PROTEIN HAVING L-PROLINE EFFLUX FUNCTION, AND USE THEREOF
The present application claims priority to Chinese Patent Application No. 2021100451754 filed with China National Intellectual Property Administration on Jan. 13, 2021, entitled “PROTEIN HAVING L-PROLINE EFFLUX FUNCTION, AND USE THEREOF”, which is incorporated herein by reference in its entirety. The present disclosure belongs to the field of molecular biology and bioengineering, and particularly relates to novel use of ThrE, a threonine efflux protein of L-proline is a naturally occurring non-essential amino acid in the human body and has a wide range of applications in the fields of clinics, biomaterials, industry, and the like. Methods for producing L-proline mainly include chemical methods and fermentation methods. The chemical extraction method has gradually lost its marketability due to the serious pollution and high cost, while the microbial fermentation method has become the most widely used method in the modern industry due to its advantages of low production cost, high productivity, high specificity, low environmental pollution, and the like. Currently, the commonly used industrial fermentation strains are In order to overcome the problems in the prior art, in the present disclosure, L-proline efflux proteins of An objective of the present disclosure is to provide the use of the proline efflux protein in producing L-proline or hydroxyproline. Another objective of the present disclosure is to provide a strain producing L-proline or hydroxyproline. Still, another objective of the present disclosure is to provide a method for producing L-proline or hydroxyproline. Still, yet another objective of the present disclosure is to provide a method for constructing a strain producing L-proline or hydroxyproline. In a first aspect of the present disclosure, provided is use of a polypeptide as a proline efflux protein in producing L-proline and hydroxyproline, the polypeptide being:
In another preferred embodiment, the polypeptide is a polypeptide derived from a polypeptide having an amino acid sequence set forth in SEQ ID NO: 1 or 2, is formed by adding one or several, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, and most preferably 1 amino acid residue at either or both ends of the amino acid sequence set forth in SEQ ID NO: 1 or 2, and has an L-proline efflux function. In another preferred embodiment, the polypeptide has an amino acid sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In a second aspect of the present disclosure, provided is a strain for producing L-proline, wherein the strain expresses the following polypeptide:
In another preferred embodiment, the polypeptide is a polypeptide derived from a polypeptide having an amino acid sequence set forth in SEQ ID NO: 1 or 2, is formed by adding one or several, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, and most preferably 1 amino acid residue at either or both ends of the amino acid sequence set forth in SEQ ID NO: 1 or 2, and has an L-proline efflux function. In another preferred embodiment, the polypeptide has an amino acid sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In another preferred embodiment, the strain is a bacterium. In another preferred embodiment, the strain is selected from In another preferred embodiment, glutamate kinase in the bacterium is not subjected to feedback inhibition by L-proline or is subjected to attenuated feedback inhibition by L-proline. In another preferred embodiment, the activity of glutamate kinase and/or glutamate-semialdehyde dehydrogenase and/or pyrroline-5-carboxylate reductase in the bacterium is enhanced. In a third aspect of the present disclosure, provided is a method for producing L-proline, the method comprising: culturing the strain described above to produce L-proline. In another preferred embodiment, the method further comprises a step of isolating L-proline from a fermentation broth. In a fourth aspect of the present disclosure, provided is a method for constructing a strain for producing L-proline, the method comprising enhancing the activity of the following polypeptide having an L-proline efflux function in the strain:
In another preferred embodiment, the polypeptide is a polypeptide derived from a polypeptide having an amino acid sequence set forth in SEQ ID NO: 1 or 2, is formed by adding one or several, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, and most preferably 1 amino acid residue at either or both ends of the amino acid sequence set forth in SEQ ID NO: 1 or 2, and has an L-proline efflux function. In another preferred embodiment, the polypeptide has an amino acid sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In another preferred embodiment, the strain is a bacterium. In another preferred embodiment, the strain is selected from In another preferred embodiment, glutamate kinase in the bacterium is not subjected to feedback inhibition by L-proline or is subjected to attenuated feedback inhibition by L-proline. In another preferred embodiment, the activity of glutamate kinase and/or glutamate-semialdehyde dehydrogenase and/or pyrroline-5-carboxylate reductase in the bacterium is enhanced. In a fifth aspect of the present disclosure, provided is a host cell in which the activity of a polypeptide having an L-proline efflux function is attenuated, wherein the polypeptide having the activity of the L-proline efflux function is:
In another preferred embodiment, the host cell is selected from In another preferred embodiment, glutamate kinase in the host cell is not subjected to feedback inhibition by L-proline or is subjected to attenuated feedback inhibition by L-proline. In another preferred embodiment, the activity of a proline hydroxylase in the host cell is enhanced. In another preferred embodiment, the proline hydroxylase is trans-proline-4-hydroxylase having a nucleotide sequence as set forth in SEQ ID NO: 5. In another preferred embodiment, the activity of glutamate kinase and/or glutamate-semialdehyde dehydrogenase and/or pyrroline-5-carboxylate reductase in the bacterium is enhanced. In a sixth aspect of the present disclosure, provided is a method for producing hydroxyproline such as trans-4-hydroxy-L-proline and the like, the method comprising: culturing the host cell described above to produce hydroxyproline such as trans-4-hydroxy-L-proline and the like. In another preferred embodiment, the method further comprises a step of isolating hydroxyproline such as trans-4-hydroxy-L-proline and the like from a fermentation broth. In a seventh aspect of the present disclosure, provided is a method for constructing a strain for producing hydroxyproline such as trans-4-hydroxy-L-proline and the like, wherein the method comprises:
In another preferred embodiment, the activity of glutamate kinase and/or glutamate-semialdehyde dehydrogenase and/or pyrroline-5-carboxylate reductase in the bacterium is enhanced. In another preferred embodiment, the proline hydroxylase is trans-proline-4-hydroxylase having a nucleotide sequence as set forth in SEQ ID NO: 5. The beneficial effects of the present disclosure are as follows:
The technical solutions of the present disclosure will be further illustrated in detail with reference to the following specific examples. It will be appreciated that the following examples are merely exemplary illustrations and explanations of the present disclosure, and should not be construed as limiting the protection scope of the present disclosure. All techniques implemented based on the content of the present disclosure described above are included within the protection scope of the present disclosure. Unless otherwise stated, the starting materials and reagents used in the following examples are all commercially available products or can be prepared using known methods. Where specific conditions are not indicated in experimental methods in the following examples, conventional conditions such as those described in Sambrook et al., The term “polypeptide having an L-proline efflux function” used herein refers to a protein or a polypeptide that can excrete L-proline in a cell to the outside of the cell, which may be a protein set forth in SEQ ID NO: 1 or SEQ ID NO: 2, or a protein or a polypeptide that is obtained by mutating SEQ ID NO: 1 or SEQ ID NO: 2 and still has an L-proline efflux function. The terms “protein”, “polypeptide” and “peptide” used herein are used interchangeably, have the meanings commonly understood by one of ordinary skill in the art, and refer to amino acid polymers of any length. The polymers may be linear or branched. They may comprise modified amino acids and may be interrupted by non-amino acids. The terms also encompass amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other operation, such as conjugation with a labeling component). The term “fusion protein” used herein refers to a protein obtained by fusing the mutant protein with a protein tag. The protein tag can be located at the N-terminus of the mutant protein or at the C-terminus of the mutant protein. The mutant protein and the protein tag may also have a spacer amino acid residue therebetween, and specifically may have fewer than 10 spacer amino acid residues therebetween. The term “host cell” herein means any type of cell that is susceptible to transformation, transfection, transduction, and the like using the polypeptide having the activity of the L-proline efflux function of the present disclosure, a polynucleotide encoding the polypeptide, or an expression vector. The term “recombinant microorganism” encompasses host cells which differ from parent cells after introduction of a transcription initiation element or a recombinant expression vector, specifically, the recombinant host cells are achieved by transformation. For example, suitable host cells for use in the present disclosure include, but are not limited to, The term “transformation” herein has the meaning generally understood by those skilled in the art, i.e., the process of introducing exogenous DNA into a host. Methods for the transformation include any method for introducing a nucleic acid into a cell, including, but not limited to, electroporation, calcium phosphate precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method. The culture of the host cell herein may be performed according to a conventional method in the art, including, but not limited to, well plate culture, shake-flask culture, batch culture, continuous culture, fed-batch culture, and the like, and various culture conditions such as temperature, time, pH of a medium, and the like may be appropriately adjusted according to actual circumstances. The terms “comprise”, “have”, “include”, or “contain” used herein are intended to be inclusive or open-ended and do not exclude additional, unspecified elements or method steps. The term “about” used herein means that a value includes the standard deviation of error for the device or method used to determine the value. The term “or” used herein is defined as merely an alternative and “and/or”, but unless it is explicitly stated to be only an alternative or mutually exclusive between alternatives, the term “or” in the claims means “and/or”. The selected/optional/preferred “numerical range” used herein includes both numerical endpoints at both ends of the range and all natural numbers covered between the numerical endpoints with respect to the aforementioned numerical endpoints. The terms “wild-type” and “naturally occurring” used herein refer to an object that can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism, that can be isolated from a source in nature, and that has not been intentionally modified by humans in the laboratory, is naturally occurring. The term “amino acid mutation” or “nucleotide mutation” used herein includes “substitution, repetition, deletion, or addition of one or more amino acids or nucleotides”. In the present disclosure, the term “mutation” refers to an alteration in nucleotide sequence or amino acid sequence. In a specific embodiment, the term “mutation” refers to “substitution”. The term “native state” used herein refers to the activity of a polypeptide in a microorganism in an unmodified state, i.e., the activity in the native state. The term “having the activity of an L-proline efflux function” used herein has the same or similar meaning as conventionally understood by those skilled in the art. It means that the amino acid sequence of a fragment is a portion of the amino acid sequence of an intact protein or polypeptide, and has the same or similar function or activity as the intact protein or polypeptide. Specifically, in the present disclosure, it indicates any amino acid fragment obtained from the ThrE protein of the present disclosure and having an L-proline efflux function. It is known to those skilled in the art that, for mutating a wild-type polypeptide in order to improve the activity, it is more important to find a site that can achieve the desired purpose. Therefore, based on the teachings of the present disclosure, a person skilled in the art will mutate the amino acid sequence set forth in SEQ ID NO: 1 or 2 and test the mutant for the relevant activity. In addition, it is not difficult for one of ordinary skill in the art to know that altering a few amino acid residues in certain regions of a polypeptide, e.g., in non-critical regions, does not substantially alter biological activity. For example, the sequence obtained by properly replacing some amino acids does not affect its activity (see Watson et al., Therefore, it is apparent that further mutations of the L-proline efflux protein of the present disclosure result in further mutants that still have corresponding functions and activities. For example, it is well known to those skilled in the art that adding or removing several amino acid residues, e.g., preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, and most preferably 1 amino acid residue, to or from either end of a polypeptide does not affect the function of the resulting mutant. For example, for ease of purification, a skilled person usually makes the resulting protein have a 6×His tag at either end, and such protein has the same function as a protein that does not have the 6×His tag. Therefore, the present disclosure shall include conservative mutations obtained based on the present disclosure. The term “conservative mutation” refers to a mutation that can normally maintain the function of a protein. A representative example of the conservative mutation is a conservative replacement. As used in the present disclosure, the term “conservative replacement” relates to the replacement of an amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art and include those having basic side chains (e.g., lysine, arginine, and histidine), acidic side chains (e.g., aspartic acid and glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan), (3-branched chains (e.g., threonine, valine, and isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, and histidine). As used in the present disclosure, the “conservative replacement” typically refers to the substitution of one type of amino acid at one or more sites in a protein. Such substitution may be conservative. Examples of replacements regarded as conservative replacements include replacement of Ala with Ser or Thr, replacement of Arg with Gln, His or Lys, replacement of Asn with Glu, Gln, Lys, His or Asp, replacement of Asp with Asn, Glu or Gln, replacement of Cys with Ser or Ala, replacement of Gln with Asn, Glu, Lys, His, Asp or Arg, replacement of Glu with Gly, Asn, Gln, Lys or Asp, replacement of Gly with Pro, replacement of His with Asn, Lys, Gln, Arg or Tyr, replacement of Ile with Leu, Met, Val or Phe, replacement of Leu with Ile, Met, Val or Phe, replacement of Lys with Asn, Glu, Gln, His or Arg, replacement of Met with Ile, Leu, Val or Phe, replacement of Phe with Trp, Tyr, Met, Ile, or Leu, replacement of Ser with Thr or Ala, replacement of Thr with Ser or Ala, replacement of Trp with Phe or Tyr, replacement of Tyr with His, Phe or Trp, and replacement of Val with Met, Ile or Leu. In addition, the conservative mutations also include naturally occurring mutations caused by individual differences, differences in strain and species, and the like from which genes are derived. The term “corresponding to” used herein has the meaning commonly understood by one of ordinary skill in the art. Specifically, the term “corresponding to” refers to a position in a sequence corresponding to a specified position in another sequence after alignment of the two sequences by homology or sequence identity. Thus, for example, in terms of “an amino acid residue corresponding to position 40 of the amino acid sequence set forth in SEQ ID NO: 1”, if a 6×His tag is added to one end of the amino acid sequence set forth in SEQ ID NO: 1, then position 40 of the resulting mutant corresponding to the amino acid sequence set forth in SEQ ID NO: 1 may be position 46. In a specific embodiment, the homology or sequence identity may be no less than 90%, preferably no less than 95%, and more preferably 96%, 97%, 98%, or 99% homology. Methods for determining sequence homology or identity well known to one of ordinary skill in the art include, but are not limited to: Unless defined otherwise, or clear from the background, all technical and scientific terms used in the present disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure belongs. The inventors screened L-proline efflux proteins of To further confirm the effect of the thrE gene inhibition on L-proline production, evaluations were performed by fermentation using a 24-well deep-well plate. The seed culture medium contained the following ingredients (g/L): 5 g/L glucose, 1 g/L yeast powder, 3 g/L soybean peptone, 3 g/L urea, 0.5 g/L succinic acid, 1 g/L K2HPO4.3H2O, 0.1 g/L MgSO4·7H2O, 0.01 mg/L biotin, 0.1 mg/L vitamin B1, and 20 g/L MOPS. The fermentation culture medium contained the following ingredients: 80 g/L glucose, 1 g/L yeast powder, 1 g/L soybean peptone, 1 g/L NaCl, 1 g/L ammonium sulfate, 6 g/L urea, 1 g/L K2HPO4·3H2, 0.45 g/L MgSO4·7H2O, 0.05 g/L FeSO4·7H2O, 0.4 mg/L biotin, 0.1 mg/L vitamin B1, and 40 g/L MOPS, and the initial pH was 7.2. Firstly, the strains were inoculated into a seed culture medium containing 15 μg/mL chloramphenicol and cultured for 8 h. The cultures were inoculated as seeds into a 24-well plate containing 15 μg/mL chloramphenicol and a 0.03 mM IPTG fermentation culture medium. The volume of the medium was 800 μL, and the inoculation amount was controlled with the initial OD600being 0.03 (as detected by a microplate reader). The seeds were cultured at 30° C. for 21 h, with the rotation speed of a plate shaker being 800 rpm. The experiment for each strain was performed in triplicate. After fermentation, OD600and the yield of L-proline were detected. The detection of L-proline was performed as follows: The fermentation solution was diluted with 3% (W/V) sulfosalicylic acid to a proper concentration. 1 mL of the dilution was taken, and 1 mL of an acid-ninhydrin complex (1.25 g of ninhydrin dissolved in 30 mL of glacial acetic acid and 20 mL of 6M H3PO4by heating at 70° C.) and 1 mL of glacial acetic acid were added. The mixture was reacted in a boiling water bath at 100° C. for 45 min. After cooling, OD520was determined. A standard curve was plotted by adopting L-proline at concentrations of 0-100 mg/L, and the concentrations of the samples to be tested were calculated according to the standard curve. The results are shown in Table 2, indicating that the yield and specific productivity of L-proline of the strains decreased by 63% and 49%, respectively, after the inhibition of thrE gene expression. (1) Construction of Knockout, Complementation and Overexpression Strains of thrE Gene in SZCgP1 Strains The inventors constructed knockout mutants based on CRISPR/Cas9 genome editing technology. Using a pCas9 plasmid (LIU, Jiao, et al. Development of a CRISPR/Cas9 genome editing toolbox for To construct the overexpression plasmid, the thrE gene was cloned onto the pEC-ccdB plasmid, which is derived from the pEC-XK99E plasmid. The pEC-ccdB plasmid was digested using a Bsa I enzyme. According to the reported genome sequence of To further confirm whether the thrE gene is an L-proline efflux protein, intracellular and extracellular L-proline concentrations of knockout, complementation and overexpression strains were determined using shake-flask fermentation. The seed culture medium contained the following ingredients (g/L): 5 g/L glucose, 1 g/L yeast powder, 3 g/L soybean peptone, 3 g/L urea, 0.5 g/L succinic acid, 1 g/L K2HPO4·3H2O, 0.1 g/L MgSO4·7H2O, 0.01 mg/L biotin, 0.1 mg/L vitamin B1, and 20 g/L MOPS. The fermentation culture medium contained the following ingredients: 80 g/L glucose, 1 g/L yeast powder, 1 g/L soybean peptone, 1 g/L NaCl, 1 g/L ammonium sulfate, 6 g/L urea, 1 g/L K2HPO4·3H2, 0.45 g/L MgSO4·7H2O, 0.05 g/L FeSO4·7H2O, 0.4 mg/L biotin, 0.1 mg/L vitamin B1, and 40 g/L MOPS, and the initial pH was 7.2. Firstly, the strains were inoculated into a seed culture medium and cultured for 8 h. The cultures were inoculated as seeds into 250 mL triangular flasks containing a fermentation culture medium, the volume of the medium being 25 mL. 25 μg/mL kanamycin and 0.05 mM IPTG were added as needed, and the inoculation amount was controlled with the initial ° Da) being 0.1 (as determined by a spectrophotometer). The mixture was cultured at 30° C. for 21 h, with the rotation speed of a shaker being 2200 rpm. The experiment for each strain was performed in triplicate. Samples were taken in the fermentation process to determine OD600, intracellular L-proline concentration and extracellular L-proline concentration. The intracellular and extracellular L-proline concentrations were determined as follows: 400 μL of silicone oil was added into a 1.5 mL centrifuge tube in advance, and 400 μL of the fermented bacterial solution was quickly pipetted and then slowly added into the tube. The mixture was centrifuged at 4° C. and 12000 rpm for 10 min, and the supernatant was obtained as an extracellular sample. The bacteria precipitate at the bottom of the centrifuge tube was cut off and placed in a 1.5 mL centrifuge tube. A proper amount of 3% sulfosalicylic acid was added according to the amount of the bacteria. The mixture was boiled at 100° C. for 20 min and centrifuged at 12000 rpm for 10 min, and the supernatant was obtained as an intracellular sample. The detection of L-proline was performed as described in Example 1, and the intracellular L-proline concentration was calculated based on the volume of The results of the determination of the intracellular and extracellular L-proline concentrations of each strain in the fermentation process are as shown in Tables 4 and 5. The extracellular L-proline concentration of the thrE gene-knockout strain SZCgP2 was significantly lower than that of the starting strain SZCgP1 throughout the fermentation process, and the intracellular L-proline concentration of the knockout strain was slightly higher than that of the starting strain SZCgP1 in the early stage (3-9 h) of the fermentation. The extracellular L-proline concentration of the complementation strain SZCgP2(pEC-thrE1) was significantly higher than that of the starting strain SZCgP1 throughout the fermentation process, and the intracellular L-proline concentration of the complementation strain was significantly lower than that of the starting strain during the rapid acidogenic phase (3-15 h). The extracellular L-proline concentration of the overexpression strain SZCgP1(pEC-thrE1) was significantly higher than that of the control strain SZCgP1(pEC-control) throughout the fermentation process, and the intracellular L-proline concentration of the overexpression strain was significantly lower than that of the control strain SZCgP1(pEC-control) throughout the fermentation process (especially during the rapid acidogenic phase). Based on the above results, it was indicated that ThrE is a proline efflux protein. The overexpression of ThrE in the SZCgP1 strain could increase the yield of L-proline, and the overexpression strain SZCgP1(pEC-thrE1) showed a 1.57-fold increase in the yield of extracellular L-proline at 21 h relative to the control bacterium SZCgP1(pEC-control) introduced with an empty plasmid, indicating that the overexpression of the L-proline efflux protein gene is of great significance in the modification of a strain producing L-proline. Firstly, a strain producing L-proline, SZCgP3, was constructed based on a Firstly, an expression plasmid pEC-mip4h was constructed for expressing trans-proline-4-hydroxylase, based on the pEC-XK99E plasmid, as described in Patent No. CN201710661945.1. The sequence of trans-proline-4-hydroxylase is provided as SEQ ID NO: 5. The pEC-mip4h plasmid and the pEC-XK99E control plasmid were transformed into an SZCgP1 strain to obtain an overexpression strain SZCgP1(pEC-m/p4h) and a control strain SZCgP1(pEC-XK99E), respectively, and were transformed into an SZCgP2 strain to obtain an overexpression strain SZCgP2(pEC-mip4h) and a control strain SZCgP2(pEC-XK99E), respectively. The seed culture medium contained the following ingredients (g/L): 5 g/L glucose, 1 g/L yeast powder, 3 g/L soybean peptone, 3 g/L urea, 0.5 g/L succinic acid, 1 g/L K2HPO4·3H2O, 0.1 g/L MgSO4·7H2O, 0.01 mg/L biotin, 0.1 mg/L vitamin B1, and 20 g/L MOPS. The fermentation culture medium contained the following ingredients: 80 g/L glucose, 1 g/L yeast powder, 1 g/L soybean peptone, 1 g/L NaCl, 1 g/L ammonium sulfate, 6 g/L urea, 1 g/L K2HPO4·3H2O, 0.45 g/L MgSO4·7H2O, 0.2 g/L FeSO4·7H2O, 0.4 mg/L biotin, 0.1 mg/L vitamin B1, and 40 g/L MOPS, and the initial pH was 7.2. Firstly, the strains were inoculated into a seed culture medium and cultured for 8 h. The cultures were inoculated as seeds into a 24-well plate containing 800 μL of a fermentation culture medium, and the inoculation amount was controlled with the initial OD600being 0.1 (as detected by a microplate reader). The seeds were cultured at 30° C. for 18 h, with the rotation speed of a plate shaker being 800 rpm. The experiment for each strain was performed in triplicate. After fermentation, OD600and the yield of trans-4-hydroxy-L-proline and L-proline were detected. The detection of trans-4-hydroxy-L-proline was performed with reference to the China national standard GB/T 9695.23-2008, and the detection of L-proline was performed as described in Example 1. The results are shown in Table 7, indicating that the strains without expression of trans-proline-4-hydroxylase failed to produce trans-4-hydroxy-L-proline, and that the knockout of the L-proline efflux protein thrE gene could remarkably reduce the yield of extracellular L-proline by-products and increase the ratio of trans-4-hydroxy-L-proline to L-proline, helping to obtain trans-4-hydroxy-L-proline production with higher purity. It is expected that further enhancement of the activity of trans-proline-4-hydroxylase allows rapid transformation of intracellularly synthesized L-proline to trans-4-hydroxy-L-proline in the strain, and knockout of the L-proline efflux protein thrE gene also reduces the efflux of L-proline to the extracellular space, allowing the yield of trans-4-hydroxy-L-proline to be also increased. Therefore, the knockout of L-proline efflux protein thrE is of great significance to the production of trans-4-hydroxy-L-proline. To further verify the use of the L-proline efflux protein in the production of other hydroxyproline, in the present disclosure, a plasmid for expressing trans-proline-3-hydroxylase was first constructed, that is, an expression plasmid pEC-Ubp4h for expressing the trans-proline-3-hydroxylase Ubp4h as shown in Patent No. CN110804596A was artificially synthesized based on a pEC-XK99E plasmid. The pEC-Ubp4h plasmid and the pEC-XK99E control plasmid were transformed into an SZCgP1 strain to obtain an overexpression strain SZCgP1(pEC-Ubp4h) and a control strain SZCgP1(pEC-XK99E), respectively, and were transformed into an SZCgP2 strain to obtain an overexpression strain SZCgP2(pEC-Ubp4h) and a control strain SZCgP2(pEC-XK99E), respectively. The ingredients in the medium and the culture of the strains were referred to Example 4. The detection of trans-3-hydroxy-L-proline was performed with reference to Patent No. CN110804596A, and the detection of L-proline was performed as described in Example 1. The result shows that the strains without expression of trans-proline-3-hydroxylase failed to produce trans-3-hydroxy-L-proline, and that the knockout of the L-proline efflux protein thrE gene could remarkably reduce the yield of extracellular L-proline by-products and increase the ratio of trans-3-hydroxy-L-proline to L-proline, helping to obtain trans-3-hydroxy-L-proline production with higher purity. That is, the knockout of L-proline efflux protein thrE is of great significance to the production of trans-3-hydroxy-L-proline. Hydroxyproline has four natural stereoisomers, namely trans-4-hydroxy-L-proline, cis-4-hydroxy-L-proline, trans-3-hydroxy-L-proline, and cis-3-hydroxy-L-proline, and it is known to those skilled in the art that the four different hydroxyprolines are obtained by directly catalyzing L-proline with corresponding trans-proline-4-hydroxylase, cis-proline-4-hydroxylase, trans-proline-3-hydroxylase, and cis-proline-3-hydroxylase, respectively. Documents in the prior art have also reported that different hydroxyprolines can be produced by overexpressing different proline hydroxylases based on strains producing L-proline (Zhang F, Liu H, Zhang T, Pijning T, Yu L, Zhang W, Liu W, Meng X. Biochemical and genetic characterization of fungal proline hydroxylase in echinocandin biosynthesis. A protein having an L-proline efflux function and the use thereof are provided. A method for producing L-proline or hydroxyproline by means of using a protein ThrE is used for producing L-proline by means of enhancing the activity of a polypeptide, having an L-proline efflux function, in an L-proline-producing strain. Alternatively, the method is used for producing hydroxyproline by means of weakening the activity of a polypeptide, having an L-proline efflux function, in L-proline-producing host cells and enhancing the activity of a proline hydroxylase. 1. Use of a polypeptide in producing L-proline or hydroxyproline, wherein the polypeptide is:
A) a polypeptide having an amino acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2; or B) a polypeptide having some amino acids added or deleted at either or both ends of the polypeptide of A) but still having the activity of an L-proline efflux function; or C) a polypeptide having higher than 90%, 95%, 96%, 97%, 98%, or 99% homology to the polypeptide of A) and derived from Corynebacterium with the activity of an L-proline efflux function; preferably, the polypeptide has an amino acid sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2. 2. A strain for producing L-proline, wherein the strain expresses the following polypeptide:
A) a polypeptide having an amino acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2; or B) a polypeptide having some amino acids added or deleted at either or both ends of the polypeptide of A) but still having the activity of an L-proline efflux function; or C) a polypeptide having higher than 90%, 95%, 96%, 97%, 98%, or 99% homology to the polypeptide of A) and derived from Corynebacterium with the activity of an L-proline efflux function; preferably, the polypeptide has an amino acid sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2; preferably, the strain is a bacterium; preferably, the strain is selected from more preferably, glutamate kinase in the bacterium is not subjected to feedback inhibition by L-proline or is attenuated feedback inhibition by L-proline; even more preferably, the activity of glutamate kinase and/or glutamate-semialdehyde dehydrogenase and/or pyrroline-5-carboxylate reductase in the bacterium is enhanced. 3. A method for producing L-proline, wherein the method comprises: culturing the strain of preferably, the method further comprises a step of isolating L-proline from a fermentation broth. 4. A method for constructing the strain for producing L-proline of A) a polypeptide having an amino acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2; or B) a polypeptide having some amino acids added or deleted at either or both ends of the polypeptide of A) but still having the activity of an L-proline efflux function; or C) a polypeptide having higher than 90%, 95%, 96%, 97%, 98%, or 99% homology to the polypeptide of A) and derived from Corynebacterium with the activity of an L-proline efflux function; preferably, the polypeptide has an amino acid sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2; preferably, the strain is a bacterium; preferably, the strain is selected from more preferably, glutamate kinase in the bacterium is not subjected to feedback inhibition by L-proline or is subjected to an attenuated feedback inhibition by L-proline; even more preferably, the activity of glutamate kinase and/or glutamate-semialdehyde dehydrogenase and/or pyrroline-5-carboxylate reductase in the bacterium is enhanced. 5. A host cell for producing hydroxyproline, wherein the activity of a polypeptide having an L-proline efflux function in the host cell is attenuated, wherein the polypeptide having the activity of the L-proline efflux function is:
A) a polypeptide having an amino acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2; or B) a polypeptide having some amino acids added or deleted at either or both ends of the polypeptide of A) but still having the activity of the L-proline efflux function; or C) a polypeptide having higher than 90%, 95%, 96%, 97%, 98%, or 99% homology to the polypeptide of A) and derived from Corynebacterium with the activity of an L-proline efflux function; preferably, the host cell is selected from more preferably, glutamate kinase in the host cell is not subjected to feedback inhibition by L-proline or is subjected to an attenuated feedback inhibition by L-proline; even more preferably, the activity of a proline hydroxylase in the host cell is enhanced; even more preferably, the activity of glutamate kinase and/or glutamate-semialdehyde dehydrogenase and/or pyrroline-5-carboxylate reductase in the host cell is enhanced. 6. The host cell as claimed in 7. A method for producing hydroxyproline, wherein the method comprises: culturing the host cell of preferably, the method further comprises a step of isolating hydroxyproline from a fermentation broth. 8. A method for constructing the host cell for producing hydroxyproline of (1) attenuating the activity of a polypeptide having an L-proline efflux function in the cell, wherein the polypeptide having the activity of the L-proline efflux function is: A) a polypeptide having an amino acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 and having the activity of the L-proline efflux function; or B) a polypeptide having some amino acids added or deleted at either or both ends of the polypeptide of A) but still having the activity of the L-proline efflux function; or C) a polypeptide having higher than 90%, 95%, 96%, 97%, 98%, or 99% homology to the polypeptide of A) and derived from Corynebacterium with the activity of an L-proline efflux function; (2) relieving or attenuating feedback inhibition by L-proline on glutamate kinase; and (3) introducing a gene encoding a proline hydroxylase into the cell obtained in step (2); preferably, the activity of glutamate kinase and/or glutamate-semialdehyde dehydrogenase and/or pyrroline-5-carboxylate reductase in the host cell is enhanced. 9. The method for constructing the host cell for producing hydroxyproline as claimed in TECHNICAL FIELD
BACKGROUND
SUMMARY
BRIEF DESCRIPTION OF THE DRAWINGS
DETAILED DESCRIPTION
Definitions and Description:
EXAMPLE 1
Screening of L-Proline Efflux Proteins of
thrE-F TTCACACTGCTC 6 GAACTTGTACCT thr E-R AAACAGGTACAA 7 GTTCGAGCAGTG Effect of inhibition of thrE gene expression on yield and specific productivity of L-proline Specific Yield of productivity L-proline of L-proline Strain OD600 (g/L) (g/L/OD600) SZCgP1(pdCas9gRNA- 13.60 ± 1.42 5.05 ± 0.50 0.37 ± 0.00 control) SZCgP1(pdCas9gRNA-thrE) 9.91 ± 0.64 1.87 ± 0.29 0.19 ± 0.03 EXAMPLE 2
Identification of L-Proline Efflux Proteins of
cas9-1 GCGCTCACAATTTCACACAGGAAACAG 8 AATTAATTAAGCTTAAAGGCACCCGAT ATGGATAAGAAATACTCAATAGGC cas9-2 TCAGTCACCTCCTAGCTGACTCAAATC 9 gRNA-1 GTCAGCTAGGAGGTGACTGAAGCTTGG 10 CTGTTTTGGCGGATG gRNA-2 CTGTGTGAAATTGTGAGCGCTCACAAT 11 TCC Cas9-3 TCGAAGGGCACCAATAACTGC 12 Cas9-4 CTTTTACTTTCACCAGCGTTTCTG 13 Cas9-5 AACGCTGGTGAAAGTAAAAGATGC 14 Cas9-6 GAATGGAACGGATCAAACGGTGAATTA 15 CACTGTACCTGTTGCGTC gRNA-3 CCGTTTGATCCGTTCCATTCGTTTTAG 16 AGCTAGAAATAGCAAG gRNA-4 CAACCTGCCATCACGAGATTTTC 17 thrE-1 AATCTCGTGATGGCAGGTTGACGGGAG 18 CCTAAGTGAAATG thrE-2 CCTTGGTAAATGCACGGTATGGGTCAG 19 TGAGATCAATCGGG thrE-3 CCATACCGTGCATTTACCAAGG 20 thrE-4 CAGTTATTGGTGCCCTTCGACTTTGTG 21 GTCTTCTTTGCGG thrE-5 ACAGGCCAAAGGAGTTGAGAATGTTGA 22 GTTTTGCGACCC thrE-6 CCAAGCTTGCATGCCTGCAGTTACCTT 23 TTATTACCGAATC
(2) Determination of Intracellular and Extracellular L-Proline Concentrations of Knockout, Complementation and Overexpression Strains of thrE Gene by Shake-Flask Fermentation
Intracellular L-proline concentrations of knockout, complementation and overexpression strains of thrE gene in Intracellular L-proline concentration (mM) SZCgP2 SZCgP1 SZCgP1 (pEC- (pEC- (pEC- Time SZCgP1 SZCgP2 thrE1) thrE1) control) 3 h 151 ± 17 213 ± 21 83 ± 1 67 ± 10 123 ± 7 6 h 192 ± 17 239 ± 13 72 ± 3 73 ± 2 221 ± 61 9 h 296 ± 18 315 ± 15 116 ± 19 106 ± 10 246 ± 37 12 h 287 ± 19 256 ± 14 112 ± 8 107 ± 5 228 ± 21 15 h 206 ± 37 235 ± 15 101 ± 2 92 ± 3 228 ± 11 18 h 103 ± 5 110 ± 6 105 ± 3 95 ± 2 159 ± 9 21 h 76 ± 6 70 ± 1 111 ± 4 105 ± 5 108 ± 9 Extracellular L-proline concentrations of knockout, complementation and overexpression strains of thrE gene in Extracellular L-proline concentration (g/L) SZCgP2 SZCgP1 SZCgP1 (pEC- (pEC- (pEC- Time SZCgP1 SZCgP2 thrE1) thrE1) control) 3 h 0.05 ± 0.00 0.03 ± 0.00 0.08 ± 0.00 0.08 ± 0.00 0.04 ± 0.00 6 h 0.15 ± 0.00 0.03 ± 0.00 0.32 ± 0.03 0.30 ± 0.02 0.12 ± 0.01 9 h 0.65 ± 0.02 0.20 ± 0.04 1.40 ± 0.10 1.98 ± 0.26 0.47 ± 0.02 12 h 1.49 ± 0.37 0.47 ± 0.00 3.14 ± 0.35 3.09 ± 0.14 0.87 ± 0.09 15 h 5.41 ± 0.12 2.42 ± 0.05 11.61 ± 0.96 11.77 ± 1.14 4.40 ± 0.16 18 h 5.41 ± 1.09 3.40 ± 0.69 17.01 ± 0.96 16.40 ± 4.23 5.34 ± 1.48 21 h 5.56 ± 0.41 2.71 ± 0.29 17.87 ± 2.90 16.22 ± 4.31 6.32 ± 0.31 EXAMPLE 3
Use of L-Proline Efflux Protein in Production of L-Proline in
Yield of extracellular L-proline of thrE gene overexpression strain in Yield of extracellular L-proline (g/L) Time SZCgP3(pEC-control) SZCgP3(pEC-thrE2) 3 h 0.02 ± 0.00 0.03 ± 0.00 6 h 0.05 ± 0.00 0.17 ± 0.01 9 h 0.22 ± 0.02 0.80 ± 0.09 12 h 0.59 ± 0.01 1.56±0.07 15 h 1.00 ± 0.03 3.56 ± 0.22 18 h 3.85 ± 0.36 10.55 ± 0.36 21 h 3.81 ± 0.47 13.56 ± 1.26 EXAMPLE 4
Use of L-Proline Efflux Protein in Production of Hydroxyproline
Effect of thrE gene knockout on the yield of extracellular trans-4-hydroxy-L-proline and L-proline Yield of Yield of Ratio of hydroxyproline proline hydroxyproline Strain OD600 (g/L) (g/L) to proline SZCgP1(pEC-XK99E) 16.47 ± 0.94 — 4.25 ± 0.35 — SZCgP1(pEC-mip4h) 13.16 ± 0.18 0.70 ± 0.01 2.94 ± 0.21 1:4.2 SZCgP2(pEC-XK99E) 15.52 ± 0.82 — 1.68 ± 0.08 — SZCgP2(pEC-mip4h) 14.31 ± 0.22 0.70 ± 0.05 0.89 ± 0.05 1:1.3 EXAMPLE 5
Use of L-Proline Efflux Protein in Production of Hydroxyproline


