MOLECULAR MARKER FOR IDENTIFYING COLOR OF SOYBEAN AND USE THEREOF
The present invention refers to soy bean color identification method for identifying color number one primer pair and a number are disclosed. The bean is injected very important crops world mirror number are disclosed. We often taken in case food uses biodiesel as raw material for animal feed forward more cookies further progressing disclosed. The number of useful gene having the beans before world Institute of research and development and breeding etc. varieties due to converge to a producer and director. Bean in a variety of applications and can be used as food industry, such as the lid of and a head used primarily etc. in particular station. Said bean varieties suitable to only select phenotypes using normally bean varieties, is used for the same size of transgenic seed, bell blood color, color number etc. (hilum color). Typically proteins (yellow) color varieties take the greater number seed large varieties to handle any other. For analyzing DNA molecular marker relates to Korean Public Patent Notification 200 krone 5 provided 0109812 bean is, during bell blood color identifying molecules capable of marker in a soy DNA sequence are disclosed. The victims of the appearance of the present invention color number of beans can quickly and effectively identifying and processing to affect color number since labeled molecules capable of initially selecting breeding has been developed.
The purpose of the invention is represented by the sequence number 1 number 2 and sequencing primer; and sequencing number represented by the sequence numbers 3 4 primer; and sequencing primer sequence numbers 5 6 number is indicated; and sequencing number represented by sequence number 7 8 primer; and sequencing primer sequence number 10 number 9 is indicated; and sequencing primer sequence numbers 11 12 number represented by; and sequencing number 14 and sequencing number 13 represented by at least one primer pair selected from the group consisting antibody pairs including process for number for identifying primer pair number [...] color (hilum color) are disclosed.
It is another object of the present invention (V) isolating a soybean genome DNA from a sample; (A) said separated genome DNA as templates, performing PCR amplification reactions using primer pair according to Claim 1; (Some) detecting PCR amplification product; and (A) comparing the detected in (some) soybean varieties of an amplification product; A number including a color identification number [...] bean method are disclosed.
The present invention refers to the sequence numbers 1 2 and sequencing number represented by primer; and sequencing number represented by the sequence numbers 3 4 primer; and sequencing primer sequence numbers 5 6 number is indicated; and sequencing number represented by sequence number 7 8 primer; and sequencing primer sequence number 10 number 9 is indicated; and sequencing primer sequence numbers 11 12 number represented by; and sequencing number 14 and sequencing number 13 represented by at least one primer pair selected from the group consisting antibody pairs including process for number for identifying primer pair number color (hilum color) [...] substrate.
In the present invention implies process for appearance quality and processability such as "color number (hilum color)" terms affecting soy gene for one, the color of a soybean seed eye site said substrate. In the present invention it number referred to as "color identification number" hetero-color color identifying big number and beans. In the present invention number hetero-color color number is gold-gold color classification number (bean varieties name) and hereinafter in the present invention that represents an hetero-gold color is a color other than color that represents an abundant harvest-his classification (bean varieties name) technology.
In the present invention number color transformation bean varieties including gold and abundant harvest the identification used to table 1 of the varietal 104 can be a two, the one number are not disclosed.
Said color number process for the primer pairs (background gene) into a gene related to the left through the varieties to analyzing a PCR method between band size/number identifying traits can be bean color analysis. Said process for number of hetero-gene related to color left implementation being chromosome 8 times. Preferably between insertion/deletion (insertion/deletion) in chromosome 8 times at different bean varieties can be variant site.
In the present invention the terms "insertion/deletion (indel) variant site" DNA base sequence is received intermediate (insertion) or deleted (deletion) transition in some base is the general term to each other. Said Indel site based trafficking sequence through a dielectric types of comparative analysis method is based on a dielectric insert (insertion) or deleted (deletion) area to discover small number decodes information based on primer. The its amplification result based on dielectric (insertion) compared to the band be pulled in and if the former is smaller (deletion) may be this is effected by insuring form two types of varieties device for a system capable of disclosed.
The present invention refers to, (V) isolating a soybean genome DNA from a sample; (A) said separated genome DNA as templates, performing PCR amplification reactions using primer pair according to Claim 1; (Some) detecting PCR amplification product; and (A) comparing the detected in (some) soybean varieties of an amplification product; A color identification method including a bean number number [...] substrate.
Said color number process for the primer pairs (background gene) into a gene related to the left through the varieties to analyzing a PCR method between band size/number identifying traits can be bean color analysis. Said process for number of hetero-gene related to color left implementation being chromosome 8 times. Preferably between insertion/deletion (insertion/deletion) in chromosome 8 times at different bean varieties can be variant site.
(The) an amplification product detected in said step of comparing the amplified gene inserts or deletions since due to the length of the section between the differ, bean varieties grown in same number can be compared to identify the presence or absence of various color.
The primer pairs of the present invention determining gene on chromosome 8 times involved in color number process for present amplifying specific bio-sequence listing can be left, gene loci in identifying genetic variant (insertion/deletion site) occurs can be soybean varieties growing number of seeds and future gene program initially can be indication of whether color identifying number SNPs (marker provided assist selection) can be promoting - bean color. Figure 1 shows a color number for identifying molecular marker utilizing a mimetic bean also are disclosed. Figure 2 in the present invention revealing the secret number 104 used bean varieties grown in two color phenotype are disclosed. Figure 3 of the present invention 7 representing the result of performing PCR using primer pair of are disclosed (H is gold type, D is abundant harvest type, exhibits hetero is H). Figure 4 104 for two PCR genotype and phenotype comparison result bean varieties are disclosed (red/gold type, blue/abundant harvest type, exhibits hetero/yellow). Hereinafter, the present invention in the embodiment by a data transmissions take other. Stage, in the embodiment for the present invention is exemplified ephemeral is, in the embodiment of the present invention to defined by contents are not correct. In the embodiment 1. DNA extracted from soybean varieties Chromosome DNA for decryption (table 1) varieties of soy bean extract from gene won 104 brocadcast FM with food Institute age agriculture laboratory after 30 to convert such as tissue from the Sowing box is protrusively [...] Saghai Maroof (1984) to DNA extraction method of conducting. In buckwheat leaves -70 °C preservation (0. 2G) is cooled to a liquid nitrogen immediately when the fire while a moment [...] grinding 1. 5 Ml tube affected by chicken soup. CTAB (cetyl trimethyl ammonium bromide) extraction buffer to allow mixing of roadway 500 micro l 30 minutes after adding 65 °C-gate because bath is carried out. Chloroform/ISO amyl alcohol (Chloroform/isoamyl alcohol, 24:1) adding each sample solution 500 micro l, reversed hand spray is opened while 12,000 rpm, 15 minutes in his 4 °C centrifuging. Supernatant after 10 micro l less affected by saddle tube (10 mg/Ml) RNase A through the decreased. 30 Minutes to precipitate the DNA into small propane this year 2/3 been mode so that by operating the mixing degree. (Pellet) in 70% ethanol precipitated [...] out after addition of 12,000 rpm, 5 minutes when the supernatant after centrifuging the number of special cleaning back to his 70% ethanol. DNA pellet to dry sterilization in distilled water was added 300 micro l. When the extracted DNA is regulated so as to remove the above micro l concentration 100 ng/nano drop as well as experiment. In the embodiment 2. Molecular marker bean color identification number search and PCR conditions Molecular marker for color identification number aujesky bean, 7 decryption bean varieties (gold, abundant harvest, williams 82, receiver, storehouse [kyo, 2 new it sells the month bean, white cloud) bio-sequence listing information on the number 5 bp or more embedded in color gene deletion (Insertion/deletion)/left primer 3 to table is searched for a new design for primer pair 2 transitions have, table 2 PCR product of the expected size detected firstly. Sequence numbers 1 and 2 of the primer pairs of the present invention to "SHC-a 1", the sequence numbers 3 and 4 of the primer pairs to "SHC-a 2", the sequence numbers 5 and 6 of the primer pairs to "SHC-a 3", the sequence numbers 7 and 8 of the primer pairs "SHC-a 4" to, sequence number 9 and 10 of the primer pairs "SHC-a 5" to, the sequence numbers 11 and 12 of the primer pairs "SHC-a 6" to, the sequence numbers 13 and 14 of the primer pairs each was designated "SHC-a 7". The PCR reaction mixture is added to 10 micro l when the performance (master mix), 100 ng of genomic DNA therein, (CellSafe, Suwon, Korea) 2X DNA free-a Taq PCR Master Mix 2 pmole of each primers and 5 micro l to all. PCR amplification is C1000 Touch (BMS, New York, USA) in 5 minutes 95 °C (denaturation) performing a modified by the source have, in compound 94 °C after 30 seconds, annealing at a temperature of 30 seconds have 43 °C (annealing), 72 °C (extension) in 30 seconds when the total 35 cycle amplification process repeated, 72 °C 5 minutes have in the final amplification, terminate in PCR amplification reactions was 10 °C. The amplified PCR product is a replacement reagent 6X LoadingSTAR EtBr (Ethidium bromide) obtained by adding 3% agarose gel (DyneBio, Seongnam-a si, Korea) in 120 to 180 minutes after loading expected to progress when the 100V, copper end behind the memory in an electrophoretic UV therefrom. In the embodiment 3. The present invention bean varieties grown in number 104 used in comparison of two color phenotype and genotype Figure 2 the present invention according to the table 1 soybean varieties can be identified by the pairs of primer 104 to a test object number two and number the abundant harvest gold type (H) color number color phenotype (D) have shown to reduce the amount of color-group 2. Figure 3 7 104 using primer pair of genotype irradiated result was tested in two varieties in Ziegler-Natta catalysts. The amplified result such as "H" it appears that only small size band provided are based on the results, such as abundant harvest results "D", if his "h" hetero-time. Figure 4 of the present invention color identification primer pair of amplification resulting phenotype and genotype bean number 104 compares two varieties have shown. Provided are regions such as the red ones, such as region is abundant harvest blue, yellow hetero region is his display. 2 To 4 also appears in the classifies the result also, SHC-a 1, SHC-a 2 performed result of the genotype and bean number for primer pair and SHC-a 3 color match rate 95 phenotype. 2% -98. 1% SHC-a 4 pulse, SHC-a 5, performing result of the genotype for primer pairs SHC-a 6 and SHC provided 7 (table 3) and agreement on 100% co. The two primer pairs for very rapid bean varieties grown in color number 7 moieties can be hetero-number identifying color development can be efficiently utilized was a decision. The present invention relates to a pair of primers for identification of soybean color, and a method for discriminating bean color using the same. Specifically, by using a primer pair specific to a locus related to a soybean color trait, a molecular marker of identifying color of soybean can be used to quickly identify the color of the soybean variety, thereby capable of being utilized in development of soybean without any color. Further, in the future molecular breeding program, the color of seeds at an early stage of cultivating the soybean varieties can be discriminated, thereby promoting marker-assisted selection of soybean color. COPYRIGHT KIPO 2018 The sequence numbers 1 2 and sequencing number represented by primer; and sequencing number represented by the sequence numbers 3 4 primer; and sequencing primer sequence numbers 5 6 number is indicated; and sequencing number represented by sequence number 7 8 primer; and sequencing primer sequence number 10 number 9 is indicated; and sequencing primer sequence numbers 11 12 number represented by; 8 and 13 antibody pairs 14 and sequencing of number represented by at least one selected from the group consisting willi america [me pair number for identifying color (hilum color) including soy one primer pair.
According to Claim 1,
The identification number and number hetero-color color color number said soy beans to differentiate the color bean number for identifying primer pair.
According to Claim 1,
Said two soybean varieties grown in bright color display 104 1 bean is number for identifying primer pair. [Table 1]
According to one of Claim 1 to Claim 3,
According to Claim 3 table 1 gene deletion/insertion of said primer pairs are display 104 (Insertion/deletion) to detect two varieties grown in variant site number will it became work, bean color number for identifying primer pair.
(V) isolating a soybean genome DNA from a sample;
(A) said separated genome DNA as templates, performing PCR amplification reactions using primer pair according to Claim 1;
(Some) detecting PCR amplification product; and
(A) comparing the detected in an amplification product of soybean varieties (some); bean color identification method including a number. According to Claim 5, said hetero-color color number and color the identification number number soy beans to differentiate the bean number color identification method.
According to Claim 5,
According to Claim 3 table 1 104 to prevent the two said soy is appearing a varietal, soy number color identification method.
According to one of Claim 5 to Claim 7,
Said two primer pairs according to Claim 3 table 1 gene insertion/deletion variant site display 104 (insertion/deletion) to detect the number of the substrates will it became work, process for number color identification method. Number The varietal name Number The varietal name Number The varietal name 1 Stipendiary circle 36 2 Call attaches a soy 71 Virtue type 2 A compacted 37 [Cheng two call 1 72 New it sells the month bean 3 Docking 38 [Thay storehouse soy 73 It sells month soy 4 2 Docking call 39 Has anti 74 Image foot bean 5 The senate 40 Gold soy 75 Cotton cloth fills the role 6 Three quantity foot bean 41 Light soy 76 Cities and back 7 Fresh verdure 42 Southern sea soy 77 Two light 8 Escape ol 43 Multi 78 The bird only hundred beans 9 Is big and the bean which comes 44 A sensitive 79 Database 2010 10 Anger freezing, foot bean 45 [Ley america soy 80 For 11 Small hwang 46 Crock fastness extracted soy 81 1 Call for 12 Solid soy 47 Jewel 82 Astronomical phenomenon 13 South wind 48 The secondary soy 83 1 Trillion sheep call 14 Multiple soy 49 Nova bean 84 It will increase and it kicked 15 Namely soy 50 The southwest soy 85 Multi this year 16 Soy protein 51 Carbon soy 86 Middle wool 3003 17 Troupe soy 52 Small rock bean 87 Williams 82 18 Ambition 53 Cow hundred green bean 88 White cloud 19 The ocean floor 54 Database soy 89 Receiver 20 Tins of soy 55 GaAs 90 Enrei 21 Abundant harvest 56 Point 91 L29 22 Soy bean 57 Synthetic 92 Hsinchiang 23 Being filled with water 58 Criticism 93 Right [lam 24 Endless soy 59 Nimbus 94 PI96983 25 Third son soy 60 Hwang circle 95 V94 provided 5152 26 Small wall soy 61 Eun soy 96 Squall 27 [Song crane soy 62 The tooth extracted soy 97 Sea breeze 28 Full bean 63 Long-term 98 Cyclone 29 Helpful soy 64 Trillion sons 99 Planus 30 Rose soy 65 It sells degree extracted soy 100 Market year soy 31 The multiple soy 66 P'ungsan extracted soy 101 Laws soy 32 Market lobe soy 67 Wind circle 102 [...] soy 33 Market won soy 68 [...] soy 103 The Ggreat soy 34 [...] soy 69 Call connection 104 Click soy 35 Attaches a soy 70 Storehouse [kyo Primer pair (Bp) PCR product size Chromosome Position (kbp) A forward primer (5 '→3') Sequence number Reverse primer (5 '→3') Sequence number SHC-a 1 110 8 8,344 TTCAAAACCTTGAAATTCCT 1 GGATAAAACTACTGGAAATCCTT 2 SHC-a 2 92 8 8,345 ACCGCTATAATTAATGGCAA 3 AACATAGGTGCTCTTTTTGG 4 SHC-a 3 113 8 8,345 CTTGCAAAAATTGATGTGAA 5 CAAAAGCGACTAAGGGAAA 6 SHC-a 4 89 8 8,374 GACAAATATCCATTCCAATTC 7 CCTCATAATTTTGGGATTGA 8 SHC-a 5 80 8 8,376 ACAGAGGAGAGAGGGAGAAG 9 TAACTTTGAAATGTTGGCG 10 SHC-a 6 106 8 8,415 ACACCTGTTTAAACTCGATCA 11 ACATGCACGTTCGTGTTAC 12 SHC-a 7 104 8 8,498 TGATTTCCAAGACAAATAAAGA 13 TTTTGTTTTTGTCAGCTACG 14 Number The varietal name Phenotype Genotype SHC-a 1 SHC-a 2 SHC-a 3 SHC-a 4 SHC-a 5 SHC-a 6 SHC-a 7 Phenotype and genotype match rate 95. 2% 98. 1% 98. 1% 100% 100% 100% 100% 1 Stipendiary circle D* 1 X* 3 O O O O O O 2 A compacted H* 2 O* 4 O O O O O O 3 Docking H O O O O O O O 4 2 Docking call D X O O O O O O 5 The senate H O O O O O O O 6 Three quantity foot bean D X O O O O O O 7 Fresh verdure H O O O O O O O 8 Escape ol D O O O O O O O 9 Is big and the bean which comes H O O O O O O O 10 Anger freezing, foot bean H O O O O O O O 11 Small hwang H O O O O O O O 12 Solid soy D O O O O O O O 13 South wind D O O O O O O O 14 Multiple soy D O O O O O O O 15 Namely soy D O O O O O O O 16 Soy protein D O O O O O O O 17 Troupe soy D O O O O O O O 18 Ambition D O O O O O O O 19 The ocean floor H O O O O O O O 20 Tins of soy H O O O O O O O 21 Abundant harvest D O O O O O O O 22 Soy bean D O O O O O O O 23 Being filled with water H O O O O O O O 24 Endless soy D O O O O O O O 25 Third son soy D O O O O O O O 26 Small wall soy H O O O O O O O 27 [Song crane soy H O O O O O O O 28 Full bean D O O O O O O O 29 Helpful soy D O O O O O O O 30 Rose soy D O O O O O O O 31 The multiple soy D O O O O O O O 32 Market lobe soy H O O O O O O O 33 Market won soy D O O O O O O O 34 [...] soy H O O O O O O O 35 Attaches a soy H O O O O O O O 36 2 Call attaches a soy H O O O O O O O 37 [Cheng two call 1 D O O O O O O O 38 [Thay storehouse soy H O O O O O O O 39 Has anti H O O O O O O O 40 Gold soy H O O O O O O O 41 Light soy D O O O O O O O 42 Southern sea soy D O O O O O O O 43 Multi D O O O O O O O 44 A sensitive D O O O O O O O 45 [Ley america soy D O O O O O O O 46 Crock fastness extracted soy D O O O O O O O 47 Jewel D O O O O O O O 48 The secondary soy D O O O O O O O 49 Nova bean D O O O O O O O 50 The southwest soy D O O O O O O O 51 Carbon soy D O O O O O O O 52 Small rock bean D O O O O O O O 53 Cow hundred green bean H O O O O O O O 54 Database soy D O O O O O O O 55 GaAs D O O O O O O O 56 Point D O O O O O O O 57 Synthetic D O O O O O O O 58 Criticism D O O O O O O O 59 Nimbus D O O O O O O O 60 Hwang circle D O O O O O O O 61 Eun soy D O O O O O O O 62 The tooth extracted soy D O O O O O O O 63 Long-term D O O O O O O O 64 Trillion sons H O O O O O O O 65 It sells degree extracted soy D O O O O O O O 66 P'ungsan extracted soy H O O O O O O O 67 Wind circle D O O O O O O O 68 [...] soy D O O O O O O O 69 Call connection D O O O O O O O 70 Storehouse [kyo D O O O O O O O 71 Virtue type D O O O O O O O 72 New it sells the month bean D O O O O O O O 73 It sells month soy D O O O O O O O 74 Image foot bean D X X X O O O O 75 Cotton cloth fills the role H O O O O O O O 76 Cities and back H O O O O O O O 77 Two light D O O O O O O O 78 The bird only hundred beans D O O O O O O O 79 Database 2010 D O O O O O O O 80 For H O O O O O O O 81 1 Call for H O O O O O O O 82 Astronomical phenomenon D O O O O O O O 83 1 Trillion sheep call H O O O O O O O 84 It will increase and it kicked H O O O O O O O 85 Multi this year D O O O O O O O 86 Middle wool 3003 H X X X O O O O 87 Williams 82 D O O O O O O O 88 White cloud D O O O O O O O 89 Receiver D O O O O O O O 90 Enrei H O O O O O O O 91 L29 D O O O O O O O 92 Hsinchiang D O O O O O O O 93 Right [lam H O O O O O O O 94 PI96983 D O O O O O O O 95 V94 provided 5152 D O O O O O O O 96 Squall H O O O O O O O 97 Sea breeze D O O O O O O O 98 Cyclone H O O O O O O O 99 Planus H O O O O O O O 100 Market year soy D O O O O O O O 101 Laws soy D O O O O O O O 102 [...] soy H O O O O O O O 103 The Ggreat soy H O O O O O O O 104 Click soy H O O O O O O O * 1 D: abundant harvest type, color number release has occurred,* 2 H: gold type, number chromatic nil,* 3 X: phenotype and genotype mismatch,* 4 O: phenotype and genotype match
