LNA) units (thio- claim 1 , amino- an oxy-LNA) claim 1 , intercalating nucleic acid (INA) units claim 1 , morpholino units claim 1 , PNA (peptide nucleic acid) units claim 1 , 2′-Deoxy-2′-fluoro-arabinonucleic acid (FANA) claim 1 , arabinonucleic acid (ANA) claim 1 , unlocked nucleic acid (UNA) units claim 1 , phosphoramidate units and hexitol nucleic acid (HNA) units.3) The molecule according to claim 1 , wherein all nucleotides of the first and or second oligonucleotide is selected from the group consisting of: DNA units but no more than 4 units in succession claim 1 , RNA units modified in the 2-O-position (e.g. 2′-0-(2-methoxyethyl)-RNA claim 1 , 2′O-methyl-RNA claim 1 ...

Подробнее
Номер записи: 68
04-04-2013 дата публикации

NANOMOTORS AND MOTION-BASED DETECTION OF BIOMOLECULAR INTERACTIONS

Номер: US20130084569A1
Автор: Balasubramanian Shankar, Kagan Daniel, Manesh Kalayil Manian, Wang Joseph, Wu Jie
Принадлежит:

Techniques and systems are disclosed for detecting biomolecular interactions based on the motion of nanomotors. In one aspect, a method of detecting biomolecular interactions based on a motion of a nanomachine includes functionalizing a nanomachine with a capture probe adapted to interact with biological targets; and detecting a presence of the biological targets in an environment based on a motion of the nanomachine. 1. A method of detecting biomolecular interactions based on a motion of a nanomachine , the method comprising:functionalizing a nanomachine with a capture probe adapted to interact with biological targets; anddetecting a presence of the biological targets in an environment based on a motion of the nanomachine.2. The method of claim 1 , wherein detecting the presence of the biological targets comprises detecting a concentration of the biological targets based on a distance traveled by the functionalized nanomachine.3. The method of claim 1 , wherein detecting the presence of the biological targets in an environment comprises:providing the functionalized nanomachine and nanoparticle tags in the environment to allow the capture probe to form a complex with the nanoparticle tags and the biological targets; anddetecting the complex formation based on the motion of the functionalized nanomachine.4. The method of claim 1 , wherein detecting the complex formation comprises:detecting the motion of the functionalized nanomachine in a nanoparticle-releasing solution, wherein the presence of the released nanoparticle speeds up the motion of the functionalized nanomachine.5. The method of claim 1 , wherein the nanoparticle tags comprise silver nanoparticle tags.6. The method of claim 1 , wherein the nanomachine comprises an anode segment and a cathode segment.7. The method of claim 6 , wherein the anode segment comprises platinum and the cathode comprises gold.8. The method of comprising:wherein the biological targets comprise nucleic acid targets.9. The method of ...

Подробнее
Номер записи: 69
04-04-2013 дата публикации

Protein complementation regulators

Номер: US20130085095A1
Автор: Paul Terence Toran
Принадлежит: Boston University

The present invention relates to protein complementation regulators and methods for reducing target-independent interaction of protein complementation molecules.

Подробнее
Номер записи: 70
04-04-2013 дата публикации

TREATMENT OF ATONAL HOMOLOG 1 (ATOH1) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO ATOH1

Номер: US20130085112A1
Автор: Collard Joseph, Khorkova Sherman Olga
Принадлежит: CuRNA, Inc.

The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Atonal homolog 1 (ATOH1), in particular, by targeting natural antisense polynucleotides of Atonal homolog 1 (ATOH1). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of ATOH1. 1. A method of modulating a function of and/or the expression of an Atonal homolog 1 (ATOH1) polynucleotide in a biological system comprising: contacting said system with at least one antisense oligonucleotide 5 to 30 nucleotides in length wherein said at least one oligonucleotide has at least 50% sequence identity to a reverse complement of a natural antisense of an Atonal homolog 1 (ATOH1) polynucleotide; thereby modulating a function of and/or the expression of the Atonal homolog 1 (ATOH1) polynucleotide.2. A method of modulating a function of and/or the expression of an Atonal homolog 1 (ATOH1) polynucleotide in a biological system according to comprising: contacting said biological system with at least one antisense oligonucleotide 5 to 30 nucleotides in length wherein said at least one oligonucleotide has at least 50% sequence identity to a reverse complement of a polynucleotide comprising 5 to 30 consecutive nucleotides within the natural antisense transcript nucleotides 1 to 589 of SEQ ID NO: 2; thereby modulating a function of and/or the expression of the Atonal homolog 1 (ATOH1) polynucleotide.3. A method of modulating a function of and/or the expression of an Atonal homolog 1 (ATOH1) polynucleotide in patient cells or tissues in vivo or in vitro comprising: contacting said cells or tissues with at least one antisense oligonucleotide 5 to 30 nucleotides in length wherein said oligonucleotide has at least 50% sequence identity to an antisense oligonucleotide to the Atonal homolog 1 (ATOH1) polynucleotide; thereby modulating a function of and/or the expression of ...

Подробнее
Номер записи: 71
11-04-2013 дата публикации

METHOD OF GENERATING GENE MOSAICS

Номер: US20130090246A1
Автор: Luque Alejandro, Pandjaitan Rudy
Принадлежит: EVIAGENICS S.A.

The invention relates to a method for generating a gene mosaic by somatic in vivo recombination, comprising: e) in a single step procedure (vii) transforming a cell with at least one gene A having a sequence homology of less than 99.5% to another gene to be recombined that is an integral part of the cell genome or presented in the framework of a genetic construct, (viii) recombining said genes, (ix) generating a gene mosaic of the genes at an integration site of a target genome, wherein said at least one gene A has a single flanking target sequence either at the 5′ end or 3′ end anchoring to the 5′ or 3′ end of said integration site, and f) selecting clones comprising the gene mosaic, as well as a method of producing a diversity of gene mosaics and gene assembly. 1. A method for generating a gene mosaic by somatic in vivo recombination , comprising (i) transforming a cell with at least one gene A having a sequence homology of less than 99.5% to another gene to be recombined that is an integral part of the cell genome or is presented in a framework of a genetic construct,', '(ii) recombining said genes, and', '(iii) generating a gene mosaic of the genes at an integration site of a target genome, wherein said at least one gene A has a single flanking target sequence either at the 5′ end or 3′ end anchoring to the 5′ or 3′ end of said integration site, and, 'a) in a single step procedureb) selecting clones comprising the gene mosaic.2. A method according to claim 1 , wherein a selection marker is used in the gene mosaic and the clones are selected according to the presence of the selection marker.3. A method according to claim 1 , wherein said gene to be recombined is part of the genome of the cell.4. A method according to claim 1 , wherein the cell is co-transformed with at least one gene A and at least one gene B claim 1 , wherein said single flanking target sequence of gene A is anchoring to the 5′ end of an integration site on said target genome claim 1 , and ...

Подробнее
Номер записи: 72
11-04-2013 дата публикации

AGENT FOR SUPPRESSING EXPRESSION OF DOMINANT ALLELE

Номер: US20130090373A1
Автор: Hohjoh Hirohiko, TAKAHASHI Masaki
Принадлежит: National Center of Neurology and Psychiatry

An agent for selectively suppressing the expression of a dominant allele while allowing expression of wild-type or desired alleles and methods for using the agent are described. The RNAi agent has a structure obtained by assigning a dominant point mutation in the targeted allele as a standard point, setting a base length from the standard point to the 5′ end to a predetermined length, and introducing one mismatch base differing from the target sequence to a predetermined position downstream from the standard point. 1. An agent for suppressing the expression of a dominant allele of a target gene , comprising an RNAi molecule ,the RNAi molecule comprisingan RNAi sense strand region consisting of a nucleotide sequence identical to any one 16- to 30-base consecutive nucleotide sequence in the sense strand of the dominant allele comprising at least one dominant point mutation andan RNAi antisense strand region consisting of a nucleotide sequence complementary thereto, wherein:any one base at the 7th to 10th positions upstream from any one dominant point mutation in the RNAi sense strand region constitutes the 5′-terminal base of the RNAi molecule; andany one base at the 3rd to 8th positions downstream from the any one dominant point mutation is a mismatch base different from the corresponding base in the nucleotide sequence in the sense strand of the dominant allele.2. An agent for suppressing the expression of a dominant allele of a target gene , comprising an expression vector comprising an operably linked DNA encoding an RNAi molecule ,the RNAi molecule comprising an RNAi sense strand region consisting of a nucleotide sequence identical to any one 16- to 30-base consecutive nucleotide sequence in the sense strand of the dominant allele comprising at least one dominant point mutation and an RNAi antisense strand region consisting of a nucleotide sequence complementary thereto, wherein:any one base at the 7th to 10th positions upstream from any one dominant point ...

Подробнее
Номер записи: 73
18-04-2013 дата публикации

Bispecific Antisense Oligonucleotides that Inhibit IGFBP-2 and IGFBP-5 and Methods of Using Same

Номер: US20130096180A1
Автор: Gleave Martin, Signaevsky Maxim
Принадлежит: The University of British Columbia

Bispecific antisense oligonucleotides which consist essentially of a sequence of bases that is complementary to portions of both the gene encoding human IGFBP-2 and the gene encoding human IGFBP-5 are useful in as antisense therapeutics in the treatment of endocrine-regulated cancers. 118-. (canceled)19. A method of inhibiting expression of both human IGFBP-2 and human IGFBP-5 comprising exposing cells expressing human IGFBP-2 and human IGFBP-5 to a bispecific antisense oligonucleotide consisting of Seq ID No. 5 , whereby expression of both human IGFBP-2 and human IGFBP-5 is inhibited.20. The method of wherein in the exposing step claim 19 , the cells are exposed to a pharmaceutical composition made by combining the bispecific antisense oligonucleotide with a pharmaceutically acceptable carrier for intravenous claim 19 , intraperitoneal claim 19 , subcutaneous or oral administration.21. The method of claim 20 , wherein the oligonucleotide is modified to increase the stability of the antisense in vivo.22. The method of claim 21 , wherein the oligonucleotide is a phosphorothioate derivative.23. The method of claim 21 , wherein the oligonucleotide has 2′-O-methoxyethyl substitutions on the backbone.24. The method of claim 19 , wherein the oligonucleotide is modified to increase the stability of the antisense in vivo.25. The method of claim 24 , wherein the oligonucleotide is a phosphorothioate derivative.26. The method of claim 24 , wherein the oligonucleotide has 2′-O-methoxyethyl substitutions on the backbone. This application claims the benefit of U.S. Provisional Application No. 60/350,046, filed Jan. 17, 2002, which is incorporated herein by reference.This present application relates to bispecific antisense olignucleotides that inhibit IGFBP-2 and IGFBP-5 and methods of using same in the treatment of endocrine-regulated tumors (for example, breast, prostate, ovarian and colon cancers).Prostate cancer is the most common cancer that affects men, and the second ...

Подробнее
Номер записи: 74
18-04-2013 дата публикации

TREATMENT OF SODIUM CHANNEL, VOLTAGE-GATED, ALPHA SUBUNIT (SCNA) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO SCNA

Номер: US20130096183A1
Автор: Coito Carlos, Collard Joseph, De Leon Belinda, HSIAO Jane H., Khorkova Sherman Olga
Принадлежит: CuRNA, Inc.

The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Sodium channel, voltage-gated, alpha subunit (SCNA), in particular, by targeting natural antisense polynucleotides of Sodium channel, voltage-gated, alpha subunit (SCNA). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of SCNA. 1. A method of modulating a function of and/or the expression of a Sodium channel , voltage-gated , alpha subunit (SCNA) polynucleotide in a biological system comprising: contacting said system with at least one antisense oligonucleotide 5 to 30 nucleotides in length wherein said at least one oligonucleotide has at least 50% sequence identity to a reverse complement of a natural antisense of a Sodium channel , voltage-gated , alpha subunit (SCNA) polynucleotide; thereby modulating a function of and/or the expression of the Sodium channel , voltage-gated , alpha subunit (SCNA) polynucleotide.2. A method of modulating a function of and/or the expression of a Sodium channel claim 1 , voltage-gated claim 1 , alpha subunit SCN1A polynucleotide in a biological system according to comprising: contacting said claim 1 , biological system with at least one antisense oligonucleotide 5 to 30 nucleotides in length wherein said at least one oligonucleotide has at least 50% sequence identity to a reverse complement of a polynucleotide comprising 5 to 30 consecutive nucleotides within the natural antisense transcript nucleotides 1 to 1123 of SEQ ID NO: 12 and 1 to 2352 of SEQ ID NO: 13 claim 1 , 1 to 267 of SEQ ID NO: 14 claim 1 , 1 to 1080 of SEQ ID NO: 15 claim 1 , 1 to 173 of SEQ ID NO: 16 claim 1 , 1 to 618 of SEQ ID NO: 17 claim 1 , 1 to 871 of SEQ ID NO: 18 claim 1 , 1 to 304 of SEQ ID NO: 19 claim 1 , 1 to 293 of SEQ ID NO: 20 claim 1 , 1 to 892 of SEQ ID NO: 21 claim 1 , 1 to 260 of SEQ ID NO: 22 claim 1 , 1 to 982 of SEQ ID ...

Подробнее
Номер записи: 75
18-04-2013 дата публикации

NKX3-1 SARNA AND KLF4 SARNA AND USES THEREOF

Номер: US20130096184A1
Автор: Li Long-Cheng
Принадлежит: The Regents of the University of California

The present disclosure provides compositions, pharmaceutical preparations, kits and methods for increasing expression of a NKX3-1 gene product in a cell by contacting the cell with a small activating RNA (saRNA) molecule comprising a ribonucleic strand that is complementary to a promoter region sequence of the NKX3-1 gene. The present disclosure also provides compositions, pharmaceutical preparations, kits and methods for increasing expression of a KLF4 gene product in a cell by contacting the cell with a small activating RNA (saRNA) molecule comprising a ribonucleic strand that is complementary to a promoter region sequence of the KLF4 gene. 1. An isolated composition comprising ,a small activating RNA (saRNA) molecule comprising at least a first ribonucleic acid strand comprising a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, wherein the sequence is complementary to a promoter region sequence of a NKX3-1 gene and is sufficient to activate transcription of the NKX3-1 gene.2. The composition of claim 1 , wherein the saRNA molecule comprises a second ribonucleic acid strand and wherein when the first ribonucleic acid strand comprises a sequence from SEQ ID NO: 1 claim 1 , the second ribonucleic acid strand comprises a sequence from SEQ ID NO: 2 and when the first ribonucleic acid strand comprises a sequence from SEQ ID NO: 3 claim 1 , the second ribonucleic acid strand comprises a sequence from SEQ ID NO: 4.3. The composition of claim 1 , wherein the saRNA molecule comprises a thio modified internucleotide linkage.4. The composition of claim 1 , wherein the composition comprises a second saRNA molecule comprising at least one ribonucleic acid strand claim 1 , wherein when the first ribonucleic acid strand comprises a sequence from SEQ ID NO: 1 claim 1 , the one ribonucleic acid strand of the second saRNA comprises a sequence from SEQ ID NO: 3 or SEQ ID NO: 4.5. The composition of claim 4 , wherein when the one ribonucleic acid ...

Подробнее
Номер записи: 76
18-04-2013 дата публикации

HYDROXYMETHYL SUBSTITUTED RNA OLIGONUCLEOTIDES AND RNA COMPLEXES

Номер: US20130096289A1
Автор: Wengel Jesper
Принадлежит: MARINA BIOTECH, INC.

The present invention is directed to RNA oligonucleotides or complexes of RNA oligonucleotides, denoted herein together as RNA complexes, containing at least one, but optionally more that one, hydroxymethyl substituted nucleotide monomer(s). By a hydroxymethyl substituted nucleotide monomer is understood a nucleotide monomer containing a hydroxymethyl group (that may be unsubstituted, O-substituted for example with a conjugating group, or converted into an optionally substituted or conjugated aminomethyl group). This hydroxymethyl group is not partaking in formation of an internucleotide linkage and is not the hydroxymethyl group (containing the 5′-hydroxy group) of a natural RNA monomer. The RNA complexes of the invention may be useful for therapeutic applications, diagnostic applications or research applications. 124-. (canceled)26. The oligonucleotide of claim 25 , comprising from one to five acyclic monomers.27. The oligonucleotide of claim 25 , further comprising a nucleotide analogue selected from the group consisting of 2′-O-alkyl-RNA monomers claim 25 , 2′-amino-DNA monomers claim 25 , 2′-fluoro-DNA monomers claim 25 , PNA monomers claim 25 , HNA monomers claim 25 , ANA monomers claim 25 , FANA monomers claim 25 , CeNA monomers claim 25 , ENA monomers claim 25 , DNA monomers claim 25 , and INA monomers.28. The oligonucleotide of claim 25 , further comprising one or more 2′-O-alkyl-RNA nucleotide analogues.29. The oligonucleotide of claim 25 , further comprising a phosphorothioate linkage or a boranophosphate linkage.30. The oligonucleotide of claim 25 , wherein the oligonucleotide has a nucleotide sequence that is complementary to a target nucleotide sequence.31. The oligonucleotide of claim 25 , wherein the oligonucleotide has reduced off-target effects as compared to an identical oligonucleotide with natural RNA monomers instead of acyclic monomers.32. The oligonucleotide of claim 25 , wherein the oligonucleotide has increased or prolonged potency for gene ...

Подробнее
Номер записи: 77
25-04-2013 дата публикации

COMPOSITIONS COMPRISING NUCLEIC ACID APTAMERS

Номер: US20130101506A1
Автор: Smith Cassandra L.
Принадлежит:

Disclosed herein are aptamers that comprise a nucleic acid sequence that has a specific affinity for a target. These aptamers can be used as delivery vehicles to deliver specific agents to particular sites. Alternatively, targeted aptamers can also be used with detection techniques to determine the presence of absence of specific targets in heterogeneous backgrounds. 1. An aptamer that binds to CEA , wherein the aptamer comprises a consensus nucleic , acid sequence selected from the group consisting of SEQ ID NOs: 3 , 4 , 5 , 6 , 7 , 8 , and 9.2. The aptamer of claim 1 , wherein the aptamer comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 10 claim 1 , 11 claim 1 , 12 claim 1 , 13 claim 1 , 16 claim 1 , 17 claim 1 , 18 claim 1 , 19 claim 1 , 20 claim 1 , 21 claim 1 , 22 claim 1 , 23 claim 1 , 24 claim 1 , 25 claim 1 , 26 claim 1 , 27 claim 1 , 28 claim 1 , 29 claim 1 , 30 claim 1 , 31 claim 1 , 32 claim 1 , 33 claim 1 , 34 claim 1 , 35 claim 1 , 36 claim 1 , and 37.3. The aptamer of claim 1 , having a dissociation constant of about 4 nM to about 20 nM.4. The aptamer of claim 1 , wherein the aptamer comprises single-stranded DNA claim 1 , RNA or PNA.5. The aptamer of claim 1 , wherein the aptamer comprises natural or non-naturally occurring bases.6. The aptamer of claim 1 , wherein the aptamer comprises a chemical backbone selected from the group consisting of a phosphodiester claim 1 , a phosphorothioate claim 1 , a methylene phosphorothioate claim 1 , a peptide and other chemical modifications.7. The aptamer of claim 5 , wherein the non-naturally occurring bases are selected from the group consisting of methylinosine claim 5 , dihydrouridine claim 5 , methyl guanosine and thiouridine.8. A method of identifying claim 1 , detecting claim 1 , or imaging cells or tissues expressing CEA claim 1 , the method comprising administering to a subject the aptamer of .9. The method of claim 8 , wherein the aptamer comprises a nucleic acid ...

Подробнее
Номер записи: 78
25-04-2013 дата публикации

GENERAL COMPOSITION FRAMEWORK FOR LIGAND-CONTROLLED RNA REGULATORY SYSTEMS

Номер: US20130102651A1
Автор: Beisel Chase, Smolke Christina D., Win Maung Nyan
Принадлежит: California Institute of Technology

The invention provides an improved design for the construction of extensible nucleic acid-based, ligand-controlled regulatory systems, and the nucleic acid regulatory systems resulting therefrom. The invention contemplates improving the design of the switches (ligand-controlled regulatory systems) through the design of an information transmission domain (ITD). The improved ITD eliminates free-floating ends of the switching and the competing strands, and localizes competitive hybridization events to a contiguous strand of competing and switching strands in a strand-displacement mechanism-based switch, thereby improving the kinetics of strand-displacement. The improved regulatory systems have many uses in various biological systems, including gene expression control or ligand-concentration sensing. 121-. (canceled)22. A method for regulating expression of a recombinant gene , comprising:{'b': '21', '(i) providing a cell of claim ,'}(ii) contacting the cell with said molecule in an amount that alters the activity of said modular actuator domain.2325-. (canceled)261. A method for rendering expression of a target gene in a cell dependent on the presence or absence of a molecule , comprising introducing into the cell a polynucleotide of claim comprising a modular actuator domain comprising a substrate for RNase III , wherein said substrate , when processed by RNase III , produces an siRNA or miRNA that targets a transcript of said target gene , wherein , binding of said molecule to said modular sensor domain (e.g. , aptamer) causes a change in the intramolecular interaction of said information transmission domain , such that said substrate is processed by RNase III to produce the siRNA or miRNA to target said transcript , at a rate dependent upon the presence or absence of said molecule.27. A method of determining the amount of an analyte in a cell which expresses a reporter gene , comprising:{'b': '1', '(1) introducing into the cell a polynucleotide of claim comprising a ...

Подробнее
Номер записи: 79
25-04-2013 дата публикации

EFFICIENT METHOD FOR NUCLEAR REPROGRAMMING

Номер: US20130102768A1
Автор: KOYANAGI Michiyo, YAMANAKA Shinya
Принадлежит: KYOTO UNIVERSITY

A method of preparing induced pluripotent stem cells, comprising a nuclear reprogramming step with a nuclear reprogramming factor in the presence of miRNA, wherein said miRNA has a property of providing a higher nuclear reprogramming efficiency in the presence of said miRNA than in the absence thereof. 1. A nuclear reprogramming factor for a somatic cell , which comprises isolated miRNA comprising at least 15 contiguous nucleotides in the nucleotide sequence selected from the group consisting of: hsa-miR-372 , hsa-miR-373 , hsa-miR-371-373 cluster , hsa-miR-302b , hsa-miR-302c , hsa-miR-302a , hsa-miR-302d , hsa-miR-367 , hsa-miR-302-367 cluster , hsa-miR-520c , mmu-miR-290 , mmu-miR-291a , mmu-miR-294 , and mmu-miR-295.2. The nuclear reprogramming factor according to claim 1 , wherein the nucleotide sequence is selected from the group consisting of SEQ ID NOs: 1 to 14.3. The nuclear reprogramming factor according to claim 1 , wherein the miRNA is selected from the group consisting of: hsa-miR-372; hsa-miR-373 or hsa-miR-373/373*; hsa-miR-371-373 cluster; hsa-miR-302b or hsa-miR-302b/302b*; hsa-miR-302-367 cluster; hsa-miR-520c or hsa-miR-520c-5p/520c-3p; mmu-miR-291a or mmu-miR-291a-5p/291a-3p; mmu-miR-294 or mmu-miR-294/294*; and mmu-miR-295 or mmu-miR-295/295*.4. The nuclear reprogramming factor according to claim 3 , wherein the miRNA consists of hsa-miR-302-367 cluster.5. The nuclear reprogramming factor according to claim 3 , wherein the miRNA consists of mmu-miR-295/295* or 294/294*.6. The nuclear reprogramming factor according to claim 1 , wherein the nuclear reprogramming factors further comprise the isolated genes selected from the group consisting of an Oct family gene and a Klf family gene.7. The nuclear reprogramming factor according to claim 6 , wherein the an Oct family gene and a Klf family gene is selected from Oct3/4 and Klf4.8. The nuclear reprogramming factor according to claim 6 , wherein the nuclear reprogramming factors further comprise the ...

Подробнее
Номер записи: 80
25-04-2013 дата публикации

INTERFERING RNA MOLECULES

Номер: US20130102769A1
Автор: GIESE Klaus, Kaufmann Jörg, Klippel-Giese Anke
Принадлежит: Silence Therapeutics Aktiengesell Schaft

The present invention is related to a ribonucleic acid comprising a double stranded structure whereby the double-stranded structure comprises a first strand and a second strand, whereby the first strand comprises a first stretch of contiguous nucleotides and whereby said first stretch is at least partially complementary to a target nucleic acid, and the second strand comprises a second stretch of contiguous nucleotides whereby said second stretch is at least partially identical to a target nucleic acid, and whereby the double stranded structure is blunt ended. 1. A nucleic acid molecule comprising a first strand and a second strand ,wherein said first strand comprises a first stretch that is complementary to a target nucleic acid,wherein said second strand comprises a second stretch that is complementary to said first stretch,wherein said first strand and said second strand form a double-stranded structure comprising said first stretch and said second stretch,wherein said nucleic acid molecule is blunt ended on at least one end, andwherein each stretch consists of at least 15 and fewer than 30 ribonucleotides.2. The nucleic acid molecule according to claim 1 , wherein said nucleic acid molecule is blunt ended on the end defined by the 5′ end of the first strand and the 3′ end of the second strand.3. The nucleic acid molecule according to claim 1 , wherein said nucleic acid molecule is blunt ended on the end defined by the 3′ end of the first strand and the 5′ end of the second strand.4. The nucleic acid molecule according to claim 1 , wherein the nucleic acid molecule is blunt ended on both end.5. The nucleic acid molecule according to claim 1 , wherein each strand consists of at least 17 to 30 ribonucleotides.6. The nucleic acid molecule according to claim 1 , wherein the first stretch and the second stretch are of the same length.7. The nucleic acid molecule according to claim 1 , wherein the first strand and the second strand are each 17 to 23 nucleotides long.8. ...

Подробнее
Номер записи: 81
02-05-2013 дата публикации

COMPOSITIONS AND METHODS FOR MODULATION OF SMN2 SPLICING

Номер: US20130109091A1
Автор: Baker Brenda F., Hua Yimin, Krainer Adrian R.
Принадлежит:

Disclosed herein are compounds, compositions and methods for modulating splicing of SMN2 mRNA in a cell, tissue or animal. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders, including spinal muscular atrophy. 1. An antisense oligonucleotide targeted to intron 6 , exon 7 or intron 7 of a nucleic acid molecule encoding SMN2 , wherein said oligonucleotide is 12 to 20 nucleotides in length and comprises a 2′-O-methoxyethyl sugar modification at each position.2. The oligonucleotide of which is 12 nucleotides in length.3. The oligonucleotide of which is 15 nucleotides in length.4. The oligonucleotide of which is 18 nucleotides in length.5. The oligonucleotide of which is targeted to an intronic splicing silencer element.6. The oligonucleotide of which is targeted to an exonic splicing silencer element.7. The oligonucleotide of which is targeted to intron 6.8. The oligonucleotide of claim 7 , wherein the target site of said oligonucleotide is nucleotide 5 claim 7 , 6 claim 7 , 7 or 8 of SEQ ID NO: 1.9. The oligonucleotide of claim 7 , wherein the nucleotide sequence of said oligonucleotide comprises at least an 8-nucleobase portion of SEQ ID NO: 6 claim 7 , 7 claim 7 , 8 claim 7 , 9 claim 7 , 10 claim 7 , 11 claim 7 , 12 or 13.10. The oligonucleotide of which is targeted to exon 7.11. The oligonucleotide of wherein the target site of said oligonucleotide is nucleotide 64 claim 10 , 65 claim 10 , 66 claim 10 , 67 claim 10 , 68 claim 10 , 94 claim 10 , 95 claim 10 , 96 or 97 of SEQ ID NO: 1.12. The oligonucleotide of claim 10 , wherein the nucleotide sequence of said oligonucleotide comprises at least an 8-nucleobase portion of SEQ ID NO: 37 claim 10 , 38 claim 10 , 41 claim 10 , 59 claim 10 , 62 claim 10 , 63 claim 10 , 64 claim 10 , 66 claim 10 , 67 or 68.13. The oligonucleotide of which is targeted to intron 7.14. The oligonucleotide of wherein the target site of said oligonucleotide ...

Подробнее
Номер записи: 82
02-05-2013 дата публикации

MODIFIED 5' DIPHOSPHATE NUCLEOSIDES AND OLIGOMERIC COMPOUNDS PREPARED THEREFROM

Номер: US20130109850A1
Автор: Manoharan Muthiah, Prakash Thazha P., Rajeev Kallanthottathil G., Seth Punit P., Swayze Eric E., Zlatev Ivan
Принадлежит: Isis Pharmaceuticals, Inc

Provided herein are modified 5′ diphosphate nucleosides and oligomeric compounds prepared therefrom. More particularly, modified 5′ diphosphate nucleosides are provided that can be further modified at the 2′ and 5′ positions. In some embodiments, the oligomeric compounds provided herein are expected to hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. The oligomeric compounds are also expected to be useful as primers and probes in diagnostic applications. 150-. (canceled)52. The compound of wherein Bx is uracil claim 51 , thymine claim 51 , cytosine claim 51 , 5-methylcytosine claim 51 , adenine or guanine.53. The compound of any one of wherein r is 1 claims 52 , Mis H and Mis OH.54. The compound of any one of wherein r is 0 claims 53 , Mis O(CH)CN and Mis N[CH(CH)].55. The compound of wherein G is halogen claim 54 , OCH claim 54 , OCHF claim 54 , OCHF claim 54 , OCF claim 54 , OCHCH claim 54 , O(CH)F claim 54 , OCHCHF claim 54 , OCHCF claim 54 , OCH—CH═CH claim 54 , O(CH)—OCH claim 54 , O(CH)—SCH claim 54 , O(CH)—OCF claim 54 , O(CH)—N(R)(R) claim 54 , O(CH)—ON(R)(R) claim 54 , O(CH)—O(CH)—N(R)(R) claim 54 , OCHC(═O)—N(R)(R) claim 54 , OCHC(═O)—N(R)—(CH)—N(R)(R) or O(CH)—N(R)—C(═NR)[N(R)(R)] wherein R claim 54 , R claim 54 , Rand Rare each claim 54 , independently claim 54 , H or C-Calkyl.56. The compound of wherein G is halogen claim 55 , OCH claim 55 , OCF claim 55 , OCHCH claim 55 , OCHCF claim 55 , OCH—CH═CH claim 55 , O(CH)—OCH claim 55 , O(CH)—O(CH)—N(CH) claim 55 , OCHC(═O)—N(H)CH claim 55 , OCHC(═O)—N(H)—(CH)—N(CH)or OCH—N(H)—C(═NH)NH.57. The compound of wherein G is F claim 56 , OCH claim 56 , O(CH)—OCH claim 56 , OCHC(═O)—N(H)CHor OCHC(═O)—N(H)—(CH)—N(CH).58. The compound of wherein G is O(CH)—OCH.59. The compound of wherein each Pg is claim 58 , independently claim 58 , methyl claim 58 , ethyl claim 58 , isopropyl claim 58 , tert-butyl claim 58 , 2-cyanoethyl claim 58 , benzyl claim 58 , phenyl claim 58 , 4- ...

Подробнее
Номер записи: 83
09-05-2013 дата публикации

REDUCER OF IMMUNOSUPPRESSION BY TUMOR CELL AND ANTITUMOR AGENT USING THE SAME

Номер: US20130115225A1
Автор: Kawakami Yutaka, Kudo Chie
Принадлежит: KEIO UNIVERSITY

The invention features methods for inhibiting enhancement of expression of a FoxP3 gene in a cell, methods for inhibiting induction of differentiation of a cell into a regulatory T cell, methods for reducing immunosuppression, methods for stimulating tumor immunity, and methods for treating a patient with a tumor. The methods of the invention involve suppressing function of an FSTL1 protein in the cell. In the methods of the invention, function of an FSTL1 protein in the cell may be suppressed using an anti-FSTL1 antibody. 1. A method for inhibiting enhancement of expression of FoxP3 gene in a cell , comprising suppressing function of an FSTL1 protein in the cell.2. A method of claim 1 , wherein function of an FSTL1 protein is suppressed with an anti-FSTL1 antibody.3. A method for inhibiting induction of differentiation of a cell into a regulatory T cell claim 1 , comprising suppressing function of an FSTL1 protein in the cell.4. A method of claim 3 , wherein function of an FSTL1 protein is suppressed with an anti-FSTL1 antibody.5. A method for reducing immunosuppression claim 3 , comprising suppressing function of an FSTL1 protein in a cell being capable of differentiating into a regulatory T cell.6. A method of claim 5 , wherein function of an FSTL1 protein is suppressed with an anti-FSTL1 antibody.7. A method for stimulating tumor immunity claim 5 , comprising suppressing function of an FSTL1 protein in the tumor cell.8. A method of claim 7 , wherein function of an FSTL1 protein is suppressed with an anti-FSTL1 antibody.9. A method for treating a patient with a tumor claim 7 , comprising suppressing function of an FSTL1 protein in the tumor cell.10. A method of claim 9 , wherein function of an FSTL1 protein is suppressed with an anti-FSTL1 antibody. This application is a continuation of U.S. patent application Ser. No. 12/674,881, having a 371(c) Date of Apr. 20, 2010, which is the U.S. National Stage filing under 35 U.S.C. §371 of International Application No. ...

Подробнее
Номер записи: 84
09-05-2013 дата публикации

METHOD FOR TRANSFECTING NUCLEIC ACID TO CELL AND NUCLEIC ACID COMPLEX

Номер: US20130115700A1
Автор: FUJII Masayuki
Принадлежит: KITAKYUSHU FOUNDATION FOR THE ADVANCEMENT OF INDUSTRY SCIENCE AND TECHNOLOGY

A method for transacting nucleic acid to cell comprising a step for forming a nucleic acid complex by bringing a double-stranded nucleic acid molecule into contact with a nucleic acid carrier having an amino acid sequence of alternating a basic amino acid and a hydrophobic amino acid, which has a peptide chain that forms a β-sheet structure in which a side chain of a positively charged basic amino acid is disposed on one surface side and a side chain of a hydrophobic amino acid is disposed on the opposite surface side in the presence of the double-stranded nucleic acid molecule having a double helix structure, and by binding the double-stranded nucleic acid molecule and the peptide chain through either one or both of the electrostatic interaction between the side chains of the basic amino acid and phosphate groups and hydrogen bonds between the double stranded-nucleic acid molecule and the peptide chain and a nucleic acid complex used for the same are disclosed. 116-. (canceled)17. A method for transfecting nucleic acid to cell comprising a step for forming a nucleic acid complex by bringing a double-stranded nucleic acid molecule into contact with a nucleic acid carrier having an amino acid sequence of alternating arginine or ornithine and a hydrophobic amino acid , which has a peptide chain that forms a β-sheet structure in which a side chain of a positively charged arginine or ornithine is disposed on one surface side and a side chain of a hydrophobic amino acid is disposed on the opposite surface side in the presence of the double-stranded nucleic acid molecule having a double helix structure , and by binding the double-stranded nucleic acid molecule and the peptide chain that forms the β-sheet structure through either one or both of the electrostatic interaction between the side chains of arginine or ornithine of the peptide chain that forms the β-sheet structure and phosphate groups and hydrogen bonds between the double stranded-nucleic acid molecule and the ...

Подробнее
Номер записи: 85
09-05-2013 дата публикации

Antagonists of miRNA-29 Expression and Their Use in the Prevention and Treatment of Aneurysm

Номер: US20130116303A1
Автор: Boon Reinier, Dimmeler Stefanie, Zeiher Andreas
Принадлежит: JOHANN WOLFGANG GOETHE-UNIVERSITAT FRANKFURT AM MAIN

The present invention relates to antagonists of the expression and/or the function of the micro RNA miRNA-29 for use in the prevention and/or treatment of aortic aneurysms. Further disclosed is a method for the identification of miRNA-29 antagonists, a pharmaceutical composition comprising said miRNA-29 antagonists and a method for preventing and treating age-related aortic aneurysm formation in a subject in need of such a treatment. 1. A method for the prevention and/or treatment of aortic aneurysm formation in a mammal , wherein said method comprises administering , to a mammal in need of such prevention and/or treatment , an antagonist of miRNA-29 expression and/or function.2. The method according to claim 1 , wherein said aortic aneurysm is an abdominal aortic aneurysm (AAA).3. The method according to claim 1 , wherein said aortic aneurysm formation further involves a weakening of arterial vessels and/or aortic rupture.4. The method according to claim 1 , wherein said aortic aneurysm further involves a down-regulation of at least one gene encoding an extracellular matrix protein.5. The method according to claim 1 , wherein said miRNA-29 is selected from miRNA-29a claim 1 , miRNA-29b and miRNA-29c.6. The method according to claim 1 , wherein said antagonist is selected from antisense DNA- and/or RNA-oligonucleotides claim 1 , antisense 2′-O-methyl oligoribonucleotides claim 1 , antisense oligonucleotides containing phosphorothiaote linkages claim 1 , antisense oligonucleotides containing Locked Nucleic Acid LNA® bases claim 1 , morpholino antisense oligonucleotides claim 1 , PPAR-gamma agonists claim 1 , antagomirs claim 1 , and mixtures thereof.7. The method according to claim 1 , wherein said antagonist is administered to the arterial tissue by a drug-eluting stent or by a balloon.8. A method for identifying an antagonist of miRNA-29a to c comprising:(a) contacting a cell with a candidate compound;(b) assessing at least one of miRNA-29a to c activity or ...

Подробнее
Номер записи: 86
09-05-2013 дата публикации

OLIGOMERIC COMPOUNDS FOR THE MODULATION OF HIF-1A EXPRESSION

Номер: US20130116309A1
Автор: Høg Anja Mølhart, Kristjansen Paul E.G., Thrue Charlotte Albæk
Принадлежит:

Oligonucleotides directed against the hypoxia-inducible factor-1α (HIF-1α) gene are provided for modulating the expression of HIF-1α. The compositions comprise oligonucleotides, particularly antisense oligonucleotides, targeted to nucleic acids encoding the HIF-1α. Methods of using these compounds for modulation of HIF-1α expression and for the treatment of diseases associated with the hypoxia-inducible factor-1α are provided. Examples of diseases are cancer and pre-eclampsia. The oligonucleotides may be composed of deoxyribonucleosides, a nucleic acid analogue, or Locked Nucleic Acid (LNA) or a combination thereof. 136-. (canceled)37. A compound of 16 to 50 nucleotides or nucleotide analogues , wherein adjacent nucleotides or nucleotide analogues are covalently linked by an internucleotide linkage , and wherein the compound modulates HIF-1α expression.38. The compound according to which inhibits the expression of HIF-1α in a cell or tissue.39. The compound according to claim 37 , which is an antisense oligonucleotide.40. The compound according to claim 39 , wherein the antisense oligonucleotide comprises at least one nucleotide analogue.41. The compound according to claim 40 , wherein the nucleotide analogue is a Locked Nucleic Acid (LNA) unit.44. The compound according to claim 42 , wherein the internucleotide linkage is selected from the group consisting of —O—P(O)—O— claim 42 , —O—P(O claim 42 ,S)—O— claim 42 , —O—P(S)—O— claim 42 , —S—P(O)—O— claim 42 , —S—P(O claim 42 ,S)—O— claim 42 , —S—P(S)—O— claim 42 , —O—P(O)—S— claim 42 , —O—P(O claim 42 ,S)—S— claim 42 , —S—P(O)—S— claim 42 , —O—PO(R)—O— claim 42 , O—PO(OCH)—O— claim 42 , —O—PO(NR)—O— claim 42 , —O—PO(OCHCHS—R)—O— claim 42 , —O—PO(BH)—O— claim 42 , —O—PO(NHR)—O— claim 42 , —O—P(O)—NR— claim 42 , —NR—P(O)—O— claim 42 , and —NR″-CO—O— claim 42 , where Ris selected form hydrogen and C-alkyl.45. The compound of claim 44 , wherein at least one internucleotide linkage is a phosphorothioate linkage.46. The ...

Подробнее
Номер записи: 87
09-05-2013 дата публикации

ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF

Номер: US20130116310A1
Автор: Fletcher Sue, McClorey Graham, Wilton Stephen Donald
Принадлежит: The University of Western Australia

An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. 1. An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene , as set forth in SEQ ID NO: 1 to 202.2. An antisense molecule according to capable of inducing exon skipping in exons 3 claim 1 , 4 claim 1 , 8 claim 1 , 10 to 16 claim 1 , 19 to 40 claim 1 , 42 to 44 claim 1 , 46 claim 1 , 47 and 50 to 53 of the dystrophin gene.3. A combination of two or more antisense molecules according to or capable of binding to a selected target to induce exon skipping in the dystrophin gene.4. A combination or two or more antisense molecules according to selected from Table 1B.5. A combination of two or more antisense molecules according to or joined together to form a “weasel” claim 3 , wherein said weasel is capable of binding to a selected target to induce exon skipping in the dystrophin gene.6. A combination of two or more antisense molecules according to selected from Table 1C.7. The antisense molecule according to any one of to claim 5 , capable of binding to a selected target site claim 5 , wherein the target site is an mRNA splicing site selected from a splicer donor site claim 5 , splice acceptor sites or exonic splicing enhancer elements.8. A method of treating muscular dystrophy in a patient comprising administering to the patient a composition comprising an antisense molecule according to anyone of to .9. A pharmaceutical or therapeutic composition for the treatment of muscular dystrophy in a patient comprising (a) at least an antisense molecule according to any one of to claim 5 , and (b) one or more pharmaceutically acceptable carriers and/or diluents.10. The composition according to claim 9 , comprising about 20 nM to 600 nM of the antisense molecule.11. The use of an antisense molecule according to any one of to for the manufacture of a medicament for modulation ...

Подробнее
Номер записи: 88
09-05-2013 дата публикации

Methods for the Development of Vaccines Based on Oligosaccharide-Oligonucleotide Conjugates

Номер: US20130116417A1
Автор: Hedstrom Lizbeth K., KRAUSS Isaac J., MacPherson Iain S.
Принадлежит: BRANDEIS UNIVERSITY

Described herein are oligosaccharide-oligonucleotide conjugates useful as vaccines against one or more human or veterinary therapeutic indications, and methods of synthesizing and identifying them. The conjugates may be identified using non-human antibodies as binding targets, thereby expanding the power and scope of the invention. Efficacious conjugates may be identified through an iterative. 1. A method , comprising the steps of: wherein', 'the oligonucleotide comprises a first primer binding site on the 5′ end, a randomized region, and a stem-loop region;', 'the randomized region is located between the first primer binding site and the stem-loop region;', 'the stem-loop region comprises a second primer binding site; and', 'at least one of the deoxyribonucleotide triphosphates comprises a reactive substituent;, '(a) combining an oligonucleotide, a first DNA polymerase, and a plurality of deoxyribonucleotide triphosphates,'}thereby forming an extended oligonucleotide comprising an original strand and an extended strand, wherein the extended strand comprises at least one reactive substituent;(b) combining a plurality of modifying compounds and the extended oligonucleotide under reaction conditions,thereby forming a modified extended oligonucleotide comprising the original strand and a modified extended strand; and(c) combining a primer complementary to the second primer binding site, a second DNA polymerase, the modified extended oligonucleotide, and a plurality of deoxyribonucleotide triphosphatesthereby creating a duplex with the original strand and displacing the modified extended strand.2. (canceled)3. The method of claim 1 , wherein oligonucleotide is in the form of a partial stem-loop.45-. (canceled)6. The method of claim 1 , wherein the deoxyribonucleotide triphosphate comprising a reactive substituent is an unnatural deoxyribonucleotide triphosphate.7. The method of claim 1 , wherein the reactive substituent is ethynyl.8. The method of claim 1 , wherein the ...

Подробнее
Номер записи: 89
09-05-2013 дата публикации

PROMOTER, PROMOTER CONTROL ELEMENTS, AND COMBINATIONS, AND USES THEREOF

Номер: US20130117881A1
Автор: ALEXANDROV Nickolai, APUYA Nestor, COOK Zhihong, DANG David Van-dinh, DAVIS Shawna, DONSON Jonathan, Fang Yiwen, FELDMANN Kenneth A., GRIZARD Danielle, JOFUKU Diane K., KIEGLE Edward, KWOK Shing, LU Yu-Ping, MARGOLLES-CLARK Emilio, MEDRANO Leonard, OKAMURO Jack K., PENNELL Roger, PORTEREIKO Michael, ROBLES Dennis, SCHNEEBERGER Richard, TATARINOVA Tatiana, THEISS Noah, Wu Chuan-Yin
Принадлежит: CERES, INC.

The present invention is directed to promoter sequences and promoter control elements, polynucleotide constructs comprising the promoters and control elements, and methods of identifying the promoters, control elements, or fragments thereof. The invention further relates to the use of the present promoters or promoter control elements to modulate transcript levels. 1. An isolated nucleic acid molecule capable of modulating transcription wherein the nucleic acid molecule shows at least 80% sequence identity to any one of the promoter sequences in the Sequence Listing , or a complement thereof.2. The isolated nucleic acid molecule of claim 1 , wherein said nucleic acid is capable of functioning as a promoter.3. The isolated nucleic acid molecule of claim 2 , wherein said nucleic acid comprises a reduced promoter nucleotide sequence having a sequence consisting of one of the promoter sequences in Table 1 having at least one of the corresponding optional promoter fragments identified in Table 1.4. The isolated nucleic acid molecule of claim 2 , wherein said nucleic acid comprises a reduced promoter nucleotide sequence having a sequence consisting of one of the promoter sequences in Table 1 having all of the corresponding optional promoter fragments identified in Table 1.5. The isolated nucleic acid molecule of claim 1 , wherein said nucleic acid molecule is capable of modulating transcription during the developmental times claim 1 , or in response to a stimulus claim 1 , or in a cell claim 1 , tissue claim 1 , or organ as set forth in Table 1 in the section “The spatial expression of the promoter-marker-vector.”7. The vector construct according to claim 6 , wherein said nucleic acid comprises a reduced promoter nucleotide sequence having a sequence consisting of one of the promoter sequences in Table 1 having at least one of the corresponding optional promoter fragments identified in Table 1 deleted therefrom.8. The vector construct according to claim 6 , wherein said ...

Подробнее
Номер записи: 90
16-05-2013 дата публикации

Nucleic Acid of Formula (I): GlXmGn, or (II): ClXmCn, in Particular as an Immune-Stimulating Agent/Adjuvant

Номер: US20130121988A1
Автор: Birgit Scheel, Ingmar Hoerr, Jochen Probst, Thomas Ketterer
Принадлежит: CureVac AG

The present invention relates to a nucleic acid of the general formula (I): G l X m G n , which may be modified by a lipid. The invention relates further to a pharmaceutical composition containing an immune-stimulating agent according to the invention in combination with a pharmaceutically active carrier/vehicle (and, optionally, further auxiliary substances, additives and/or further adjuvants). The present invention can relate to a vaccine, which corresponds to a pharmaceutical composition of the invention, wherein the pharmaceutically active component induces a specific immune response (e.g. an antigen). The present invention can relate to the use of a nucleic acid of the invention or a pharmaceutical composition according to the invention for the treatment of infectious diseases, autoimmune disease, allergies or cancer diseases.

Подробнее
Номер записи: 91
16-05-2013 дата публикации

MICRORNA COMPOSITIONS AND METHODS

Номер: US20130123329A1
Автор: Akinc Akin, Bhat Balkrishen, Linsley Peter, Marcusson Eric G.
Принадлежит:

Provided herein are compositions comprising oligomeric compounds. In certain embodiments, the oligomeric compounds are useful as miRNA mimics. The oligomeric compounds may mimic the activity of miR-34. Also provided herein are methods for the treatment of cancer. 1. A method of treating cancer comprising administering to a subject having cancer a composition comprising an oligomeric compound comprising an oligonucleotide consisting of 7 to 30 linked nucleosides , wherein the nucleobase sequence of the oligonucleotide has at least 80% seed region identity with the nucleobase sequence of miR-34.2. The method of wherein the cancer is selected from liver cancer claim 1 , breast cancer claim 1 , lung cancer claim 1 , colon cancer claim 1 , ovarian cancer claim 1 , cervical cancer claim 1 , leukemia claim 1 , lymphoma claim 1 , brain cancer claim 1 , esophageal cancer claim 1 , Hodgkin lymphoma claim 1 , non-Hodgkin lymphoma claim 1 , kidney cancer claim 1 , melanoma claim 1 , myeloma claim 1 , oral cancer claim 1 , pancreatic cancer claim 1 , prostate cancer claim 1 , rectal cancer claim 1 , stomach cancer claim 1 , bladder cancer claim 1 , thyroid cancer claim 1 , and testicular cancer.3. The method of wherein the liver cancer is hepatocellular carcinoma.4. The method of wherein the liver cancer comprises secondary liver cancer.5. The method of wherein the secondary liver cancer is the result of colorectal cancer with metastasis to the liver.6. The method of wherein the subject is a human.7. (canceled)8. The method of comprising administering at least one additional therapy.9. The method of wherein the at least one additional therapy comprises a chemotherapeutic agent.10. (canceled)11. The method of wherein the chemotherapeutic agent is selected from 5-fluorouracil claim 9 , gemcitabine claim 9 , doxorubicine claim 9 , mitomycin c claim 9 , sorafenib claim 9 , etoposide claim 9 , carboplatin claim 9 , epirubicin claim 9 , irinotecan and oxaliplatin.1229.-. (canceled)30. ...

Подробнее
Номер записи: 92
16-05-2013 дата публикации

COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF MYLIP/IDOL GENE

Номер: US20130123332A1
Автор: Bettencourt Brian, Fitzgerald Kevin, Manoharan Muthiah
Принадлежит: ALNYLAM PHARMACEUTICALS, INC.

The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the Mylip/Idol gene, and methods of using such dsRNA compositions to inhibit expression of Mylip/Idol. 1. (canceled)2. A double-stranded ribonucleic acid (dsRNA) for inhibiting expression of Mylip/Idol , wherein said dsRNA comprises a sense strand and an antisense strand , the antisense strand comprising a region of complementarity to a Mylip/Idol transcript which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from one of the antisense sequences of SEQ ID NOs: 20-167 and 648-1103 , SEQ ID NOs: 168-299 , SEQ ID NOs: 300-447 , and SEQ ID NOs: 448-579.3. The dsRNA of claim 1 , wherein said dsRNA comprises at least one modified nucleotide.4. The dsRNA of claim 3 , wherein at least one of said modified nucleotides is chosen from the group consisting of:a 2′-O-methyl modified nucleotide; a nucleotide comprising a 5′-phosphorothioate group; a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group; a 2′-deoxy-2′-fluoro modified nucleotide; a 2′-deoxy-modified nucleotide; a locked nucleotide; an abasic nucleotide; 2′-amino-modified nucleotide; 2′-alkyl-modified nucleotide; morpholino nucleotide; a phosphoramidate; and a non-natural base comprising nucleotide.5. (canceled)6. The dsRNA of claim 2 , wherein the region of complementarity is at least 17 nucleotides in length.7. The dsRNA of claim 2 , wherein the region of complementarity is between 19 and 21 nucleotides in length.8. The dsRNA of claim 7 , wherein the region of complementarity is 19 nucleotides in length.9. The dsRNA of claim 2 , wherein each strand is no more than 30 nucleotides in length.10. The dsRNA of claim 2 , wherein at least one strand comprises a 3′ overhang of at least 1 nucleotide.11. (canceled)12. The dsRNA of claim 2 , further comprising a ligand.13. The dsRNA of claim 12 , wherein the ligand is conjugated to the 3′ end of the sense ...

Подробнее
Номер записи: 93
16-05-2013 дата публикации

Nucleic Acid Functionalized Nanoparticles for Therapeutic Applications

Номер: US20130123333A1
Автор: Giljohann David A., Mirkin Chad A., Rosi Nathaniel L., Thaxton C. S.
Принадлежит: Northwestern University

Materials and methods for regulating gene expression using nanoparticles functionalized with antisense oligonucleotides are provided. 1. A method of inhibiting expression of a gene product comprising the step of hybridizing a polynucleotide encoding said gene product with one or more oligonucleotides complementary to all or a portion of said polynucleotide , said oligonucleotide being bound to a nanoparticle , wherein hybridizing between said polynucleotide and said oligonucleotide occurs over a length of said polynucleotide with a degree of complementarity sufficient to inhibit expression of said gene product.2. The method of wherein expression of said gene product is inhibited in vivo.3. The method of wherein expression of said gene product is inhibited in vitro.4. The method of wherein said nanoparticle is metallic.5. (canceled)6. The method of wherein said nanoparticle is selected from the group consisting of a gold nanoparticle claim 4 , a silver nanoparticle claim 4 , a platinum nanoparticle claim 4 , an aluminum nanoparticle claim 4 , a palladium nanoparticle claim 4 , a copper nanoparticle claim 4 , a cobalt nanoparticle claim 4 , an indium nanoparticle claim 4 , and a nickel nanoparticle.9. The method of wherein said oligonucleotide is a DNA oligonucleotide or an RNA oligonucleotide.10. (canceled)1159-. (canceled)60. The method of wherein said polynucleotide is an inhibitory RNA (RNAi) that performs a regulatory function.61. The method of wherein the RNAi is selected from the group consisting of a small inhibitory RNA (siRNA) claim 60 , an RNA that forms a triplex with double stranded DNA claim 60 , and a ribozyme.6265-. (canceled)66. A kit comprising at least one container claim 60 , the container holding at least one type of oligonucleotide-functionalized nanoparticle claim 60 , said oligonucleotide-functionalized nanoparticle comprising:an oligonucleotide being covalently bound to an inorganic nanoparticle, wherein said nanoparticle does not comprise a ...

Подробнее
Номер записи: 94
16-05-2013 дата публикации

RNAi Inhibition of Serum Amyloid A For Treatment of Glaucoma

Номер: US20130123337A1
Автор: Clark Abbot F., McNatt Loretta Graves, Wang Wan-Heng
Принадлежит: NOVARTIS AG

RNA interference is provided for inhibition of serum amyloid A mRNA expression in glaucomas involving SAA expression. 2. A method of treating a subject having glaucoma claim 1 , the method comprising administering the interfering RNA of to the eye of the subject. The present application is a continuation of U.S. patent application Ser. No. 13/362,549 filed Jan. 31, 2012 (pending); which is a continuation of U.S. patent application Ser. No. 12/912,061 filed Oct. 26, 2010 (now abandoned), which is a divisional of U.S. patent application Ser. No. 12/712,323 filed Feb. 25, 2010 (now abandoned), which is a divisional of U.S. patent application Ser. No. 11/313,210 filed Dec. 19, 2005 (now abandoned), which claims the benefit of co-pending U.S. Provisional Patent Application Ser. No. 60/638,706 filed Dec. 23, 2004, the text of which is specifically incorporated by reference herein.The present invention relates to the field of interfering RNA compositions for inhibition of expression of serum amyloid A (SAA) in glaucoma, particularly for primary open angle glaucoma.Glaucoma is a heterogeneous group of optic neuropathies that share certain clinical features. The loss of vision in glaucoma is due to the selective death of retinal ganglion cells in the neural retina that is clinically diagnosed by characteristic changes in the visual field, nerve fiber layer defects, and a progressive cupping of the optic nerve head (ONH). One of the main risk factors for the development of glaucoma is the presence of ocular hypertension (elevated intraocular pressure, IOP). An adequate intraocular pressure is needed to maintain the shape of the eye and to provide a pressure gradient to allow for the flow of aqueous humor to the avascular cornea and lens. IOP also appears to be involved in the pathogenesis of normal tension glaucoma where patients have what is often considered to be normal IOP.The elevated IOP associated with glaucoma is due to elevated aqueous humor outflow resistance in the ...

Подробнее
Номер записи: 95
16-05-2013 дата публикации

Compositions and methods for silencing apolipoprotein b

Номер: US20130123339A1
Автор: Adam Judge, Alan Martin, Amy C.H. Lee, Ian Maclachlan, James Heyes, Marjorie Robbins, Mark Wood
Принадлежит: PROTIVA BIOTHERAPEUTICS INC

The present invention provides compositions and methods for the delivery of interfering RNAs such as siRNAs that silence APOB expression in cells such as liver cells. In particular, the nucleic acid-lipid particles provide efficient encapsulation of nucleic acids and efficient delivery of the encapsulated nucleic acid to cells such as liver cells in vivo. The compositions of the present invention are highly potent, thereby allowing effective knock-down of APOB at relatively low doses. In addition, the compositions and methods of the present invention are less toxic and provide a greater therapeutic index compared to compositions and methods previously known in the art.

Подробнее
Номер записи: 96
16-05-2013 дата публикации

FRACTALKINE BINDING POLYNUCLEOTIDES AND METHODS OF USE

Номер: US20130123347A1
Автор: KOKKOLI EFROSINI, Sreevatsan Srinand, Wang Ping, Waybrant Brett M.
Принадлежит:

Provided herein are polynucleotides that bind to fractalkine. In one embodiment, a polynucleotide includes the polynucleotide sequence SEQ ID NO:1 or a sequence having at least 80% identity to SEQ ID NO:1. Also provided herein are structures that include such a polynucleotide present on its surface, including 2-dimentional and 3-dimentional structures. Also provided are compositions that include such a polynucleotide, and methods for using the polynucleotides. 1. A polynucleotide comprising the polynucleotide sequence SEQ ID NO:1 or a sequence having at least 80% identity to SEQ ID NO:1 , wherein the polynucleotide binds to fractalkine.2. The polynucleotide of wherein the polynucleotide is a single stranded deoxyribonucleic acid.3. The polynucleotide of wherein the polynucleotide comprises at least one modification.4. The polynucleotide of wherein the polynucleotide comprises at the 5′ end claim 1 , at the 3′ end claim 1 , or at an internal nucleotide a covalently attached tail.5. The polynucleotide of wherein the tail comprises an affinity label.6. The polynucleotide of wherein the tail comprises a hydrophilic group or a hydrophobic group.7. The polynucleotide of wherein the tail comprises an amphiphile.8. A surface comprising the polynucleotide of .9. The surface of wherein the surface is 3-dimensional.10. A vesicle comprising the polynucleotide of on the surface of the vesicle.11. A composition comprising the polynucleotide of and a pharmaceutically acceptable carrier.12. A method comprising administering the composition of to a subject.13. The method of wherein the subject is a human.14. A 3-dimensional structure comprising a layer claim 12 , wherein the layer comprises an attached polynucleotide claim 12 , wherein the polynucleotide comprises a sequence having at least 80% identity to SEQ ID NO:1 claim 12 , and wherein the polynucleotide has biological activity.15. The 3-dimensional structure of wherein the 3-dimensional structure is a vesicle.16. The 3- ...

Подробнее
Номер записи: 97
16-05-2013 дата публикации

RNA INTERFERENCE MEDIATING SMALL RNA MOLECULES

Номер: US20130125259A1
Автор: Elbashir Sayda Mahgoub, Lendeckel Winfried, Tuschl Thomas
Принадлежит:

Double-stranded RNA (dsRNA) induces sequence-specific post-transcriptional gene silencing in many organisms by a process known as RNA interference (RNAi). Using a in vitro system, we demonstrate that 19-23 nt short RNA fragments are the sequence-specific mediators of RNAi. The short interfering RNAs (siRNAs) are generated by an RNase III-like processing reaction from long dsRNA. Chemically synthesized siRNA duplexes with overhanging 3′ ends mediate efficient target RNA cleavage in the lysate, and the cleavage site is located near the center of the region spanned by the guiding siRNA. Furthermore, we provide evidence that the direction of dsRNA processing determines whether sense or antisense target RNA can be cleaved by the produced siRNP complex. 1. Isolated double-stranded RNA molecule , wherein each RNA strand has a length from 19-25 nucleotides , wherein said RNA molecule is capable of target-specific nucleic acid modifications.2. The RNA molecule of wherein at least one strand has a 3′-overhang from 1-5 nucleotides.3. The RNA molecule of capable of target-specific RNA interference and/or DNA methylation.4. The RNA molecule of claim 1 , wherein each strand has a length from 19-23 claim 1 , particularly from 20-22 nucleotides.5. The RNA molecule of claim 2 , wherein the 3′-over-hang is from 1-3 nucleotides.6. The RNA molecule of claim 2 , wherein the 3′-over-hang is stabilized against degradation.7. The RNA molecule of claim 1 , which contains at least one modified nucleotide analogue.8. The RNA molecule of claim 7 , wherein the modified nucleotide analogue is selected from sugar- or backbone modified ribonucleotides.9. The RNA molecule according to claim 7 , wherein the nucleotide analogue is a sugar-modified ribonucleotide claim 7 , wherein the 2′-OH group is replaced by a group selected from H claim 7 , OR claim 7 , R claim 7 , halo claim 7 , SH claim 7 , SR′ claim 7 , NH2 claim 7 , NHR claim 7 , NR2 or CN claim 7 , wherein R is C1-C6 alkyl claim 7 , alkenyl ...

Подробнее
Номер записи: 98
23-05-2013 дата публикации

MODULATION OF BCL11A FOR TREATMENT OF HEMOGLOBINOPATHIES

Номер: US20130129629A1
Автор: Orkin Stuart H., Sankaran Vijay G.
Принадлежит:

The invention relates to methods and uses of modulating fetal hemoglobin expression (HbF) in a hematopoietic progenitor cells via inhibitors of BCL11A expression or activity, such as RNAi and antibodies. 1. A method for identifying a modulator of BCL11A activity or expression , the method comprising contacting a hematopoietic progenitor cell with a composition comprising a test compound , and measuring the level of fetal hemoglobin or fetal hemoglobin mRNA in said cell or its progeny , wherein an increase in fetal hemoglobin is indicative that said test compound is a candidate inhibitor of BCL11A activity or expression.2. The method of claim 1 , wherein the hematopoietic progenitor cell is contacted in vivo claim 1 , ex vivo claim 1 , or in vitro.3. The method of claim 1 , wherein the cell is of human claim 1 , non-human primate claim 1 , or mammalian origin.4. The method of claim 1 , wherein the test compound is a small molecule claim 1 , antibody or nucleic acid.5. The method of claim 1 , wherein the composition causes an increase in fetal hemoglobin mRNA or protein expression.6. A method of treatment of a hemoglobinopathy in a subject comprising administering an effective amount of a composition comprising an inhibitor of BCL11A claim 1 , wherein the inhibitor of BCL11A is a nucleic acid that inhibits the expression of BCL11A and hybridizes to BCL11A claim 1 , and whereby fetal hemoglobin expression is increased in the subject relative to prior to the administration.7. The method of claim 6 , wherein the nucleic acid is a BCL11A specific RNA interference agent claim 6 , or a vector encoding a BCL11A specific RNA interference agent.8. The method of claim 6 , wherein the RNA interference agent comprises one or more of the nucleotide sequences of SEQ ID NO:1-6.9. The method of claim 6 , wherein the subject has been diagnosed with a hemoglobinopathy.10. The method of further comprising selecting a subject who has been diagnosed with a hemoglobinopathy.11. The method ...

Подробнее
Номер записи: 99
23-05-2013 дата публикации

HER2 NUCLEIC ACID APTAMERS

Номер: US20130129719A1
Автор: Giangrande Paloma H., McNamara James O., Rockey William M., Thiel Kristina W., Thiel William
Принадлежит: UNIVERSITY OF IOWA RESEARCH FOUNDATION

The present invention relates to optimized HER2 aptamers and methods of using these aptamers. 1. An aptamer molecule not more than 55 nucleotides in length comprising the nucleic acid sequence 5′-GGGAGGACGAUGCGG-R-CAGACGACUCGCCCGA-3′ (SEQ ID NO: 45) , wherein Ris (n)where each n represents any nucleotide , and wherein x is an integer from 19 to 21.3. The aptamer of claim 1 , wherein the nucleic acid molecule comprises nucleic acid 5′-GGGAGGACGAUGCGGGACUGUAYGGGGCUCUGUGCAGACGACUCGCCCGA-3′ (SEQ ID NO: 25); 5′-GGGAGGACGAUGCGGUCUGUUGUGCUUGAUAUGCCC CAGACGACUCGCCCGA-3′ (SEQ ID NO: 26); 5′-GGGAGGACGAUGCGGCUGUCUWMGCUUCUACUGCCGCAGACGACUCGCCC GA-3′ (SEQ ID NO: 27); 5′-GGGAGGACGAUGCGGAUGUAUGUUGGGAGCCACGCCAGACGACUCGCCCG A-3′ (SEQ ID NO: 28); or 5′-GGGAGGACGAUGCGGUCCUGUCGUYUGKUCSKCCCCAGACGACUCGCCCGA-3′ (SEQ ID NO: 29).4. A conjugate comprising the aptamer of operably linked to a Blc-2 RNAi molecule.5. The conjugate of claim 4 , wherein the Bcl-2 RNAi molecule comprises nucleic acid 5′-GCUGUCACAGAGGGGCUACUU-3′ (SEQ ID NO: 30).6. The conjugate of claim 5 , consisting of 5′-GGGAGGACGAAUGCGGGACUGUACGGGGCUCUGUGCAGACGACUCGCCCG AGCUGUCACAGAGGGGCUACUU-3′ (A1-Bcl-2 claim 5 , SEQ ID NO:32); 5′-GGGAGGACGAUGCGGGACUGUAUGGGGCUCUGUGCAGACGACUCGCCCGA GCUGUCACAGAGGGGCUACUU-3′ (A2-Bcl-2 claim 5 , SEQ ID NO:33); 5′-GGGAGGACGAUGCGGGACUGUACGGGCUCUGUGCAGACGACUCGCCCGAG CUGUCACAGAGGGGCUACUU-3′ (A3-Bcl-2 claim 5 , SEQ ID NO:34); 5′-GGGAGGACGAUGCGGUCUGUUGUGCUUGAUAUGCCCCAGACGACUCGCCC GAGCUGUCACAGAGGGGCUACUU-3′ (B1-Bcl-2 claim 5 , SEQ ID NO:35); 5′-GGGAGGACGAUGCGGUGGUGUGUCAAGGUACGCGCCAGACGACUCGCCCG AGCUGUCACAGAGGGGCUACUU-3′ (B2-Bcl-2 claim 5 , SEQ ID NO:36); 5′-GGGAGGACGAUGCGGUCUGCUGUGCUUGAUAUGCCCCAGACGACUCGCCC GAGCUGUCACAGAGGGGCUACUU-3′ (B3-Bcl-2 claim 5 , SEQ ID NO:37); 5′-GGGAGGACGAUGCGGCUGUCUACCUUCUACUGCCGCAGACGACUCGCCCGA GCUGUCACAGAGGGGCUACUU-3′ (C1-Bcl-2 claim 5 , SEQ ID NO:38); 5′-GGGAGGACGAUGCGGCGAUGCUUACGUGCACGCGCCAGACGAACUCGCCCG AGCUGUCACAGAGGGGCUACUU-3′ (C2-Bcl-2 claim 5 , SEQ ID NO:39); 5′- ...

Подробнее
Номер записи: 100