Ochratoxin A (OTA) fluorescence detection method adopting carbon nitride nanosheet and aptamer coupled for sensing

Technical Field

The invention relates to the invention relates to analysis of the detection field, in particular to a carbon nitride nano ligand sensing ochratoxin A fluorescence detection method.

Background Art

Food is human survival and material foundation for the development, the food safety problem is related to the people's health as well as social harmony of the important issues. The mildew food and feed is usually caused by human and animal poisoning, cytostimulation toxic substances is mainly a fungal toxin. In has been found in fungal toxin, ochratoxin A (Ochratoxin A, OTA) toxicity to the maximum, the highest average produces the poisonous quantity, the most widely distributed, the most serious pollution of agricultural products, the human health and is most closely related to the concern throughout the world. Cereal class, coffee, tea and other various food and crops is very easy to be is toxin ochratoxin, Chinese medicinal materials in the storage or transportation is bad when the rot is extremely easy to produce ochratoxin. The material in the human body is not easy to be metabolic decomposition, its long-term accumulation can cause kidney, liver, immune system and the like of the lesion, while at the same time with sterilization and carcinogenic, therefore, to the content of the sensitive detection of toxin ochratoxin has important significance. Our country's existing OTA test method mainly has the immune affinity chromatography purification liquid phase chromatography, ion-exchange solid phase extraction column purification by high performance liquid chromatography, immune affinity chromatography purification liquid chromatography - mass spectrometry in series, the enzyme-linked immunosorbent assay and thin-layer chromatographic assay method and the like. These methods generally require more complex detection sample pre-treatment process, the detection instrument for more complex and expensive, or the detection sensitivity is low and the like.

Nucleic acid protrudes (aptamer) is a section of the by the 25 - 80 a RNA or DNA base pairs of oligonucleotide fragment, it has similar antibody is highly specific binding target molecules function, and the recognition of a target molecule to a wider range, more easily synthesized, better stability and the like, now widely research applications. Wherein the adapter body of the present invention sequence in OTA 2008 year by Penner and Cruz - Aguado by index concentration system evolution in vitro screening technology (SELEX) successfully screened, to the height of the OTA has specific binding ability.

Carbon nitride nanometer developed in recent years of the nano-layered material, by graphite type nitride prepared by ultrasonic stripping the carbon passes through. The material is environment friendly and the synthetic low cost, in water have an excellent dispersibility and unique photoelectric nature, and have the physical and chemical nature of such graphene, therefore in the sensing field and has good application prospect.

Content of the invention

The purpose of this invention is to provide a detection method is simple, time consuming and short, strong selectivity, high sensitivity of carbon nitride nano ligand sensing ochratoxin A fluorescence detection method.

The purpose of this invention through the following technical proposal: a nitride-carbon nano ligand sensing ochratoxin A fluorescence detection method, the use of the adapter with the g - C₃ N₄ The nano (CNNS) and g - C interaction₃ N₄ Nanometer the quenching function of the fluorescent luminophor, and combine the adapter specific identification ochratoxin A characteristic, constructing the signal enhancement of toxin ochratoxin A fluorescence detection method;

Wherein the utensil ligand sequence are as follows:

5 '- GATCGGTGTGGGTGGCGTAAAGGGAGCATCGGACA - FAM - 3'.

For the purposes of the prior art, the advantage of this invention lies in: this text using boron nitride carbon nano fluorescent luminophor effective quenching function, combined with suitable ligand specific recognition of the target object characteristic, to construct the signal enhancement of the OTA fluorescence detection method. This method is simple in operation, the background signal is low, the detection limits lowly and selectively good. The nitride carbon nano-piece of green environmental protection, is easy to produce and water dispersibility is good, but the adapter the specificity is strong, good stability, easy to synthesize, therefore, of the present invention adapts the body OTA fluorescent detection method is expected to be as alternative method OTA detection of further application in practice.

Description of drawings

Figure 1 the fluorescent detection of the sensor principle of OTA schematic view

Figure 2 is the fluorescent spectrogram of detection method of this invention in the feasibility analysis of different substances.

Figure 3 is the TEM characterization plan of CNNS.

Figure 4 is CNNS structure diagram.

Figure 5 is a different concentration CNNS OTA/to the adapter and the adapter mixed after the change of the fluorescence intensity.

Figure 6 is CNNS with the adapter and the adapter OTA/fluorescence intensity with time after mixing power learning curve.

Figure 7 is the role of the OTA and appropriate time under different from the fluorescence intensity of the

Figure 8 is the fluorescent spectrogram of different OTA concentration system.

Figure 9 is the linear relationship graph of OTA between the concentration of the fluorescence intensity.

Figure 10 is the fluorescence change chart of different toxin in the presence of a system.

Mode of execution

The combination of the following drawings and embodiment of the present invention detailed description of the content:

A nitride-carbon nano ligand sensing ochratoxin A fluorescence detection method, the use of the adapter with the g - C₃ N₄ The interaction of the nanometer and g - C₃ N₄ Nanometer the quenching function of the fluorescent luminophor, and combine the adapter specific identification ochratoxin A characteristic, constructing the signal enhancement of toxin ochratoxin A fluorescence detection method;

Wherein the utensil ligand sequence are as follows:

5 '- GATCGGTGTGGGTGGCGTAAAGGGAGCATCGGACA - FAM - 3'. The adapter sequence is comprised of a biological engineering (Shanghai) shares limited synthesis.

The invention using target-mediated nucleic acid aptamers body configuration to the change in the carbon nitride nanometer slice of the adsorption capacity of the difference, and then produced the fluorescent signal intensity to the changes of the detection ochratoxin A.

The detection method of the feasibility analysis are as follows:

(Aptamer) protrudes through the in vitro screening is obtained for a short period of a single oligonucleotide sequence, i.e. single-stranded DNA (ssDNA) or RNA. The adapter molecules between molecular recognition function very similar with the antibody, but protrudes in addition to the stability of the nucleic acid itself has strong, easy modification, denatured renaturation fast reversible with the mark and be used as fine nanometer device like the outer, its target molecules of the scope of the role of antibody more widely. With CNNS ssDNA binding force stronger than dsDNA, and CNNS by light-induced electron transfer (PET) function to the quenching DNA end labeling organic fluorophore FAM fluorescent signal. The invention is based on this kind of characteristic CNNS, combined with the adapter to its target binding action of the peculiar recognition of to design a can be used for the OTA identification detection of fluorescence sensing strategy.

The sensor detection process as shown in Figure 1, the basic principle is that: with the ssDNA binding force between the CNNS is very strong, but protrudes is in itself a section of the widowed chain ssDNA sequence. The parallel of the OTA protrudes and CNNS coexist in the solution, the adapter easily through the π - π conjugated accumulation CNNS combine with adsorption to the role of the surface. At this time protrudes t end modified FAM fluorophore is also close to the surface of the CNNS. As can be CNNS through PET effect effective quenching fluorophore FAM signal, then the system can detect the fluorescent signal is very weak. When the target molecules the presence of OTA, because the adapter specially recognition ability, OTA will and the adapter body specific binding to form a composite material. As a result of this complex with the binding capability of CNNS to was weaker than the adapter with the binding capability of CNNS, the composite free with the solution, so that the fluorophore FAM CNNS far away from the surface, thereby reducing its quenching efficiency CNNS, at this moment in the reaction system can still detect the stronger fluorescence signal. Therefore, only when the target molecule in the presence of OTA, the reaction systems can only obtain stable fluorescence response, thereby achieving the purpose of selectively detecting OTA.

In order to further verify the feasibility of, first inspected object before adding a certain amount of fluorescent change OTA. From Figure 2 it can be seen that, because of the marked FAM, the adapter in the 520 nm at a strong fluorescence signal (curve a). When adding the after CNNS, its fluorescent signal is inhibited obviously (curve b). This is due to the presence of the CNNS, ligand by π - π stacking of CNNS way close to the surface, so that the PET is FAM CNNS effect due to the quenching. The OTA when suitable ligand and after the reaction, the reaction solution is added to the again CNNS, the solution of the fluorescent signal intensity relative to the presence of non-OTA(curve c) obviously, have demonstrated that when the solution in the presence of the OTA, adapting experience and the OTA to form a complex, the complex with the binding capability of CNNS will be significantly weaker than the free of the adapter with the binding capability of CNNS, leading to enhancement of the fluorescence signal of the system. The experiment shows that, the sensing platform can be used for determining the target content of OTA. Figure 2 in, a FAM mark protrudes for fluorescent spectrogram of the system; b is CNNS FAM mark protrudes after mixing with fluorescent spectrogram of the system; c is FAM mark protrudes to form a composite with the OTA and then after mixing after CNNS fluorescent spectrogram of the system.

The nitride carbon nano ligand sensing ochratoxin A fluorescence detection method, it specifically comprises the following steps:

(1) Synthetic g - C₃ N₄ The nano;

(2) Preparing the adapter solution;

(3) Preparing ochratoxin A standard solution;

(4) Drawing ochratoxin A response standard curve and obtain the linear regression equation: in different concentration of toxin ochratoxin A standard solution are respectively added with a prepared solution of adapter body, reaction 30 - 210 minutes, adding in g - C₃ N₄ The nano, standing 0.5 - 3 min, for fluorescence spectrophotometer at room temperature are respectively detecting the different concentration ochratoxin A standard solution in the 520 nm fluorescence intensity of at, obtain fluorescence intensity with the concentration of the toxin ochratoxin A standard curve; according to the obtained standard curve, obtain fluorescence intensity with the concentration of the toxin ochratoxin A linear regression equation;

(5) Fluid examination to be measured: the liquid to be tested is added to the prepared solution of the adapter body, reaction 30 - 210 minutes, then adding g - C₃ N₄ The nano, standing 0.5 - 3 min, for fluorescence spectrophotometer at room temperature detection system in the 520 nm at the fluorescence intensity, the fluorescence intensity into the step (4) obtained in the linear regression equation, to be measured by calculating the concentration of the toxin ochratoxin A.

Wherein steps (1) synthetic g - C₃ N₄ Nano-sheet is the specific method is:

A. the synthesis phase of the g - C₃ N₄ : Will be placed in a tube furnace in the dielectric layer, in order to 2 - 3 °C/min rate of temperature programming and in the 600 - 700 °C lower heating 2 - 3 the H, to obtain flaxen body g - C₃ N₄ ;

B. the preparation g - C₃ N₄ The nano: g - C the body₃ N₄ After the grinding takes the form of powder, dispersed in water and ultrasonic 16 - 20 the H, to form a suspension; then, the formed suspension to 6000 - 7000 rmp speed centrifugal 5 - 10 min to remove the remaining non-dispersed of g - C₃ N₄ ; Finally, the supernatant fluid is collected and 60 - 70 °C in the rotary evaporator under concentrating under reduced pressure, to obtain suspension;

Step (2) the method of preparing the adapter solution for: the 1 OD protrudes into the ultra-high speed centrifuge to 10000 - 15000 rpm centrifugal 5 - 10 minutes, adding 270 μl of distilled water, fully mix into concentration is 10 μm right ligand mother liquor; after the right ligand this mother liquor is put into the metal constant temperature in the heater, in the 90 °C lower melting 5 min; out, slowly cooled to room temperature, the spare; for after the 20 μl 10 µm melting after the adapter body of the mother liquor, by adding 180 μl distilled water, full oscillation mixing, dilution for 1 μm right ligand solution, spare; moves to the fluid gun to move takes for 20 μl 1 µm right ligand solution, adding 180 μl 20 mm Tris - HCl buffer solution, full oscillation mixing, dilution is 100 nm right ligand solution;

Wherein said Tris - HCl buffer solution including 100 mm NaCl, 5.0 mm KCl and 5.0 mm MgCl₂ , And the pH is 7.4.

Step (3) preparing ochratoxin A of standard solution method is: diluent for the ochratoxin A pure product is formulated to concentration are respectively 0, 1, 2, 5, 10, 20, 50, 100 nm of toxin ochratoxin A standard solution, wherein diluent is methanol and water volume ratio of 7:3 solution.

The fluorescence spectrophotometer excitation wavelength is set to 490 nm, excitation slit width is 5 nm, emission slit width is 5 nm.

In light of specific embodiment below, the content of the present invention more detailed elaboration of the:

G - C Embodiment 1: synthesis₃ N₄ The nano:

First of all, of synthetic body g - C₃ N₄ : The 3 g is placed in the tube furnace in the dielectric layer, in order to 3 °C/min rate of temperature programming and in 600 °C lower heating 2 h, to obtain flaxen body g - C₃ N₄ . Then, preparation CNNS: 100 mg of g - C body₃ N₄ Powder after grinding, dispersed in 100 ml water and ultrasonic 16 h. Then, the formed suspension to 6000 rmp speed centrifugal 5 min for removing residual non-dispersed of g - C₃ N₄ . Finally, the supernatant fluid is collected and 60 °C under pressure in the rotary evaporator in the concentrate, milk shape suspension obtained, is g - C₃ N₄ The nano. 该g - C₃ N₄ The nano structure diagram as shown in Figure 4 as shown in Figure 3, CNNS of TEM characterization plan.

Embodiment 2: preparation right ligand solution:

The 1 OD protrudes into the ultra-high speed centrifuge to 10000 rpm centrifugal 5 min, adding 270 μl of distilled water, fully mix into concentration is 10 μm right ligand mother liquor. The right ligand mother liquor after putting into metal constant temperature in the heater, 90 °C lower melting 5 min. Out, slowly cooled to room temperature, the spare. Moves to the fluid gun to take for 20 μl 10 µm melting after the adapter body of the solution, by adding 180 μl distilled water, full oscillation mixing, dilution for 1 μm right ligand solution, spare. Moves to the fluid gun to move takes for 20 μl 1 µm right ligand solution, adding 180 μl 20 mm Tris - HCl buffer (containing 100 mm NaCl, 5.0 mm KCl, 5.0 mm MgCl₂ , PH 7.4), full oscillation mixing, dilution is 100 nm right ligand solution, follow-up detection process is used in the solution of the adapter body.

Embodiment 3: preparation ochratoxin A standard solution

Diluent for the ochratoxin A pure product is formulated to concentration are respectively 0, 1, 2, 5, 10, 20, 50, 100 nm of toxin ochratoxin A standard solution, wherein diluent is methanol and water volume ratio of 7:3 solution.

The determination of the optimum dosage of Embodiment 4: CNNS:

In order to obtain better detection results, the invention optimizes the experimental conditions of the system. First inspected to CNNS consumption of the adapter or adapter body duplicate OTA/composition of the fluorescence signal of the impact. The specific operation of the experiment is as follows:

The experiment is set as two major groups, each group 5 tube, a total of 10 tube by means of the control experiment.

Group is a 200 μl containing 100 nm of the adapter (Apt) Tris - HCl buffer solution, the second group is a 200 μl containing 100 nm the adapter and 30 nm OTA of Tris - HCl buffer solution. 10 Tube fully after mixing, put into the constant temperature oscillator oscillating within 3 h. Oscillation is finished, in two major groups are added in different concentrations of CNNS optimized consumption, the experimental CNNS-out is: 0, 0.25, 0.50, 0 . 75, 1.0, 1.25μg/mL. After thoroughly mixing, the static set 5 min after, respectively measuring its fluorescence intensity.

From Figure 5 it can be seen that, in the absence of the presence of the OTA, along with the increase of the density CNNS, the adapter of the fluorescence signal rapidly decreases, and when the CNNS concentration is 1.0 μg/mL when, the fluorescent signal of the system to a minimum. In contrast, with the existence of the OTA the fluorescent signal of the system when changes in the relaxation of many more, and when the CNNS concentration is 1.0 μg/mL when, with only the adapter in the presence of a signal difference of maximum. This has also demonstrated, CNNS protrudes to the free state of the adsorption capacity of the OTA/adapter body duplicate compound is strong. Therefore, the study will CNNS the optimal concentration is determined to be 1.0 μg/mL.

Embodiment 5: CNNS determination of the best reaction time: the invention further inspected CNNS OTA/with the adapter or adapter body duplicate the action time of the composition of the fluorescent signal of the impact to the system. The specific operation of the experiment is as follows:

The experiment is set as two major groups, each group 4 tube, a total of 8 tube by means of the control experiment.

Group is a 200 μl containing 100 nm of the adapter (Apt) Tris - HCl buffer solution, the second group is a 200 μl containing 100 nm the adapter and 30 nm OTA of Tris - HCl buffer solution.

8 Tube fully after mixing, put into the constant temperature oscillator oscillating within 3 h. Oscillation is finished, in the 8 pipe are respectively added with a final concentration of 1.0 μg/mL CNNS of, each group of 4 root canal are respectively standing 0 min, 1 min, 2 min, 3 min, measuring its fluorescence intensity. Figure 6 can be known, CNNS is added to the solution after the adapter body, the adapter of the OTA/fluorescent signal will be rapidly quenching, in 2 min after, its fluorescent signal remain basically the same. When the OTA and the adapter body after forming complex, although joining the CNNS after its fluorescence intensity still as the change of time but a slight weakening, its intensity is still significantly greater than that of the adapter with the role of the simple CNNS of the fluorescence after signal strength, and in the 2 min after, the two highest values and tends to be stable. Therefore, the following experiment uses 2 min as CNNS with the adapter the best time. This also shows that the adapter body CNNS fluorescent signal quenching behavior is a very fast process.

Embodiment 6: the adapter with the OTA determination of the best reaction time:

The experiment is divided into seven groups, each group a tube, a total of 7 tube comparative experiment.

Each pipe by adding 200 μl containing 100 nm the adapter and 30 nm OTA of Tris - HCl buffer solution. The full reaction respectively put into the oscillator in a period of time. The experimental reaction time is set to 30 min, 60 min, 90 min, 120 min, 150 min, 180 min, 210 min. Oscillation is finished, add final concentration is 1.0 μg/mL of CNNS, fully mix, standing 2 min, measuring its fluorescence intensity. From Figure 7 it can be seen that, with the target with the appropriate ligand OTA extension of time, after adding CNNS, system of the fluorescence signal of gradually increasing, when the reaction time up to 180 min, fluorescent signal reaches the highest and tends to be stable. Therefore, the invention will be 180 min OTA and protrudes as the best reaction time is long.

Embodiment 7: drawing ochratoxin A response standard curve and obtain the linear regression equation

Separately taking 5 μl implementation resulting different concentrations of OTA standard solution, and then respectively adding 200 μl containing 100 nm right ligand solution, reaction 180 min, respectively add final concentration is 1.0 μg/mL of CNNS, standing 2 min, the fluorescence spectrophotometer at room temperature different from the above OTA respectively detect the concentration of the standard solution in the 520 nm fluorescence intensity at (the resulting spectrogram as shown in Figure 8, wherein Figure 8 curve in the a - h in OTA concentration are respectively 0, 1, 2, 5, 10, 20, 50,100 nm), at the same time detection to the different concentration OTA standard solution in the 520 nm fluorescence intensity respectively at 98, 154, 178, 224, 261, 282, 307, 367, obtain fluorescence intensity with the concentration of the toxin ochratoxin A standard curve as shown in Figure 9; the linear equation as: I=151.77 lg C (a.u.)_OTA (NM)+ 101.51, the correlation coefficient R=0.9919, the limit of detection is 0.7 nm (S/N=3).

Embodiment 8: detection:

In 195 μl containing 100 nm of suitable ligands Tris - HCl buffer solution is added 5 μl in the liquid to be measured, the reaction 180 min, then adding the final concentration is 1.0 μg/mL of CNNS, standing 2 min, the fluorescence spectrophotometer at room temperature detection system in the 520 nm fluorescence intensity at 228, the fluorescence intensity into the implementation of obtained in the linear regression equation, shall be measured by calculation of the concentration of the toxin ochratoxin A 6.81 nm.

Wherein the calculation method is:

228=151.77 lg C_OTA (NM)+ 101.51 shall C_OTA =6.81 nM.

Embodiment 9: OTA detection selectivity of inspection: verifying the selectivity of the detection method of this invention, the present invention is relatively different fungal toxin to the sensor response situation. Selecting ochratoxin B (OTB) and aflatoxin B1 (AFB1) as interfering substances, the concentration of the OTA is 10 times. The specific experimental method is as follows:

The experiment is divided into three groups, respectively in 200 μl containing 100 nm of suitable ligands Tris - HCl buffer solution by adding 30 nm OTA, 150 nm ochratoxin B (OTB) and 150 nm aflatoxin B1 (AFB1). After thoroughly mixing, put into the constant temperature oscillator oscillating within 3 h. Oscillation is finished, all add 10 μl CNNS respectively measuring its fluorescence intensity. The result of the detection as shown in Figure 10, here adopts the fluorescence variation Δ FL said signal in response to the situation under different toxin, Δ FL=FL₁ - FL₀ , Wherein the FL₀ And FL₁ Are respectively expressed toxin to join the front and back of the fluorescence intensity. From Figure 10 it can be seen that when the reaction system in the presence of OTA caused by the fluorescence change is very clear, and the other two toxin in the presence of fluorescent change value but smaller, this indicates that the high concentration of the toxin in the presence of interference, the method still can realize the detection of the OTA, has good selectivity.

It is nothing less than the preferred embodiment of the present invention, it should be noted that, for the ordinary technical personnel in the technical field, in not break away from the the present invention contemplates the premise, can also be made to a number of changes, improvements and polished, these changes, improved and polished shall also be considered the scope of protection of the present invention.

Sequence listing

<110> Fujian University of traditional Chinese medicine

<120> Carbon nitride nano ligand sensing ochratoxin A fluorescence detection method

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 35

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

Gatcggtgtg ggtggcgtaa agggagcatc ggaca 35