Detection method for BRAF gene mutation

Technical Field

The invention relates to molecular biology method for detecting the mutation base.

Background Art

Human complete genome about 30 billion base pairs, 4 million gene, distributed in 24 on the chromosome. Each gene encoding specific protein, regulation and control in vivo biochemical reaction, play a biological function. Single nucleotide polymorphism (single   nucleotide   polymorphism, SNP), are mainly in the genome by a single polynucleotide level caused by the variation of the DNA sequence of the polymorphism. The genetic variation in the human can be one of the most common. All known polymorphism account for 90% or more. SNP extensively exist in the human genome, the average every 500-1000 base pair in a 1 a, it is estimated that the total number thereof can be up to 300 million or more. DNA sequence of many biological function is affected by the change in, for example, individual to the disease probability of infection, and the response to drug treatment. By the study the control of a plurality of genes in the course of a complex disease, SNP analysis helps to judge whether each gene specific function.

Full name BRAF gene for murine sarcoma viral enterotoxinogenic (v-raf) carcinogenic homologous body B1, located on human chromosome 7q34, coding B-Raf protein, MAPK pathway is a serine/threonine kinase, the penetrated from the RAS signal transduction to MEK1/2, so as to participate in the regulation of cell growth, proliferation or apoptosis. BRAF activation mutation in including melanomas, thyroid cancer, colon cancer, and the like various malignant tumor, there is a report. Mutant site basic are located in section 15 exons of 1799 site, thymine is replaced by gland pyrimidine , so that the encoded amino acid from valine to glutamic acid (V600E mutation), and then the analog T599 and S602 two site process of phosphorylation of sustained activation BRAF kinase, MAPK pathway caused by sustained activation, cell unrestricted and split the multiplication. Therefore, the mutation can be used as a diagnostic and prognostic molecular biology mark and development for treating multiple malignant tumor gene target.

The common application of gene mutation BRAF method for detecting direct DNA sequencing for and limiting the small segment length polymorphism analysis (RFLP). Direct DNA sequencing, the method cycle is relatively long, expensive, flux is not high, cross-contamination may exist, and the degree of sensitiveness is only 20%-25% ; and tedious thorough RFLP experiment, long inspection period, the cost is high, there is restriction enzyme wheel 1st false positive, easy pollution, are difficult to meet the requirements of the clinical test.

Content of the invention

The present high throughput TaqMan-MGB probe gene typing method has been used for detecting single nucleotide polymorphism. Compared with the traditional taqman probe, quenching group MGB probe using non- the fluorescence quenches group (NFQ,   quencher   non-fluorescent), is not of itself generate fluorescence, can greatly reduce the interference of the background signal. On the probe at the same time is also connected with a MGB (minor   groove   binder) modifying groups, can improve Tm value of the probe 10 the left and right [...]. MGB probe is therefore shorter than the ordinary Taqman probe, is generally 10 to 15bp (Taqman probe is generally 25-35bp), higher probe specificity, can distinguish the difference of a base template, template difference of only one base, and will not be able to probe hybridization.

In response to the defect in the above-mentioned prior art, the present invention provides a method for detection of gene mutation BRAF, comprising the following steps:

A) extracting the tumor tissue DNA;

B) to step a) of the extracted DNA as the template, the sequence of the sequence list 1) and sequence 2) primer pair consisting of the sequence and the sequence table 3) and sequence 4) Taqman-MGB probe of the PCR amplification;

C) the step b) the product of the amplification of the allele discrimination analysis BRAF.

Said step a) the tumor tissue DNA from peripheral blood cells, or blood plasma circumference blood blood serum , humoral, black cavity, fresh tissue, cryosections, extracting sample paraffin slice.

Said step b) in, the reaction conditions of PCR 92-97 the pre-denaturation [...] 30s-5min; 92-97 the denatured [...] 10-30s, 55-60 the annealing [...] 30-45s, 30-40 a circulation.

Said step b) in, PCR   Taq Premix   Ex composition of the reaction solution   (2×)the 10  l, sequence 1) primer 0.2-0.4 the  l, sequence 2) primer 0.2-0.4 the  l, sequence 3) probe 0.4-0.8 the  l, sequence 4) probe 0.4-0.8 the  l, dye ROXII korsh than the 0.4  l, template DNA the 2  l, fill distilled water to 20 the  l.

The beneficial results of this invention are: the general MGB probe uses in SNP typing and wild type known point mutation, the detection of mutant and able, is a fast, high specificity, highly automated method of detecting SNP, can be used for large-scale genotyping. The detection method can be auxiliary clinical medical screening BRAF gene mutation in the patient, drug to the clinician to provide guidance and according to, the treatment of the risk and economic burden of the patient.

The major advantage of this invention lies in:

(1) this invention can achieve high flux detection, one can be detected at the same time up to 96 samples.

(2) the detection method of this invention simple steps, thus avoiding complex many existing in the course of operation is not the determining factor, thereby greatly improving the accuracy of the detection, can be used for analyzing a plurality of sources and sampling mode of the organization of DNA in the sample.

(3) the present invention improves the detection method of the detection time required is far less than the commonly used DNA sequencin detection technology. The result judging processing to from the sample only 90 minutes.

(4) the detection method can at the same time, detection of allele to the wild-type and mutant, not only greatly increases the accuracy of the detection of a gene mutation and the detection efficiency, also simplifies the operation procedure, and saves the time and cost.

(5) the detection method has high sensitivity, good specificity. DNA samples only narker level detection of, real-time detection of PCR product, no need of subsequent treatment, high specificity up to 100%.

Description of drawings

Figure 1 is the embodiment of the invention 3 in extracting DNA agarose electrophoresis map samples.

Figure 2 for BRAF wild-type positive control plasmid PCR amplification curve.

Figure 3 for mutant BRAF positive control plasmid PCR amplification curve.

Figure 4 as compared with the plasmid BRAF PCR amplification curve able to.

Fig. 5 is one example thyroid papilliferum cancer type the PCR amplification curve.

Figure 6 is one example thyroid papilliferum cancer cancer normal thyroid tissue samples by PCR amplification curve.

Figure 7 is one example thyroid papilliferum cancer opposite side normal thyroid tissue sample PCR amplification curve.

Figure 8 as the allele identifying print the report.

Mode of execution

The following embodiment of the experimental method and reagent used, if there is no special note, are conventional method and the conventional reagent.

Embodiment 1:

A, BRAF gene specific amplification primer and taqman-MGB and synthetic design of the probe:

According to the position of the mutation site design and genotype a pair of gene-specific upstream and downstream amplification primer (the length of the amplification product 136bp) and directed against the wild-type and mutant BRAF gene with different fluorescein-labelled taqman-MGB probe, each one. Primers and probes from Shanghai biological base Kang synthesis technology Company. Specific sequence is as follows.

BRAF   amplification primer:

BRAF-F1 (forward): 5 '  CTTACCTAAACTCTTCATAATGCTTGC   3''

BRAF-R1   (reverse): 5 '  TAGCCTCAATTCTTACCATCCACA   3''

BRAF gene wild-type probe: 5 the the [...] -E-AGCTACAGTGAAATC-P-3 [...]

BRAF gene mutant probe: 5 the the [...] -F-AGCTACAGAGAAATC-P-3 [...]

Wherein: the report E=HEX dye, dye report F=FAM, P=Taqman-MGB group

B, tumor tissue DNA extraction:

(1) sample collection: heating 2 example -80 the frozen [...] the fresh tissue block and 3 example normal temperature ethanol fixed tissue block 50-100   milligram, for the valve to be rapidly transferred to the mortar in liquid nitrogen precooling, the organization for grinding pestle , by adding liquid nitrogen continuously therebetween, until the grinding takes the form of powder (no obvious visible particles, if there is no grinding thoroughly affect the yield and quality of DNA). Add 1   milliliter   DNA extraction reagent (treasure biological engineering Company limited, Dairen, China; shipment numbers D305A), the grinding into a powder sample completely covered, to continue to grinding to cracking for maching pestle transparent, and returned to room temperature. Organizations cracking solution is   10, 000rpm/min, 4 °C centrifugal 5 minutes to remove most of the impurities such as tissue fragments, and the supernatant fluid is transferred to the new centrifuge tube. After the mortar and pestle timely into 0.5   M overnight   soak in   NaOH, morrows is cleaned by distilled water, high-pressure sterilizing.

(2) DNA extraction and purification: added to the above-mentioned cracking solution 500   uL anhydrous ethanol. Repeatedly reversed mixing 1-3 minutes, to precipitate DNA in the fog shape , the DNA from the gun head is transferred to the new centrifuge tube. If there is no precipitation or DNA when the amount is smaller and, can 4, 000rpm/min centrifugal room temperature for 2 minutes to precipitate DNA. Add 1 milliliter   75% ethanol washing DNA precipitation, 12, centrifugal 000rpm/min4 °C 5 minutes later discard supernatant. Inverted 5-10 minutes (inversion time as DNA plaquelike precipitation size and DNA aridic speed decision, that DNA can not be too dry, otherwise DNA will be difficult to be dissolved, but centrifugal pipe wall must remove the ethanol). Adding 50   uL   sterilizing steam water three times, the gun head for the door fully dissolved DNA.

(3) DNA concentration and purity determination: ultraviolet spectrophotometer using PerkinElmer, determining the concentration of DNA. Qualified indicators, A260/A230 in accordance with (1) OD value: 2.0-2.2 ; (2) A260/A280: 1.8-2.0 between requirements.

(4) DNA electrophoresis identification: the extracted DNA   5 add   uL   1   uL   6 × sample buffer solution, with 1.0% agarose gel electrophoresis 160V electrophoretic 15 minutes, electrophoresis strip more single, relatively pure.

Table 1 to 5 example of the detection result of the purity of the DNA sample.

Table 1

Three, BRAF wild-type and mutant positive control plasmid and identifying the preparation of:

Selecting 4 example papilliferum thyroid cancer cases sample, extracting DNA. As the template DNA to amplify the containing T1799A DNA fragment of the mutation site, primer sequence is BRAF-F2:5 '-ATGTTTTAAAGAATATTATA-3' ; BRAF-R2:5 ' -ACTCAGCAGCATCTCAGGGC-3'. PCR reaction conditions are 94 the pre-denaturation [...] 5   minute;   94 the denatured [...] 30   s, 60 the annealing [...] 30   s, 72 the extending [...] 30   s, 30 cycles. Recovery of DNA using agarose gel kit (treasure biological engineering Company limited, Dairen, China. Shipment numbers DV805A), that operation in accordance with the kit, tapping and purification of the product DNA, and identifying purity by agarose gel electrophoresis. Taking 4 example tumor samples with recovery of product DNA carrier T the 16 [...] connection sleepovers. Morrows conversion to fresh feeling state JM109 bacteria in, containing the X-gal, IPTG, Amp agarose plate culture medium for culturing. Selection of white colonies, enlarged culture, to get the plasmid, to DNA sequencing verification. After verification by the DNA sequencing, picking to the wild-type and mutant clone BRAF a, glycerin the fungus saves frozen , and extracting DNA plasmid spare.

Four, preparing PCR reaction solution:

PCR reaction solution in the ice of the preparation, the amount of each component and the final concentration as shown in table 2 is shown.

Table 2

The PCR reaction solution prepared, in addition to the template DNA, are noncontrast premixing and mix, and should include the additional volume (sufficient for one additional PCR reaction) in the process in order to compensate for the losses caused by the liquid. The sample is divided into the following types.

(1) template-free negative control: the premix mix liquid topping-up 1   uL sterilized distilled water.

(2) wild-type   BRAF positive control: the premix mix liquid topping-up 1 by   uL 1:10 of wild-type plasmid BRAF.

(3) positive control mutant   BRAF: mix liquid, the premix 1 by   uL 1:10 BRAF of mutant plasmid.

(4) compared with the able   BRAF: the premix mix liquid topping-up the 1 by   uL 1:10 of wild-type and mutant plasmid BRAF.

(5) unknown sample: mix liquid, the premix 1   uL DNA sample to be measured.

Five, PCR amplification and result interpretation:

(1) using   ABI   7500   PCR   instrument, through the implementation of the following steps to generate BRAF allele identification data and results of experiment:

Reading premplification fluorescence signal: using a allele differentiation reaction plate file, measuring premplification and primer and probe related baseline fluorescence level;

Amplification process: using an absolute quantitative reaction plate file generating real-time   PCR   data, for analysis and debugging the   PCR   data necessary to complete the allele identifying the experiment. PCR reaction conditions for 95 the pre-denaturation [...] 30s; 95 the denatured [...] 5   s, 60 the annealing [...] 34s, 40 a circulation;

Read fluorescence signal after amplification of the original allele differentiation reaction plate file, automatic less premplification read signal measured during the baseline fluorescence level, then data using post amplification of the allele typing (automatic or manual).

Sample BRAF gene mutation type the results of the analysis as shown in table 3 is shown.

Table 3

<110>Institute of medical science  , Jiangsu province atom

<120> A method of detecting BRAF gene mutation

<160>   4

<210>   1

<211>   27

<212>   DNA

<213> Artificial sequence

<400>   1

 Tgcttgc   ctcttcataa cttacctaaa     27

<210>   2

<211>   24

<212>   DNA

<213> Artificial sequence

<400>   2

 Caca   tcttaccatc tagcctcaat     24

<210>   3

<211>   15

<212>   DNA

<213> Artificial sequence

<400>   3

 Aaatc agctacagtg     15

<210>   4

<211>   15

<212>   DNA

<213> Artificial sequence

<400>   4

 Aaatc agctacagag     15