КОМПЬЮТЕРНЫЙ СПОСОБ ИДЕНТИФИКАЦИИ СОХРАНЕННЫХ КОНСЕРВАТИВНЫХ ПЕПТИДНЫХ МОТИВОВ

Изобретение относится к компьютерному способу идентификации пептидов, пригодных для использования в качестве мишеней для лекарственных средств. Сущность способа заключается в том, что создают библиотеки пептидов из белковых последовательностей различных организмов и осуществляют последующее сравнение для идентификации сохраненных консервативных пептидных мотивов, которые идентифицируют с помощью прямого сравнения последовательностей для различных бактериальных организмов и геномов хозяев без каких-либо предположений. Способ пригоден для идентификации возможных мишеней для лекарственных средств и может служить для скрининга антибактериальных лекарственных средств широкого спектра, а также для специфического диагноза инфекций, и в дополнение, для приписывания функций белкам с еще неизвестными функциями с помощью характеристик инвариантных пептидных мотивов. Преимущество изобретения заключается в ускорении способа идентификации пептидных мотивов. 3 с. и 8 з.п. ф-лы, 4 ил.

РЕАГЕНТНЫЕ МАТЕРИАЛЫ И СООТВЕТСТВУЮЩИЕ ТЕСТОВЫЕ ЭЛЕМЕНТЫ

Группа изобретений относится к области биохимии. Предложен тестовый элемент для определения гидроксибутирата и глюкозы, содержащий первый коферментзависимый фермент или субстрат для первого фермента (гидроксибутиратдегидрогеназу), второй коферментзависимый фермент или субстрат для второго фермента (глюкозодегидрогеназу или глюкозооксидазу), кофермент, выбранный из тио-NAD, тио-NADP и соединения формулы (I). Предложен реагентный материал для определения гидроксибутирата, содержащий 3-гидроксибутиратдегидрогеназу и кофермент, представляющий собой тио-NAD, тио-NADP, карба-NAD, карба-NADP. Предложен тестовый элемент, содержащий тест-полоску для электрохимического определения первого и второго аналитов, содержащую указанный первый реагентный материал для определения гидроксибутирата и второй реагентный материал для определения глюкозы. Предложен способ определения уровней глюкозы и кетонов в образце биологической жидкости организма с использованием вышеуказанных тестовых элементов. Группа изобретений ...

ИЗМЕРЕНИЕ И ИСПОЛЬЗОВАНИЕ МЕЖМОЛЕКУЛЯРНОГО ВЗАИМОДЕЙСТВИЯ

Изобретение относится к иммунобиохимии, в частности к способу определения аффинности партнеров по связыванию по отношению друг к другу или свойства одного из партнеров по связыванию, зависящего от аффинности. Способ содержит следующие этапы: приводят в контакт партнеров по связыванию, один из которых иммобилизирован на поверхности, сообщают поверхности колебательное движение с возрастающей амплитудой и регистрируют явление диссоциации. Аналогичный способ можно использовать для выделения искомого аналита из состава. Устройство для определения аффинности партнеров по связыванию по отношению друг к другу содержит поверхность, на которой иммобилизирован один из партнеров по связыванию, средство возбуждения колебательного движения поверхности с возрастающей амплитудой и средство регистрации явления диссоциации. Технический результат - расширение арсенала средств для определения взаимодействия, например, антигена и антитела. 3 с. и 24 з.п.ф-лы, 17 ил.

УСТРОЙСТВО ПРЕДСКАЗАНИЯ ВЗАИМОДЕЙСТВИЯ, СПОСОБ ПРЕДСКАЗАНИЯ ВЗАИМОДЕЙСТВИЯ И КОМПЬЮТЕРНЫЙ ПРОГРАММНЫЙ ПРОДУКТ

Группа изобретений относится к области предсказания биомолекулярного связывания. Предложен способ и устройство предсказания взаимодействия между соединением и протеином, и энергонезависимый материальный считываемый компьютером носитель данных. Устройство содержит блок хранения данных и блок управления. Блок хранения содержит блок хранения данных структуры соединений и блок хранения данных структуры протеинов. Блок управления содержит блок получения данных структуры соединения, блок получения данных структуры протеина, блок определения предсказанного протеина и блок определения силы взаимодействия. Способ включает этап получения данных структуры соединения, этап получения данных структуры протеина, этап определения предсказанного протеина и этап определения силы взаимодействия. Носитель данных содержит запрограммированные команды, выполненные с возможностью вызывать при их исполнении устройством предсказания взаимодействия. Изобретения обеспечивают возможность эффективно идентифицировать ...

СПОСОБ СОЗДАНИЯ БИОСЕНСОРА ДЛЯ ОПРЕДЕЛЕНИЯ ПАРОВ ФЕНОЛА В ВОЗДУХЕ

Изобретение относится к аналитической химии органических соединений и может быть применено для детектирования паров фенола в воздухе рабочей зоны. Способ создания биосенсора для определения паров фенола в воздухе включает приготовление модификатора, нанесение его на тензочувствительную область пьезорезонатора. Для приготовления модификатора используют смесь Тритона Х-100 и экстракта мицелия вешенки обыкновенной (Pleurotus ostreatus) в объемном соотношении 1:1, общая масса сорбента 10-15 мкг, масса навески мицелия вешенки 8-10 г, в качестве растворителя и экстрагента применяют ацетон. Изобретение позволяет повысить чувствительность биосенсора к парам фенола. 1 ил., 3 табл.

ИНКУБАТОР И СПОСОБ ИНКУБАЦИИ ПРОБ ВОДЫ

Группа изобретений относится к области инкубации проб воды. Предложен инкубатор для проб воды и способ инкубации проб воды. Инкубатор выполнен в виде объединения свето- и теплоизолированных ячеек. Каждая ячейка включает крышку, корпус, стакан, теплоизолированный от корпуса, устройство управления ячейки, индивидуальную систему стабилизации температуры и индивидуальную систему стабилизации освещенности. Индивидуальная система стабилизации освещенности содержит светодиод в нижней части стакана. Светодиод обеспечивает необходимый уровень засветки образца. Способ инкубации осуществляют в предложенном инкубаторе, условия по температуре и постоянной освещенности задаются индивидуально для каждой пробы. Изобретения позволяют осуществить инкубацию проб воды в индивидуальных условиях каждого образца. 2 н. и 2 з.п. ф-лы, 2 ил.

МАКРОЦИКЛИЧЕСКОЕ СОЕДИНЕНИЕ И СПОСОБ ИДЕНТИФИКАЦИИ АГЕНТА НА ЕГО ОСНОВЕ

Изобретение относится к новым макроциклическим соединениям формулы: где A, D, D1, G, Z, Z1, Е, X, Т, Q, Y, Y1, J, J1, U, U1 и n имеют значения, указанные в описании, обладающим противораковой и антимитотической (блокирующий митоз) активностью, а также к способу идентификации агентов, которые индуцируют продолжительный митотический блок в клетке после временного экспонирования этой клетки этим агентом. Технический результат - получение новых макроциклических соединений, проявляющих сильное противораковое действие. 2 н. и 19 з.п. ф-лы, 2 табл.

ОДНОРАЗОВЫЕ ЭЛЕКТРОХИМИЧЕСКИЕ ДАТЧИКИ

Изобретение относится к электрохимическим датчикам, используемым для детектирования и/или определения количества целевых аналитов в пробе. Технический результат изобретения: повышение точности измерений. Сущность: непрерывное полотно электрохимических датчиков, предназначенных для детектирования глюкозы в крови, содержит множество первых и вторых электродов, нанесенных методом трафаретной печати в виде линейной последовательности на непрерывный лист гибкого материала подложки, слой реагента, нанесенный методом трафаретной печати поверх упомянутого полотна так, что упомянутый реагент покрывает по меньшей мере один из первого и второго электродов каждой пары электродов, герметизирующий слой, расположенный поверх упомянутого слоя реагента и упомянутых электродов с образованием камеры приема пробы. 4 з.п. ф-лы, 8 ил.

СПОСОБ РАННЕЙ ДИАГНОСТИКИ ИНФЕКЦИЙ, ПЕРЕДАЮЩИХСЯ ПОЛОВЫМ ПУТЕМ, ВЫЗВАННЫХ УСЛОВНО-ПАТОГЕННОЙ МИКРОФЛОРОЙ

Способ ранней диагностики инфекций, передающихся половым путем, включает в себя взятие пробы из цервикального канала шейки матки коров после 50-60 дней после родов при подготовке к осеменению, посев на МПА с добавлением 5% эритроцитов барана, желточно-солевой агар, среду Эндо, Плоскирева, Энтерококкагар, Сабуро и на агар Цейсслера с инкубацией последней в анаэростате. Одновременно проводят посевы на жидкие, разлитые высоким столбиком в пробирки среды Бликфельдта и Бифидумсреду, сахарный бульон. Посевы выращивают при температуре 37°С, в оптимальные для каждого искомого микроорганизма сроки. Окрашивают мазки по Граму и проводят дальнейшую идентификацию выделенных культур микроорганизмов по общепринятым методикам. Способ позволяет проводить раннюю диагностику инфекций, передающихся половым путем, вызванных условно-патогенной микрофлорой, профилактировать аборты, заболевания репродуктивных органов и проводить своевременные профилактику и лечение. 2 табл.

СПОСОБ ИЗМЕРЕНИЯ КОНЦЕНТРАЦИИ АНАЛИЗИРУЕМОГО ВЕЩЕСТВА (ВАРИАНТЫ), ИЗМЕРИТЕЛЬНЫЙ ПРИБОР ДЛЯ ИЗМЕРЕНИЯ КОНЦЕНТРАЦИИ АНАЛИЗИРУЕМОГО ВЕЩЕСТВА

Изобретение относится к электрохимическим средствам для измерения концентрации анализируемого вещества в биологической жидкости. Сущность: Способ включает в себя подачу постоянного тока малой величины через зазор с одновременным контролем разности потенциалов между электродами. Время, когда проба замыкает зазор, отмечается резким падением потенциала. После обнаружения пробы прикладывают постоянное напряжение и контролируют ток и/или заряд, проходящий через пробу, в течение некоторого периода времени. По измеренному току или заряду вычисляют концентрацию анализируемого вещества. Также предложено устройство для измерения концентрации анализируемого вещества. Технический результат изобретения: повышение точности измерения особенно при малых концентрациях анализируемого вещества, снижение влияния шума, использование недорогих электронных элементов для измерения. 3 с. и 12 з.п. ф-лы, 6 ил.

СПОСОБЫ ПОЛУЧЕНИЯ И ПРИМЕНЕНИЯ МУЛЬТИПОТЕНТНЫХ КЛЕТОЧНЫХ ПОПУЛЯЦИЙ

Изобретение относится к области биотехнологии и клеточной технологии. Заявленное изобретение направлено на создание плюрипотентных, мультипотентных и/или самообновляющихся клеток, которые способны начать дифференцироваться в культуре в различные типы клеток и способны к дальнейшей дифференцировке in vivo. Заявленное изобретение также направлено на создание популяций требуемых дифференцирующихся клеток, которые можно пересадить пациентам, генетическую модификацию эндогенных клеток и лечение пациентов, страдающих заболеваниями, интенсивность которых можно уменьшить с помощью этих методов. Данное изобретение также предлагает способы предупреждения, лечения или замедления развития заболевания, связанного с инфекцией вирусом иммунодефицита. 4 н. и 13 з.п. ф-лы, 1 ил., 13 пр.

СПОСОБ ИССЛЕДОВАНИЯ ПОВЫШЕНИЯ АНТИБИОТИКОЧУВСТВИТЕЛЬНОСТИ УСЛОВНО-ПАТОГЕННОЙ МИКРОФЛОРЫ IN VITRO МОЛОЧНОКИСЛОЙ КОРМОВОЙ ДОБАВКОЙ, СОДЕРЖАЩЕЙ КУЛЬТУРУ МИКРООРГАНИЗМОВ STREPTOCOCCUS TERMOPHILUS TH-4

Изобретение относится к ветеринарной микробиологии и может быть использовано в лабораторной практике при изучении антибиотикочувствительности микроорганизмов. Способ исследования повышения антибиотикочувствительности условно-патогенной микрофлоры in vitro молочнокислой кормовой добавкой, содержащей культуру микроорганизмов Streptococcus termophilus ТН-4, включает использование супернатанта молочнокислой кормовой добавки, содержащей культуру микроорганизмов Streptococcus termophilus ТН-4, полученного в разные сроки культивирования - на 1, 10, 20 и 30 день, после чего к 0,5 мл среды МПБ добавляют 0,5 мл супернатанта молочнокислой кормовой добавки, далее вносят 0,5 мл МПБ суточной культуры одного из штаммов Е. fecalis 200, St. albus АТСС 25923, Е. coli АТСС 25222, Pr. vulgaris 192, Kl. pneumonia 71 условно-патогенной микрофлоры, полученный раствор инкубируют 18-24 ч при Т=37,0±0,5°С, затем проводят определение антибиотикочувствительности микроорганизмов дискодиффузионным методом на МПА с 24 ...

КОМПОЗИЦИЯ РЕАГЕНТОВ, РЕАГЕНТНАЯ ТЕСТ-ПОЛОСКА, СИСТЕМА, СПОСОБ И НАБОР ДЛЯ ОБНАРУЖЕНИЯ ИЛИ ОПРЕДЕЛЕНИЯ ПРИСУТСТВИЯ АНАЛИТА В ФИЗИОЛОГИЧЕСКОМ ОБРАЗЦЕ

Изобретение относится к области биотехнологии, конкретно к определению аналита в физиологическом образце, и может быть использовано в медицинских и диагностических целях. Систему, окисляющую аналит и генерирующую сигнал, включающую аналит-оксидазу и растворимую в воде соль тетразолия, которая способна к присоединению гидрид-иона с образованием растворимого в воде окрашенного соединения формазана, наносят на поверхность положительно заряженной подложки. Тест-полоски, наборы и системы с полученной композицией используют для обнаружения или определения присутствия аналита в физиологическом образце. Изобретение позволяет повысить достоверность определения присутствия аналита в физиологическом образце и упростить способы определения указанных аналитов. 5 н. и 4 з.п. ф-лы, 1 ил., 3 табл.

СПОСОБ ИЗГОТОВЛЕНИЯ СТЕРИЛИЗОВАННОГО И ТАРИРОВАННОГО МЕДИЦИНСКОГО УСТРОЙСТВА НА ОСНОВЕ БИОСЕНСОРА (ВАРИАНТЫ)

Изобретение относится к области изготовления медицинских устройств. Способ изготовления стерилизованного и тарированного медицинского устройства на основе биосенсора (например, медицинского устройства с объединенными в одно целое биосенсором и ланцетом), содержащее реагент биосенсора (например, реагент биосенсора из специфического фермента для анализируемого вещества и медиатора). Стерилизацию осуществляют, например, гамма-излучением. Затем тарируют реагент биосенсора стерилизованного медицинского устройства на основе биосенсора. Другой способ изготовления стерилизованного и тарированного медицинского устройства на основе биосенсора включает в себя вначале сборку и упаковывание множества медицинских устройств с реагентом биосенсора, затем стерилизацию облучением для создания множества стерилизованных, упакованных медицинских устройств на основе биосенсора. После этого тарируют стерилизованные и упакованные медицинские устройства на основе биосенсора. Тарирование можно выполнять, используя ...

ОПРЕДЕЛЕНИЕ ТРАНСФОРМИРУЮЩЕЙ СПОСОБНОСТИ АГЕНТОВ

Изобретение относится к области медицинской биотехнологии, в частности активации апоптин-индуцированного апоптоза различными агентами, вызывающими трансформацию клетки в нормальных и/или склонных к раковым заболеваниям клетках. Сущность изобретения состоит в следующем. Апоптин, или так называемый VP3, является вирусным белком, выделенным из вируса анемии цыплят. Также изобретение относится к профилактической противоопухолевой терапии нормальных и/или склонных к раковым заболеваниям клеток. Обработка нормальных и/или склонных к раковым заболеваниям клеток агентами, индуцирующими развитие опухоли, будет активировать апоптин-индуцированный апоптоз, приводя к уничтожению потенциальных опухолевых клеток. Также изобретение относится к диагностике агентов, вызывающих раковые заболевания. Агенты, обладающие опухолеродной активностью, могут быть исследованы путем их экспрессии в нормальных клетках и анализа их способности вызывать апоптин-индуцированный апоптоз. Технический результат - расширение ...

МИКРООРГАНИЗМЫ И КЛЕТКИ ДЛЯ ДИАГНОСТИКИ И ЛЕЧЕНИЯ ОПУХОЛЕЙ

Изобретение относится к области биотехнологии. Предложено применение аттенуированной бактерии Vibrio cholerae для получения фармацевтической композиции, предназначенной для лечения опухоли и/или элиминации метастатической опухоли у пациента. При этом бактерия содержит ДНК, кодирующую белок для лечения опухоли и/или элиминации метастатической опухоли, обладает способностью накапливаться в опухоли и распознается иммунной системой пациента. Также предложено применение штамма LIVP вируса коровьей оспы для тех же целей. Изобретение позволяет проводить мониторинг и лечение опухоли у пациента. Изобретение может быть использовано в медицине. 5 н. и 45 з.п. ф-лы, 14 ил., 6 табл.

Способ оценки биотропного проявления электромагнитного излучения сверхвысокой частоты, интегрированного под контроль гена dps

Изобретение относится к области биохимии. Описан способ оценки биотропного проявления электромагнитного излучения сверхвысокой частоты, интегрированного под контроль гена dps, согласно которому регуляторная область гена dps интегрируется в плазмиду рЕТ28b-EGFP перед геном репортерного белка GFP, клетки Е. Coli трансформируются полученной плазмидой; при этом увеличение интенсивности флуоресцентного излучения трансформированных бактериальных клеток, фиксируемое визуально, свидетельствует о повышенном уровне электромагнитного излучения СВЧ-диапазона, воздействующего на клетки. Полученные по данному способу результаты дают возможность использовать регуляторную область гена dps в биосенсорах, отслеживающих фоновый уровень электромагнитного излучения. Изобретение расширяет арсенал средств оценки биотропного проявления электромагнитного излучения. 2 ил.

СПОСОБ ОЦЕНКИ ЭФФЕКТИВНОСТИ ДЕЗИНФЕКТАНТОВ И АНТИСЕПТИКОВ

Изобретение относится к микробиологии. В способе используют цилиндры, установленные на плотную питательную среду, содержащую естественный нейтрализатор. Вносят в цилиндры исследуемый препарат и инокулюм. Экспозицию проводят 5 мин. Затем прибавляют искусственный нейтрализатор. После чего оценивают эффективность препаратов. Способ менее трудоемок и позволяет снизить расход компонентов, 2 табл.

СТРОБИРОВАННАЯ АМПЕРОМЕТРИЯ

Изобретение относится к области электрохимических методов анализа. Предложена система датчика, устройство и способы для определения концентрации анализируемого вещества в образце. Последовательности стробированных амперометрических импульсов, включающие в себя многочисленные рабочие циклы последовательных возбуждений и релаксаций, обеспечивают более короткое время анализа и/или улучшают точность и/или воспроизводимость анализа. Раскрытые последовательности стробированных амперометрических импульсов могут снижать погрешности анализа, являющиеся результатом гематокритного эффекта, изменения объемов цокольного зазора, неустановившихся режимов, медиаторного фона, недозаполнения, изменений температуры в образце и одиночного набора калибровочных констант. 6 н. и 24 з.п. ф-лы, 3 табл., 11 ил.

СПОСОБ ОПРЕДЕЛЕНИЯ ПОЛИМОРФИЗМА APAF1, АССОЦИИРОВАННОГО С ГАПЛОТИПОМ ФЕРТИЛЬНОСТИ ГОЛШТИНСКОГО СКОТА HH1

Изобретение относится к молекулярной генетике. Описан способ определения полиморфизма генов, ассоциированных с фертильностью крупного рогатого скота, а именно гена апоптотического протеаза-активирующего фактора 1 (APAF1), связанного с гаплотипом фертильности голштинского скота НН1. Способ включает ПЦР-ПДРФ определение полиморфизма C→T в позиции 63150400 (сборка генома UMD 3.1) гена APAF1. При этом амплификацию фрагмента гена, содержащего мутацию, проводят с использованием двух праймеров. В обратный праймер вводится нуклеотидная замена, приводящая к исключению неспецифического сайта рестрикции эндонуклеазы BstC8I, расположенного на расстоянии 10 п.о. «down stream» от места исследуемой мутации, с последующим рестрикционным гидролизом продуктов ПЦР эндонуклеазой BstC8I. Фрагменты меньшей длины, образующиеся в результате рестрикции, соответствуют аллелю Q, в то время как нерестрицированный фрагмент большей длины соответствует аллелю X. Идентификация генотипов животных осуществляется по результатам ...

СПОСОБ ОПРЕДЕЛЕНИЯ ОСТАТОЧНОЙ АКТИВНОСТИ СТРЕПТОМИЦИНА С ПОМОЩЬЮ СПОРОВО ТЕСТ-КУЛЬТУРЫ ШТАММА Bacillus anthracis Davies "R" БАЛ №31 StrD В ПИТАТЕЛЬНЫХ СРЕДАХ, БИОЛОГИЧЕСКИХ ТКАНЯХ И ЖИДКОСТЯХ

Изобретение относится к медицинской микробиологии. Предварительно получают на градиентные пластинки Str 25 мкг/мл споры авирулентного бесплазмидного штамма в трех вариантах а, b, c с различным уровнем стрептомицинзависимости, а затем с помощью этих вариантов определяются степени зависимости этих трех вариантов в исследуемом объекте, содержащем остаточную активность стрептомицина. Настоящее изобретение позволяет определять активность (концентрацию) стрептомицина в питательной среде в биологических тканях и жидкостях. 3 ил.

Микрофлюидный чип для распознавания бактерий в пищевых продуктах

Полезная модель относится к области пищевой промышленности и может быть использована для определения патогена Salmonella Typhimurium. Полезная модель представляет собой микрофлюидный чип с размером 50 мм×75 мм×5 мм, состоящий из трех отсеков: (1) камера смешивания исходных компонентов диаметром 8 мм, глубиной 3 мм; (2) змеевиковый канал для образования комплекса с Salmonella Typhimurium шириной 600 мкм, высотой 600 мкм и общей длиной 40 см, (3) многофункциональная камера диаметром 8 мм и глубиной 3 мм для магнитного разделения комплекса с Salmonella Typhimurium, промывки и катализа OPD/H2O2, с образованием желтого DAP, отличающегося тем, что в микрофлюидном чипе образуется комплекс MOF-Salmonella-MN при введении 80 мкл раствора MN-mAb (20 мкг) и 80 мкл раствора MOF-pAb (80 мкг), обладающего пероксидазоподобной активностью. Полезная модель обеспечивает визуальное обнаружение патогена Salmonella Typhimurium в пищевых продуктах в линейном диапазоне от 1,5×101 до 1,5×107 КОЕ/мл, с нижний пределом ...

СПОСОБ ОПРЕДЕЛЕНИЯ АНТИРАДИКАЛЬНОЙ АКТИВНОСТИ ВЕЩЕСТВ IN VITRO

Изобретение относится к области биотехнологии и может быть использовано для определения антирадикальной активности веществ по способности взаимодействия их с радикалами ОН. Определение величины константы скорости реакции вещества с радикалами ОН (kOH) проводят в условиях γ-облучения, в качестве эталона сравнения используют водный раствор р-нитрозодиметиланилина. Отбирают вещества с kOH выше (4-5)х109 л/моль·с. Затем определяют последовательно соотношения равноповреждающих доз при γ -облучении для трипсина, ДНК и эритроцитов в присутствии отобранного вещества и без него и оценивают антирадикальную активность исследуемого вещества путем сравнительного анализа. Изобретение позволяет количественно оценить антирадикальную активность БАВ, получить данные о свойствах вторичных радикалов БАВ, сопоставить антирадикальные и антиоксидантные эффекты БАВ и сделать достоверные выводы о свойствах исследуемых БАВ. 1 табл.

БИОЧИП ДЛЯ ИССЛЕДОВАНИЯ КЛЕТОК

... 1. Биочип для исследования клеток, содержащий подложку, на которой размещены тестовые участки с иммобилизованными молекулами веществ, способных связываться с поверхностными молекулами клеток, отличающийся тем, что подложка представляет собой капилляр, на внутренней поверхности стенки которого расположены тестовые участки. ! 2. Биочип по п.1, отличающийся тем, что капилляр состоит из секций, герметично соединяемых между собой. ! 3. Биочип по п.1, отличающийся тем, что снабжен приводящей трубкой. ! 4. Биочип по п.1, отличающийся тем, что снабжен отводящей трубкой. ! 5. Биочип по п.1, отличающийся тем, что капилляр имеет, по крайней мере, одну плоскую стенку, на которой расположены тестовые участки. ! 6. Биочип по п.1, отличающийся тем, что снабжен платформой, к которой крепится капилляр. ! 7. Биочип по п.6, отличающийся тем, что платформа является съемной. ! 8. Биочип по п.1, отличающийся тем, что содержит контрольный участок, обеспечивающий прочность связывания клеток, заведомо меньшую, ...

СПОСОБ ДИФФЕРЕНЦИАЦИИ ВОЗБУДИТЕЛЕЙ МЕЛИОИДОЗА И САПА МЕТОДОМ ИММУНОЭЛЕКТРОФОРЕЗА

Изобретение относится к биотехнологии. Ставят реакцию агглютинации иммунной сыворотки с клетками патогенных буркхольдерий. Для получения иммунной сыворотки используются внеклеточные (экстрацеллюлярные) антигены (ЭЦА) типичного штамма B.pseudomallei С141. ЭЦА получают из смыва бактериальной массы, выросшей на твердой питательной среде, покрытой целлофаном, освобожденной от клеток центрифугированием и фильтрацией. Затем проводят стерилизацию и отделение ЭЦА, бактериологический и биологический контроль стерильности. Для получения иммунной сыворотки ЭЦА в смеси с неполным адьювантом Фрейнда иммунизируют кроликов за два цикла. При титре не менее 1:32 кровь забирают и получают иммунную сыворотку. Иммуноэлектрофорез (ИЭФ) проводят в пластинах агарозы. В лунки вносят ЭЦА анализируемых штаммов B.mallei и B.pseudomallei, проводят ИЭФ. Затем в траншеи вносят антисыворотку против ЭЦА B.pseudomallei С141. Наличие линий преципитации в анодной и катодной областях геля указывает на наличие в геле антигенов ...

Устройство регистрации результатов ПЦР с монохроматором

Изобретение относится к устройству регистрации результатов полимеразной цепной реакции (ПЦР). Устройство регистрации результатов ПЦР содержит источник света (1) с широким спектром излучения, осветительный объектив (8), кювету (9) с образцами и систему регистрации. Между источником света (1) и осветительным объективом (8) установлен монохроматор, который обеспечивает освещение образцов монохроматическим светом возбуждения, а также возвращение флуоресцентного излучения в автоколлимационном ходе объективом (8) в выходную щель (7) монохроматора и его фокусировку в щель (10), которая находится в плоскости входной щели (3) монохроматора и отстоит от нее на величину линейной дисперсии монохроматора, соответствующей разности длин волн возбуждающего и флуоресцентного излучения. Устройство позволяет проводить ПЦР диагностику с использованием красителей, обладающих различными спектрами поглощения и флуоресценции, а также обеспечивает возможность перестройки длины волны возбуждающего излучения при ...

СПОСОБ МОДЕЛИРОВАНИЯ ФОРМИРОВАНИЯ УСТОЙЧИВОСТИ БАКТЕРИЙ К ДЕЗИНФИЦИРУЮЩЕМУ СРЕДСТВУ

Изобретение относится к биотехнологии и может быть использовано для моделирования формирования устойчивости бактерий к дезинфицирующему средству и для оценки бактерицидного действия дезинфицирующих средств. Способ предусматривает предварительный подбор концентрации раствора дезинфицирующего средства, при которой бактерии проявляют неполную чувствительность к данному средству. Воздействие на бактерии раствором дезинфицирующего средства при данной концентрации. Отбор выросших колоний бактерий после воздействия дезинфицирующего средства и высев их на твердую питательную среду с последующим культивированием при температуре 37°С. Отбор изолированных колоний бактерий из выросших на предыдущем этапе в количестве бактерий от 1 до 299 колониеобразующих единиц (КОЕ/мл). Отобранные, изолированные колонии бактерий пересевают на питательную среду и выращивают их при условиях, необходимых для роста бактерий данного вида с последующим разделением выращенных колоний на две части. На одну часть выращенных ...

СПОСОБ ОЦЕНКИ ЭФФЕКТИВНОСТИ ПЛЕНОЧНЫХ ПОКРЫТИЙ НА ОСНОВЕ ХИТОЗАНА С УЧЕТОМ ЧУВСТВИТЕЛЬНОСТИ МИКРООРГАНИЗМОВ И ГЛУБИНЫ ОЖОГОВОЙ РАНЫ В РАЗЛИЧНЫЕ ПЕРИОДЫ ОЖОГОВОЙ БОЛЕЗНИ

Для оценки эффективности пленочных покрытий при лечении ожоговых ран проводят определение чувствительности микроорганизмов к пленочным покрытиям на основе хитозана. Для этого определяют воздействие покрытия на раневую микрофлору путем инкубирования раневой микрофлоры и покрытия на питательной среде с агаром с последующей оценкой чувствительности микрофлоры к покрытию по отсутствию роста бактерий. Инкубацию проводят при 37°С в течение 24 часов. Определение чувствительности микроорганизмов проводят последовательно в каждый период ожоговой болезни, после чего производят замену покрытия на оцененное наиболее эффективным. Использование изобретения повышает точность определения эффективности пленочного покрытия на основе хитозана за счет определения чувствительности микроорганизмов, находящихся на поверхностях ожоговых и гранулирующих ран, в зависимости от особенностей течения раневого процесса, степени и глубины поражения.

НАБОР СИНТЕТИЧЕСКИХ ОЛИГОНУКЛЕОТИДОВ ДЛЯ ВЫЯВЛЕНИЯ ДНК ПАРОДОНТОПАТОГЕННОГО МИКРООРГАНИЗМА Prevotella intermedia МЕТОДОМ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления ДНК пародонтопатогенного микроорганизма Prevotella intermedia. Изобретение может быть использовано в медицине для диагностики заболеваний ротовой полости.

НАНОАГЕНТЫ ДЛЯ СКРИНИНГА ПАТОГЕННЫХ ШТАММОВ БАКТЕРИЙ С МНОЖЕСТВЕННОЙ ЛЕКАРСТВЕННОЙ УСТОЙЧИВОСТЬЮ И СПОСОБ ПОЛУЧЕНИЯ

Изобретение относится к биотехнологии и представляет собой наноагент для скрининга патогенных штаммов бактерий с множественной лекарственной устойчивостью, характеризующийся тем, что представляет собой конъюгат наночастицы золота с ферментом деполимеразой бактериофага или профага, иммобилизованным на поверхности наночастицы, отличающийся тем, что размеры наночастиц золота составляют от 20 нм до 32+4 нм, фермент представляет собой деполимеразу Dpo1053, кодируемую в геноме литического фага Аcinetobacter baumannii AP22, или фермент представляет собой деполимеразу Dpo1432, кодируемую в геноме литического фага Аcinetobacter baumannii vB_AbaP_AS12. Изобретение касается также способа получения такого наноагента для скрининга патогенных штаммов бактерий с множественной лекарственной устойчивостью, включающего стадии получения наночастиц золота, получения конъюгатов наночастиц золота с фаговым или профаговым ферментом деполимераза, характеризующегося иммобилизацией ферментов на поверхности наночастиц ...

СИНТЕТИЧЕСКИЕ ОЛИГОНУКЛЕОТИДНЫЕ ПРАЙМЕРЫ И СПОСОБ ВЫСОКОЧУВСТВИТЕЛЬНОГО ЭКСПРЕСС-ВЫЯВЛЕНИЯ ДНК ВИРУСА АФРИКАНСКОЙ ЧУМЫ СВИНЕЙ МЕТОДОМ ПЕТЛЕВОЙ ИЗОТЕРМИЧЕСКОЙ АМПЛИФИКАЦИИ В ПРИСУТСТВИИ ДНК ВНУТРЕННЕГО КОНТРОЛЬНОГО ОБРАЗЦА

Изобретение относится к области молекулярной диагностики. Описаны набор олигонуклеотидных праймеров и зонды для выявления ДНК вируса африканской чумы свиней (АЧС) и ДНК бактериофага лямбда как внутреннего контрольного образца исследования. Также предложен способ выявления ДНК вируса АЧС из биологического материала с использованием набора олигонуклеотидных праймеров и зондов с помощью петлевой изотермической амплификации (LAMP) в присутствии внутреннего контрольного образца ДНК бактериофага лямбда. Технический результат заключается в разработке высокочувствительного, специфичного и быстрого метода выявления вируса африканской чумы свиней. 2 н. и 1 з.п. ф-лы, 2 ил., 6 табл., 3 пр.

Селективная питательная среда для выделения аэромонад из водных объектов

Изобретение относится к области биотехнологии. Изобретение представляет собой питательную селективную среду для выделения аэромонад из водных объектов, которая содержит пептон, экстракт кормовых дрожжей, аргинин, калий фосфорнокислый однозамещенный, сульфат магния, хлорид натрия, дезоксихолат, гидроксид натрия, бромтимоловый синий, тимоловый синий, ампициллин и воду дистиллированную. Изобретение позволяет повысить накопительные и селективные свойства для выделения аэромонад из водных объектов. 5 табл.

Иммуноферментная тест-система для выявления антител к BLV в сыворотке крови, молоке крупного рогатого скота

Изобретение относится к области биотехнологии и ветеринарии. Описаны иммуноферментная тест-система и способ ее применения. Тест-система содержит набор реагентов: Иммуносорбент, Конъюгат-1, Конъюгат-2, РРК-1, РРК-2, К+, К-, ПР, Стоп-реагент и ТМБ-субстратный раствор. Изобретение может быть использовано для качественного выявления суммарных антител к вирусу лейкоза крупного рогатого скота (BLV) в индивидуальных или сборных образцах сыворотки крови и индивидуальных образцах молока крупного рогатого скота (КРС). Технический результат заключается в повышении чувствительности выявления антител к BLV за счет использования «сэндвич» формата ИФА с биотин-стрептавидин системой и выявления всех классов антител к 11 известным генотипам BLV. 2 н. и 1 з.п. ф-лы, 1 ил., 7 табл., 2 пр.

СПОСОБ ОПРЕДЕЛЕНИЯ ЦИТОТОКСИЧНОСТИ АНТИГЕНОВ Burkholderia pseudomallei in vitro

Способ предусматривает использование клеточной модели для оценки токсичности антигенов В. pseudomallei - возбудителя мелиоидоза in vitro. Реакцию цитотоксичности выполняют на перевиваемых монослойных клеточных линиях мышиных фибробластов L929 или клеток яичника китайского хомячка СНО-К1. До начала экспериментов клетки выводят из криоконсервированного состояния, параллельно готовят исследуемые антигены, изолированные из различных структурных компонентов бактериальной клетки возбудителя мелиоидоза, с рН 7,0±0,1, стерилизуют их через мембранные фильтры и вносят по 20 мкл в лунки подготовленных к основным опытам в 48-луночных культуральных пластинах со сформированным монослоем клеток-мишеней, оставляя на каждой пластине по 2 лунки с интактной культурой (контроль). Пластину инкубируют в СО2-инкубаторе при 37°С и насыщении атмосферы 5-7% СО2 в течение 3 суток. Лунки культуральных пластин ежедневно просматривают, оценивая наличие или отсутствие изменений морфологии и функционального состояния ...

СПОСОБ ОЦЕНКИ МИКРОБНОГО РИСКА ВОЗНИКНОВЕНИЯ БАКТЕРИАЛЬНЫХ КИШЕЧНЫХ ИНФЕКЦИЙ, ПЕРЕДАВАЕМЫХ ВОДНЫМ ПУТЕМ ПРИ НЕПОСРЕДСТВЕННОМ ВЫДЕЛЕНИИ ВОЗБУДИТЕЛЯ ОСТРЫХ КИШЕЧНЫХ ИНФЕКЦИЙ ИЗ ВОДЫ РАЗЛИЧНОГО НАЗНАЧЕНИЯ

Изобретение относится к области медицины, а именно к эпидемиологической оценке вод различного назначения. Сущность способа состоит в том, что проводят бактериологический анализ воды по нормируемым показателям с определением патогенных бактерий и дополнительно при анализе воды определяют потенциально-патогенные бактерии и их патогенные и вирулентные свойства, по полученным данным проводят оценку вероятности возникновения у человека инфекционного процесса по формуле: Hpatogen=(C·(100-Pt)·V·v/r)·T. Затем проводят расчет интегрального показателя вероятности возникновения бактериальных кишечных инфекций, передаваемых водным путем при непосредственном выделении возбудителей, выделенных и идентифицированных при проведении микробиологического анализа воды по формуле: ! Далее осуществляют оценку риска возникновения бактериальных кишечных инфекций, распространяющихся водным путем, считают приемлемыми, если его значение не превышает 1×10-5, при этом микробный риск возникновения бактериальных кишечных ...

СПОСОБ ОПРЕДЕЛЕНИЯ ЭЛЕКТРОНОНАСЫЩЕННОГО АРОМАТИЧЕСКОГО АМИНА, ЯВЛЯЮЩЕГОСЯ МАРКЕРОМ СОДЕРЖАНИЯ АНАЛИТА В БИОЛОГИЧЕСКОЙ ЖИДКОСТИ, И СРЕДСТВО ДЛЯ ЕГО ОСУЩЕСТВЛЕНИЯ

Использование: в медицине, для определения аналита при помощи образования гетерополисинего. Сущность: аналит превращают с веществом, которое приводит к электрононасыщенному амину, который вступает в контакт с труднорастворимой солью гетерополикислоты. Средство для осуществления способа содержит труднорастворимую соль гетерополикислоты в количестве, достаточном для перевода всего амина в гетерополисиний. 2 с и 2 з. п. ф-лы, 7 ил., 4 табл.

ШТАММ БАКТЕРИЙ KLEBSIELLA PNEUMONIAE, ИСПОЛЬЗУЕМЫЙ В КАЧЕСТВЕ РЕФЕРЕНС-ШТАММА ПРИ ОПРЕДЕЛЕНИИ ИНТЕНСИВНОСТИ ДЫХАНИЯ МИКРООРГАНИЗМОВ

Использование: медицинская микробиология, референс-штамм, определение интенсивности дыхания, энтеробактерии. Сущность изобретения: штамм Klebsiella pneumoniae ГИСК N 216 обладает стабильной способностью к интенсивности дыхания, приобретая ярко-красное окрашивание колоний. Интенсивность дыхания штамма определяют путем посева бляшками на плотную питательную среду, содержащую конго-рот, последующих инкубаций при 37oC в течение 18 - 24 ч и учета. Ярко-красное окрашивание бляшек и прилегающей зоны свидетельствует о наличии искомого признака. 4 пр. 3 табл.

СПОСОБ ОПРЕДЕЛЕНИЯ СПОСОБНОСТИ МИКРООРГАНИЗМОВ ФОРМИРОВАТЬ БИОПЛЕНКИ НА ПОВЕРХНОСТИ ТВЕРДОЙ ФАЗЫ

Изобретение относится к боихимии и касается способов определения способности микроорганизмов формировать биопленки на поверхности твердой фазы, что имеет большое значение в урологии для лечения мочекаменной болезни. Для получения объективных данных о способности микроорганизмов формировать биопленки на поверхности биологических субстратов в качестве твердой фазы использовали предварительно измельченные и простерилизованные натуральные почечные камни. В процессе культивирования бактерии адгезировались к поверхности почечных камней и формировали на них биопленки разной интенсивности. После культивирования осуществляют окрашивание сформировавшихся биопленок красителем с последующим экстрагированием связавшегося с биопленками красителя этиловым спиртом и оценкой интенсивности окрашивания спиртового раствора на фотометре. Изобретение позволяет повысить эффективность определения способности микроорганизмов формировать биопленки. 2 ил., 2 пр.

СПОСОБ ИЗМЕРЕНИЯ АКТИВНОСТИ МОЛОКОСВЕРТЫВАЮЩИХ ФЕРМЕНТОВ

Использование: в молочной, мясной и биотехнологической промышленности при контроле качества ферментных препаратов. Сущность изобретения: субстрат сухой стандартизированный растворяют в дистиллированной воде с концентрацией сухих веществ 11,1±1,0% при pH 6,5±0,1 и температуре 35,0±0,5oC. Полученный раствор свертывают раствором стандартного образца сычужного фермента или пепсина, или их смесевых композиций и раствором аналогичного по составу испытуемого ферментного препарата. Время свертывания сравнивают. 2 таб.

Способ определения уровня биосовместимости штаммов бифидобактерий и/или лактобактерий

Изобретение относится к биотехнологии. Предложен способ определения уровня биосовместимости штаммов бифидобактерий и/или лактобактерий. Способ включает раздельное выращивание штаммов на жидкой среде и соинкубирование их супернатантов в отдельности с взвесью клеток тест-штамма Bifidobacterium lognum МС-42. Отмытые клетки тест-штамма культивируют в питательном бульоне, отделяют супернатант, в котором затем культивируют соинкубированный ранее штамм, предварительно выращенный на плотной питательной среде, определяют его ростовые свойства, антилизоцимную активность, биопленкообразование. Рассчитывают уровень биосовместимости штаммов – В, (%) по формуле:, где РСо и РСk - ростовые свойства штаммов в опыте и контроле, ед. ОП; БПОо и БПОk – биопленкообразование, ед. ОП; АЛАо и АЛАk - антилизоцимная активность, мкг/мл*ОП. При значении В, равном либо более 50%, биосовместимость штаммов бифидобактерий и/или лактобактерий считают высокой. Способ позволяет определить уровень биосовместимости штаммов ...

СПОСОБ ПОЛУЧЕНИЯ ЛЕКАРСТВЕННОГО СРЕДСТВА КОЛЛАЛИЗИН&αχιρχ;, ЛИОФИЛИЗАТА ДЛЯ ПРИГОТОВЛЕНИЯ РАСТВОРА ДЛЯ МЕСТНОГО И ПАРЕНТЕРАЛЬНОГО ПРИМЕНЕНИЯ ДЛЯ ЛЕЧЕНИЯ ФИБРОПРОЛИФЕРАТИВНЫХ ЗАБОЛЕВАНИЙ

Изобретение относится к биотехнологии и медицине, в частности к промышленной технологии получения ферментного препарата Коллализин® для использования в медицинских целях. Способ получения Коллализина® путем культивирования продуцента Clostridium histolyticum в анаэробных условиях на питательной среде Рамона с последующим отделением микробной массы путем фильтрации, при этом для культивирования используют продуцент Clostridium histolyticum 468 или продуцент Clostridium histolyticum SK В-8362, а отделение микробной массы проводят с помощью каскада глубинных фильтров с диаметром пор от 3,0-0,8 до 0,3-0,1 мкм с исключением попадания культуры в нативный раствор, применяя номинальную и абсолютную стерилизующую фильтрацию нативного раствора с дальнейшей ультрафильтрацией, концентрированием и хроматографической очисткой на основе сорбента Sephacryl S-100. Применение Коллализина® для лечения фибропролиферативных заболеваний. Вышеописанный способ получения позволяет получить препарат, обладающий ...

Способ определения степени раздражающего действия дезинфекционных средств на кожу человека

Изобретение относится к области биотехнологии. Изобретение представляет собой способ определения степени раздражающего действия дезинфекционных средств на кожу человека, заключающийся в том, что культуру клеток Chang conjunctiva рассеивают на 96-луночную панель по 100 мкл в каждую лунку в концентрации 1×10клеток/мл в питательной среде Игла-MEM с 10% эмбриональной телячьей сывороткой (ЭТС). Для формирования монослоя клеток панель инкубируют в термостате в атмосфере 5% СОпри температуре 37°С в течение 24 часов. После инкубации культуральную среду меняют на среду, содержащую 2% ЭТС по 100 мкл в каждую лунку. Затем образцы дезинфекционных средств (ДС) раститровывают непосредственно в лунках с клетками Chang conjunctiva методом двукратных серийных разведений в трех повторах на точку, оставляя три контрольные лунки с монослоем клеток свободными от внесения ДС. Панель помещают в термостат, инкубируют в атмосфере 5% СОпри температуре 37°С в течение 24 часов. После инкубирования КС из лунок удаляют ...

Способ изготовления матричного биосенсора на основе восстановленного оксида графена и матричный биосенсор на полимерной подложке

Использование: для проведения исследований в области биотехнологий. Сущность изобретения заключается в том, что изготовление матричного биологического сенсора на основе восстановленного оксида графена включает формирование на полимерной подложке пленки оксида графена, локальную модификацию оксид-графеновой пленки по заданному рисунку с образованием нескольких проводящих каналов и иммобилизацию на модифицированной оксид-графеновой пленке биомолекул, обеспечивающих избирательное взаимодействие с другими биологическими агентами. При этом формирование пленки оксида графена проводится с помощью жидкостных методов нанесения. Локальную модификацию оксид-графеновой пленки с заданным топологическим рисунком осуществляют путем неполного восстановления области с данным рисунком с дальнейшим удалением невосстановленной пленки с целью улучшения адгезии защитной полимерной пленки. Полученную заготовку биологического сенсора покрывают защитной полимерной пленкой за исключением областей контактов и отверстий ...

Способ культивирования почвенного микробного сообщества

Изобретение относится к области биотехнологии. Изобретение представляет собой способ культивирования почвенного микробного сообщества, характеризующийся следующей последовательностью действий: твердую олиготрофную питательную среду с низкой концентрацией источников углерода стерилизуют в автоклаве для удаления всех чужеродных микроорганизмов, затем продолжают нагревать в автоклаве и при достижении средой температуры 50-60°С в нее асептически вносят антимикотик в количестве равном 1 мл/л среды, представляющий собой 4%-ный раствор амфотерицина в диметилсульфоксиде, или 3%-ный раствор флюконазола в диметилсульфоксиде. После внесения антимикотика питательную среду разливают в стерильные чашки Петри и сушат до полного высыхания поверхности среды,) затем поверхность твёрдой питательной среды заражают аликвотой разведения почвенного материала в воде в соотношении 1:10000 и равномерно распределяют её по поверхности до полного впитывания аликвоты в толщу среды. После заражения чашки Петри с питательной ...

СПОСОБ ОПРЕДЕЛЕНИЯ ЦИТОКИНОВОГО СТАТУСА ЧЕЛОВЕКА НА ГЕНЕТИЧЕСКОМ УРОВНЕ

... 1. Полуколичественный способ оценки уровней траскрипционной активности генов в биологических системах путем определения информационных РНК (иРНК) цитокинов на основе сочетания методов обратная транскрипция - полимеразная цепная реакция с блот- и дот-гибридизацией, отличающийся тем, что для выявления изменений в цитокиновом статусе исследуют спектр интерферон (ИФ)-зависимых и пролиферативных иРНК цитокинов: интерферонов (альфа-2, бета-1 и гамма-), ИФ-регулируемых ферментов: 2', 5'-олигоаденилатсинтетазы (2,5-ОАС), РНК-азы L, двухспиральная РНК-протеинкиназы (дсПК), факторов клеточной пролиферации: протоонкогена Всl-2, Fas-антигена (Fas-АГ) и белка цитоскелета - гамма-актина, с помощью синтетических олигонуклеотидов, выбранных из набора (группы), состоящего: из 2-х праймеров из 21 звена с нуклеотидной последовательностью GGCCTTGATACTCCTGGCACA и АGGCАCААGGGCTGTATTTCT и гибридизационного зонда из 21 звена с нуклеотидной последовательностью GAGCCTTCTGGAACTGGTTGC, взаимодействующих с иРНК альфа ...

УСТРОЙСТВО ДОСТАВКИ И АНАЛИЗА БИОЛОГИЧЕСКИХ ПРОБ И СПОСОБ ЕГО ИЗГОТОВЛЕНИЯ

... 1. Устройство доставки и анализа биологических проб, состоящее из матрицы в виде плоскопараллельной пластины со сквозными отверстиями и устройство доставки с каналами транспортирования, отличающееся тем, что устройство доставки выполнено в виде монолитного усеченного конуса с внутренними сквозными отверстиями от основания к вершине, при этом входы отверстий на пластине и выходы отверстий на вершине усеченного конуса устройства доставки совпадают при совмещении, причем отверстия на пластине, и на устройстве доставки расположены отдельными группами, разделенными друг от друга по замкнутому периметру сплошными стенками с плоскими поверхностями на торцах пластины, а также на основании и вершине усеченного конуса устройства доставки, при этом плоские торцевые поверхности разделительных стенок вокруг групп выходных отверстий на вершине конуса и вокруг групп входных отверстий на пластине совпадают при совмещении отверстий и тем самым изолируют отдельные группы отверстий друг от друга. 2. Устройство ...

МЕТОД АНАЛИЗА СПОСОБНОСТИ СОЕДИНЕНИЙ ИЛИ СРЕДСТВ СНИЖАТЬ АКТИВНОСТЬ МИКРОСОМАЛЬНОЙ ПРОСТАГЛАНДИН-E-СИНТАЗЫ ИЛИ ГЕМАТОПОЭТИЧЕСКОЙ ПРОСТАГЛАНДИН-D-СИНТАЗЫ

... 1. Способ определения способности соединения или средства снижать активность простагландин-синтазы, выбранной из группы, состоящей из микросомальной простагландин-Е-синтазы (mPGES) и гематопоэтической простагландин-D-синтазы (hPGDS), в реакции с субстратом с образованием конечного простагландина, включающий следующие стадии: (a) перемешивание простагландин-синтазы с субстратом, кофактором и соединением или средством; (б) инкубирование смеси, полученной на стадии (a), с останавливающим раствором, который содержит средство, препятствующее спонтанному превращению субстрата в конечный простагландин; (в) инкубирование смеси, полученной на стадии (б), с детектирующим реагентом, содержащим конечный простагландин, помеченный флуоресцентной меткой, и антитело, для которого конечный простагландин является иммуногеном; (г) облучение смеси, полученной на стадии (в), и контрольной смеси плоскополяризованным светом с длиной волны возбуждения флуоресцентной метки и измерение поляризации флуоресценции ...

УЛУЧШЕННЫЕ МУТЕИНЫ ИНТЕРЛЕЙКИНА-2

... 1. Выделенная молекула нуклеиновой кислоты, содержащая нуклеотидную последовательность, выбранную из группы, состоящей изa) нуклеотидной последовательности, кодирующей мутеин человеческого IL-2, причем указанный мутеин включает в себя аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302 ...

СПОСОБ ОПРЕДЕЛЕНИЯ ВЛИЯНИЯ ВАГИНАЛЬНЫХ ЭПИТЕЛИОЦИТОВ НА БИОЛОГИЧЕСКИЕ СВОЙСТВА БАКТЕРИЙ (ВАРИАНТЫ)

... 1. Способ определения влияния вагинальных эпителиоцитов на биологические свойства бактерий, заключающийся в том, что получают вагинальные эпителиоциты, освобождают их от сопутствующей микрофлоры, инкубируют и отделяют супернатант, из суточной культуры исследуемых бактерий готовят микробную взвесь и смешивают ее с эпителиальным супернатантом, параллельно готовят контроль из взвеси исследуемых бактерий и среды для культивирования эпителиоцитов, инкубируют, измеряют биологические свойства бактерий в опытной и контрольной пробах, рассчитывают степень изменения биологических свойств в опытной пробе по отношению к контрольной и по степени изменения судят о стимулирующем, индифферентном или подавляющем влиянии эпителиоцитов на биологические свойства бактерий. ! 2. Способ определения влияния вагинальных эпителиоцитов на биологические свойства бактерий, заключающийся в том, что получают вагинальные эпителиоциты, инактивируют их формалином, отмывают и готовят взвесь эпителиоцитов в физиологическом ...

СПОСОБЫ НАХОЖДЕНИЯ ЛИГАНДОВ

... 1. Конъюгат мишень-соединение, выбранный из где означает мишень, R и R' каждый независимо означает незамещенную (С1-С20)алифатическую группу, замещенную (С1-С20)алифатическую группу, незамещенный арил или замещенный арил; m означает 0, 1 или 2; и n означает 1 или 2. 2. Конъюгат мишень-соединение по п.1, где мишенью является полипептид. 3. Конъюгат мишень-соединение по п.2, где ковалентная связь между группой -S-S-и мишенью обратима. 4. Конъюгат мишень-соединение по п.2, где ковалентная связь между группой -S-S-и мишенью необратима. 5. Конъюгат мишень-соединение по п.2, где мишень выбирается из группы, состоящей из ферментов, рецепторов, факторов транскрипции, лигандов рецепторов, факторов роста, цитокинов, иммуноглобулинов, ядерных белков, компонентов трансдукции сигнала и аллостерических регуляторных ферментов. 6. Библиотека соединений, где каждый член имеет формулу, выбранную из группы, состоящей из где R и R' каждый независимо означает незамещенную (С1-С20)алифатическую группу, замещенную ...

СПОСОБ ИНДИКАЦИИ БАКТЕРИАЛЬНЫХ АНТИГЕНОВ

Изобретение относится к иммунологии и может быть использовано для экспрессной индикаций бактериальных средств при возникновение чрезвычайных ситуаций. Целью изобретения является обеспечение экспрессной диагностики бактериальных антигенов за счет ускорения учета реакции агломерации и повышения точности ее результатов. Это достигается тем, что исследуемый материал смешивают с иммуносуспензионным диагностикумом, например, на основе латексных частиц, эритроцитов в разводящей жидкости и через ее слой высотой 1,0 - 2,0 мм пропускают лазерный луч денситометра результаты агломерации учитывают через 1 - 2 мин по увеличению пиков оптической плотности относительно базовой линии в 2 - 4 раза.

СПОСОБ МОДЕЛИРОВАНИЯ ЛЕПРОЗНОЙ ИНФЕКЦИИ

Изобретение относится к медицине, а именно к лепрологии и может быть использовано для моделирования лепрозной инфекции на лабораторных животных. Целью предлагаемого изобретения является ускорение размножения микобактерий лепры. Поставленная цель достигается в изобретении тем, что за 1-2 ч до интраплантарного заражения мышей взвесью микобактерий лепры, пассируемых от человека на мышах, в лапу мыши вводят раствор перекиси водорода в объеме 0,03-0,05 мл на мышь.

СПОСОБ ПРОГНОЗИРОВАНИЯ ФОРМИРОВАНИЯ НЕСТАБИЛЬНЫХ АТЕРОСКЛЕРОТИЧЕСКИХ ПОРАЖЕНИЙ

Способ прогнозирования риска формирования нестабильных атеросклеротических поражений, предусматривающий анализ ДНК субъекта на наличие двух значимых для формирования нестабильных атеросклеротических поражений полиморфизмов, одним из которых является полиморфизм С1019Т гена коннексина-37 (Сх37), определение генотипа по каждому из исследуемых полиморфных сайтов и составление заключения о вероятности формирования нестабильных атеросклеротических поражений и развития ишемии миокарда и головного мозга на основании установленной комбинации генотипов, и отличающийся тем, что вторым анализируемым полиморфизмом является полиморфизм G894T гена eNOS, причем выявление гомозиготного генотипа GG по данному полиморфизму в комбинации с гомозиготным генотипом ТТ по полиморфизму С1019Т гена Сх37 служит основанием для заключения о высокой степени риска формирования нестабильных атеросклеротических поражений.

ЛЮМИНЕСЦЕНТНОЕ ТРАНСГЕННОЕ ЖИВОТНОЕ, НЕ ОТНОСЯЩЕЕСЯ К ЧЕЛОВЕЧЕСКОМУ РОДУ, ПОТОМСТВО, ПРОИЗВОДНЫЕ КЛЕТОК И ИХ ПРИМЕНЕНИЕ

... 1. Трансгенное животное, не принадлежащее к человеческому роду, потомство и производные клеток, способные экспрессировать ген апофотопротеина и продуцировать биолюминесцентный сигнал в ответ на изменения внутриклеточной концентрации кальция. ! 2. Трансгенное животное, не принадлежащее к человеческому роду, потомство и производные клеток по п.1, в котором экспрессия гена апофотопротеина и/или продукция люминесцентного сигнала в ответ на изменения внутриклеточной концентрации кальция являются универсальными. ! 3. Трансгенное животное, не принадлежащее к человеческому роду, потомство и производные клеток по п.1, в котором экспрессия гена апофотопротеина и/или продукция люминесцентного сигнала в ответ на изменения внутриклеточной концентрации кальция являются индуцируемыми и/или специфичными для органа, ткани, типа клеток или стадии развития. ! 4. Трансгенное животное, не принадлежащее к человеческому роду, потомство и производные клеток по любому из предшествующих пунктов, где животное является ...

СПОСОБ АКТИВАЦИИ РОСТА КЛЕТОЧНЫХ ЛИНИЙ

... 1. Способ активации роста клеточных линий, заключающийся в физической обработке культуры клеток в питательной среде в течение определенного времени с определенной интенсивностью, отличающийся тем, что обработку осуществляют акустическим звуком интенсивностью 20-60 дБ с определенной частотой в течение 10 мин. ! 2. Способ по п.1, где в качестве частоты активации предлагается 50 Гц для клеток печени человека и 2000 Гц для клеток почек свиньи.

МОНИТОРИНГ СМЕСЕЙ ФЕРМЕНТОВ

... 1. Способ одновременного обнаружения присутствия или отсутствия, по меньшей мере, двух ферментов в пробе, который включает стадии: ! (1) воздействие пробы на первый субстрат для первого фермента, причем указанный первый субстрат мечен первым флуорофором, и второй субстрат для второго фермента, причем второй субстрат мечен вторым флуорофором, способствующее взаимодействию первого и второго ферментов, присутствующих в пробе, в случае присутствия, с соответствующими первым и вторым меченными флуорофором субстратами с целью образования соответствующих фрагментов первого и второго меченных флуорофором субстратов; ! (11) обнаружение присутствия указанных фрагментов меченных флуорофором субстратов. ! 2. Способ по п.1, отличающийся тем, что для обнаружения уровней, по меньшей мере, двух содержащихся в воздухе ферментов включает этапы: ! (1) до воздействия пробы на субстраты получение первой пробы атмосферного воздуха; и ! (11) улавливание любых частиц ферментов, которые присутствуют в первой пробе ...

ПРОСТОЙ СПОСОБ ОПРЕДЕЛЕНИЯ СУММАРНОЙ ФИТОТОКСИЧНОСТИ КОМПЛЕКСА МИКРОСКОПИЧЕСКИХ ГРИБОВ ПОЧВЫ

Способ определения суммарной фитотоксичности комплекса микроскопических грибов почвы, включающий выделение грибов на среду Чапека и определение их фитотоксичности при помощи тест-культуры путем учета величины прироста ее корней, отличающийся тем, что агаровую пластину с выделенными при инкубации посева в течение 14 сут грибами переворачивают и на обратной стороне пластины размещают проростки семян испытываемой культуры на 24 ч.

ДЕМПФЕР ВЕРТИКАЛЬНОГО РОТОРА

... 1. Система для измерения уровня анализируемого вещества, содержащая тест-полоску, имеющую средство для измерения уровня анализируемого вещества электрохимическим способом, и хрупкое соединение, расположенное на указанной тест-полоске. 2. Система для измерения уровня анализируемого вещества по п.1, в которой указанное хрупкое соединение содержит токопроводящую дорожку. 3. Система для измерения уровня анализируемого вещества по п.2, в которой указанная токопроводящая дорожка является материалом, выбранным из группы, состоящей из углерода, серебра, платины, палладия, золота, Ir, Pt, вольфрама, железа и алюминия. 4. Система для измерения уровня анализируемого вещества по п.1, в которой указанная токопроводящая дорожка обладает положительным температурным коэффициентом сопротивления. 5. Система для измерения уровня анализируемого вещества по п.2, в которой указанная токопроводящая дорожка содержит первую зону электрического контакта и вторую зону электрического контакта, каждая из которых приспособлена ...

СПОСОБ ОПРЕДЕЛЕНИЯ НАЛИЧИЯ МИКРООРГАНИЗМОВ, ОБРАЗУЮЩИХ БИОПЛЕНКУ, В БУМАЖНОЙ ПРОМЫШЛЕННОСТИ

... 1. Способ обнаружения наличия образующих биопленку микроорганизмов в процессе производства бумаги или картона для определения потребности в добавлении в процесс агента, противодействующего образованию биопленки, характеризующийся наличием следующих стадий: (а) помещение устройства для отбора проб в технологическую линию на период времени, достаточный для того, чтобы микроорганизмы образовали биопленку in situ на поверхности устройства для отбора проб в производственном процессе, (б) обработка поверхности устройства для отбора проб с образовавшейся на ней биопленкой раствором испытываемого агента, противодействующего образованию биопленки, в течение определенного периода времени, (в) приведение поверхности устройства для отбора проб с находящейся на ней биопленкой в контакт с жидкой культуральной средой, находящейся в углублении устройства для культивирования микроорганизмов, на определенный период времени, (г) удаление культуральной среды и поверхности устройства для отбора проб из углубления ...

СПОСОБ ДЕТЕКЦИИ БАКТЕРИЙ РОДА YERSINIA И ДИФФЕРЕНЦИАЦИИ ПАТОГЕННЫХ ДЛЯ ЧЕЛОВЕКА ВИДОВ ИЕРСИНИЙ МЕТОДОМ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ (ПЦР), ОЛИГОНУКЛЕОТИДНЫЕ ПРАЙМЕРЫ И НАБОР РЕАГЕНТОВ ДЛЯ ЕГО ОСУЩЕСТВЛЕНИЯ

... 1. Способ детекции бактерий рода Yersinia и дифференциации патогенных для человека видов иерсиний методом полимеразной цепной реакции, заключающийся в том, что детекцию иерсиний осуществляют путем амплификации участка гена OmpF порина с помощью пары смыслового и антисмыслового родоспецифичных праймеров, направленных к нуклеотидным последовательностям, кодирующим пептиды RLGFAGLK и WNVGAKYDA, идентификацию патогенных видов иерсиний осуществляют путем а) амплификации участка гена OmpF порина Y.pestis с помощью смыслового родоспецифичного и антисмыслового видоспецифичного с нуклеотидной последовательностью, кодирующей пептид TIANGLNT, праймеров, б) амплификации участка гена OmpF порина Y.pseudotuberculosis с помощью пары праймеров: смыслового родоспецифичного праймера, обладающего гомологией на 80-100% с нуклеотидной последовательностью, кодирующей пептид RLGFAGLK, и антисмыслового видоспецифичного праймера, обладающего гомологией на 95-100% с нуклеотидной последовательностью, кодирующей пептид ...

Способ генотипирования полиморфного локуса rs111837807 (T>C) гена CCHCR1 у человека методом ПЦР в режиме "реального времени" с применением аллель-специфических флуоресцентных зондов

Изобретение относится к области биотехнологии, молекулярно-генетической диагностики. Представлен способ генотипирования полиморфного локуса rs111837807 (T>C) гена CCHCR1 у человека методом ПЦР в режиме ''реального времени'' с применением аллель-специфических флуоресцентных зондов, отличающийся тем, что идентификацию аллельных вариантов rs111837807 (T>C) гена CCHCR1 осуществляют с использованием прямого праймера c SEQ ID NO 1, обратного праймера c SEQ ID NO 2, Т-аллель-специфичного флуоресцентно-меченого зонда c SEQ ID NO 3, С-аллель-специфичного флуоресцентно-меченого зонда c SEQ ID NO 4. Изобретение позволяет расширить арсенал способов генотипирования полиморфных вариантов гена CCHCR1, отличается простотой, точностью и низкой себестоимостью. 1 ил.

СПОСОБ ОПРЕДЕЛЕНИЯ КОНЦЕНТРАЦИИ АНТИТЕЛ В СЫВОРОТКАХ КРОВИ К ПАТОГЕННЫМ БАКТЕРИЯМ YERSINIA ENTEROCOLITICA СЕРОВАРОВ O:3, O:5 ИЛИ O:6,30 С ПРИМЕНЕНИЕМПЬЕЗОГРАВИМЕТРИЧЕСКОГО ИММУНОСЕНСОРА

Изобретение относится к иммунологии. Через проточную микроячейку объемом 15-20 мкл пропускают поток фосфатного буферного раствора-носителя со скоростью 30-90 мкл/мин, в который вводят анализируемый образец сыворотки в объеме 200 мкл. Проточная ячейка снабжена горизонтально закрепленным пьезогравиметрическим иммуносенсором с частотой колебания fm и рецепторным покрытием на основе одного из ЛПС Yersinia enterocolitica серовара О:3, О:5 или О:6,30. Затем регистрируют связывание ЛПС Yersinia enterocolitica серовара О:3, О:5 или О:6,30, с антителами по уменьшению частоты колебаний сенсора от fm до f и определяют концентрацию антител по градуировочному графику прямо пропорционально величине Δf, равной fm-f. Использование изобретения позволяет сократить процедуру анализа до 10 мин, а также проводить многоразовый анализ после регенерации сорбированных ЛПС с чувствительностью 1,3 мкг/мл и определять концентрацию антител в диапазоне 10-100 мкг/мл. 1 табл.

ТЕСТ-СИСТЕМА ДЛЯ АНАЛИЗА ФУНКЦИОНАЛЬНОЙ АКТИВНОСТИ АНТИТЕЛ ПРОТИВ PD-1 И АНТИТЕЛ ПРОТИВ PD-L1

Изобретение относится к области биотехнологии. Заявлена группа изобретений, включающая тест-систему для анализа функциональной активности антитела против PD-1 или антитела против PD-L1 (варианты), набор, содержащий вышеуказанную тест-систему, применение тест-системы для анализа функциональной активности антитела против PD-1 или антитела против PD-L1, применение набора для анализа функциональной активности антитела против PD-1 или антитела против PD-L1, способ анализа функциональной активности антитела против PD-1 или антитела против PD-L1. Способ определения функциональной активности антитела против PD-1 или антитела против PD-L1. В одном из вариантов реализации тест-система содержит в себе эффекторные репортерные клетки, имеющие на своей поверхности функциональный CD3 комплекс, PD-1 и содержащие репортерный ген под контролем CD3-зависимого промотора, клетки-мишени, представляющие на своей поверхности PD-L1, активатор CD3-зависимого сигнального каскада, где активатор CD3-зависимого сигнального ...

БИОСЕНСОР ДЛЯ ОПРЕДЕЛЕНИЯ ВНУТРИКЛЕТОЧНОЙ ТЕМПЕРАТУРЫ И ВЯЗКОСТИ НА ОСНОВЕ ГЕННОМОДИФИЦИРОВАННОГО ФОТОАКТИВНОГО ОРАНЖЕВОГО КАРОТИНОИДНОГО БЕЛКА

Изобретение относится к области биотехнологии, в частности к биосенсорам для измерения внутриклеточной температуры и вязкости. Генетически модифицированный водорастворимый белок ОКБ с одним цистеином в положении 245 содержит в качестве хромофора молекулу каротиноида (3'-гидроксиэхиненон или кантаксантин) и обладает фотоконверсией, то есть при поглощении сине-зеленого света белок переходит из оранжевого состояния в красное. Геномодицированный белок ОКБ конъюгируется с флуоресцентной меткой TMR через цистеин в положении 245 белка. После освещения сине-зеленым светом белок ОКБ переходит в красную, таким образом увеличивается расстояние между флуоресцентной меткой и молекулой каротиноида, нарушается процесс миграции энергии, и метка начинает флуоресцировать. Данный процесс зависит от температуры и вязкости окружения. Точность измерения температуры в растворе составила 0,2°С ± 0,05°С. За счет того, что в составе белковой части присутствует каротиноид, данный биосенсор обладает низкой цитотоксичностью ...

УЛУЧШЕННЫЙ ДИФФУЗИОННЫЙ СЛОЙ ДЛЯ ФЕРМЕНТНОГО ДАТЧИКА IN VIVO

СПОСОБ ДИАГНОСТИКИ ИНФЕКЦИЙ, ПЕРЕДАЮЩИХСЯ ПОЛОВЫМ ПУТЕМ, ПО СОСТАВУ РАВНОВЕСНОЙ ГАЗОВОЙ ФАЗЫ НАД ЦЕРВИКАЛЬНОЙ СЛИЗЬЮ

Способ диагностики инфекций, передающихся половым путем, по составу равновесной газовой фазы над цервикальной слизью, характеризующийся тем, что он предусматривает использование детектирующего устройства типа «электронный нос» на основе массива из 8 пьезосенсоров с базовой частотой колебаний 10-15 МГц, электроды которых модифицируют чувствительными покрытиями к различным классам органических соединений, таких как амины, аммиак, легколетучие кислоты, для этого на электроды наносят пленки из ацетоновых растворов бромкрезолового синего, метилового красного, тритона Х-100, толуольных растворов полиэтиленгликоля 2000, полиэтиленгликоля адипината, дициклогексана-18-краун-6 и пчелиного воска и хлороформной суспензии многослойных углеродных нанотрубок; к легколетучим карбоновым кислотам с общей массой покрытия после удаления растворителя 4-10 мкг, подготовленное детектирующее устройство подключают к компьютеру и управляют программой, регистрирующей в режиме реального времени сигналы массива пьезосенсоров ...

ЭЛЕКТРОХИМИЧЕСКАЯ АНАЛИТИЧЕСКАЯ ТЕСТ-ПОЛОСКА СО СЛОЕМ ФЕРМЕНТНОГО РЕАГЕНТА, СОДЕРЖАЩЕГО МЕДИАТОР НА ОСНОВЕ НАФТОХИНОНА И FAD-GDH

СПОСОБ ДИАГНОСТИКИ МУТАЦИИ p.Arg200Trp (C598T) В ГЕНЕ VHL, ОТВЕТСТВЕННОЙ ЗА РАЗВИТИЕ АУТОСОМНО-РЕЦЕССИВНОГО ЭРИТРОЦИТОЗА

... 1. Способ диагностики мутации p.Arg200Trp (С598Т) в гене VHL, ответственной за развитие злокачественного аутосомно-рецессивного эритроцитоза, отличающийся тем, что при тестировании образцов ДНК, полученных от больных и здоровых индивидов, оценивают различия параметров кривой плавления нормальных и мутантных, амплифицированных после проведения лигазной реакции фрагментов ДНК. ! 2. Способ диагностики по п.1, отличающийся тем, что для увеличения разницы температур плавления нормальных и мутантных фрагментов ДНК проводят лигазную реакцию со специфическими олигонуклеотидными пробами к мутантному и нормальному аллелям, при этом в структуру пробы, специфичной нормальному аллелю, вводят негомологичную геномной ДНК человека G/C-богатую вставку. ! 3. Способ по п.2 отличающийся тем, что лигазную реакцию проводят в течении 1-2 ч при 56-60°С в 5 µ1 смеси следующего состава: 0.1-1.0 µg ДНК, 0.16-10 fmol/µl каждой пробы для лигирования (MLPER 3FN, MLPER 3FM, MLPER 3R), 0.4 U Pfu-лигазы, буфер для лигирования ...

СПОСОБ ОЦЕНКИ СТЕПЕНИ АДГЕЗИИ МИКРООРГАНИЗМОВ НА ПОВЕРХНОСТИ РАСТИТЕЛЬНЫХ СУБСТРАКТОВ

... 1. Способ оценки степени адгезии микроорганизмов на поверхности растительных субстратов, включающий смешивание суспензии предварительно отмытых клеток микроорганизмов с микрокристаллической целлюлозой в равных объемах, перемешивание полученной взвеси, инкубирование суспензии, измерение оптической плотности супернатанта, вычисление процента адгезированных микроорганизмов, отличающийся тем, что оптимизированные по размеру кормовые частицы получают путем проведения ступенчатого центрифугирования, включающим использование оптимального режима центрифугирования (500 об/мин), при котором в поле зрения видно достаточное количество частиц субстрата среднего размера (⌀(10±2) мкм), превышающего размер бактерий в 20-30 раз.2. Способ по п.1, отличающийся тем, что подсчет адгезированных микроорганизмов проводят на модельном микроорганизме - биосенсоре Е.coli-эколюм-11 с помощью микропланшетного люминометра LM-01T с термостатом;3. Способ по п.1, отличающийся тем, что степень адгезии модельных микроорганизмов ...

САМОИНДУЦИРУЕМАЯ ЭКСПРЕССИОННАЯ СИСТЕМА И ЕЕ ПРИМЕНЕНИЕ ДЛЯ ПОЛУЧЕНИЯ ПОЛЕЗНЫХ МЕТАБОЛИТОВ С ПОМОЩЬЮ БАКТЕРИИ СЕМЕЙСТВА Enterobacteriaceae

... 1. Генетическая экспрессионная система, включающая элементы транскрипционного аппарата, регулируемого белком типа LysR, отличающаяся тем, что указанная система экспрессии модифицирована таким образом, что регуляция указанной системы, функционирующей по принципу самоиндукции с положительной обратной связью, опосредована коиндуктором.2. Система экспрессии по п.1, отличающаяся тем, что указанная система происходит из бактерии, принадлежащей к семейству Enterobacteriaceae.3. Система экспрессии по п.1, отличающаяся тем, что указанная система из пути биосинтеза разветвленных L-аминокислот.4. Система экспрессии по п.1, отличающаяся тем, что указанная система дерегулирует уровень экспрессии целевого(ых) гена(ов).5. Система экспрессии по п.4, отличающаяся тем, что указанная система увеличивает уровень экспрессии целевого(ых) гена(ов).6. Система экспрессии по любому из пп.4-5, отличающаяся тем, что указанный(е) целевой(ые) ген(ы) кодирует(ют) белок(ки), включенный(е) в биосинтез указанного коиндуктора ...

СПОСОБ ДЕТЕКЦИИ СПЕЦИФИЧЕСКИХ ПОСЛЕДОВАТЕЛЬНОСТЕЙ НУКЛЕИНОВЫХ КИСЛОТ (ВАРИАНТЫ) И УСТРОЙСТВО ДЛЯ ЕГО ОСУЩЕСТВЛЕНИЯ

... 1. Способ детекции специфических последовательностей нуклеиновых кислот электрохимическим методом, отличающийся тем, что детекцию осуществляют путем регистрации циклических вольтамперограмм рабочего электрода, модифицированного углеродными нанотрубами с нековалентно иммобилизованным на их поверхности олигонуклеотидным зондом, до и после внесения в исследуемый раствор образца нуклеиновой кислоты (РНК или ДНК); по изменению емкостной характеристики, определяемой по площади циклических вольтамперограмм, делают вывод о наличии или отсутствии в исследуемом образце нуклеиновой кислоты (РНК или ДНК) участка, комплементарного олигонуклеотидному зонду, а также определяют концентрацию детектируемой нуклеиновой кислоты.2. Способ детекции специфических последовательностей нуклеиновых кислот электрохимическим методом, отличающийся тем, что детекцию осуществляют путем регистрации циклических вольтамперограмм рабочего электрода, модифицированного углеродными нанотрубами с нековалентно иммобилизованным ...

СПОСОБ ОПРЕДЕЛЕНИЯ АНТИРАДИКАЛЬНОЙ АКТИВНОСТИ ВЕЩЕСТВ IN VITRO

Способ определения антирадикальной активности веществ in vitro, заключающийся в γ-облучении исследуемого вещества и эталона сравнения и определении количественных характеристик исследуемого вещества, отличающийся тем, что в качестве эталона сравнения используют водный раствор р-нитрозодиметиланилина, методом конкурентной кинетики определяют константу скоростей реакции веществ с радикалами ОН (kон) и при получении константы скорости реакции исследуемого вещества выше (4-5)·109л/моль·c методом конкурентной кинетики последовательно определяют соотношения равноповреждающих доз при облучении в присутствии испытуемого вещества и без него в сравнении с трипсином по снижению его ферментативной активности, в сравнении с ДНК по снижению характеристической вязкости двунитевой ДНК и в сравнении с эритроцитами по снижению оптической плотности эритроцитов, затем полученные экспериментальные величины сравнивают с расчетными и оценивают свойства радикальных состояний исследуемых веществ.

СПОСОБ ОПРЕДЕЛЕНИЯ ТОКСИНОВ БЛЕДНОЙ ПОГАНКИ AMANITA PHALLOIDES АМАНИТИНОВ

... 1. Способ обнаружения токсинов бледной поганки Amanita phalloides аманитинов, включающий изменение спектральных характеристик аналитического реагента под воздействием аманитинов, отличающийся тем, что в качестве аналитического реагента используют производные акридина, а аналитический эффект регистрируют по степени тушения флуоресценции аналитического реагента в процентах. 2. Способ по п.1, отличающийся тем, что в качестве аналитического реагента для обнаружения аманитинов используют метилакридиний метилсульфат, а анализ проводят в буферной среде при значениях рН 7-10. 3. Способ по п.1, отличающийся тем, что количественное содержание аманитинов в анализируемом экстракте из грибов определяют по предварительно построенному градуировочному графику зависимости от концентрации аманитина, где I0 - исходная интенсивность флуоресценции МА+ в контрольном опыте (в отсутствие аманитина); It - интенсивность флуоресценции МА+ после воздействия экстрактом из гриба.

УСТРОЙСТВО ДЛЯ ОЦЕНКИ КАЧЕСТВА ПРОДУКТОВ ЖИВОЙ И НЕЖИВОЙ ПРИРОДЫ

Устройство для оценки качества продуктов живой и неживой природы, содержащее биодетектор, включающий блок перемещения, емкости с тест-объектами, оптическую систему, видеокамеру, источник освещения, отличающееся тем, что в блок перемещения емкостей с тест-объектами введена электронная схема управления перемещением, снабженная отдельным источником питания и имеющая в электрической цепи включения обмоток шагового двигателя дополнительные усилители-формирователи сигналов управления, а в компьютер в качестве аналого-цифрового преобразователя, принимающего видеосигнал с биодетектора, установлен видеограббер, например типа FlyVideo, который оцифровывает изображение емкости с тест-объектами, после чего цифровое изображение записывается в оперативную память компьютера и обрабатывается специальной программой, передающей после обработки изображение на монитор и управляющей процессором компьютера для выработки сигналов управления, поступающих через параллельный порт компьютера на блок перемещения емкостей ...

СПОСОБ ВЫЯВЛЕНИЯ МИКОБАКТЕРИЙ ТУБЕРКУЛЕЗА ИЗ ВОЗДУШНОЙ СРЕДЫ

... 1. Способ выявления микобактерий туберкулеза из воздушной среды, включающий отбор пробы воздуха путем направленного ударного действия струи на дно чашки Петри, обработку пробы раствором фосфорнокислого натрия трехзамещенного, инкубирование в течение 18-24 ч, центрифугирование, нейтрализацию осадка, посев на питательную среду и повторное инкубирование до появления роста, отличающийся тем, что обработку пробы раствором фосфорнокислого натрия трехзамещенного ведут путем предварительного помещения на дно чашки Петри пластины из поролона, смоченной в 4-6 мл 5%-ного раствора фосфорнокислого натрия трехзамещенного, с последующим инкубированием чашки Петри с поролоновой пластиной, перед центрифугированием проводят отделение исследуемого материала, нейтрализацию осадка осуществляют 1%-ным раствором лимонной кислоты в соотношении 1:1, а посев проводят на питательную среду "Новая".2. Способ по п.1, отличающийся тем, что диаметр пластины из поролона равен диаметру дна чашки Петри, а ее толщина составляет ...

УСТРОЙСТВО ДЛЯ ВЫЯВЛЕНИЯ HELICOBACTER PYLORI

... 1. Устройство для выявления Helicobacter pylori по уреазной активности биоптата, содержащее мочевину, буфер, кислотно-основной индикатор в водном растворе, отличающееся тем, что устройство выполнено в виде герметично запаянной ампулы объемом 0,1 - 0,5 мл, частично заполненной индикаторным раствором, способным к изменению окраски при изменении кислотности среды в интервале рН от 6 до 9. 2. Устройство по п. 1, отличающееся тем, что при его изготовлении индикатор растворяют в воде в щелочной форме, переводят в кислую форму, титруют одним из компонентов буфера до заданного соотношения кислотно-основных форм индикатора, определяющих соотношение компонентов буфера, а ампулы, находящиеся под поверхностью раствора заполняют этим раствором в результате охлаждения. 3. Устройство по п. 2, отличающееся тем, что в ходе герметизации ампул запайкой жидкость из капилляра выбрасывается из капилляра во внешнюю среду за счет нагрева газового пузыря внутри ампулы непосредственно в ходе запайки.

СПОСОБ ОПРЕДЕЛЕНИЯ ДНК-ГИДРОЛИЗУЮЩЕЙ АКТИВНОСТИ МОЛЕКУЛ И УСТРОЙСТВО ДЛЯ ЕГО ОСУЩЕСТВЛЕНИЯ

... 1. Способ определения ДНК-гидролизующей активности молекул, отличающийся тем, что определение осуществляют электрохимически, адсорбируя продукты гидролиза ДНК на рабочем электроде и регистрируя сигнал окисления продуктов гидролиза ДНК, величина которого пропорциональна ДНК-гидролизующей активности молекул. ! 2. Способ по п.1, отличающийся тем, что ДНК-гидролизующую активность молекул определяют в составе биологических материалов. ! 3. Способ по п.1, отличающийся тем, что ДНК-гидролизующую активность определяют у молекул, выделенных из биологических материалов. ! 4. Способ по п.1, отличающийся тем, что ДНК-гидролизующую активность определяют у небиологических молекул. ! 5. Устройство для проведения электрохимического анализа - электрохимический анализатор, отличающийся тем, что его применяют для определения активности ДНК-гидролизующих молекул. ! 6. Устройство по п.5, отличающееся тем, что используют модифицированный рабочий электрод. ! 7. Устройство по п.5, отличающееся тем, что используют ...

СПОСОБ ИЗМЕРЕНИЯ АКТИВНОСТИ МОЛОКОСВЕРТЫВАЮЩИХ ФЕРМЕНТНЫХ ПРЕПАРАТОВ

Изобретение относится к мясной и молочной отраслям промышленности, биотехнологии производства молокосвертывающих ферментов и может быть использовано на заводах по производству ферментных препаратов и других организациях, производящих ферменты и контролирующих их качество. Целью изобретения является повышение точности измерений активности молокосвертывающих ферментных препаратов и уровня их стандартизации. Поставленная цель достигается путем использования единого стандартизованного субстрата и индивидуальных отраслевых стандартных образцов ферментов.

СПОСОБ ДЕТЕКЦИИ СПЕЦИФИЧЕСКИХ ФРАГМЕНТОВ ДНК ИЛИ РНК С ПОМОЩЬЮ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ В РЕЖИМЕРЕАЛЬНОГО ВРЕМЕНИ

... 1. Способ амплификации специфических фрагментов ДНК или РНК с помощью полимеразной цепной реакции в режиме реального времени, отличающийся тем, что в нем не требуется применения гибридизационных зондов, а используются не образующие вторичных структур олигонуклеотидные праймеры, несущие в своем составе флуоресцентные красители и отжигающиеся на мишени в непосредственной близости друг от друга или даже с небольшим перекрытием, обеспечивая тем самым флуоресцентный резонансный перенос энергии между красителем-донором и красителем-акцептором, входящими соответственно в состав прямого и обратного праймеров и где детекция накопления целевых продуктов амплификации ведется путем регистрации увеличения свечения акцепторного флуорохрома. 2. Способ по п.1, отличающийся тем, что в состав прямого и обратного праймеров входят флуоресцентный краситель и универсальный гаситель, соответственно, а детекция накопления целевых продуктов амплификации ведется путем регистрации снижения свечения флуорохрома за ...

КОМПОЗИЦИИ РЕАГЕНТОВ С НИЗКОЙ ОБЩЕЙ КОНЦЕНТРАЦИЕЙ СОЛИ И СИСТЕМЫ ДЛЯ БИОСЕНСОРОВ

... 1. Биосенсорная система для определения концентрации анализируемого вещества в образце, содержащая:реакционное средство для избирательного осуществления окислительно-восстановительной реакции анализируемого вещества,при этом реакционное средство содержит связующее средство, буферную соль, посредник, содержащий не более 20% (масс./масс.) неорганической соли непереходного металла, и ферментативную систему; иизмерительное средство для измерения скорости окислительно-восстановительной реакции анализируемого вещества,при этом измерительное средство содержит по меньшей мере два проводника; иизмерительное средство выполнено с возможностью измерения значения выходного сигнала из реакционного средства при максимальной кинетической эффективности в течение не более 7 секунд от введения образца в реакционное средство, и значение выходного сигнала чувствительно к концентрации анализируемого вещества в образце,измерительное средство выполнено с возможностью определения по меньшей мере одного значения ...

СПОСОБ ДИАГНОСТИКИ ЛЕЙКОЗА КРУПНОГО РОГАТОГО СКОТА

Способ диагностики лейкоза крупного рогатого скота, включающий выделение ДНК из образца ткани, обработку полученной ДНК эндонуклеазами рестрикции и последующий анализ образовавшихся фрагментов ДНК - продуктов гидролиза, отличающийся отсутствием стадии амплификации ДНК.

АДЬЮВАНТ ВАКЦИНЫ ДЛЯ ЛИМФОЦИТОВ ЧЕЛОВЕКА

... 1. Способ усиления иммунного ответа на антиген у млекопитающего, предусматривающий введение кондиционированной лимфоцитами среды в комбинации с указанным антигеном указанному млекопитающему. 2. Способ по п.1, в котором указанная кондиционированная лимфоцитами среда получена из "необученных" Т-клеток, культивируемых с покрытыми антителами к CD3/CD28 гранулами. 3. Способ по п.1, в котором указанным антигеном является ВИЧ-1 или ВИЧ-2. 4. Способ по п.1, в котором указанным антигеном является вирус гепатита В. 5. Способ по п.1, в котором указанным антигеном является столбнячный токсоид. 6. Способ по п.1, в котором указанным антигеном является специфический для предстательной железы антиген. 7. Способ по п.1, в котором указанным антигеном является вирус гепатита А. 8. Способ по п.1, в котором указанным антигеном является возбудитель дифтерии. 9. Способ по п.1, в котором доза указанной кондиционированной лимфоцитами среды равна приблизительно 10 мкг - приблизительно 500 мкг. 10. Способ по п.1, ...

РЕАГЕНТНЫЕ МАТЕРИАЛЫ И СООТВЕТСТВУЮЩИЕ ТЕСТОВЫЕ ЭЛЕМЕНТЫ

... 1. Тестовый элемент, созданный для определения первого и второго аналитов, содержащий:- первый коферментзависимый фермент или субстрат для первого фермента;- второй коферментзависимый фермент или субстрат для второго фермента; и- кофермент, выбранный из группы, состоящей из тио-NAD, тио-NADP и соединения формулы (I):в которойА обозначает аденин или его аналог,Т в каждом случае независимо обозначает О или S,U в каждом случае независимо обозначает ОН, SH, ВН или BCNH ,V в каждом случае независимо обозначает ОН или фосфатную группу,W обозначает COOR, CON(R), COR или CSN(R), где R в каждом случае независимо обозначает Н или C-C-алкил,X, Хв каждом случае независимо обозначают О, СН, СНСН, С(СН), NH или NCH,Y обозначает NH, S, О или СН,Z обозначает остаток, содержащий циклическую группу с 5 атомами С, которая необязательно содержит гетероатом, выбранный из О, S и N, и необязательно один или несколько заместителей, и остаток CR4, где CR4связан с циклической группой и с Х, игде R4 в каждом случае ...

СПОСОБ РОДОВОЙ И ВИДОВОЙ МИКРОБИОЛОГИЧЕСКОЙ ДИАГНОСТИКИ УСЛОВНО-ПАТОГЕННЫХ ЭНТЕРОБАКТЕРИЙ

Способ родовой и видовой микробиологической диагностики условно-патогенных энтеробактерий, выделенных от больных с гнойно-септической патологией и из внешней среды, путем изучения их биологических признаков, определяющих принадлежность к семейству, с использованием питательных сред и режима культивирования, отличающийся тем, что после определения принадлежности к семейству у возбудителей изучают биологические признаки: способность к образованию сероводорода, индола, цитрата, наличие фенилаланиндезаминазы, желатиназы, уреазы, утилизацию лизина, сорбита, орнитина и аргинина, характер реакции с метиловым красным, наличие пигмента и подвижности, с последующим формированием групп, используя комбинации из этих признаков для определения родовой и видовой принадлежности возбудителя.

Способ оценки адгезивных свойств холерных вибрионов Vibrio cholerae EI Tor и Vibrio cholerae 0139 на клеточной культуре Hu Tu-80

Способ оценки адгезивных свойств холерных вибрионов Vibrio cholerae El Tor и Vibrio cholerae O139 на клеточной культуре HuTu-80, включающей следующие стадии:а) проводят подготовку монослоя клеток HuTu-80 путем их выращивания в пластиковых флаконах объемом 50 мл, по 100-150 тыс. на 1 мл с последующим трипсинизированием культуры и внесением ее в пенфлаконы с дисками (диски 12,0 X 0,11 SPL Lifesciences) по 50 тыс. клеток в объеме 1 мл;б) готовят бактериальную суспензию штаммов Vibrio cholerae El Tor и Vibrio cholerae 0139, которые выращивают на агаре Мартена (рН 7,7) в течение 18 ч, после этого петлей засевают в бульон LB (рН 7,7) и выдерживаю в термостате при 37°С в течение 3 ч;в) эксперимент проводят в пенфлаконах с дисками, на которых сформировался разреженный монослой HuTu-80, туда добавляют 10 мкл бактериальной суспензии и 1 мл среды DMEM с 5% сыворотки эмбриональной бычьей, до концентрации холерных вибрионов 10м.к./мл, затем проводят инкубирование в течение 90 мин при 37°С, удаляют питательную ...

Устройство для биологических и биохимических исследований

Полезная модель относится к области биологии и биохимии и может использоваться в устройствах для проведения биологических и биохимических исследований преимущественно в медицине, ветеринарии, токсикологии и экологии. Устройство содержит корпус, в котором размещен блок управления, и соединенные с ним: снабженный шаговым двигателем основной узел перемещения сменного держателя; размещенный в сменном держателе планшет с лунками для исследуемых образцов; снабженный шаговым двигателем дополнительный узел перемещения сменного держателя; светодиодный узел подсветки; снабженный шаговым двигателем узел перемещения видеокамеры с объективом переменного фокусного расстояния; блок регулирования температуры; индикаторную панель; блок питания и датчики перемещения, которыми снабжены шаговые двигатели. Дополнительный узел перемещения сменного держателя выполнен с обеспечением возможности линейного перемещения сменного держателя в горизонтальной плоскости по оси, ортогональной оси перемещения сменного держателя ...

Технология для детекции биозараженности нефтегазовых объектов

Изобретение относится к биотехнологии, а именно к методу быстрой и высокоэффективной детекции микроорганизмов, вовлеченных в коррозию металлов, и может быть использовано для мониторинга биокоррозии как нефтепромысловых, так и любых других объектов, содержащих металлоконструкции. Предложен набор олигонуклеотидных зондов и биочип для идентификации основных групп микроорганизмов, вовлеченных в коррозию металлов, таких как сульфатвосстанавливающие бактерии и археи, метаногенные археи, термофильные археи металлвосстанавливающие, денитрифицирующие, ферментативные бактерии, ацетoгенные бактерии, углеводород деградирующие бактерии и бактерии, принадлежащие к семейству Enterobacteriaceae. Предложен способ обнаружения, идентификации и/или количественного определения микроорганизмов, вызывающих биокоррозию. Изобретение позволяет значительно расширить спектр и количество детектируемых микроорганизмов, вовлеченных в коррозию металлов и повысить эффективность мониторинга биокоррозии. 3 н. и 17 з.п. ф-лы ...

Способ определения флавонолов в растениях

Изобретение относится к биохнмии растений9 к способам определения биологически активных веществ, а именно к количественному определению флавонолов . Целью изобретения является сокращение продолжительности процесса . Растительное сырье перед экстрагированием этиловым спиртом подвергают воздействию комплекса ферментов, содержащего пекта-i тт азу, пектинлиазу, пеллюлазу и ксиланаз. Причем обработку проводят водным раствором комплекса ферментов с активностями; ед/мл: пектатлиаза 800-1200; пектин- лиаза 50-90; целлюлаза 0,8-1,2 кси- ланаза 0,8-1,4 при 29-31 °С в течение 2.0-3,0 ч с, 4 табло i ...

Способ количественного определения @ -экзотоксина и инсектицидного экзогенного метаболита в энтомоцидных бактериальных препаратах

Использование: производство энтомо- патогенных бактериальных препаратов, контроль инсектицидной активности. Сущность изобретения: препарат растворяют в воде, удаляют твердые частицы центрифугированием , в фугат вносят аммиак до рН 7.1- 7,3, раствор центрифугируют, при этом в твердой фракции (осадке) содержится экзогенный метаболит, в жидкой -/ -экзотоксин . В жидкую фракцию вносят хлористый барий для связывания / -экзотоксина, отделяют осадок в виде бариевой соли экзотоксина центрифугированием. К осадку добавляют раствор серной кислоты, затем рН доводят до 7,2 раствором аммиака и центрифугируют , отделяя жидкую фракцию, содержащую -экзотоксин, и вводят в нее соляную кислоту до рН 4,6-4,8.0садок, содержащий экзогенный метаболит, растворяют подкисленным соляной кислотой этиловым спиртом, центрифугируют, отделяют осадок, затем его растворяют и доводят рН раствора до 3,4-3,6. Водные растворы /3-экзотоксина и экзогенного метаболита фотометрируют и определяют оптическую плотность растворов при ...

Способ расовой дифференциации спорообразцов головни проса

Изобретение относится к сельскому хозяйству , в частности к фитопатологии и селекции проса на устойчивость к головне (Sphacelotheca Panici-millacei (Pers), Bub), Целью изобретения является повышение точности дифференциации. Собирают индивидуальные спорообразцы головни проса по принципу: один спорообразец (изолят) с одного пораженного растения, каждым из собранных спорообразцов при строгой изоляции их друг от друга заражают семена сортов - дифференциаторов проса. В качестве сортов-дифференциаторов используют сорта проса к-9520, к-9571, к-8751. к-9123, к-241, к-518, к-5763 с генами резистентно- сти 0, Sph 1, Sph 2, Sph 3, Sph 4, Sph 5, Sph 6 соответственно. После отчетливого проявления болезни учитывают пораженные растения каждого сорта дифференциатора. По совокупности реакций набора сортов дифференциаторов определяют расовую принадлежность исходного изолята. Предложенный способ позволяет более достоверно провести расовую дифференциацию изолятов возбудителя головни проса. 7 табл. Ј ...

Установка для испытания химических соединений на биологическую активность

Способ количественного определения жирнокислотного состава липидов микроорганизмов

Препарат для определения плазмокоагулирующей активности стафилококков

Изобретение относится к микробиологии и предназначено для определения коагулирующей активности: стафилококков при их идентификации. Цель изобретения - улучшение качества препарата за счет повышения его чувствительности, упрощение и ускорение процесса определения, а также увеличение срока годности. Используемый препарат содержит сухую цитратную кроличью плазму, полиэтиленгликоль с мол.м. 4000, бычий сывороточный альбумин, сахарозу и глицерин при следующем соотношении компонентов, мас.%: сухая цитратная кроличья плазма 36,54-39,62; полиэтиленгликоль 4000 35,85-40.38; бычий сывороточный альбумин 3,84-5,66: сахароза 3,77-5,77: глицерин остальное. 3 табл.

Способ определения ДНКазной активности микроорганизмов

Изобретение относится к медицинской микробиологии и предназначено для ускоренного определения ДНКазной активности микроорганизмов. Целью изобретения является ускорение, упрощение и повышение экономичности способа. Способ заключается в том, что микробная культура смешивается с раствором ДНК или ее соли на предметном стекле и после 1-2 ч экспозиции при 37°С определяют ДНКазную активность исследуемой культуры с помощью капиллярометрии по скорости подъема жидкости в капилляре. 2 табл.

Способ выявления зараженности клещей патогенными микроорганизмами

Изобретение относится к паразитологии и может быть использовано для оценки зараженности клещей возбудителями болезней человека и животных. Целью изобретения является повышение чувствительности и достоверности способа. На предметное стекло наносят тонкий слой агара и вырезают три лунки. В левую лунку помещают каплю испытуемой гемолимфы, а в среднюю и правую лунки - по капле гемолимфы с гемоцитами из конечности заведомо не зараженного клеща лабораторной линии. Лунки накрывают покровным стеклом и оставляют на ночь при температуре 30°С, Микроскопически определяют миграцию ге- моцитов из средней лунки При этом подсчитывают количество гемоцитов, мигрировавших и осевших на правой и левой стороне средней лунки. Значение индекса миграции рассчитывают по формуле В том случае, когда число гемоцитов, осевших на опытной (левой) стороне лунки вдвое или более превышает число гемоцитов. осевших на контрольной (правой) стороне, результат реакции рассматривают как достоверно положительный . При этом значение ...

Способ определения амилазной активности рубца жвачных животных

Изобретение относится к микробиологии , в частности к способам определения амилазной активности в рубце жвачных животных . Цель изобретения - ускорение, упрощение и удешевление способа. Для определения амилазной активности в рубцовую жидкость вносят подкрахмальную индикаторно-субстратную микропленку, содержащую крахмал, желатин, йод кристаллический и йодистый калий при массовом соотношении компонентов: 0,0004:0,0004:0,0033:0,0066 на 0,04 мл дистиллированной воды. Инкубацию осуществляют до полного обесцвечивания микропленки и оценивают количество крахмала, расщепленного в единицу времени. 3 табл. Ё ...

Способ определения максимальной удельной скорости роста микроорганизмов при их культивировании на жидкой питательной среде

Изобретение может быть использовано в биотехнологии и направлено на сокращение времени определения макси- м альной удельной скорости роста микроорганизмов ,. Культуральную среду прокачивают через две последовательно соединенные измерительные ячейки (Я). Культуральную среду первой Я насыщают кислородом и питательным субстратом в концентрациях, не вызывакицих ингибирование роста микроорганизмов . В Культуральную среду г второй Я. вводят буферный агент, инги- бирующий рост микроорганизмов. В каждой измерительной Я измеряют скорость потребления кислорода микроорганизмами , а максимальную удельную скорость роста микроорганизмов опреi jtV QolMctKC „ деляют по формуле М„е|цс Кд OjMMH где Л QOiMHH - скорости по требления кислорода в первой и во второй измерительных ячейках соответственно; К, и Kj- коэффициенты пропорциональности. 1 ил. j (Л ОР О) Од 00 сл ...

METHOD OF DETERMINATION OF ANTIPLAGUE VACCINE IMMUNOGENICITY

CПOCOБ KOHTPOЛЯ ПPOЦECCA TИHДAЛИЗAЦИИ KOHCEPBOB

INDICATOR FOR DETECTION OF MICROORGANISMS PRESENCE IN WATER

Biosensor system and method for measuring concentration of analyte

A biosensor system can comprise a sensor chip and a measurement device. The sensor chip comprises a capillary and electrodes disposed within the capillary. The height of the capillary is set to be less than the maximum value of the sum of the diffusion distance of an electron-transfer mediator and the diffusion distance of an analyte at the upper limit of the measurement guaranteed temperature of the biosensor system. The measurement device applies an open circuit voltage, a voltage that is lower than during concentration measurement, or the like to the electrodes of the sensor chip.

Electrochemical method and apparatus of identifying the presence of a target

An electrochemical method of identifying the presence of a target protein in a sample is provided. The method comprises providing a redox probe modified to include a detector that is suitable to bind to the target protein, and exposing the sample to the detector-modified redox probe. A change in the electrochemical signal produced by the redox probe as compared to a control signal is indicative of the presence of the target protein.

Method for determining the concentration of an analyte in a liquid sample using small volume samples and fast test times

Analytes in a liquid sample are determined by methods utilizing sample volumes of up to 1.0 μl and test times from about 4 to about 9 seconds after detection of the sample. The methods are preferably performed using small test strips including a sample receiving chamber filled with the sample by capillary action.

Subcutaneous Glucose Electrode

A small diameter flexible electrode designed for subcutaneous in vivo amperometric monitoring of glucose is described. The electrode is designed to allow “one-point” in vivo calibration, i.e., to have zero output current at zero glucose concentration, even in the presence of other electroreactive species of serum or blood. The electrode is preferably layered, with the layers serially deposited within a recess upon the tip of a polyamide insulated gold wire. A first glucose concentration-to-current transducing layer can be overcoated with an electrically insulating and glucose flux limiting layer (second layer) on which, optionally, an immobilized interference-eliminating horseradish peroxidase based film is deposited. An outer layer is preferably biocompatible.

Crosslinked Adduct of Polyaniline and Polymer Acid Containing Redox Enzyme for Electrochemical Sensor

A polymer matrix that may coated on an electrode is created by co-crosslinking (1) an adduct of a polyaniline formed by templated oxidative polymerization on a polymer acid; (2) a water-soluble crosslinker; and (3) a redox enzyme. The polymer matrix may be hydrated, and the absorbed water may make it permeable to, for example, glucose. The polyaniline may be polyaniline itself or a substituted polyaniline; the water-soluble crosslinker may be poly(ethylene glycol)diglycidyl ether, and the redox enzyme may be glucose oxidase. The polymer matrix may be produced by co-crosslinking (1) an adduct of an electrically conductive polymer and a polymer acid; (2) a water-soluble crosslinker; and (3) a redox enzyme in a single step at an about neutral pH, curing by drying. After hydration, the crosslinked polymer matrix may form a 3-dimensional glucose-permeable bioelectrocatalyst, catalyzing the electrooxidation of glucose.

Determination of blood glucose in a small volume and in a short test time using a chemical coating including binders and very short read potentials

Analytes in a liquid sample are determined by methods utilizing sample volumes of less than about 1.0 μl and test times within about eight seconds. The methods are preferably performed using small test strips including a sample receiving chamber filled with the sample by capillary action.

Method for Assessing Skin Condition

A method for evaluating the efficacy of a skin-cleansing composition comprises measuring an ATP level on a skin site after cleansing. A method for evaluating the condition of living skin comprises measuring an ATP level on a skin site. The ATP level may be monitored over time to determine a rate of change in the ATP level on the skin site.

Biosensor, thin film electrode forming method, quantification apparatus, and quantification method

A biosensor is disclosed comprising a support; a conductive layer composed of an electrical conductive material such as a noble metal, for example gold or palladium, and carbon; slits parallel to and perpendicular to the side of the support; working, counter, and detecting electrodes; a spacer which covers the working, counter, and detecting electrodes on the support; a rectangular cutout in the spacer forming a specimen supply path; an inlet to the specimen supply path; a reagent layer formed by applying a reagent containing an enzyme to the working, counter, and detecting electrodes, which are exposed through the cutout in the spacer; and a cover over the spacer. The biosensor can be formed by a simple method, and provides a uniform reagent layer on the electrodes regardless of the reagent composition.

Quality assays for antigen presenting cells

The present invention provides methods for evaluating the quality of a preparation of antigen presenting cells, such as dendritic cells. Assays for antigen-independent co-stimulation of T cells and for presentation of predetermined antigen by APCs are provided

Detection Method for Sensor Membrane of EuTixOy as Part of a Biosensor by Using PNIPAAm for Wrapping Enzymes

A detection method for a sensor membrane formed of EuTi x O y as part of a biosensor by using PNIPAAm for wrapping enzymes is provided with adding 1.0 g of NIPAAm powder to 20 ml water, heating same at 60° C. to form NIPAAm solution, and cooling the NIPAAm solution; adding 200 μl of 98.7 wt % of APS and 50 μl of 99 wt % of TEMED to the NIPAAm solution, uniformly mixing same, and reacting the mixture for 30 hours to prepare a transparent, gel PNIPAAm; adding 5 mg enzymes to 100 μl of 1× PBS buffer solution, uniformly mixing same, adding 100 μl of PNIPAAm to the buffer solution, and uniformly mixing the buffer solution; placing a biosensor on a heater for heating at a constant temperature of 37° C. wherein the biosensor is an EIS sensor having a sensor membrane formed of EuTi x O y ; and taking a measurement.

COMPOSITION OF REDOX-REAGENTS FOR ELECTROCHEMICAL BIOSENSOR AND BIOSENSOR COMPRISING THE SAME

A composition of redox-reagent containing metal-containing complex and thionine or its derivative as electron transfer mediator for use in an electrochemical biosensor, and a biosensor containing the same are provided. With the increase in reaction rate between redox enzyme-thionine (or its derivative)-metal-containing complex in the composition of redox-reagent containing metal-containing complex and thionine or its derivative, glucose detection efficiency markedly increases, and the composition is hardly influenced from high humidity and interfering substances. Accordingly, the composition of redox-reagent is useful in fabricating an electrochemical biosensor for detecting glucose in blood. 1. A composition of redox-reagent for use in an electrochemical biosensor , the composition comprising a redox enzyme and an electron transfer mediator , wherein the electron transfer mediator comprises a metal-containing complex and thionine or derivative thereof.2. The composition as set forth in claim 1 , wherein the redox enzyme is one selected from a group consisting of flavin adenine dinucleotide-glucose dehydrogenase claim 1 , nicotinamide adenine dinucleotide-glucose dehydrogenase claim 1 , glucose dehydrogenase claim 1 , glutamate dehydrogenase claim 1 , glucose oxidase claim 1 , cholesterol oxidase claim 1 , cholesterol esterase claim 1 , lactate oxidase claim 1 , ascorbic acid oxidase claim 1 , alcohol oxidase claim 1 , alcohol dehydrogenase and bilirubin oxidase.3. The composition as set forth in claim 1 , wherein the metal-containing complex is ruthenium complex or ferricyanide complex.4. The composition as set forth in claim 3 , wherein the ruthenium complex is one selected from a group consisting of Ru(NH)Cl claim 3 , [Ru(2 claim 3 ,2′ claim 3 ,2″-terpyridine)(1 claim 3 ,10-phenanthroline)(OH)] claim 3 , trans-[Ru(2 claim 3 ,2′-bipyridine)(OH)(OH)] claim 3 , [(2 claim 3 ,2′-bipyridine)(OH)RuORu(OH)(2 claim 3 ,2′bpy)] and [Ru(4 claim 3 ,4′-bipyridine)(NH)].5. The ...

SYSTEM AND METHOD FOR MEASURING AN ANALYTE IN A SAMPLE

Methods of determining a corrected analyte concentration in view of some error source are provided herein. The methods can be utilized for the determination of various analytes and/or various sources of error. In one example, the method can be configured to determine a corrected glucose concentration in view of an extreme level of hematocrit found within the sample. In other embodiments, methods are provided for identifying various system errors and/or defects. For example, such errors can include partial-fill or double-fill situations, high track resistance, and/or sample leakage. Systems are also provided for determining a corrected analyte concentration and/or detecting some system error. 1. A system for determining an analyte concentration , comprising:an electrochemical cell having at least two electrodes and being sized and configured to receive a sample, the electrochemical cell further configured to determine an initial analyte concentration and also configured to generate a pre-determined voltage between the first and second electrodes for a pre-determined amount of time, and further configured to measure at least one resulting current of the sample during the pre-determined time; anda processor for receiving a set of data from the electrochemical cell, the data including the initial analyte concentration, at least one applied voltage, and at least one resulting current, the processor further configured to utilize this data to determine a corrected analyte concentration, said electrochemical cell being further configured to measure an error source, and in which the processor utilizes the error source in determining the corrected analyte concentration.2. The system of claim 1 , wherein the analyte is glucose.3. The system of claim 1 , wherein the analyte is glucose and the error source is a hematocrit level.4. The system of claim 3 , wherein the processor utilizes a set of equations to determine a correction term depending on the hematocrit level and the ...

Concentration Determination in a Diffusion Barrier Layer

The present invention relates to improved electrochemical biosensor strips and methods for determining the concentration of an analyte in a sample. By selectively measuring a measurable species residing in a diffusion barrier layer, to the substantial exclusion of the measurable species residing exterior to the diffusion barrier layer, measurement errors introduced by sample constituents, such as red blood cells, and manufacturing variances may be reduced. 1. An electrochemical sensor strip , comprising:a base;a first electrode on the base, the first electrode having at least one first layer on a first conductor, the first layer including a reagent layer and a second layer between the first conductor and the first layer; anda second electrode on the base, the second layer having an average initial thickness selected in response to a read pulse applied to the first and second electrodes during an analyte analysis, where the read pulse substantially detects a measurable species within the second layer and substantially excludes from detection the measurable species external to the second layer.2. The electrochemical sensor strip of claim 1 , where the average initial thickness of the second layer is at least 1 μm.3. The electrochemical sensor strip of claim 1 , where the average initial thickness of the second layer is from 5 to 25 μm.4. The electrochemical sensor strip of claim 3 , where the second layer does not include a substantial amount of at least one of the oxidoreductase enzyme and a mediator.5. The electrochemical sensor strip of claim 4 , where the second layer comprises a polymeric material.6. The electrochemical sensor strip of claim 1 , where the second layer does not include a substantial amount of at least one of the oxidoreductase enzyme and a mediator.7. The electrochemical sensor strip of claim 1 , where the second layer comprises a polymeric material.8. The electrochemical sensor strip of claim 7 , where the polymeric material comprises at least ...

MICROBIOSENSORS BASED ON DNA MODIFIED SINGLE-WALLED CARBON NANOTUBE AND PT BLACK NANOCOMPOSITES

Glucose and ATP biosensors have important applications in diagnostics and research. Combining single-walled carbon nanotubes (SWCNTs) with Pt nanoparticles can significantly enhance the performance of electrochemical biosensors. This disclosure illustrates the use of single-stranded DNA (ssDNA) to modify SWCNTs to increase SWCNT solubility in water. Multiple embodiments with this configuration allows for exploration of new schemes of combining ssDNASWCNT and Pt black in aqueous media systems. These embodiments resulted in a nanocomposite with enhanced biosensor performance. The ssDNA-SWCNT/Pt black nanocomposite constructed by a layered scheme proved most effective in terms of biosensor activity. The key feature of this structure and method of use is the exploitation of ssDNASWCNTs as molecular templates for Pt black electrodeposition. Glucose and ATP microbiosensors fabricated utilizing this structure and method of use exhibited high sensitivity, wide linear range and low limit of detection. 1. A biosensor comprising ,an electrode including single strand DNA immobilized with single wall carbon nanotubes on the electrode utilizing a scheme for electrodeposition of Pt black on the electrode for aqueous media based analysis.2. The biosensor of claim 1 , further comprising a cross-linking agent.3. The biosensor of claim 2 , wherein the cross-linking agent is glutaraldehyde.4. The biosensor of claim 3 , further comprising an enzyme bound to Pt black by the cross-linking agent.5. The biosensor of claim 4 , wherein the enzyme is selected from the group consisting of glucose oxidase claim 4 , hexokinase claim 4 , glycerol kinase claim 4 , glycerol-3-phosphate oxidase claim 4 , and any combination thereof.6. The biosensor of claim 4 , wherein the enzyme is glucose oxidase.7. The biosensor of claim 6 , wherein the electrode is configured to measure glucose.8. The biosensor of wherein the enzyme is part of a multi-enzyme combination.9. The biosensor of wherein the multi- ...

FORMATION OF IMMOBILIZED BIOLOGICAL LAYERS FOR SENSING

The invention is directed to enzyme immobilization compositions comprising: one or more enzymes, a humectant, an acrylic-based monomer, a water-soluble organic photo-initiator and a water-soluble acrylic-based cross-linker in a substantially homogeneous aqueous mixture. The invention is also directed to methods for forming sensors comprising such compositions and to apparati for forming arrays of immobilized layers on an array of sensors by dispensing such compositions onto a substrate. 117-. (canceled)18. An apparatus for forming an immobilized enzyme layer on a substantially planar surface , the apparatus comprising a dispensing head for dispensing a controlled volume of a photoformable enzyme-containing matrix at a pre-selected location on said surface and a UV radiation source with a registration and alignment means capable of focusing a beam of radiation onto an area substantially covering said pre-selected location at a predetermined time and for a predetermined duration , at a predetermined intensity , after said matrix has been dispensed.19. The apparatus of claim 18 , wherein said substantially planar surface is selected from the group consisting of silicon wafer claim 18 , alumina wafer claim 18 , liquid crystal substrate claim 18 , glass substrate and plastic substrate and flexible plastic substrate.20. The apparatus of claim 18 , wherein said dispensing head comprises a syringe needle with a reservoir for said matrix claim 18 , and a displacement means for controlling the dispensed volume from said syringe onto said surface.21. The apparatus of claim 18 , wherein the photoformable matrix is the composition comprising one or more enzymes claim 18 , a humectant claim 18 , an acrylic-based monomer claim 18 , a water soluble organic photo-initiator and a water soluble acrylic-based cross-linker in a substantially homogeneous aqueous mixture.22. The apparatus of claim 18 , wherein the controlled volume is in the range of about 5 nL to about 1 μL.23. The ...

DEVICES AND METHODS FOR TESTING ANALYTES

A method and device are provided for measuring a level of a clinically relevant analyte (such as glucose) in a fluid (such as blood). The device includes a flow path for conducting said fluid through the device; a detection chamber arranged on said flow path; and detector means arranged to detect analyte levels in the fluid in said chamber, wherein: said detection chamber contains a predetermined amount of an analyte such that that analyte mixes with fluid in the detection chamber to form, at the detector means, a calibration sample of the fluid at a time after the arrival of the fluid in said detection chamber, and said detector means is arranged to detect a first analyte level of an unadulterated sample of the fluid at a first time which is before the formation of said calibration sample and to detect a second analyte level of said calibration sample at a second time which is after the formation of said calibration sample. 150.-. (canceled)51. A device for measuring a level of a clinically relevant analyte in a fluid , including:a flow path for conducting said fluid through the device;a detection chamber arranged on said flow path; anddetector means arranged to detect analyte levels in the fluid in said chamber, wherein:said detection chamber contains a predetermined amount of an analyte such that that analyte mixes with fluid in the detection chamber to form, at the detector means, a calibration sample of the fluid at a time after the arrival of the fluid in said detection chamber, andsaid detector means is arranged to detect a first analyte level of an unadulterated sample of the fluid at a first time which is before the formation of said calibration sample and to detect a second analyte level of said calibration sample at a second time which is after the formation of said calibration sample.52. A device according to wherein the analyte in said predetermined amount is the same as said clinically relevant analyte.53. A device according to wherein said device has ...

SYSTEMS AND METHODS FOR COLLECTING TEAR FILM AND MEASURING TEAR FILM OSMOLARITY

A sample receiving chip comprising a substrate that receives an aliquot volume of a sample fluid and a sample region of the substrate, sized such that the volume of the sample fluid is sufficient to operatively cover a portion of the sample region. The energy imparted into the sample fluid is transduced by the sample region to produce an output signal that indicates energy properties of the sample fluid. The sample receiving chip also includes a channel formed in the substrate, the channel configured to collect the aliquot volume of a sample fluid and transfer the aliquot volume of sample fluid to the sample region. 144.-. (canceled)45. A device for determining the presence of an analyte in a fluid sample comprising:a. a collection chamber containing a hydrophilic polymer;b. a fluidic channel connected to the collection chamber;c. a sensing chamber connected to the fluidic channel, wherein the sensing chamber is operably linked to a processor that allows detection of the analyte using electrochemical sensing.46. The device of claim 45 , wherein the processor comprises an electrode system claim 45 , and wherein the processing of the fluid comprises applying a voltage to the electrode system to induce an electrochemical reaction between the material that specifically detects the analyte and the analyte in the fluid sample and detecting a current produced by the electrochemical reaction.47. The device of claim 45 , wherein detection of the analyte comprises an enzyme modified electrochemical reaction.48. The device of claim 45 , wherein the hydrophilic polymer comprises polyether block amides (PEBA) claim 45 , block-copolyether-esters (PEE) claim 45 , polylactic acid (PLA) claim 45 , polyurethanes (PU) including aliphatic and thermoplastic polyurethanes claim 45 , polyglycolic acid (PGA) and other polyesters (PE) claim 45 , polycaprolactone (PCL) claim 45 , polyethersulfones (PES) claim 45 , polycarbonate (PC) claim 45 , or a combination thereof.49. The device of claim ...

MICELLULAR COMBINATION COMPRISING A NANOPARTICLE AND A PLURALITY OF SURFMER LIGANDS

The field of the present invention relates to the stabilisation of nanoparticles in aqueous dispersion and, in particular, the stabilisation of nanoparticles by encapsulating the nanoparticles in a micellular combination. The field of the present invention further relates to a micellular combination of nanoparticles and a method of manufacture of the micellular combination and uses thereof. In a first aspect the present disclosure teaches a micellular combination that allows the stable dispersion of nanoparticles into aqueous environment. The micellular combination comprises at least one nanoparticle in a core of the micellular combination. A plurality of surfactants is co-assembled with a plurality of hydrophobic ligands on the surface of the nanoparticle in such a way that the hydrophilic part of the surfactant forms a hydrophilic shell around the core of the micellular combination. 1. A micellular combination comprising:at least one inorganic nanoparticle surrounded in a core of hydrophobic ligands,a plurality of ionic, zwitter-ionic or non-ionic surfactants comprising a hydrophilic moiety and a hydrophobic moiety, wherein the hydrophobic moiety surrounds the core of hydrophobic ligands with the at least one inorganic nanoparticle andat least one polymer chain of polymerisable monomers.2. The micellular combination according to claim 1 , comprising at least one copolymerised hydrophobic ligand and/or surfactant.3. The micellular combination of claim 1 , wherein the inorganic nanoparticle is any one of metal oxide claim 1 , metal nanoparticles claim 1 , rare earth doped nanoparticle or a semiconducting nanoparticle including quantum dots.4. The micellular combination according to claim 1 , comprising a mixture of different inorganic nanoparticles in the core.5. The micellular combination according to claim 1 , wherein the surfactant is an amphiphilic block copolymer.6. The micellular combination of claim 5 , comprising a surfmer or an amphiphilic di or multi-block ...

Electron-Conducting Crosslinked Polyaniline-Based Redox Hydrogel, and Method of Making

A polymer matrix that may coated on an electrode is created by co-crosslinking (1) an adduct of a polyaniline formed by templated oxidative polymerization on a polymer acid; (2) a water-soluble crosslinker; and (3) a redox enzyme. The polymer matrix may be hydrated, and the absorbed water may make it permeable to, for example, glucose. The polyaniline may be polyaniline itself or a substituted polyaniline; the water-soluble crosslinker may be poly(ethylene glycol) diglycidyl ether, and the redox enzyme may be glucose oxidase. The polymer matrix may be produced by co-crosslinking (1) an adduct of an electrically conductive polymer and a polymer acid; (2) a water-soluble crosslinker; and (3) a redox enzyme in a single step at an about neutral pH, curing by drying. After hydration, the crosslinked polymer matrix may form a 3-dimensional glucose-permeable bioelectrocatalyst, catalyzing the electrooxidation of glucose. 121-. (canceled)22. A method for producing a crosslinked polymeric matrix , the method comprising co-crosslinking a polyaniline with a polymer acid and a redox enzyme.23. The method according to claim 22 , wherein the polyaniline is a ring-substituted polyaniline.24. The method according to claim 23 , wherein the ring-substituted polyaniline is a compound selected from the group consisting of poly-meta-toluidine claim 23 , poly-ortho-toluidine claim 23 , poly-ortho-fluoroaniline claim 23 , poly-ortho-methoxyaniline claim 23 , poly-ortho claim 23 ,ortho′-dimethylaniline.25. The method according to claim 22 , wherein the polymer acid is poly(2-acrylamido-2-methyl-propane sulfonic acid) (PAAMSA).26. The method according to claim 25 , wherein the polyaniline and PAAMSA are present in a molar ratio of from about 1:0.7 to about 1:0.99.27. The method according to claim 22 , wherein the method comprises crosslinking the polymeric matrix with a water soluble crosslinker.28. The method according to claim 27 , wherein the water soluble crosslinker comprises poly( ...

Method for determining the concentration of an analyte in a liquid sample using small volume samples and fast test times

Analytes in a liquid sample are determined by methods utilizing sample volumes of up to 1.0 μl and test times from about 4 to about 9 seconds after detection of the sample. The methods are preferably performed using small test strips including a sample receiving chamber filled with the sample by capillary action.

METHOD OF CORRECTING FOR OXYGEN EFFECT ON TEST SENSORS

An electrochemical test sensor is adapted to measure glucose and correct for the oxygen effect in a fluid sample. The test sensor comprises a base, first and second working electrodes, and a counter electrode. The first working electrode includes glucose oxidase, a mediator and peroxidase. The second working electrode includes glucose oxidase and the mediator. The first working electrode, the second working electrode and the counter electrode are located on the base. In other embodiments, an electrochemical test sensor is adapted to measure cholesterol, lactate, pyruvate or xanthine and correct for the oxygen effect in a fluid sample. 172-. (canceled)73. A method for correcting the oxygen effect in determining the concentration of glucose in a fluid using an electrochemical test sensor , the method comprising the acts of:providing a test sensor, the test sensor comprising a base, first and second working electrodes, and a counter electrode, the first working electrode including glucose oxidase, an oxidized form of a mediator and peroxidase, the second working electrode including glucose oxidase and the oxidized form of the mediator, the first working electrode, the second working electrode and the counter electrode being adjacent to the base;contacting the test sensor to a meter to form an electrical connection;placing the fluid on the test sensor;measuring a first current from the first working electrode from the reduced form of the mediator;measuring a second current from the second working electrode from the reduced form of the mediator; anddetermining the concentration of glucose and correcting for the oxygen effect, the oxygen effect being determined by subtracting the first current measurement from the second current measurement.74. The method of claim 73 , wherein the determination of the glucose concentration includes adding the second current measurement to the oxygen effect.75. The method of claim 73 , wherein the fluid is blood.76. The method of claim 73 ...

METHOD FOR DETERMINING HEMATOCRIT CORRECTED ANALYTE CONCENTRATIONS

The method includes: providing a test strip comprising a reference electrode and a working electrode coated with a reagent layer; applying a fluid sample to the test strip for a reaction period; applying a test voltage between the reference electrode and the working electrode; measuring a test current as a function of time; measuring a steady state current value when the test current has reached an equilibrium; calculating a ratio of the test current to the steady state current value; plotting the ratio of the test current to the steady state current value as a function of the inverse square root of time; calculating an effective diffusion coefficient from the slope of the linearly regressed plot of the ratio of the test current to the steady state current value as a function of the inverse square root of time; and calculating a hematocrit-corrected concentration of analyte. 1. A method of calculating a hematocrit-corrected glucose concentration in a fluid sample , the method comprising: applying a fluid sample to the test strip for a reaction period;', 'applying a test voltage between the reference electrode and the working electrode;', 'measuring a test current as a function of time;', 'measuring a steady state current value when the test current has reached an equilibrium;', 'calculating a ratio of the test current to the steady state current value;', 'plotting the ratio of the test current to the steady state current value as a function of the inverse square root of time;', 'calculating an effective diffusion coefficient from the slope of the linearly regressed plot of the ratio of the test current to the steady state current value as a function of the inverse square root of time; and', 'calculating a hematocrit-corrected concentration of analyte., 'providing a test strip comprising a reference electrode and a working electrode formed with a plurality of microelectrodes and coated with a reagent layer;'}4. The method of claim 1 , wherein the test strip further ...

Test strips and preparation method thereof

The present invention relates to test strips and preparation method thereof. More particularly, the present invention relates to a test strip comprising: (a) an insulating substrate; (b) an electrode system disposed on the insulating substrate; (c) an insulation layer disposed on the electrode system, in which an accommodation space is disposed at one side of the insulation layer for exposing a part of the electrode system to carry out an electrochemical reaction of an analyte; and (d) a gel, disposed in the accommodation space and formed by dissolving a reactive enzyme reacting with the analyte in a hydrogel and being cured. 1. A test strip comprising:(a) an insulating substrate;(b) an electrode system disposed on the insulating substrate;(c) an insulation layer disposed on the electrode system, in which an accommodation space is disposed at one side of the insulation layer for exposing a part of the electrode system to carry out an electrochemical reaction of an analyte; and(d) a gel, disposed in the accommodation space and formed by dissolving a reactive enzyme reacting with the analyte in a hydrogel and being cured.2. The test strip of claim 1 , wherein the test strip further comprises an upper cover disposed on the insulation layer.3. The test strip of claim 1 , wherein the reactive enzyme is a glucose oxidation enzyme.4. The test strip of claim 1 , wherein the analyte is a blood sugar.5. A method of preparing a test strip comprising the steps of:(a) providing an insulating substrate;(b) forming an electrode system on the insulating substrate;(c) forming an insulation layer on the electrode system, which has an accommodation space disposed at one side of the insulation layer; and(d) providing a gel, disposed in the accommodation space and being cured after dissolving in a reactive enzyme electrochemically reacting with an analyte in a hydrogel, comprising the steps of;(d1) providing a roller for rolling the gel;(d2) laminating the gel on a reaction specimen and ...

DEVICES AND METHODS RELATING TO ELECTROCHEMICAL BIOSENSORS

A system for testing for analytes in a sample of biological fluid includes a test strip that defines a cavity for receiving the sample. At least two sets of electrodes are adjacent the sample cavity, including one for measuring one property of the sample, and another for measuring one or more other properties of the sample, such as temperature and/or the presence or magnitude of confounding variables. The measurements are combined to yield the desired result. At least one set of working and counter electrodes each have a plurality of elongated “fingers” interdigitated with those of the other electrode in the set. The gaps between fingers can be quite small, so that the two electrode sets together can operate in a small measurement volume of sample. Additional electrodes can be included that measure the presence or sufficiency of the sample, and additional traces on the strip can act as configuration identifiers. 1. A test strip , comprising:a first sensor adapted to test a sample of a bodily fluid in a first measurement region of a sample cavity; anda second sensor adapted to test the same sample within a second measurement region of the sample cavity;wherein the first measurement region and second measurement region total at most about 240 nL.2. The test strip of claim 1 , wherein the total measurement volume is at most about 200 nL.3. The test strip of claim 1 , wherein the total measurement volume is at most about 90 nL.4. The test strip of claim 1 , wherein the total measurement volume is at most about 80 nL.5. The test strip of claim 1 , wherein the total measurement volume is at most about 65 nL.6. The test strip of claim 1 , wherein:the first sensor comprises a working electrode and a counter electrode; andthe second sensor comprises a single lead.7. The test strip of claim 1 , wherein:the first sensor comprises a first working electrode and a first counter electrode; andthe second sensor comprises a second working electrode and a second counter electrode.8. ...

SENSOR HEAD FOR USE WITH IMPLANTABLE DEVICES

The present invention provides a sensor head for use in an implantable device that measures the concentration of an analyte in a biological fluid which includes: a non-conductive body; a working electrode, a reference electrode and a counter electrode, wherein the electrodes pass through the non-conductive body forming an electrochemically reactive surface at one location on the body and forming an electronic connection at another location on the body, further wherein the electrochemically reactive surface of the counter electrode is greater than the surface area of the working electrode; and a multi-region membrane affixed to the nonconductive body and covering the working electrode, reference electrode and counter electrode. In addition, the present invention provides an implantable device including at least one of the sensor heads of the invention and methods of monitoring glucose levels in a host utilizing the implantable device of the invention. 1. A sensor for use in a glucose measuring device , the sensor comprising:a first electrode, a second electrode, and a non-conductive body located between the first electrode and the second electrode, wherein the first electrode and the second electrode each form an electrochemically reactive surface at one end of the sensor and an electronic connection at another end of the sensor; anda multi-region membrane covering the first electrode and the second electrode, wherein the multi-region membrane comprises an immobilized enzyme domain comprising an enzyme in at least a portion thereof, wherein the multi-region membrane comprises a glucose exclusion domain that is permeable to oxygen and interferes with glucose transport across said membrane, and wherein said glucose exclusion domain does not cover the working electrode.2. The sensor of claim 1 , wherein the multi-region membrane further comprises an interference domain more proximal to said electrochemically reactive surfaces than said glucose exclusion domain.3. The ...

SYSTEMS AND METHODS FOR MULTIPLEXED ELECTROCHEMICAL DETECTION

Contemplated methods and devices comprise performing electrochemical sample analysis in a multiplexed electrochemical detector having reduced electrical cross-talk. The electrochemical detector includes electrodes that share a common lead from a plurality of leads. The sample, which may be a liquid sample, is introduced into one or more sample wells and a signal is applied to at least one of the electrodes. A response signal is measured while simultaneously applying a substantially fixed potential to each of a remainder of the plurality of leads. 1. A method for performing electrochemical analysis , the method comprising:introducing a sample into a multiplexed electrochemical detector, the multiplexed electrochemical detector comprising a first sample well and a plurality of leads, wherein the first sample well comprises a first plurality of working electrodes each adapted to be electrically coupled to one of the plurality of leads, and the first plurality of working electrodes are adapted to be electrically coupled to a first counter electrode;applying a first signal to a first lead of the plurality of leads;measuring a first response signal from the first counter electrode while simultaneously applying a substantially fixed potential to each of a first remainder of the plurality of leads; anddetermining whether a first target analyte is present in the sample based on the first response signal.2. The method of claim 1 , wherein the multiplexed electrochemical detector further comprises a second sample well claim 1 , the second sample well comprising a second plurality of working electrodes each adapted to be electrically coupled to one of the first plurality of working electrodes via one of the plurality of leads claim 1 , each of the second plurality of working electrodes being adapted to be electrically coupled to a second counter electrode claim 1 , the method further comprising:applying a second signal to a second lead of the plurality of leads;measuring a ...

Electrochemical-based analytical test strip with intersecting sample-receiving chambers

An electrochemical-based analytical test strip for the determination of an analyte (such as glucose) in a bodily fluid sample (for example, a whole blood sample) and/or a characteristic of the bodily fluid sample (for example, hematocrit) includes a first sample-receiving chamber with first and second sample-application openings, and first and second electrodes. The first and second electrodes are disposed in the first sample-receiving chamber between the first and second sample-application openings. The electrochemical-based analytical test strip also includes a second sample-receiving chamber and a plurality of electrodes disposed in the second sample-receiving chamber. In addition, the second sample-receiving chamber intersects the first sample-receiving chamber between the first and second electrodes, thereby defining a chamber intersection.

FAD-CONJUGATED GLUCOSE DEHYDROGENASE GENE

Disclosed herein are a gene (polynucleotide) encoding an FAD-conjugated glucose dehydrogenase which can be characterized by reactivity to glucose, thermal stability, substrate-recognition performance, and low activity for maltose; a process for the production of the enzyme using a transformant cell transfected with the gene; a method for the determination of glucose; a reagent composition for use in the determination of glucose; and a biosensor for use in the determination of glucose. An embodiment is a polynucleotide encoding an FAD-conjugated glucose dehydrogenase, comprising a polypeptide whose amino acid sequence comprises X1-X2-X3-X4-X5-X6, wherein X1 and X2 independently represent an aliphatic amino acid residue; X3 and X6 independently represent a branched amino acid residue; and X4 and X5 independently represent a heterocyclic amino acid residue or an aromatic amino acid residue. 124-. (canceled)25. A biosensor comprising a recombinant FAD-conjugated glucose dehydrogenase , wherein the recombinant FAD-conjugated glucose dehydrogenase is selected from the group consisting of:(a) a polypeptide which comprises the amino acid sequence represented by SEQ ID NO: 1; and(b) a polypeptide which comprises an amino acid sequence having a homology of 90% or more to the amino acid sequence (a) and has an FAD-conjugated glucose dehydrogenase activity,and wherein the biosensor is capable of detecting glucose.26. The biosensor of claim 25 , wherein the biosensor comprises a reaction layer comprising the recombinant FAD-conjugated glucose dehydrogenase.27. The biosensor of claim 26 , wherein the reaction layer further comprises a hydrophilic polymer and an electron acceptor.28. The biosensor of claim 27 , wherein the electron receptor is an osmium compound claim 27 , a quinone compound or a ferricyan compound.29. The biosensor of claim 27 , wherein the reaction layer is in contact with an electrode system comprising a working electrode claim 27 , a counter electrode claim 27 ...

Biosensor Performance Increasing Methods Having Enhanced Stability and Hematocrit Performance

The present invention relates to electrochemical sensor strips and methods of determining the concentration of an analyte in a sample or improving the performance of a concentration determination. The electrochemical sensor strips may include at most 8 μg/mmof a mediator. The strips, the strip reagent layer, or the methods may provide for the determination of a concentration value having at least one of a stability bias of less than ±10% after storage at 50° C. for 4 weeks when compared to a comparison strip stored at −20° C. for 4 weeks, a hematocrit bias of less than ±10% for whole blood samples including from 20 to 60% hematocrit, and an intercept to slope ratio of at most 20 mg/dL. A method of increasing the performance of a quantitative analyte determination also is provided. 1. A method of increasing the performance of a quantitative analyte determination assay comprising: [{'sup': '2', 'wherein the at least one first layer includes a reagent layer including a polymeric binder, an enzyme system, and at most 8 μg/mmof a mediator,'}, 'wherein the mediator assists in transferring electrons between the analyte containing sample and the first conductor, and', 'wherein the sample provides electrical communication between the first and the second conductors;, 'introducing an analyte containing sample having a liquid component to an electrochemical sensor strip, the strip having a base, a first conductor on the base, a second conductor on the base, and at least one first layer on at least the first conductor,'}applying an electric potential between the first and the second conductors in the form of at least 2 read pulses within 3 to 14 seconds; andmeasuring a current from at least one of the read pulses to provide a quantitative value of the analyte concentration in the sample with increased performance attributable to at least one performance parameter selected from the group consisting of a stability bias of less than ±10% after the strip is stored at 50° C. for 2 ...

Porous Polymeric Formulation Prepared Using Monomer

An analyte sensor for the continuous or semi-continuous monitoring of physiological parameters and a method for making the analyte sensor are disclosed. In one aspect, the analyte sensor includes a crosslinked, hydrophilic copolymer in contact with a surface of an electrode, and an analyte sensing component embedded within the crosslinked, hydrophilic copolymer. The crosslinked, hydrophilic copolymer has methacrylate-derived backbone chains of first methacrylate-derived units, second methacrylate-derived units and third methacrylate-derived units. The first and second methacrylate-derived units have side chains that can be the same or different, and the third methacrylate-derived units in different backbone chains are connected by hydrophilic crosslinks. 1. An analyte sensor comprising:a crosslinked, hydrophilic copolymer in contact with a surface of an electrode; and [ first methacrylate-derived units, each having a first hydrophilic side chain;', 'second methacrylate-derived units, each having a second hydrophilic side chain,, 'backbone chains comprising;'}, third methacrylate-derived units; and', 'hydrophilic crosslinks between third methacrylate-derived units in different backbone chains., 'wherein the first and second side chains are the same or different;'}], 'an analyte sensing component embedded within the crosslinked, hydrophilic copolymer, wherein the crosslinked, hydrophilic copolymer comprises2. The sensor according to claim 1 , wherein the side chain of the first methacrylate-derived units comprise one or more hydroxy groups.5. The sensor according to claim 1 , wherein the second methacrylate-derived units comprise one or more alkylene oxide units.8. The sensor according to claim 1 , wherein the hydrophilic crosslinks comprise one or more alkylene oxide units.11. The sensor according to claim 1 , wherein the analyte sensing component comprises glucose oxidase.12. The sensor according to claim 1 , wherein the crosslinked claim 1 , hydrophilic copolymer ...

Method for measuring concentration of analyte

A biosensor system can comprise a sensor chip and a measurement device. The sensor chip comprises a capillary and electrodes disposed within the capillary. The height of the capillary is set to be less than the maximum value of the sum of the diffusion distance of an electron-transfer mediator and the diffusion distance of an analyte at the upper limit of the measurement guaranteed temperature of the biosensor system. The measurement device applies an open circuit voltage, a voltage that is lower than during concentration measurement, or the like to the electrodes of the sensor chip.

Phenotypic High-Content Assay to Evaluate Drugs

The present invention includes a high throughput screen for an active agent for the treatment of comprising: plating cells at least one pathophysiologically relevant mislocated mutant form of a peroxisomal enzyme; adding a control and compound to each plate from a library of compounds; fixing the cells; contacting the cells with an agent that detects the mislocated mutant form of a peroxisomal enzyme; and imaging the cells in the wells. 1. A method of determining the effectiveness of one or more drug candidates to change the intracellular localization of a target molecule , the method comprising:(a) incubating the one or more drug candidates with a first subset of the cells, and a control agent with a second subset of the cells;(b) fixing and staining the first and second subset of cells, wherein the stain detects the target molecule;(c) generating images of the first and second subset of cells with a camera;(d) measuring the difference in the intracellular localization of the target molecule in the first as compared to a second subset of cells; and(e) determining if the drug candidate modifies the localization of the intracellular localization of the target protein, wherein if the candidate drug modifies the intracellular localization of the target protein when compared to the placebo it is an effective drug candidate.4. The method of claim 1 , further comprising the step of determining cell count claim 1 , nuclear intensity claim 1 , morphology and condensation.5. The method of claim 1 , wherein the localization changes from the cytosol or mitochondria to a peroxisome.6. The method of claim 1 , wherein a candidate drug is selected from at least one of 26-Deoxymonensin B claim 1 , nigericin claim 1 , salinomycin claim 1 , or active derivatives thereof.7. A method of determining the effectiveness of one or more candidate pharmacoperones to treat and/or prevent protein misfolding claim 1 , the method comprising:(a) incubating the one or more candidate pharmacoperones ...

ENZYME STABILIZATION IN ELECTROCHEMICAL SENSORS

The present invention relates to a composition for forming an electrode, an electrochemical sensor comprising the same, and a method for determining an analyte using the electrochemical sensor. 117-. (canceled)18. A composition for forming an electrode , the composition comprising an electrically conductive component having an analyte-specific enzyme selectively covalently bound to the electrically conductive component , wherein the composition further comprises at least one electrically nonconductive or semiconductive component stabilizing the analyte-specific enzyme by either reacting with the analyte-specific enzyme to form a complex or conjugate with the enzyme or by converting chemical substances causing decomposition of the enzyme.19. The composition according to claim 18 , wherein the electrically conductive component is a HO-decomposition catalyst.20. The composition according to claim 18 , wherein the electrically conductive component is selected from the group consisting of activated carbon claim 18 , carbon black claim 18 , graphite claim 18 , carbonaceous nanotubes claim 18 , palladium claim 18 , platinum claim 18 , and hydroxides of iron oxide.21. The composition according to claim 20 , wherein the electrically conductive component is selected from the group consisting of graphite and carbonaceous nanotubes.22. The composition according to claim 18 , wherein the enzyme is an oxidase.23. The composition according to claim 22 , wherein the enzyme is a glucose oxidase.24. The composition according to claim 18 , wherein the electrically nonconductive or semiconductive enzyme-stabilizing component is a HO-decomposition catalyst.25. The composition according to claim 18 , wherein the electrically nonconductive or semiconductive enzyme-stabilizing component is selected from the group consisting of an HO-degrading metal oxide and an HO-degrading enzyme.26. The composition according to claim 25 , wherein the component is AgO claim 25 , AlOor an oxide of a metal ...

REAGENT COMPOSITION FOR BIOSENSOR AND BIOSENSOR HAVING THE SAME

This invention discloses a reagent composition for a biosensor having high sensitivity which is capable of improving analysis linearity of an analyte such as glucose by reacting an oxidoreductase, a metal-containing complex, and Naphthol Green B, and minimizing blood necessary for measuring blood glucose since it is possible to detect a concentration of a small amount of the analyte, and a biosensor having the same. The reagent composition for a biosensor includes at least two kinds of electron transfer mediators including Naphthol Green B, and an enzyme. 1. A reagent composition for a biosensor ,wherein the reagent composition includes at least two kinds of electron transfer mediators including Naphthol Green B, and an enzyme.2. The reagent composition according to claim 1 ,wherein the electron transfer mediator further includes a metal-containing complex.3. The reagent composition according to claim 2 ,wherein the metal-containing complex is a ruthenium complex or a ferricyanide complex.4. The reagent composition according to claim 3 ,{'sub': 3', '6', '3', '2', '2', '2', '2', '2', '3', '5, 'sup': 2+', '2+', '4+', '2+, 'wherein the ruthenium complex is at least one selected from the group consisting of Ru(NH)Cl, [Ru(2,2′,2″-terpyridine)(1,10-phenanthroline)(OH)], trans-[Ru(2,2′-bipyridine)(OH)(OH)], [(2,2′-bipyridine)(OH)RuORu(OH)(2,2′bpy)], and [Ru(4,4′-bipyridine)(NH)].'}5. The reagent composition according to claim 1 ,wherein the Naphthol Green B equal to or greater than 0.1 parts by weight and equal to or less than 20 parts by weight is used with respect to a buffer solution being 100 parts by weight.6. The reagent composition according to claim 1 ,wherein the enzyme is any of oxidoreductase, dehydrogenase, transferase, or hydrolase.7. The reagent composition according to claim 6 ,wherein the oxidoreductase is at least one selected from the group consisting of flavin adenine dinucleotide-glucose dehydrogenase, nicotinamide adenine dinucleotide-glucose ...

GENERATION OF UNIFORM HEPATOCYTES FROM HUMAN EMBRYONIC STEM CELLS BY INHIBITING TGF-BETA and METHODS OF MAINTAINING HEPATIC CULTURES

This disclosure relates generally to new methods of maintaining the expression of hepatic genes in human hepatocytes and method for maintaining the functional hepatic enzyme activity of primary hepatocytes in culture. The disclosure also encompasses new methods of deriving a population of pure hepatocytes without selecting or sorting the cells from the cultured pluripotent cells.

ELECTROCHEMICAL-BASED ANALYTICAL TEST STRIP WITH ENZYMATIC REAGENT LAYER CONTAINING A NAPHTHOQUINONE-BASED MEDIATOR AND FAD-GDH

An electrochemical-based analytical test strip for the determination of an analyte (such as glucose) in a bodily fluid sample includes an electrically insulating base layer, an electrically conductive layer disposed on the electrically insulating base layer and including at least one electrode, an enzymatic reagent layer disposed on the at least one electrode, a patterned spacer layer, and a top layer. Moreover, the enzymatic reagent layer includes at least one naphthoquinone-based mediator. The naphthoquinone-based mediator can, for example, be at least one of 1,2-naphthalenedione-4-(3-mercapto-1-propane sulfonic acid) and 1,2-naphthalenedione-4-(3-mercaptopropionic acid); and FAD-GDH enzyme.

METHOD OF MAKING AN ELECTROCHEMICAL SENSOR STRIP

A method of making an electrochemical sensor strip that includes: depositing a first electrode on a base; depositing a second electrode on the base; applying a first layer onto the first electrode; and applying a second layer onto the second electrode. The first layer includes an oxidoreductase and a mediator. The second layer includes a soluble redox species. 122-. (canceled)23. A method of making an electrochemical sensor strip , the method comprising:depositing a first electrode on a base;depositing a second electrode on the base;applying a first reagent layer onto the first electrode, the first reagent layer comprising an electroactive organic molecule and an oxidoreductase configured to facilitate a redox reaction of an analyte; andapplying a second reagent layer onto the second electrode, the second reagent layer consisting essentially of a redox pair comprising a first soluble redox species and a second soluble redox species, the redox pair being selected from a group consisting of an organotransition metal complex, a transition metal coordination complex, and mixtures thereof.24. The method of claim 23 , wherein the first soluble redox species comprises at least one of ruthenium(II) hexaamine or ruthenium(III) hexaamine.25. The method of claim 23 , wherein the electroactive organic molecule includes coenzyme pyrroloquinoline quinone claim 23 , substituted benzoquinones claim 23 , substituted naphthoquinones claim 23 , N-oxides claim 23 , nitroso compounds claim 23 , hydroxylamines claim 23 , oxines claim 23 , flavins claim 23 , phenazines claim 23 , phenothiazines claim 23 , indophenols claim 23 , indamines claim 23 , phenazinium salts claim 23 , phenoxazinium salts claim 23 , 3-phenylimino-3H-phenothiazines claim 23 , or 3-phenylimino-3H-phenoxazines claim 23 , or any mixture thereof.26. The method of claim 23 , wherein the electroactive organic molecule includes at least one of a 3-phenylimino-3H-phenothiazine or a 3-phenylimino-3H-phenoxazine.27. The ...

METHOD OF MAKING AN ELECTROCHEMICAL SENSOR STRIP

A method of making an electrochemical sensor strip that includes: depositing a first electrode on a base; depositing a second electrode on the base; applying a first layer onto the first electrode; and applying a second layer onto the second electrode. The first layer includes an oxidoreductase and a mediator. The second layer includes a soluble redox species. 1. A method of making an electrochemical sensor strip , comprising:depositing a first electrode on a base;depositing a second electrode on the base;applying a first layer onto the first electrode, the first layer comprising an oxidoreductase and a mediator; andapplying a second layer onto the second electrode, the second layer comprising a soluble redox species.222-. (canceled) This application is a continuation of U.S. Nonprovisional application Ser. No. 13/214,643, filed Aug. 22, 2011, entitled “Enzymatic Electrochemical Biosensor”, which is a continuation of U.S. Nonprovisional application Ser. No. 10/576,485, filed Apr. 21, 2006, entitled “Enzymatic Electrochemical Biosensor”, now U.S. Pat. No. 8,007,656, issued on Aug. 30, 2011, which was the National Stage of International Application No. PCT/US04/35286, filed Oct. 22, 2004, entitled “Enzymatic Electrochemical Biosensor”, which was published in English and claims the benefit of U.S. Provisional Application No. 60/513,817, filed Oct. 24, 2003, entitled “Enzymatic Electrochemical Biosensor”.In monitoring medical conditions and the response of patients to efforts to treat medical conditions, it is desirable to use analytical methods that are fast, accurate, and convenient for the patient. Electrochemical methods have been useful for quantifying certain analytes in body fluids, particularly in blood samples. Typically, these analytes undergo oxidation-reduction reactions when in contact with specific enzymes, and the electric current generated by these reactions can be correlated with the concentration of the analyte of interest. Miniaturized versions of ...

ELECTRODE AND MANUFACTURING METHOD THEREOF, ENZYME SENSOR, GLUCOSE SENSOR AND IN-VIVO COMPONENT MEASURING DEVICE

In a hydrogen peroxide electrode used as a working electrode of an enzyme sensor , an intermediate layer containing particles and a retentive substance for holding the particles inside the retentive substance are provided on a substrate , and an electrode layer is provided on the intermediate layer . In this way, according to the hydrogen peroxide electrode , hydrogen peroxide can be detected with high sensitivity even when an applied voltage that is not susceptible to interference by interference substances present in the living body is used. 1. An electrode comprising:an intermediate layer being disposed on a substrate and including particles and a retentive substance for holding the particles inside the retentive substance; andan electrode layer being disposed on the intermediate layer and adapted to electrolyze hydrogen peroxide and flow an electrical current in contact with the hydrogen peroxide.2. The electrode according to claim 1 , wherein the electrode layer includes platinum.3. The electrode according to claim 1 , wherein a layer including particles and a layer including the retentive substance are laminated in the intermediate layer.4. The electrode according to claim 1 , wherein the particles are nanoparticles or microparticles.5. The electrode according to claim 1 , wherein the particles are porous particles.6. The electrode according to claim 1 , wherein the particles are nonconductive particles.7. The electrode according to claim 1 , wherein the retentive substance is a hydrophilic polymer substance.8. The electrode according to claim 7 , wherein the hydrophilic polymer substance is polyvinyl alcohol.9. The electrode according to claim 1 , wherein a hydrogen peroxide selective permeation film is not provided on the electrode layer.10. A glucose sensor comprising:a substrate;{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, 'the electrode according to arranged on the substrate; and'}oxidase immobilized on a surface of the electrode.11. A glucose sensor ...

POLYMERIC ENZYME-BASED BIOFUEL CELL AND METHODS OF MAKING AND USING

Enzyme-based biofuel cells including a bioanode, a biocathode, and an electrolyte solution are disclosed. The bioanode contains (a) a conductive substrate; (b) one or more n-type polymers; and (c) one or more enzymes. The biocathode contains (a) a conductive substrate; and (b) one or more p-type polymers. The electrolyte solution contains one or more metabolites capable of reacting with the enzymes and is in electrical communication with the bioanode and the biocathode. The bioanode is electrically connected to the biocathode. The biofuel generates power when the metabolites react with the enzymes to produce electrons; the electrons are directed through an electrical circuit to the biocathode where an oxidant is reduced to water. The structure of the n-type polymer allows for efficient electron transfer from the enzyme to the polymer, resulting improved biofuel cell performances. Methods of making and using the enzyme-based biofuel cells are also disclosed. 1. A biofuel cell comprising:a bioanode which comprises (a) a conductive substrate; (b) one or more n-type polymers; and (c) one or more enzymes;a biocathode which comprises (a) a conductive substrate; (b) one or more p-type polymers; andan electrolyte solution which comprises one or more metabolite capable of reacting with the enzyme,wherein the bioanode is electrically connected to the biocathode, and wherein the electrolyte solution is in electrical communication with the bioanode and the biocathode.2. The biofuel cell of claim 1 , wherein the n-type polymer is P90.3. The biofuel cell of claim 1 , wherein: (a) the bioanode cell further comprises coating; (b) the biocathode further comprises one or more enzymes.4. (canceled)5. The biofuel cell of claim 1 , wherein the enzyme is selected from the group consisting of glucose oxidase claim 1 , glucose dehydrogenase claim 1 , alcohol dehydrogenase claim 1 , aldehyde dehydrogenase claim 1 , formate dehydrogenase claim 1 , formaldehyde dehydrogenase claim 1 , lactic ...

FAST QUANTIFICATION OF ENZYME ACTIVITY BY ELECTROANALYSIS

The internally calibrated electrochemical continuous enzyme assay (ICECEA) was developed for the fast determination of enzyme activity unit. The assay uses integration of enzyme-free pre-assay calibration with the actual enzyme assay in one continuous experiment. Such integration results in a uniquely shaped amperometric trace that allows for the selective and sensitive determination of enzymes. 1. A method of quantifying enzyme activity comprising:placing a first composition in an electrochemical assay system, wherein the first composition comprises a substrate of an enzyme;adding a second composition to the first composition in the electrochemical assay system to create a first assay mixture, wherein the second composition comprises (a) a reactant or product of an enzymatic reaction of the enzyme, or (b) enzyme;measuring a current flowing through an electrode of the electrochemical assay system after the first assay mixture is formed;adding a third composition to the first assay mixture to create a second assay mixture, the third composition comprising the enzyme if a second composition above was (a), or a reactant or product of an enzymatic reaction of the enzyme if a second composition above was (b);measuring a current flowing through an electrode of the electrochemical assay system after the second assay mixture is formed over a predetermined time period; anddetermining the enzyme activity based on the change in current over time caused by the addition of the composition containing the enzyme.2. The method of claim 1 , further comprising measuring the changes in current by collecting an amperometric current trace or other electrochemical signal vs. time plots3. The method of or claim 1 , wherein the first composition comprises a background electrolyte.43. The method of any one of - claims 1 , wherein adding the second composition to the first composition in the electrochemical assay system comprises:adding a first aliquot of the second composition to the first ...

ANALYTICAL TEST STRIP HAVING CANTILEVERED CONTACTS

A biosensor for use as an analytical test strip is formed as a main body having a first electrode facing in a first direction, a second electrode facing in a second direction, a pair of spacers disposed between the first and second electrodes, wherein the first electrode extends from the main body of the biosensor at a first angle and the second electrode extends from the main body at a second angle transverse to the first angle. 1. A biosensor comprising:a main body;a first electrode;a second electrode, each of the first and second electrodes having a conductive surface;a pair of spacers disposed between the first and second electrodes and maintaining the first and second electrodes in a spaced apart relationship; andand wherein a portion of the first electrode is cantilevered from the main body in a first direction and a portion of the second electrode is cantilevered from the main body in a second direction and wherein the first and second directions are substantially transverse to one another.2. The biosensor of claim 1 , wherein the conductive surfaces of the first and second electrodes face one another.3. The biosensor of claim 1 , wherein the pair of spacers define a first pair of walls of a sample chamber of the biosensor.4. The biosensor of claim 3 , wherein the first and second electrodes define a second pair of walls of the sample chamber.5. The biosensor of claim 3 , wherein at least one of the second pair of walls includes a reagent deposited thereon claim 3 , and wherein the sample chamber is configured to receive a fluid sample therein claim 3 , to generate a reaction between the fluid sample and the reagent claim 3 , and to complete an electrical circuit between the first and second electrodes via the reacted fluid sample.6. The biosensor of claim 5 , wherein a portion of the first conducting surface comprises a first electrical contact pad for engaging a first electrical contact of an analyte meter when the biosensor is inserted therein.7. The ...

Biosensor for multi-analyte characterization

Embodiments of the present invention are directed to a semiconductor device. A non-limiting example of the semiconductor device includes a semiconductor substrate. The semiconductor device also includes a plurality of metal nanopillars formed on the substrate. The semiconductor device also includes an amperometric sensor associated with one of the plurality of nanopillars, wherein the amperometric sensor is selective to an enzyme-active neurotransmitter. The semiconductor device also includes a resistivity sensor associated with a pair of nanopillars, wherein the resistivity sensor is selective to an analyte.

Method and system to determine hematocrit-insensitive glucose values in a fluid sample

Various embodiments of a technique to sample output signals at different time intervals from each of the electrodes in a biosensor to obtain respective glucose estimates including one where the output signals of at least one combination of electrodes measured at various time intervals are summed together to provide for a combined glucose estimate.

PRETREATMENT METHOD AND IN-VIVO COMPONENT MEASURING DEVICE

A pretreatment method and an in-vivo component measuring device in which problems caused by bubbles is suppressed is provided. The pretreatment method uses an electrode sensor for measuring a measurement target component contained in a measurement sample collected from a subject, and a liquid used for pretreatment of measurement, the pretreatment includes step (A) for forming a droplet of liquid, step (B) for pressing the droplet of liquid onto the surface of the electrode type sensor by relative movement of the droplet of liquid and the electrode type sensor , and step (C) for removing the droplet pressed against the surface of the expression sensor 1. A pretreatment method using an electrode-type sensor for measuring a measurement target component contained in a measurement sample collected from a subject , and a liquid used for the pretreatment of the measurement , the method comprising:(A) forming a droplet of the liquid;(B) pressing the droplet against a surface of the electrode-type sensor by relative movement of the droplet and the electrode-type sensor; and(C) removing the droplet.2. The pretreatment method according to claim 1 , whereinthe forming comprises forming the droplet on a droplet forming surface provided on a counterpart object, the droplet forming surface facing the surface of the electrode-type sensor in the (A); andthe removing comprises removing the droplet from the droplet forming surface in the (C).3. The pretreatment method according to claim 1 , whereinthe (A), the (B), and the (C) are performed, and thereafter the (A), the (B), and the (C) are performed again.4. The pretreatment method according to claim 1 , whereinthe pressing comprises covering at least a part of the surface of the electrode-type sensor by deforming a shape of the droplet to a flat shape in the (B).5. The pretreatment method according to claim 2 , whereinthe forming comprises forming the droplet by sending the liquid onto the droplet forming surface from a liquid supply ...

Method for measuring components of biological sample

Provided is a method for measuring a component of a biological sample with a biosensor provided with: a capillary for introducing the biological sample; an electrode part including a first electrode system that includes a first working electrode and a first counter electrode in the capillary; and a reagent part disposed so as to be in contact with the electrode part, the reagent part containing an enzyme and a mediator, and the method including a step of starting voltage application for a duration longer than 0 second and up to 0.7 second to the first electrode system within 0 second to 0.5 second after detection of the introduction of the biological sample to obtain a hematocrit value based on a current value obtained thereby.

ORGANIC THIN FILM TRANSISTORS AND THE USE THEREOF IN SENSING APPLICATIONS

The present invention relates to organic thin film transistors and the preparation and use thereof in sensing applications, and in particular in glucose sensing applications. 1. An organic thin film transistor based sensor device , the device including:(i) a gate electrode;(ii) a dielectric layer;(iii) a semiconducting layer including at least one organic compound;(iv) a source electrode;(v) a drain electrode;(vi) a substrate; and(vii) an enzyme located in, or forming part of any one of (i)-(vi),wherein the device has top gate bottom contact configuration such that the gate electrode is disposed above the dielectric layer, and the dielectric layer is disposed above the semiconducting layer.2. The device of claim 1 , wherein the semiconducting layer is disposed above and in between the source electrode and the drain electrode.3. The device of claim 1 , wherein the source electrode and the drain electrode are disposed above the substrate.4. The device of claim 1 , wherein the gate electrode comprises a porous matrix.5. The device of claim 4 , wherein the porous matrix is a sulfonated tetrafluoroethylene-based fluoropolymer-copolymer.6. The device of claim 5 , wherein the sulfonated tetrafluoroethylene-based fluoropolymer-copolymer is a copolymer comprising a tetrafluoroethylene backbone and perfluoroalkyl ether groups terminated with sulfonate groups.7. The device of claim 6 , wherein the sulfonated tetrafluoroethylene-based fluoropolymer-copolymer is ethanesulfonic acid claim 6 , 2-[1-[difluoro[(1 claim 6 ,2 claim 6 ,2-trifluoroethenyl)oxy]methyl]-1 claim 6 ,2 claim 6 ,2 claim 6 ,2-tetrafluoroethoxy]-1 claim 6 ,1 claim 6 ,2 claim 6 ,2-tetrafluoro- claim 6 , polymer with 1 claim 6 ,1 claim 6 ,2 claim 6 ,2-tetrafluoroethene.8. The device of claim 1 , wherein the dielectric layer comprises poly(4-vinylphenol) or lithium perchlorate-doped poly(4-vinylpyridine).9. The device of claim 1 , wherein the enzyme is located in claim 1 , or forms part of claim 1 , the gate ...

ANOMALOUS SIGNAL ERROR TRAP FOR AN ANALYTE MEASUREMENT DETERMINED FROM A SPECIFIED SAMPLING TIME DERIVED FROM A SENSED PHYSICAL CHARACTERISTIC OF THE SAMPLE CONTAINING THE ANALYTE

Various embodiments for a method that allow for a more accurate analyte concentration with a biosensor by determining at least one physical characteristic of the sample and determining whether at least one output transient signal of the biosensor is erroneous by monitoring the biosensor and flagging an error if the signal outputs of the biosensor do not meet certain criteria. 1. An analyte measurement system comprising: a substrate;', 'a plurality of electrodes connected to respective electrode connectors; and, 'a test strip including a housing;', 'a test strip port connector configured to connect to the respective electrode connectors of the test strip; and', (a) apply a first signal to the plurality of electrodes so that a physical characteristic of a fluid sample is determined;', '(b) estimate an analyte concentration based on a signal output at a predetermined sampling time during a test sequence;', '(c) apply a second signal to a first electrode and a second electrode of the plurality of electrodes at a specified sampling time point or interval during the test sequence dictated by the determined physical characteristic;', '(d) measure a signal output at a plurality of time points including the specified sampling time for each of the first and second electrodes;', '(e) measure a signal output at the predetermined sampling time for each of the first and second electrodes;, 'a microprocessor in electrical communication with the test strip port connector to apply electrical signals or sense electrical signals from the plurality of electrodes, wherein the microprocessor is configured to], 'an analyte meter including(f) evaluate, for each of the first and second electrodes, whether a difference between respective magnitudes of the signal output at the specified sampling time and the predetermined sampling time is less than a predetermined threshold;(g) if the difference for each electrode is equal to or greater than the predetermined threshold then determine or ...

BIOSENSOR, THIN FILM ELECTRODE FORMING METHOD, QUANTIFICATION APPARATUS, AND QUANTIFICATION METHOD

A biosensor is disclosed comprising a support; a conductive layer composed of an electrical conductive material such as a noble metal, for example gold or palladium, and carbon; slits parallel to and perpendicular to the side of the support; working, counter, and detecting electrodes; a spacer which covers the working, counter, and detecting electrodes on the support; a rectangular cutout in the spacer forming a specimen supply path; an inlet to the specimen supply path; a reagent layer formed by applying a reagent containing an enzyme to the working, counter, and detecting electrodes, which are exposed through the cutout in the spacer; and a cover over the spacer. The biosensor can be formed by a simple method, and provides a uniform reagent layer on the electrodes regardless of the reagent composition. 144-. (canceled)45. A biosensor for quantifying a substrate in a sample liquid comprising:an insulating support;a working electrode formed from an electrically conductive layer that is made of a noble metal and is provided on a surface of the insulating support;a reagent layer on the working electrode;a spacer layer provided on and covering part of the reagent layer, where the spacer layer defines a supply path for bringing the sample liquid into contact with the reagent layer and where the supply path formed by the spacer layer is narrower than the reagent layer; anda cover provided on the spacer layer, where the cover comprises a counter electrode formed from an electrically conductive layer that is made of a noble metal and is provided on an inner surface of the cover;wherein a portion of the counter electrode and a portion of the working electrode are in the supply path,wherein part of the reagent layer is in the supply path, andwherein the noble metal provided on the insulating support and the cover is formed in turn from an inlet to the inner part of the supply path.46. The biosensor of claim 45 , wherein the noble metal is palladium claim 45 , platinum claim ...

Multi-Region And Potential Test Sensors, Methods, And Systems

Biosensor systems including a measurement device and test sensors including at least three independently addressable electrodes, with at least two of the electrodes being substantially chemically isolated are disclosed. One or more working electrodes may be combined with two or more counter electrodes. The two or more counter electrodes may operate at different potentials to provide for multi-analyte electrochemical analysis. Analysis methods are provided to perform multi-analyte electrochemical analysis and test sensors are provided having resistance to chemical mixing between secondary analysis regions.

EXAMINING TEST PAPER

The invention is related to an examining test paper which comprises an upper substrate, a lower substrate, an upper insulation sheet, a lower insulation sheet and a separator. Each of the upper and lower substrates comprises surface, a notch, a connection area, a reaction area, and an electrode layer. The notch is recessed on a proximal end. The connection area is adjacent to the notch. The reaction area and the electrode layer are defined on the surface. The upper and lower insulation sheets are respectively connected to the upper and lower substrates, and each comprises an upper surface, a lower surface, and a permeation portion. The separator is connected to the upper and lower insulation sheets and comprises two permeation portions corresponding to the permeation portions of the upper and lower insulation sheets, respectively. 1. An examining test paper comprising: a surface,', 'a proximal end,', 'a distal end opposite to the proximal end,', 'a notch recessed on the proximal end of the upper substrate,', 'a connection area formed on the upper substrate adjacent to the notch,', 'a reaction area defined on the surface near the distal end of the upper substrate, and', a distal portion overlapped with the reaction area, and', 'a proximal portion located at the connection area;, 'an electrode layer defined on the surface of the upper substrate and comprising], 'an upper substrate, being a thin film and comprising a surface,', 'a proximal end,', 'a distal end opposite to the proximal end,', 'a notch recessed on the proximal end of the lower substrate,', 'a connection area formed on lower substrate adjacent to the notch of the lower substrate,', 'a reaction area defined on the surface near the distal end of the lower substrate, and', a distal portion overlapped with the reaction area of the lower substrate, and', 'a proximal portion located at the connection area of the lower substrate;, 'an electrode layer defined on the surface of the lower substrate and comprising], ...

Test Sensors and Methods of Using The Same

A reagent composition containing GDH-PQQ as an enzyme-co-factor and screen-printed on working and counter electrodes of electrochemical biosensors, maintains activity of the enzyme reagents by proper selection of components. A preferred composition includes hydrophilic polymers, amorphous untreated silica, buffers, surfactants, and a mediator. 117-. (canceled)18. An electrochemical biosensor comprising:(a) a non porous substrate;(b) at least two electrodes disposed on said substrate; and (1) about 1-8 units of glucose dehydrogenase (GDH) and co-factor pyrrolo-quinoline quinone (PQQ), for each milligram of the total weight of said composition;', '(2) a hydrophilic polymer selected from the group consisting of cellulose derivatives, natural gums and gels, and water soluble synthetic polymers;', '(3) a thickening agent selected from the group consisting of amorphous untreated silica powder, talc, mica, diatomaceous earth, and natural and modified clays;', '(4) a buffer sufficient to maintain pH in the range of from about 4.5 to about 6.5;', '(5) a surfactant; and', '(6) a mediator., '(c) a reagent composition deposited on said at least two electrodes, said composition comprising19. The electrochemical biosensor of claim 18 , wherein said buffer is about 30 to about 200mM of an acetate claim 18 , citrate claim 18 , or succinate buffer.20. The electrochemical biosensor of claim 18 , wherein said surfactant is up to about 0.5 wt. % of an alkyl aryl polyether alcohol claim 18 , based on the total weight of said composition.21. The electrochemical biosensor of claim 18 , wherein said mediator is about 10 to about 20 wt % of potassium ferricyanide claim 18 , based on the total weight of said composition.2223-. (canceled)24. The electrochemical biosensor of claim 18 , wherein said hydrophilic polymer is about 2 to about 10 wt % of a cellulose derivative selected from the group consisting of sodium carboxy methyl cellulose claim 18 , hydroxy ethyl cellulose claim 18 , hydroxy ...

METHOD OF MEASURING BLOOD COMPONENT, SENSOR USED IN THE METHOD, AND MEASURING DEVICE

The present invention provides a method of measuring a component in blood, by which an amount of the component can be corrected accurately by measuring a hematocrit (Hct) value of the blood with high accuracy and high reliability and also provides a sensor used in the method. The method of measuring a component in blood using a biosensor comprising a first electrode system including a first working electrode on which at least an oxidoreductase that acts upon the component and a mediator are provided and a first counter electrode and a second working electrode on which the mediator is not provided. The first working electrode and the first counter electrode are used for obtaining the amount of the component and the second working electrode and the first working electrode are used for obtaining the amount of the blood cells. 143-. (canceled)44. A method of determining an amount of a component in blood using a biosensor comprising a first electrode , a second electrode , and a reagent layer comprising a mediator and an oxidoreductase , said reagent layer disposed on the second electrode;the method comprising:applying a first voltage to the first electrode and a second voltage to the second electrode such that the first electrode acts as a working electrode and the second electrode acts as a counter electrode;detecting a first current value generated by the application of the first voltage and the second voltage;applying a third voltage to the second electrode such that the second electrode acts as a working electrode; anddetecting a second current value generated by the application of the third voltage.; andcalculating an amount of the component using the first current value and the second current value.45. The method of claim 44 , wherein the reagent layer is not disposed on the first electrode.46. The method of claim 44 , wherein the second electrode has a negative polarity when it acts as a counter electrode.47. The method of claim 44 , wherein the second electrode ...

Analyte Determination Method and Analyte Meter

The presence of oxygen or red blood cells in a sample applied to an electrochemical test strip that makes use of a reduced mediator is corrected for by an additive correction factor that is determined as a function of the temperature of the sample and a measurement that reflects the oxygen carrying capacity of the sample. The measured oxygen carrying capacity can also be used to determine hematocrit and to distinguish between blood samples and control solutions applied to a test strip.

Method of Correcting For Oxygen Effect

An electrochemical test sensor is adapted to measure glucose and correct for the oxygen effect in a fluid sample. The test sensor comprises a base, first and second working electrodes, and a counter electrode. The first working electrode includes glucose oxidase, a mediator and peroxidase. The second working electrode includes glucose oxidase and the mediator. The first working electrode, the second working electrode and the counter electrode are located on the base. In other embodiments, an electrochemical test sensor is adapted to measure cholesterol, lactate, pyruvate or xanthine and correct for the oxygen effect in a fluid sample. 1. An electrochemical test sensor adapted to measure glucose and correct for the oxygen effect in a fluid sample , the test sensor comprising:a base;a first working electrode including glucose oxidase, a mediator and peroxidase;a second working electrode including glucose oxidase and the mediator; and a a counter electrode,wherein the first working electrode, the second working electrode and the counter electrode are located on the base.272-. (canceled) The present invention relates generally to a test sensor that corrects for the oxygen effect and a method of using the same. More specifically, the present invention relates to a test sensor using reagents (e.g., glucose oxidase) that assists in determining the analyte concentration (e.g., glucose concentration) in a fluid and corrects for the oxygen effect.The quantitative determination of analytes in body fluids is of great importance in the diagnoses and maintenance of certain physiological abnormalities. In particular, it is important that diabetic individuals frequently check the glucose level in their body fluids to regulate the glucose intake in their diets. The results of such tests can be used to determine what, if any, insulin or other medication needs to be administered. In one type of blood-glucose testing system, test sensors are used to test a sample of blood.A test sensor ...

BIOSENSOR AND DETECTION DEVICE

A TFT biosensor includes a gate electrode (silicon substrate), a reference electrode, and enzyme that is fixed to an insulating substrate spatially separated from the gate electrode and the reference electrode. A pH variation in the vicinity of an ion-sensitive insulating film is induced by a reaction between the enzyme and a sensing object material. The TFT biosensor can detect a concentration of the sensing object material with high sensitivity by detecting the pH variation as a threshold voltage shift of characteristics of a gate-source voltage to a source-drain current. 1. A biosensor , comprising:a semiconductor active layer;a gate insulating film that is provided on a first surface of the semiconductor active layer, and insulates the semiconductor active layer and a gate electrode from each other;an ion-sensitive insulating film that is provided on a second surface of the semiconductor active layer, and includes a region that comes into contact with a solution; andan enzyme that is fixed at a position spatially separated from the region, and reacts with a material in the solution to allow a potential variation in the region to occur,wherein an electrostatic capacity per unit area of the ion-sensitive insulating film is greater than an electrostatic capacity per unit area of the gate insulating film.2. The biosensor according to claim 1 , further comprising:a detection unit that detects a potential on the ion-sensitive insulating film after amplifying the potential with a value of a ratio obtained by dividing the electrostatic capacity per unit area of the ion-sensitive insulating film by the electrostatic capacity per unit area of the gate insulating film.3. The biosensor according to claim 1 , further comprising:a mechanism that controls a flow of a sensing object material between the ion-sensitive insulating film and the enzyme that is fixed to the position spatially separated from the ion-sensitive insulating film.4. The biosensor according to claim 1 , ...

Cationic Polymer Based Wired Enzyme Formulations for Use in Analyte Sensors

Embodiments of the invention include analyte-responsive compositions and electrochemical analyte sensors having a sensing layer that includes an analyte-responsive enzyme and a cationic polymer. Also provided are systems and methods of making the sensors and using the electrochemical analyte sensors in analyte monitoring. 160-. (canceled)61. An analyte sensor assembly , comprising:an electrochemical sensor comprising:a substrate comprising a working electrode and a counter electrode or a counter/reference electrode;a sensing layer disposed on the working electrode, wherein the sensing layer comprises a glucose-responsive enzyme, a cationic polymer selected from the group consisting of polyallylamine (PAH), polyethyleneimine (PEI), poly(L-lysine) (PLL), or poly(L-arginine) (PLA), and a positively charged redox mediator non-covalently associated with the cationic polymer; anda transmitter unit operatively coupled to the electrochemical sensor to receive signals from the electrochemical sensor corresponding to an analyte level of a subject.62. The analyte sensor of claim 61 , wherein at least a portion of the sensor is adapted to be subcutaneously positioned in a subject.63. The analyte sensor of claim 61 , wherein the analyte-responsive enzyme is glucose oxidase (GOx).64. The analyte sensor of claim 61 , wherein the analyte-responsive enzyme is a dehydrogenase.65. The analyte sensor of claim 64 , wherein the dehydrogenase is glucose dehydrogenase (GDH).66. The analyte sensor of claim 65 , wherein the glucose dehydrogenase is associated with a co-factor.67. The analyte sensor of claim 66 , wherein the co-factor is flavin adenine dinucleotide (FAD) claim 66 , nicotinamide adenine dinucleotide (NAD) claim 66 , or pyrroloquinoline quinone (PQQ).68. The analyte sensor of claim 64 , wherein the dehydrogenase comprises a complex of glucose dehydrogenase (GDH) and flavin adenine dinucleotide (FAD).69. The analyte sensor of claim 61 , further comprising a flux limiting layer ...

BIOSENSOR FOR MULTI-ANALYTE CHARACTERIZATION

Embodiments of the present invention are directed to a semiconductor device. A non-limiting example of the semiconductor device includes a semiconductor substrate. The semiconductor device also includes a plurality of metal nanopillars formed on the substrate. The semiconductor device also includes an amperometric sensor associated with one of the plurality of nanopillars, wherein the amperometric sensor is selective to an enzyme-active neurotransmitter. The semiconductor device also includes a resistivity sensor associated with a pair of nanopillars, wherein the resistivity sensor is selective to an analyte. 1. A computer-implemented method of multi-analyte detection , the method comprising:receiving, by a processor, a signal from a multi-analyte sensor in contact with a biological tissue, wherein the multi-analyte sensor comprises a resistivity sensor and an amperometric sensor;determining, by the processor, a resistivity value from the resistivity sensor;generating, by the processor, a concentration of a first analyte based at least in part upon the resistivity value;determining, by the processor, an electrical current from the amperometric sensor; andgenerating, by the processor, a concentration of a second analyte based at least in part upon the electrical current.2. The computer-implemented method of claim 1 , wherein the biological tissue comprises neuronal tissue.3. The computer-implemented method of claim 1 , wherein the first analyte is dopamine.4. The computer-implemented method of claim 1 , wherein the second analyte comprises an enzyme-active neurotransmitter.5. The computer-implemented method of claim 4 , wherein the amperometric sensor is selective to the enzyme-active neurotransmitter.6. The computer-implemented method of claim 5 , wherein the enzyme-active neurotransmitter is selected from the group consisting of glutamate claim 5 , lactate claim 5 , glucose claim 5 , choline claim 5 , adenosine claim 5 , and gamma-amino-butyric acid (GABA).7. The ...

Method for rapid identification of pharmacologically active chemical entities associated with the efficacy of ethnobotanical substances

The method includes the steps of performing in-vitro liver, intestinal and/or expressed enzyme assays with selected ethnobotanical substances, for both humans and a variety of animal species, to produce an array of resulting chemical entities, such as metabolites, for the human and the animals. Comparisons are then made between the chemical entities from the human in-vitro studies and the animal in-vitro studies to determine the closest match. The animal with the closest match is then used for an in-vivo study. If a match is present between the animal in-vivo results and the human in-vitro results, the matched chemical entity is isolated or synthesized and then further tested to determine the suitability of the matched chemical entity as a treatment drug.

ANALYTICAL TEST STRIP

An analytical test strip has mutually-insulated first and second electrodes arranged to define a sample-receiving chamber. Electrically-insulating layers are disposed over respective electrodes. First and second electrical contact pads are electrically connected to the first electrode, and a third pad to the second electrode. A first side of the test strip has a first electrically-insulating layer and the third pad, and a second side has the second electrically-insulating layer and the first and second pads. The third pad extends longitudinally from the sample-receiving chamber farther than does the first electrically-insulating layer. Methods for determining an analyte in a bodily-fluid sample and analytical test systems for use in the determination of an analyte in a bodily-fluid sample are also described. 1. An analytical test strip having a first side and an opposing second side , said test strip being defined by a longitudinal axis and a lateral axis , the analytical test strip comprising:a) a first electrode and a second electrode electrically insulated from said first electrode, wherein said first and second electrodes are arranged to define a sample-receiving chamber;b) a first electrically-insulating layer disposed over said first electrode, and a second electrically-insulating layer disposed over said second electrode;c) a first electrical contact pad and a second electrical contact pad electrically connected to the first electrical contact pad, the first and second electrical contact pads electrically connected to the first electrode; andd) a third electrical contact pad electrically connected to the second electrode;wherein the first side comprises the first electrically-insulating layer and the third electrical contact pad, and the second side comprises the second electrically-insulating layer and the first and second electrical contact pads; andwherein the third electrical contact pad extends longitudinally from the sample-receiving chamber farther ...

METHOD OF A TEST STRIP DETECTING CONCENTRATION OF AN ANALYTE OF A SAMPLE, THREE-ELECTRODE TEST STRIP, AND METHOD OF UTILIZING A TEST STRIP DETECTING DIFFUSION FACTOR

A method of a test strip detecting concentration of an analyte of a sample includes placing the sample in a reaction region of the test strip, wherein the analyte reacts with an enzyme to generate a plurality of electrons, and the plurality of electrons are transferred to a working electrode of the reaction region through a mediator; applying an electrical signal to the working electrode; measuring a first current through the working electrode during a first period; the mediator generating an intermediate according to the electrical signal during a second period; measuring a second current through the working electrode during a third period; calculating initial concentration of the analyte according to the first current; calculating a diffusion factor of the intermediate in the sample according to the second current; and correcting the initial concentration to generate new concentration of the analyte according to the diffusion factor. 1. A method of a test strip detecting concentration of an analyte of a sample , wherein the test strip comprises a substrate and a reaction region , the reaction region comprises a working electrode , a reference electrode , and a counter electrode , and an enzyme is coated in the reaction region , the method comprising:placing the sample in the reaction region, wherein the analyte reacts with the enzyme to generate a plurality of electrons, and the plurality of electrons are transferred to the working electrode through a mediator;applying an electrical signal to the working electrode;measuring a first current through the working electrode during a first period;the mediator generating an intermediate according to the electrical signal during a second period;measuring a second current through the working electrode during a third period, wherein a second polarity of the electrical signal during the second period is inverse to a first polarity of the electrical signal during the first period and a third polarity of the electrical signal ...

ENZYME MATRICES FOR USE WITH ETHYLENE OXIDE STERILIZATION

The invention pertains to analyte sensors designed to include layered compositions that provide these sensors with enhanced functional and/or material properties including, for example, resistance to damage caused by ethylene oxide during sterilization processes. Embodiments of the invention include polyvinyl alcohol N-methyl-4(4′-formylstyryl)pyridinium (SbQ) polymer materials and methods for employing such materials during the ethylene oxide sterilization of glucose sensors. 1. A method of sterilizing a device comprising a glucose oxidase composition , the method comprising:disposing the device in a chamber; wherein:', 'the glucose oxidase is disposed within a composition comprising a polyvinyl alcohol polymer comprising N-methyl-4(4′-formylstyryl)pyridinium (PVA-SbQ); and', 'amounts of PVA-SbQ in the composition are selected to be sufficient to inhibit ethylene oxide damage to the glucose oxidase in the composition; and, 'introducing ethylene oxide vapor into the chamber;'} 'so that the device comprising a glucose oxidase composition is sterilized.', 'performing an ethylene oxide vapor sterilization process;'}2. The method of claim 1 , wherein the glucose oxidase composition comprises PVA-SbQ in an amount from 5% to 15% by weight.3. The method of claim 2 , wherein the glucose oxidase composition comprises glucose oxidase in an amount from 10 KU/mL to 20 KU/mL.4. The method of claim 3 , wherein the glucose oxidase composition comprises polyvinyl alcohol having a molecular weight from 25 kilodaltons to 125 kilodaltons.5. The method of claim 4 , wherein the glucose oxidase composition comprises 1.0% to 4.0% N-methyl-4(4′-formylstyryl)pyridinium.6. The method of claim 5 , wherein the glucose oxidase composition comprises a layer that is between 4 and 12 microns in thickness.7. The method of claim 1 , wherein:the method uses ethylene oxide vapor in a concentration range from 50 to 1,500 mg/L;the method uses humidity in a range from 30% to 90%;the methods is performed ...

Method of Screen Printing On a Substrate

A test sensor reagent for measuring the concentration of analytes in body fluids includes cellulose polymers for improving the stability of the test sensor and reducing the total assay time. The test sensor reagent also includes an enzyme, an electron transfer mediator and a rheological additive.

ANALYSIS AND SCREENING OF CELL SECRETION PROFILES

Embodiments disclose apparatus, methods and software for performing biological screening and analysis implemented using an instrument platform capable of detecting a wide variety of cell-based secretions, expressed proteins, and other cellular components. The platform may be configured for simultaneous multiplexed detection of a plurality biological components such that a large number of discrete samples may be individually sequestered and evaluated to detect or identify constituents from the samples in a highly parallelized and scalable manner. 1. A system for discretely resolving analytes associated with a cellular population comprising:a plurality of sample retention regions that receive at least one cell distributed from a population of cells and retain an associated plurality of analytes released by the at least one cell;a plurality of analyte detection regions patterned with a plurality of discretely positioned analyte detection moieties, the analyte detection regions disposed in an ordered pattern alignable with the sample retention regions whereby, upon coupling, released analytes selectively associate with the plurality of analyte detection moieties forming an analyte pattern for each analyte detection region;a plurality of first alignment markers disposed about the plurality of sample retention regions and a plurality of second alignment markers disposed about the plurality of analyte detection regions;an imaging apparatus that generates a plurality of images for selected sample retention regions and retained at least one cell and additionally at least one first alignment marker, the imaging apparatus further generating a plurality of images for analyte detection regions corresponding to the selected sample regions and associated analyte patterns and additionally at least one second alignment marker; andan image processor that aligns associated images for selected sample retention regions using the at least one first alignment marker and further aligns ...

ENZYME MATRICES FOR USE WITH ETHYLENE OXIDE STERILIZATION

The invention pertains to analyte sensors designed to include layered compositions that provide these sensors with enhanced functional and/or material properties including, for example, resistance to damage caused by ethylene oxide during sterilization processes. Embodiments of the invention include polyvinyl alcohol N-methyl-4(4′-formylstyryl)pyridinium (SbQ) polymer materials and methods for employing such materials during the ethylene oxide sterilization of glucose sensors. 1. A method of making an analyte sensor apparatus comprising:disposing a working electrode, a reference electrode, and a counter electrode on a base layer;disposing an analyte sensing layer over the working electrode, wherein:the analyte sensing layer comprises glucose oxidase disposed within a polyvinyl alcohol polymer comprising N-methyl-4(4′-formylstyryl)pyridinium (PVA-SbQ);the PVA-SbQ polymer is selected for an ability to inhibit damage to glucose oxidase by ethylene oxide; anddisposing an analyte modulating layer disposed over the analyte sensing layer, wherein the analyte modulating layer modulates the diffusion of analyte therethrough;so that an analyte sensor apparatus is made.2. The method of claim 1 , wherein the analyte sensing layer:(a) comprises PVA-SbQ in an amount from 5% to 15% by weight;(b) comprises glucose oxidase in an amount from 10 KU/mL to 20 KU/mL;(c) comprises polyvinyl alcohol having a molecular weight from 25 kilodaltons to 125 kilodaltons;(d) comprises 1.0% to 4.0% N-methyl-4(4′-formylstyryl)pyridinium; and/or(e) is between 4 and 12 microns in thickness.3. The method of claim 1 , wherein the analyte sensor apparatus comprises a further layer disposed over the analyte sensing layer claim 1 , wherein the further layer:(a) comprises PVA-SbQ;(b) comprises a hydrophilic polyurethane;(c) does not include an albumin; and/or(d) is between 1 and 3 microns in thickness.4. The method of claim 1 , wherein the analyte modulating layer comprises: (a) a diisocyanate;', '(b) a ...

Measurement Method Using Oxidase

A method for measuring a target object in a sample by using an oxidase, wherein the influence of dissolved oxygen in the sample can be corrected, is provided. The method comprises: obtaining measurement values by causing the target object in the sample to react with the oxidase under different conditions of two or more types; and performing a correction based on the obtained two or more measurement values and a correction method preliminarily set so as to correct the influence of dissolved oxygen in the sample. 14-. (canceled)5. A biosensor comprising:two or more independent electrode systems each of which comprises a working electrode and a counter electrode provided on a substrate;and oxidase-containing reagents provided respectively on the two or more electrode systems, the oxidase-containing reagents being capable of measuring a single target object in a single sample under different conditions.6. A measurement device comprising:a sensor section for obtaining information about measurement results obtained from reactions between a target object in a sample and an oxidase under different conditions of two or more types;a memory section for storing a correction method;an arithmetic section for selecting the correction method stored in the memory section based on the information obtained by the sensor section, and calculating a corrected value of the information by the correction method;and a display section for displaying the corrected value.7. The biosensor according to claim 5 , wherein the sample is selected from the group consisting of blood claim 5 , plasma claim 5 , serum and urine.8. The biosensor according to claim 5 , wherein the sample is blood.9. The measurement device according to claim 6 , wherein the target object is selected from the group consisting of glucose claim 6 , lactic acid claim 6 , bilirubin claim 6 , cholesterol and ascorbic acid.10. The measurement device according to claim 6 , wherein the target object is glucose.11. The biosensor ...

Enzyme Electrode

An enzyme electrode includes an electrode, and a detection layer that is in contact with the electrode and includes an oxidoreductase, a water-soluble conductive polymer, and conductive particles, electrons being transferred between the enzyme and the electrode by direct electron transfer in the detection layer.

HbA1c DEHYDROGENASE

This invention provides an HbA1c dehydrogenase that is capable of directly acting on hemoglobin A1c and is less likely to be influenced by oxygen concentration and a method for measurement and a kit of assay reagents using such HbA1c dehydrogenase. The HbA1c dehydrogenase having dehydrogenase activity and capable of directly acting on HbA1c is obtained by substitution of one or more amino acid residues at positions corresponding to positions 280, 269, 54, 241, and 267 of the amadoriase that is capable of directly acting on hemoglobin A1c and is derived from, for example, the genus . This invention also provides a method for measurement of HbA1c, a kit of assay reagents, and a sensor using such HbA1c dehydrogenase. Such HbA1c dehydrogenase is capable of directly acting on hemoglobin A1c and has lowered oxidase activity and/or enhanced dehydrogenase activity. This not only eliminates the need for treatment of hemoglobin A1c with a protease but also enables the use of an electron mediator in the measurement of HbA1c, thereby reducing effects due to oxygen concentration, and enables HbA1c measured with high sensitivity. 1. A method for measurement of hemoglobin A1c in a sample comprising contacting an HbA1c dehydrogenase capable of directly acting on hemoglobin A1c with hemoglobin A1c in a sample and measuring a reduced electron mediator that is not hydrogen peroxide generated by the action or an oxidized electron mediator that is not oxygen consumed by the action , wherein the hemoglobin A1c in the sample is not degraded by a protease.2. The method for measurement according to claim 1 , wherein said measurement is an electrochemical measurement using an HbA1c dehydrogenase claim 1 , an enzyme electrode comprising HbA1c dehydrogenase or an enzyme sensor comprising claim 1 , as a working electrode claim 1 , said enzyme electrode claim 1 , and an electron mediator that is not oxygen or wherein said measurement is an absorbance measurement using HbA1c dehydrogenase claim 1 ...

Method And Apparatus For Implementing Threshold Based Correction Functions For Biosensors

A biosensor system, method and apparatus are provided for implementing threshold based correction functions for biosensors. A primary measurement of an analyte value is obtained. A secondary measurement of a secondary effect is obtained and is compared with a threshold value. A correction function is identified responsive to the compared values. The correction function is applied to the primary measurement of the analyte value to provide a corrected analyte value. The correction method uses correction curves that are provided to correct for an interference effect. The correction curves can be linear or non-linear. The correction method provides different correction functions above and below the threshold value. The correction functions may be dependent or independent of the primary measurement that is being corrected. The correction functions may be either linear or nonlinear. 1. A method for implementing threshold based correction functions for a biosensor comprising the steps of:applying a sample to the biosensor and obtaining a primary measurement of an analyte value;obtaining a secondary measurement of a secondary effect;comparing said secondary measurement of the secondary effect with a threshold value;responsive to said compared values, identifying a correction function; andapplying said identified correction function to said primary measurement to provide a corrected analyte value.2. A method for implementing threshold based correction functions for a biosensor as recited in wherein the step responsive to said compared values claim 1 , of identifying a correction function includes the steps of identifying said secondary measurement of the secondary effect less than or equal to said threshold value claim 1 , identifying a first coefficient A claim 1 , said first coefficient A to control magnitude of said correction function.5. A method for implementing threshold based correction functions for a biosensor as recited in wherein the step responsive to said ...

Standby Biasing Of Electrochemical Sensor To Reduce Sensor Stabilization Time During Measurement

An eye-mountable device includes an electrochemical sensor embedded in a polymeric material configured for mounting to a surface of an eye. The electrochemical sensor applies a stabilization voltage between a working electrode and a reference electrode to allow the amperometric current to stabilize before powering measurement electronics configured to measure the amperometric current and communicate the measured amperometric current. The electrochemical sensor consumes less power while applying the stabilization voltage than during the measurement. The measurement is initiated in response to receiving a measurement signal at an antenna in the eye-mountable device. 1. A method comprising:applying a stabilization voltage between a working electrode and a reference electrode in an eye-mountable device, wherein the stabilization voltage is sufficient to cause an analyte to undergo an electrochemical reaction at the working electrode;while the stabilization voltage is being applied, wirelessly receiving a measurement signal at an antenna in the eye-mountable device;responsive to receiving the measurement signal, activating measurement electronics in the eye-mountable device to transition the measurement electronics from a standby mode to an active mode, wherein the measurement electronics consume more power in the active mode than in the standby mode; andduring the active mode, operating the measurement electronics to (i) measure an amperometric current through the working electrode, wherein the amperometric current is related to the analyte, and (ii) wirelessly communicate the measured amperometric current via the antenna.2. The method according to claim 1 , further comprising:after wirelessly communicating the measured amperometric current via the antenna, de-activating the measurement electronics to transition the measurement electronics from the active mode to the standby mode.3. The method according to claim 1 , further comprising intermittently activating the ...

ELECTROCHEMICAL TEST DEVICE

An electrochemical test device for determining a concentration of an analyte in a fluid sample is provided. The electrochemical test device comprises a set of electrodes including a working electrode for the analyte and sensing chemistry for the working electrode, wherein the sensing chemistry is disposed on the working electrode in at least one layer, each layer comprising a diaphorase, an electron transfer agent having a standard redox potential in the range of −0.52 to 0.18 V, an NAD(P)-dependent dehydrogenase and a cofactor for the NAD(P)-dependent dehydrogenase. 1. An electrochemical test device for determining a concentration of an analyte in a fluid sample , the electrochemical test device comprising a set of electrodes including a working electrode for the analyte and sensing chemistry for the working electrode , wherein the sensing chemistry is disposed on the working electrode in at least one layer , each layer comprising a diaphorase , an electron transfer agent having a standard redox potential in the range of −0.52 to 0.18 V , an NAD(P)-dependent dehydrogenase and a cofactor for the NAD(P)-dependent dehydrogenase.2. An electrochemical test device according to claim 1 , wherein the test device is for determining a concentration of glycerol and the NAD(P)-dependent dehydrogenase is glycerol dehydrogenase.3. An electrochemical test device according to claim 1 , wherein the test device is for determining a concentration of β-hydroxybutyrate and the NAD(P)-dependent dehydrogenase is β-hydroxybutyrate dehydrogenase.4. An electrochemical test device according to claim 1 , wherein the test device is for determining a concentration of glucose and the NAD(P)-dependent dehydrogenase is NAD-glucose dehydrogenase.5. An electrochemical test device according to claim 1 , wherein the at least one layer comprises two or more layers; and/orwherein the at least one layer is two layers.6. (canceled)7. A composition comprising a diaphorase claim 1 , an electron transfer ...

Method of measuring blood component, sensor used in the method, and measuring device

The present invention provides a method of measuring a component in blood, by which an amount of the component can be corrected accurately by measuring a hematocrit (Hct) value of the blood with high accuracy and high reliability and also provides a sensor used in the method. The method of measuring a component in blood using a biosensor comprising a first electrode system including a first working electrode on which at least an oxidoreductase that acts upon the component and a mediator are provided and a first counter electrode and a second working electrode on which the mediator is not provided. The first working electrode and the first counter electrode are used for obtaining the amount of the component and the second working electrode and the first working electrode are used for obtaining the amount of the blood cells.

COMPOSITIONS AND METHODS FOR ANTIGEN DETECTION INCORPORATING INORGANIC NANOSTRUCTURES TO AMPLIFY DETECTION SIGNALS

The disclosure relates to antigen detection reagents and related methods, systems, and kits. The reagents comprise an antigen-binding molecule conjugated to an inorganic component. In some embodiments, the inorganic component possesses catalytic functionality to provide a detectable signal. In some embodiments, the catalytic inorganic component is or comprises a bimetallic nanoparticle. In other embodiments, the inorganic component is a nanoflowers that provides a physical scaffold onto which the antigen-binding component and a reporter component can be loaded, resulting in augmented antigen-binding and reporting capabilities. 114-. (canceled)15. A method of detecting an antigen of interest , comprising:contacting a sample with an antigen detection reagent under conditions sufficient to permit the selective binding of the antigen detection reagent to the antigen of interest, wherein the antigen detection reagent comprises one or more antigen-binding molecules conjugated to a mesoporous bimetallic nanoparticle with a diameter of from 35 nm to 50 nm, and wherein the mesoporous bimetallic nanoparticle is selected from a platinum (Pt)-gold (Au) bimetallic nanoparticle (Pt/Au NP), a platinum (Pt)-palladium (Pd) bimetallic nanoparticle (Pt/Pd NP), a platinum (Pt)-cobalt (Co) bimetallic nanoparticle (Pt/Co NP), a platinum (Pt)-nickel (Ni) bimetallic nanoparticle (Pt/Ni NP), or a platinum (Pt)-iron (Fe) bimetallic nanoparticle (Pt/Fe NP);contacting the bound antigen detection reagent with a substrate, thereby producing a product; anddetecting the presence of the product, thereby indicating the presence of the antigen of interest.16. The method of claim 15 , wherein the conversion of the substrate to the product provides a detectable signal.1720-. (canceled)21. The method of claim 15 , wherein the bimetallic nanoparticle has catalytic activity.22. The method of claim 21 , wherein the bimetallic nanoparticle has peroxidase activity.23. The method of claim 22 , wherein the ...

Electron-Conducting Crosslinked Polyaniline-Based Redox Hydrogel, and Method of Making

A polymer matrix that may coated on an electrode is created by co-crosslinking (1) an adduct of a polyaniline formed by templated oxidative polymerization on a polymer acid; (2) a water-soluble crosslinker; and (3) a redox enzyme. The polymer matrix may be hydrated, and the absorbed water may make it permeable to, for example, glucose. The polyaniline may be polyaniline itself or a substituted polyaniline; the water-soluble crosslinker may be poly(ethylene glycol)diglycidyl ether, and the redox enzyme may be glucose oxidase. The polymer matrix may be produced by co-crosslinking (1) an adduct of an electrically conductive polymer and a polymer acid; (2) a water-soluble crosslinker; and (3) a redox enzyme in a single step at an about neutral pH, curing by drying. After hydration, the crosslinked polymer matrix may form a 3-dimensional glucose-permeable bioelectrocatalyst, catalyzing the electrooxidation of glucose.

Mediator-Stabilized Reagent Compositions for Use in Biosensor Electrodes

The claimed subject matter relates to the stabilization of 1,2-quinone mediators, especially those containing 1,10-phenanthroline quinone (PQ) and more especially transition metal complexes of PQ, in the presence of enzymes when contained in dry reagent layers for biosensor electrodes, through the use of various metal salts, particularly those of lithium. 125-. (canceled)26. A method of determining concentration of an analyte , the method comprising: an electrode support;', 'a working electrode disposed on the electrode support;', an enzyme, and', a first metal ion chemically bonded to a first compound comprising an oxygen atom; and', 'a second metal ion chemically bonded to the oxygen atom of the first compound;, 'a redox mediator complex comprising], 'a reagent composition deposited on the working electrode, wherein the reagent composition comprises], 'contacting a sample with a biosensor strip comprisingapplying a potential to the working electrode;measuring a current from the working electrode; anddetermining the analyte concentration.27. The method according to claim 26 , wherein the applied potential to the working electrode ranges from −0.4 V to 0.4 V.28. The method according to claim 27 , wherein the applied potential to the working electrode is 200 mV.29. The method according to claim 26 , wherein the measured current is proportional to the analyte concentration30. The method according to claim 26 , wherein the redox mediator complex comprises at least one compound comprising a 1 claim 26 ,2-quinone moiety.31. The method according to claim 30 , wherein the at least one compound comprising a 1 claim 30 ,2-quinone moiety is 1 claim 30 ,10-phenathroline quinone claim 30 , or a derivative thereof.32. The method according to claim 26 , wherein the first metal ion is selected from the group consisting of nickel claim 26 , manganese claim 26 , iron claim 26 , cobalt claim 26 , osmium or ruthenium.33. The method according to claim 26 , wherein the first metal ion ...

Analyte Test Sensor And Method Of Manufacturing The Same

An analyte test sensor for use in measuring the concentration of a particular analyte in a test sample includes a non-conductive substrate, a reference electrode deposited on the substrate, a working electrode deposited on the substrate and a compensation electrode deposited on the substrate. The compensation electrode is provided with a resistive ladder and is designed to correct for test result inaccuracies which are the result of variances in the manufacturing of the test sensor. Specifically, in one embodiment, the compensation electrode corrects for test result inaccuracies in an analog manner by shunting a portion of the working current away from working electrode. In another embodiment, the compensation electrode corrects for test result inaccuracies in a digital manner by providing a calibration code which is proportional its resistance value. A batch of analyte test sensors are preferably manufactured in the following manner. An initial batch of the test sensors is constructed. Then, a limited sampling of the sensors is tested for accuracy using a control sample. Based on the test results, the resistance value of the compensation electrode for each remaining sensor in the batch is adjusted accordingly. 118-. (canceled)19. A method of making a plurality of calibration-adjusted sensors , the method comprising:applying a known voltage to an electrode pair of the first sensor from a first batch of sensors to produce a working current through the electrode pair of the first sensor;measuring the working current of the first sensor in the presence of a control sample;comparing the measured working current to a target working current;modifying the resistance of an electrode pair of a second sensor from the first batch of sensors if the measured working current is not the same as the target working current;measuring a working current of the second sensor in the presence of a control sample to confirm that when the known voltage is applied to the electrode pair of ...

BIOLOGICAL TEST SHEET

A biological test sheet includes an insulating substrate, an electrode structure, a first insulating septum and an insulating layer. The electrode structure is disposed on the insulating substrate and has at least one top surface and at least one side surface, and the side surface is connected between at least one fringe of the top surface and the insulating substrate. The first insulating septum is disposed on the insulating substrate and partially covers the electrode structure. The first insulating septum has a notch, and the notch exposes a first segment of the electrode structure. The insulating layer covers the fringe of the top surface and the side surface at the first segment of the electrode structure. 1. A biological test sheet , comprising:an insulating substrate;an electrode structure, disposed on the insulating substrate and having at least one top surface and at least one side surface, wherein the side surface is connected between at least one fringe of the top surface and the insulating substrate;a first insulating septum, disposed on the insulating substrate and partially covering the electrode structure, wherein the first insulating septum has a notch, and the notch exposes a first segment of the electrode structure; andan insulating layer, covers the fringe of the top surface and the side surface at the first segment of the electrode structure.2. The biological test sheet as recited in claim 1 , wherein a junction between the fringe of the top surface and the side surface is covered by the insulating layer.3. The biological test sheet as recited in claim 1 , wherein the insulating layer contacts the fringe of the top surface and the side surface.4. The biological test sheet as recited in claim 1 , wherein a second segment of the electrode structure is covered by the first insulating septum claim 1 , and the insulating layer covers the fringe of the top surface and the side surface at the second segment of the electrode structure.5. The biological ...

TEST STRIP, DETECTING DEVICE AND DETECTING METHOD

A test strip, a detecting device, and a detecting method are disclosed. The test strip includes a first specimen path, a first electrode set, a second specimen path, a second electrode set, and a reaction reagent. When the specimen contacts the first electrode set and the second electrode set, a first pulse signal and a second pulse signal are generated for obtaining a flow time of the specimen. When the specimen contacts the reaction reagent, the analyte concentration of the specimen can be obtained, and the concentration of the analyte can be corrected by the flow time. 1. A test strip used with an electrochemical instrument to detect a specimen , the test strip comprising:a first specimen path comprising an inlet end;a first electrode set having at least a portion thereof disposed in the first specimen path, the first electrode set at least comprising a first electrode and a first reference electrode;a second specimen path comprising a discharge end, the second specimen path connected to the first specimen path;a second electrode set having at least a portion thereof disposed in the second specimen path, the second electrode set at least comprising a working electrode and a second reference electrode;a reaction reagent disposed in the second specimen path, the reaction reagent at least comprising an enzyme for detecting a concentration of the analyte of the specimen;when the test strip receives a first voltage and a second voltage, a first impulse signal is generated when the specimen is in contact with the first electrode and the first reference electrode, and a second impulse signal is generated when the specimen is in contact with the first reference electrode and the working electrode, thereby obtaining a flow time of the specimen according to the first impulse signal and the second impulse signal, and the flow time can be used to correct the concentration of the analyte of the specimen.2. The test strip as claimed in claim 1 , wherein the first voltage is ...

LAYERED MICROFLUIDIC LIVING CELL ARRAY

A layered, microfluidic living cell array is disclosed. The cell array comprises a first layer comprising at least one cell culture channel; a second layer comprising at least one microfluidic channel; and a third layer, disposed between the first layer and the second layer. The third layer comprises a filter membrane with a plurality of pores, each pore fluidly connecting the microfluidic channel to the cell culture channel. 1. A layered , microfluidic living cell array , comprising:a first layer comprising at least one cell culture channel extending in a longitudinal direction;a second layer comprising at least one microfluidic channel;a third layer, disposed between the first layer and the second layer, the third layer comprising a filter membrane with a plurality of pores, each pore fluidly connecting the microfluidic channel of the second layer to the cell culture channel of the first layer;a fluid inlet connected to a first end of the microfluidic channel;a fluid outlet connected to a second end of the microfluidic channel.2. The cell array as recited in claim 1 , wherein the culture channel further comprises a plurality of cell culture chambers that are fluidly connected by the cell culture channel.3. The cell array as recited in claim 2 , wherein the pores are grouped into nests of pores claim 2 , each nest vertically stacked above a corresponding cell culture chamber in the plurality of cell culture chambers.4. The cell array as recited in claim 3 , wherein the ratio of nests to cell culture chambers is a one-to-one ratio.5. The cell array as recited in claim 2 , wherein the cell culture chambers in the plurality of cell culture chambers are circular with a diameter of about 100 micrometers to about 800 micrometers.6. The cell array as recited in claim 1 , wherein the pores have a diameter of about 10 micrometers to about 40 micrometers.7. The cell array as recited in claim 1 , wherein the microfluidic channels have a width between about 50 micrometers and ...

METHOD FOR STERILIZING MEMBRANE COMPRISING GLUCOSE OXIDASE AND ASSOCIATED BIO-SENSOR

A method for sterilizing a membrane comprising an oxidoreductase enzyme, comprises: irradiating with gamma radiation the membrane comprising an oxidoreductase enzyme soaked in an aqueous buffer solution. Associated biosensors and bioreactors are also described. 1. A method for sterilizing a membrane comprising an oxidoreductase enzyme , comprising: irradiating with gamma radiation the membrane comprising an oxidoreductase enzyme soaked in an aqueous buffer solution.2. The method of claim 1 , wherein the oxidoreductase enzyme is selected from the group consisting of glucose oxidase claim 1 , lactate oxidase and glutamate oxidase.3. The method of claim 2 , wherein the oxidoreductase enzyme is glucose oxidase.4. The method of claim 1 , wherein the aqueous buffer solution is a phosphate buffer.5. The method of claim 4 , wherein the aqueous buffer solution is a phosphate buffer saline (PBS) solution.6. The method of claim 1 , wherein the aqueous buffer solution is substantially free from organic components.7. A method for sterilizing a membrane comprising glucose oxidase claim 1 , comprising: irradiating with gamma radiation the membrane comprising glucose oxidase soaked in a phosphate buffer saline (PBS) solution.8. The method of claim 1 , wherein a dose of the gamma radiation is in a range of from about 25 kGy to about 40 kGy.9. The method of claim 1 , wherein a rate of the gamma radiation is about 20 kGy/hour.10. The method of claim 1 , wherein the membrane is in a plastic container.11. The method of claim 1 , wherein the membrane is in a biosensor.12. The method of claim 11 , wherein the biosensor comprises a Pt electrode and an Ag/AgCl electrode.13. A biosensor comprising the membrane sterilized using the method of .14. The biosensor of claim 13 , wherein the membrane comprises glucose oxidase and the sensitivity of the biosensor to glucose is about 80% of the sensitivity of a biosensor comprising a membrane comprising glucose oxidase without sterilization to ...

COENZYME-LINKED GLUCOSE DEHYDROGENASE AND POLYNUCLEOTIDE ENCODING THE SAME

The present invention provides members that produce on a large scale a coenzyme-linked glucose dehydrogenase which has excellent substrate-recognizing ability toward glucose while providing low action on maltose. The present invention relates to a polynucleotide encoding a soluble coenzyme-linked glucose dehydrogenase that catalyzes the oxidation of glucose in the presence of an electron acceptor and has an activity toward maltose of 5% or lower; a polypeptide encoded by the nucleotide sequence of the polynucleotide; a recombinant vector carrying the polynucleotide; a transformed cell produced using the recombinant vector; a method for producing a polypeptide comprising culturing the transformed cell and collecting from the cultivated products a polypeptide that links to FAD to exert the glucose dehydration activity; a method for determination of glucose using the polypeptide; a reagent composition for determination of glucose; and a biosensor. 134-. (canceled)35. A method for producing a biosensor for measuring glucose in a sample liquid comprising:(i) obtaining a flavin adenine dinucleotide(FAD)-linked glucose dehydrogenase (GLD) produced by cultivating a host cell transformed with a nucleic acid encoding the GLD, and(ii) forming a biosensor comprising an electrode system and an enzyme reaction layer on an electrode of the electrode system, the enzyme reaction layer comprising the GLD and an electron acceptor,wherein:(a) the GLD has an activity toward glucose of catalyzing dehydrogenation of glucose in the presence of the electron acceptor and has an activity toward maltose of 5% or less with respect to the activity toward glucose, and(b) the GLD has an amino acid sequence comprising the sequences set forth in SEQ ID NOs. 8 to 12.36. The method of claim 35 , wherein the nucleic acid comprises a cDNA encoding the GLD.37. The method of claim 35 , wherein the total content of galactose claim 35 , glucose claim 35 , mannose claim 35 , and arabinose contained in the ...

MULTI-ZONE, FIXED POTENTIAL TEST SENSOR HEATING SYSTEM

A test sensor heating system is disclosed that provides the desired and different temperatures to at least two different reaction zones based on a fixed potential. The measurement device does not alter the potential applied to the heating system in response to temperature feedback information. The heating system provides the desired and different temperatures to the different reaction zones of the test sensor by varying heating element spacing and/or the resistivity of an associated resistive layer of the test sensor to provide the desired temperature in response to the fixed potential. The system also may provide two or more different temperature zones to the test sensor by using different heating element spacing and/or resistive layer resistivity at different locations of the test sensor. 1. A reaction zone heating system for a test sensor , the reaction zone heating system comprising:electrical heater conductors in electrical communication with heating elements, where the electrical heater conductors and the heating elements include a conductive material;at least one resistive layer contacting the heating elements, where the resistive layer includes a mixture of conductive and non-conductive materials;a substrate contacting the at least one resistive layer; anda base contacting the electrical heater conductors and the heating elements.2. The reaction zone heating system of claim 1 , where the test sensor is an electrochemical test sensor.3. The reaction zone heating system of claim 1 , where the heating elements have a width from 0.5 to 5 millimeters.4. The reaction zone heating system of claim 1 , where the heating elements have an interstitial spacing from 0.05 to 0.56 millimeters.5. The reaction zone heating system of claim 4 , further comprising heating elements having an interstitial spacing from 0.63 to 1.2 millimeters.6. The reaction zone heating system of claim 1 , where the conductive material is selected from the group consisting of silver claim 1 , ...

SUBSTANCE DETERMINATION METHOD

A technique allowing improved determination accuracy in quantifying a substance to be determined by lessening influence by a current component different from an oxidation current is provided. The oxidation current results from oxidation of a reducing substance generated through reaction between an enzyme and the substance to be determined. Current components are contained in a response current resulting from application of a determination potential, referenced to a counter electrode, to a working electrode. Since a conditioning potential higher than a determination potential is applied as a pulse to the working electrode, influence by a current component different from an oxidation current can be lessened. Thus, the response current can be measured in a stable manner and determination accuracy in quantification of a substance to be determined which is contained in a specimen can be improved. 1. A substance determination method for quantification of a substance to be determined that is contained in a specimen , the method comprising: a cavity into which said specimen is supplied;', 'an electrode system including a working electrode and a counter electrode; and', 'a reaction layer containing an enzyme reacting specifically with the substance to be determined,', 'wherein a determination potential, referenced to said counter electrode, is applied to said working electrode, and', 'a reducing substance is generated through reaction between said substance to be determined and said reaction layer;, 'using a biosensor comprisingmeasuring an oxidation current resulting from oxidation of the reducing substance; andapplying to said working electrode at least once, a pulse of conditioning potential higher than said determination potential, with said counter electrode being defined as a reference, after said specimen is supplied into said cavity and before said determination potential is applied to said working electrode.2. The substance determination method according to claim 1 ...

METHOD, APPARATUS AND SYSTEM FOR SINGLE-MOLECULE POLYMERASE BIOSENSOR WITH TRANSITION METAL OR SILICON NANOBRIDGE

Various aspects of the present disclosure provide methods, apparatus and systems for single-molecule biosensors having transition metal dichalcogenide (TMD), Si or Si-semiconductor nanobridge for sequencing, information storage and reading. In various embodiments, the present disclosure provides nanofabrication of biomolecular sensing devices beginning with a silicon-on-insulator (SOI) wafer and in general to the fabrication of biosensor devices for analyzing DNA and related biomolecules. 1. A single-molecule biosensor comprising:a conducting electrode pair disposed on a substrate, the electrode pair comprising a first electrode and a second electrode spaced-apart from the first electrode by a nanogap of fixed width;a TMD, Si, or doped Si-semiconductor layer disposed on the substrate electrically connecting the first and second electrodes;a dielectric layer disposed completely over the first and second electrodes to encase the first and second electrodes, and disposed partially over the TMD, Si, or doped Si-semiconductor layer so as to leave an exposed portion of the TMD, Si, or doped Si-semiconductor layer having a width less than the width of the nanogap;an enzyme molecule attached to the exposed portion of the TMD, Si, or doped Si-semiconductor layer; anda microfluidic system encasing the conducting electrode pair, the contiguous TMD layer and the enzyme molecule attached thereto.2. The single-molecule biosensor of claim 1 , wherein the TMD layer comprises at least one TMD having a structure MS claim 1 , MS claim 1 , MSe claim 1 , MSe claim 1 , MTeor MTe claim 1 , wherein x is 0-0.3 claim 1 , and M is Mo claim 1 , W claim 1 , Ti claim 1 , Zr claim 1 , Hf claim 1 , V claim 1 , Nb claim 1 , Ta claim 1 , Tc claim 1 , Re claim 1 , Co claim 1 , Rh claim 1 , Ir claim 1 , Ni claim 1 , Pd claim 1 , or Pt.3. The single-molecule biosensor of claim 1 , wherein the TMD layer comprises a TMD selected from the group consisting of MoS claim 1 , WS claim 1 , TiS claim 1 , ZrS ...

Methods and Systems for Determining ADAMTS13 Enzyme Activity

Disclosed are methods and systems for the analysis activity of enzyme disintegrin and metalloproteinase with a thrombospondin type 1 motif, member 13 (ADAMTS13) in a sample. The methods and systems disclosed herein can be useful for diagnosis of thrombotic thrombocytopenic purpura in a patient.

ELECTROCHEMICAL BIOSENSOR USING DUAL ELECTRODE PAIR

An electrochemical biosensor using a sensing system includes a working electrode including an active surface modified through a linker; and an auxiliary electrode. The sensor has a high current value compared with an existing sensor and retains excellent stability and sensitivity, and thus can be expected to be easily used for sensing various kinds of biomaterials. 1. An electrochemical sensor for determining presence or concentration of an analyte in a fluid , comprising:a substrate; anda working electrode formed on the substrate, and having an enzyme attached thereon by a linker.2. The electrochemical sensor of claim 1 , wherein the linker is attached on nanoparticles directly formed on the electrode.3. The electrochemical sensor of claim 2 , wherein the nanoparticles are selected from the group consisting of gold claim 2 , platinum and palladium.4. The electrochemical sensor of claim 1 , further comprising an auxiliary electrode formed to be separated apart from the working electrode in a horizontal direction of the substrate.5. The electrochemical sensor of claim 1 , wherein the working electrode is formed to be separated apart from the substrate in a vertical direction claim 1 , and has a mesh shape.6. The electrochemical sensor of claim 5 , further comprising:an auxiliary electrode formed under the working electrode while having a space therebetween.7. The electrochemical sensor of claim 1 , wherein the linker is formed by converting a functional group of a surface-modified base material including diazonium claim 1 , a diazonium salt or a derivative thereof into an amine group claim 1 , and then mixing the surface-modified base material with a dialdehyde crosslinking agent.8. A method of manufacturing an electrochemical sensor claim 1 , comprising:forming an electrode on a substrate;forming a surface-modified base material on the electrode;reacting the surface-modified base material and a crosslinking agent; andreacting the reacted crosslinking agent and an ...

COMPETITIVE ENZYMATIC ASSAY

Competitive assays are provided for the detection and quantification of a target analyte utilizing a modified electro-active moiety and an enzyme, in which the target analyte and a target analog moiety are substrates. This method may be used to detect and/or quantify many classes of biological molecules and has a number of applications, e.g., in vitro diagnostic assays and devices. 1. A method for detecting a target analyte in a test sample , said method comprising:(a) contacting the test sample with an electroactive moiety (EAM) and at least one enzyme or contacting the test sample with a solid support, said solid support comprising an electrode or an array of electrodes, said electrode comprising:(i) a self-assembled monolayer; and {'sup': o', 'o, 'the EAM comprises a transition metal complex and an target analog moiety (TAM), the target analyte and the target analog moiety are substrates of the at least one enzyme, and the EAM has a first Ewhen the TAM has not been modified by the at least one enzyme and a second Ewhen at least a portion of the TAM has been modified by the at least one enzyme;'}, '(ii) a covalently attached electroactive moiety (EAM), wherein{'sup': o', 'o, '(b) detecting a change between the first Eand the second Eof the EAM, wherein the change is an indication of the presence of said at least one target analyte; and'}(c) determining the concentration of the target analyte.2. A method according to claim 1 , wherein an assay mixture in a solution phase is formed in step (a) and prior to step (b).3. A method according to claim 1 , further comprising:contacting said assay mixture with a solid support comprising an electrode or an array of electrodes, under conditions such that a self-assembled monolayer (SAM) forms on said electrode.4. A method for detecting a target analyte in a test sample claim 1 , said method comprising: the EAM comprises a transition metal complex and an target analog moiety (TAM), the target analyte and the target analog ...

METHOD FOR DETERMINING TEAR GLUCOSE CONCENTRATION WITH BLOOD GLUCOSE TEST STRIPS

A method for determining glucose concentration in tear fluid includes providing a blood glucose test strip having glucose dehydrogenase as an active enzyme provided therein, receiving a tear fluid sample via fluid communication of the blood glucose test strip with an eye region of a subject, and processing the tear fluid sample to determine a tear glucose concentration. The method may further include correlating the determined tear glucose concentration with a blood glucose concentration. 1. A method for determining glucose concentration in tear fluid , the method comprising:providing a blood glucose test strip having glucose dehydrogenase as an active enzyme provided therein;receiving a tear fluid sample via fluid communication of the blood glucose test strip with an eye region of a subject; andprocessing the tear fluid sample to determine a tear glucose concentration.2. The method of claim 1 , wherein receiving the tear fluid sample includes obtaining a tear fluid sample of less than about 1 μL.3. The method of claim 1 , wherein processing the tear fluid sample includes a processing time of about 5 seconds.4. The method of claim 1 , wherein the blood glucose test strip includes pyrroloquinoline quinone as a coenzyme.5. The method of claim 1 , wherein the blood glucose test strip includes a nitrosoaniline derivative as an electron transfer mediator.6. The method of claim 1 , wherein the blood glucose test strip includes electrodes provided therein claim 1 , and wherein processing the tear fluid sample includes applying a voltage to the electrodes to induce an electrochemical reaction of the active enzyme and the glucose in the tear fluid sample claim 1 , and detecting a current produced by the electrochemical reaction from which the tear glucose concentration is determined.7. The method of claim 6 , wherein the electrodes include gold electrodes.8. The method of claim 6 , wherein the voltage applied to the electrodes is between about 150 mV and 200 mV.9. The method ...

Methods and Systems for Assessing Histological Stains

The present disclosure includes methods of assessing a histologically stained specimen based on a determined color signature of a region of interest of the specimen. Such assessments may be performed for a variety of purposes including but not limited to assessing the quality of the histological stain, as part of identifying one or more biologically relevant features of the image, as part of differentiating one feature of the image from other features of the image, identifying an anomalous area of the stained specimen, classifying cells of the specimen, etc. Also provided are systems configured for performing the disclosed methods and computer readable medium storing instructions for performing steps of the disclosed methods. 1. A method of assessing a histologically stained specimen , the method comprising:a) obtaining a digital color image of the specimen;b) defining on the image a region of interest (ROI) based on a biological feature of the specimen;c) separating the digital color image into individual color channels;d) determining a color signature for the ROI, wherein the color signature comprises quantification of one or more color parameters over the ROI in one or more of the individual color channels; ande) comparing the determined color signature to a reference color signature that is specific to the biological feature and the histological stain to assess the histologically stained specimen.2. The method of claim 1 , wherein the separating is performed after defining the ROI.3. The method of claim 1 , wherein the one or more color parameters comprises the mean intensity of an individual color channel.4. The method of claim 1 , wherein the color signature comprises a color coefficient calculated by determining the ratio of the mean intensity value for a first color channel to the mean intensity value for a second color channel.5. The method of claim 1 , wherein the color signature comprises a first color coefficient calculated by determining the ratio of ...

Method to allow for linking temporal record with physiological measurement in buttonless physiological meters

Described are methods and systems to allow the use of a very simple physiological meter without a user input interface (i.e., buttonless) while maintaining the ability to store time linked measurement records for retrospective or prospective analysis of the measured physiological measurements.

METHODS AND APPARATUS FOR DETERMINING ANALYTE IN A SAMPLE USING A SENSOR HAVING ELECTRODES WHICH ARE PROVIDED WITH AN ENZYME AND A MEDIATOR

The invention relates to a method of and apparatus for determining concentration of an analyte, such as glucose, in a fluid sample, such as body fluid or control solution, using a mediated redox reaction. In particular, the method relates to mitigation of the effects of haematocrit on the response of sensor device used in such a method or apparatus. The invention describes a method of determining concentration of an analyte in a fluid sample deposited on a sensor device having a working electrode and a counter electrode, in which the electrodes are provided with an enzyme and a mediator for carrying out a mediated redox reaction, the method comprising: applying a first oxidising potential between the working and counter electrodes during a first time period; applying a second reducing potential between the working and counter electrodes during a second time period; determining a reaction parameter, the reaction parameter being indicative of the concentration of reduced mediator at the counter electrode after commencement of the second time period; using the reaction parameter to determine the concentration of analyte. 1. A method of determining concentration of an analyte in a fluid sample deposited on a sensor device having a working electrode and a counter electrode provided on a substrate , in which the working and counter electrodes are both provided with an enzyme and a mediator for carrying out a mediated redox reaction , the method comprising:applying a first oxidising potential at a first voltage between the working and counter electrodes during a first time period;applying a second reducing potential at a second voltage between the working and counter electrodes during a second time period;wherein a duration of the first time period is greater than a duration of the second time period;determining a reaction parameter, the reaction parameter being indicative of the concentration of reduced mediator at the counter electrode after commencement of the second ...

Inkjet-printed electrochemical metabolite sensors

Described are inkjet-printed sensors for detecting metabolites in biological samples obtained non-invasively. The sensors may include a backing layer, and at least one set of three electrodes printed from a conducting polymer onto the backing layer. A set of electrodes includes a three-electrode geometry with a reference electrode, a working electrode with a polymeric coating, and a counter electrode. The sensor may be connected to an acquisition system and/or a display system, forming a sensor system. The biological sample may be saliva, sputum, tear, sweat, urine, exudate, blood, plasma, or vaginal discharge. The sensor typically detects metabolites capable of interacting with oxidase or oxido-reductase enzymes. Some of the exemplary metabolites detected by the sensor include glucose, cholesterol, nicotine, carbon monoxide, nitrite, nitrate, alcohol, and bacterial metabolites.

METHODS FOR TESTING ENZYME BASED ELECTROCHEMICAL SENSORS

A method for testing enzyme based electrochemical sensors for quantitative detection of analytes in aqueous solutions, wherein an electrochemical sensor is provided, with a working electrode () and a counter electrode, the working electrode comprising an electrical conductor (), a solid-state matrix () being electrically connected with said conductor and containing an immobilized enzyme able to catalytically convert a primary analyte into a secondary analyte that can be oxidised or reduced when a suitable potential is applied at the working electrode, and a membrane () covering said matrix and separating it from the outside. The membrane is permeable for the primary analyte, such that primary analyte molecules present in an aqueous solution with which the working electrode is contacted can pass through the membrane to the matrix, where they can be catalytically converted into second analyte molecules. A measurement setup is provided, which is operatively coupled to the electrochemical sensor, providing an output signal Z, e.g. a measured signal current, of the electrochemical sensor; and the electrochemical sensor is suitably contacted with, e.g. immersed into, a test solution comprising a certain concentration of the primary analyte. The electrochemical sensor is subjected to a certain temperature T, wherein this temperature is swept within a certain range; an output signal Z is measured for different temperature values T; a derivative Z′ of the output signal Z as a function of temperature T, or inverse temperature 1/T, is determined; and a relative derivate Z′/Z at a certain temperature T, or inverse temperature 1/T, is determined as the ratio between derivative Z′ and output signal Z. 1. A method for testing enzyme based electrochemical sensors , wherein the sensors are sensors for quantitative detection of analytes in aqueous solutions , whereinan electrochemical sensor is provided, with a working electrode and a counter electrode, the working electrode ...

SAMPLE RECOGNITION METHOD AND BIOSENSOR USING SAME

A biosensor and a method for recognizing a liquid sample are provided, which can recognize whether a sample is introduced by recognizing an inside of a sample introduction channel through measurement of capacitance. The biosensor includes an upper plate and a lower plate facing each other, a middle plate interposed between the upper plate and the lower plate to form a sample introduction channel through a recess portion, a working electrode and an auxiliary electrode formed in the sample introduction channel, a sample recognition electrode formed on an outside of the sample introduction channel in a position that corresponds to the sample introduction channel, and a capacitance measurement portion electrically connected to any one of the working electrode and the auxiliary electrode and the sample recognition electrode. 1. A biosensor comprising:an upper plate and a lower plate facing each other;a middle plate interposed between the upper plate and the lower plate to form a sample introduction channel through a recess portion;a working electrode and an auxiliary electrode formed in the sample introduction channel;a sample recognition electrode formed on an outside of the sample introduction channel in a position that corresponds to the sample introduction channel; anda capacitance measurement portion electrically connected to any one of the working electrode and the auxiliary electrode and the sample recognition electrode.2. A biosensor comprising:an upper plate and a lower plate facing each other;a middle plate interposed between the upper plate and the lower plate to form a sample introduction channel through a recess portion;a working electrode and an auxiliary electrode formed in the sample introduction channel;a pair of sample recognition electrodes formed on an outside of the sample introduction channel in a position that corresponds to the sample introduction channel; anda capacitance measurement portion electrically connected to the sample recognition ...

A METHOD FOR OBTAINING INDICATOR SIGNALS FROM A CELL

The present invention relates to a field of genetically edited cells and furthermore determining indicator signals of genetically edited cells. The invention relates to a method for obtaining indicator signals from a cell, and more particularly to a method for determining a biological state of a cell. Furthermore, the present invention relates to a regenerative cell and use of a regenerative cell or a specific indicator poly-nucleotide for monitoring purposes. Also, a system for carrying out the method of the present invention is included. 1. A method for obtaining indicator signals from a cell , said method comprisingproviding regenerative cells obtained from a subject,modifying the regenerative cell by inserting a polynucleotide sequence encoding an indicator into DNA of the regenerative cell, the polynucleotide sequence encoding the indicator to be expressed together with a target polynucleotide in said regenerative cell,administering the modified regenerative cell to a subject,monitoring a signal of the indicator or absence thereof on the skin of the subject, thereby obtaining indicator signals associated with expression of the target polynucleotide.2. A method for determining a biological state of a cell , said method comprisingproviding regenerative cells obtained from a subject,modifying the regenerative cell by inserting a polynucleotide sequence encoding an indicator into DNA of a regenerative cell, the polynucleotide sequence encoding the indicator to be expressed together with a target polynucleotide in said regenerative cell,administering the modified regenerative cell to a subject,monitoring a signal of the indicator associated with expression of the target polynucleotide or absence of said indicator signal on the skin of the subject, anddetermining a biological state of the cell defined by expression of the target polynucleotide.3. The method according to claim 1 , wherein the subject has a permeable skin area and the modified regenerative cells are ...

ELECTROCHEMICALLY ACTIVE AGENTS FOR PH MODULATION IN BIOLOGICAL BUFFERS

Device and methods for use in a biosensor comprising a multisite array of test sites, the device and methods being useful for modulating the binding interactions between a (biomolecular) probe or detection agent and an analyte of interest by modulating the pH or ionic gradient near the electrodes in such biosensor. An electrochemically active agent that is suitable for use in biological buffers for changing the pH of the biological buffers. Method for changing the pH of biological buffers using the electrochemically active agents. The methods of modulating the binding interactions provided in a biosensor, analytic methods for more accurately controlling and measuring the pH or ionic gradient near the electrodes in such biosensor, and analytic methods for more accurately measuring an analyte of interest in a biological sample. 1. A method comprising: i. the support comprises (I) one or more electrodes and (II) a biomolecule interface layer having one or more immobilized probes thereon; and', 'ii. the solution comprises a quinone derivative;, 'a. providing a biosensor comprising a support in an solution, wherein'}b. adding a biomolecule analyte to the solution;{'sup': +', '−', '+', '−, 'c. electrochemically reacting the quinone derivative using the one or more electrodes to produce at least one of an amount of Hions and an amount of OHions, wherein at least one of: the pH of the solution close to the one or more electrodes is controlled by the amount of Hions; and the amount of OHions produced; and'}d. collecting signals from the biosensor, wherein a reactivity between a nucleophile and the quinone derivative is reduced compared to a reactivity between the nucleophile and an unsubstituted quinone from which the quinone derivative is derived.3. The method of claim 1 , wherein the solution contains one or more nucleophiles.4. The method of claim 3 , wherein the one or more nucleophiles are selected from the group consisting of: amines claim 3 , thiols claim 3 , amino ...

Detection of 1, 5-anhydroglucitol (1, 5-ag) in saliva

A system can facilitate detection of 1, 5-anhydroglucitol (1, 5-AG) present in a saliva sample. The saliva sample can be placed in contact with a portion of a sensing device that includes a 1, 5-AG sensor. An indicator of a concentration of 1, 5-AG in the saliva sample can be detected by the 1, 5-AG sensor. The 1, 5-AG sensor can send the indicator to a computing device that includes a processing unit. The processing unit can execute instructions stored in non-transitory memory to receive the indicator; measure an amount of 1, 5-AG in the saliva sample based on the indicator; and provide an output related to the amount of 1, 5-AG in saliva sample. The amount of 1, 5-AG in the saliva sample can be used as a diagnostic property for a subject who produced the saliva sample.

REAGENT COMPOSITION FOR BIOSENSOR AND BIOSENSOR HAVING THE SAME

This invention discloses a reagent composition for a biosensor having high sensitivity which is capable of improving analysis linearity of an analyte such as glucose by reacting an oxidoreductase, a metal-containing complex, and Naphthol Green B, and minimizing blood necessary for measuring blood glucose since it is possible to detect a concentration of a small amount of the analyte, and a biosensor having the same. The reagent composition for a biosensor includes at least two kinds of electron transfer mediators including Naphthol Green B, and an enzyme. 1. A reagent composition for a biosensor to determine presence or concentration of a predetermined analyte in a test sample , the reagent composition comprising:a first electron transfer mediator of Naphthol Green B;a second electron transfer mediator; andan enzyme, andwherein the Naphthol Green B equal to or greater than 1 parts by weight and equal to or less than 5 parts by weight is used with respect to a buffer solution being 100 parts by weight.2. The reagent composition according to claim 1 ,wherein the second electron transfer mediator includes a metal-containing complex.3. The reagent composition according to claim 2 ,wherein the metal-containing complex is a ruthenium complex or a ferricyanide complex.4. The reagent composition according to claim 3 ,{'sub': 3', '6', '3', '2', '2', '2', '2', '2', '3', '5, 'sup': 2+', '2+', '4+', '2+, 'wherein the ruthenium complex is at least one selected from the group consisting of Ru(NH)Cl, [Ru(2,2′,2″-terpyridine)(1,10-phenanthroline)(OH)], trans-[Ru(2,2′-bipyridine)(OH)(OH)], [(2,2′-bipyridine)(OH)RuORu(OH)(2,2′bpy)], and [Ru(4,4′-bipyridine)(NH)].'}5. The reagent composition according to claim 1 ,wherein the enzyme is any of oxidoreductase, dehydrogenase, transferase, or hydrolase.6. The reagent composition according to claim 5 ,wherein the oxidoreductase is at least one selected from the group consisting of flavin adenine dinucleotide-glucose dehydrogenase, ...

SENSING STRUCTURE OF ALIGNMENT OF A PROBE FOR TESTING INTEGRATED CIRCUITS

A sensing structure is presented for use in testing integrated circuits on a substrate. The sensing structure includes a probe region corresponding to a conductive region for connecting to the integrated circuit. A first sensing region at least partially surrounds the probe region. A plurality of sensing elements connects in series such that a first of the plurality of sensing elements has two terminals respectively connected to the first sensing region and the probe region. And a second of the plurality of sensing elements has two terminals respectively connected to the probe region and a first reference potential. 1. A sensing structure for use in testing an integrated circuit on a substrate , the sensing structure comprising:a layer of non-conductive material having a top surface;a layer of passivation material in contact with the top surface of the layer of non-conductive material;a conductive probe region passing completely through both the layer of passivation material and the layer of non-conductive material, said conductive probe region having a top surface that is above a top surface of the layer of passivation material; anda conductive sensing element region passing completely through both the layer of passivation material and the layer of non-conductive material, said conductive sensing element region having a top surface that is above the top surface of the layer of passivation material;wherein the conductive sensing element region is electrically insulated from the conductive probe region by portions of both the layer of passivation material and the layer of non-conductive material.2. The sensing structure of claim 1 , wherein the top surfaces of the conductive probe region and conductive sensing element region are co-planar.3. The sensing structure of claim 1 , further comprising a first diode having a first terminal electrically connected to the conductive probe region and a second terminal electrically connected to the conductive sensing element ...

Biosensor, thin film electrode forming method, quantification apparatus, and quantification method

A biosensor is disclosed comprising a support; a conductive layer composed of an electrical conductive material such as a noble metal, for example gold or palladium, and carbon; slits parallel to and perpendicular to the side of the support; working, counter, and detecting electrodes; a spacer which covers the working, counter, and detecting electrodes on the support; a rectangular cutout in the spacer forming a specimen supply path; an inlet to the specimen supply path; a reagent layer formed by applying a reagent containing an enzyme to the working, counter, and detecting electrodes, which are exposed through the cutout in the spacer; and a cover over the spacer. The biosensor can be formed by a simple method, and provides a uniform reagent layer on the electrodes regardless of the reagent composition.