СРЕДСТВО ХРОНОБИОЛОГИЧЕСКОЙ КОРРЕКЦИИ (ВАРИАНТЫ) И СПОСОБ ХРОНОБИОЛОГИЧЕСКОЙ КОРРЕКЦИИ

Изобретение относится к медицине и может быть использовано для коррекции десинхроноза функций различных органов и систем организма человека, вызванного профессиональными и техногенными факторами. Предложены варианты средства хронобиологической коррекции с учетом органотропности проявления десинхроноза. Все варианты заявляемого средства хронобиологической коррекции состоят из двух комплексов. Утренний комплекс включает растительные компоненты мягкого тонизирующего и биостимулирующего действия и комплекс растительных адаптогенов, вечерний комплекс включает растительные компоненты мягкого успокаивающего и седативного действия и стимулирующие восстановление клеточных ресурсов. Кроме того, утренний и вечерний комплексы включают витамины, минеральные вещества, антиоксиданты и специфические биологически активные вещества, направленные на коррекцию специфических органных или системных нарушений, развивающихся вследствие хронического десинхроноза. Предложен способ хронобиологической коррекции с ...

КОМПОЗИЦИИ, СОДЕРЖАЩИЕ ФЕРМЕНТЫ, ПОЛУЧАЕМЫЕ ИЗ НИХ ДИЕТИЧЕСКИЕ ПИЩЕВЫЕ ПРОДУКТЫ И ЛЕКАРСТВЕННЫЕ СРЕДСТВА И ИХ ПРИМЕНЕНИЕ ДЛЯ МЕДИЦИНСКИХ ЦЕЛЕЙ

Изобретение относится к химико-фармацевтической промышленности, а именно к созданию средств и биологически активных добавок на основе веществ природного происхождения. Композиции содержат одну или несколько гидролаз и один или несколько антиоксидантов, выбираемых среди антиокислительно действующих витаминов, каротиноидов, селенсодержащих веществ, убихинонов. Композиции являются компонентом пищевых продуктов или лекарственных средств, которые находят применение, в частности, для диетической пищевой добавки, в особенности для дополнительной сбалансированной диеты, и для лечения дисрегуляций иммунной системы. 9 н. и 16 з. п. ф-лы.

НУТРИЦЕВТИЧЕСКАЯ ОФТАЛЬМОЛОГИЧЕСКАЯ КОМПОЗИЦИЯ ДЛЯ ЛЕЧЕНИЯ ПАТОЛОГИЙ СЕТЧАТКИ С НЕОВАСКУЛЯРНЫМ КОМПОНЕНТОМ

Изобретение относится к области медицины, а именно к офтальмологии и терапии, и предназначено для лечения заболевания глаз у субъекта, получающего средство лечения, противодействующее VEGF. Применяют офтальмологическую нутрицевтическую композицию при лечении заболевания глаз у субъекта, получающего средство лечения, противодействующее VEGF. Указанная композиция содержит ресвератрол, витамин C, витамин E, цинк, медь, лютеин, зеаксантин и омега-3-жирные кислоты из рыбьего жира. Использование изобретения позволяет повысить эффективность лечения заболевания глаз у субъекта, получающего средство лечения, противодействующее VEGF. 20 з.п. ф-лы, 1 ил., 2 табл.

КОМПОЗИЦИЯ ОБОГАТИТЕЛЯ ГРУДНОГО МОЛОКА

Группа изобретений относится к композиции обогатителя человеческого грудного молока и ее применению. Композиция обогатителя человеческого грудного молока содержит: медь, селен, цинк, альфа-лактальбумин, казеин, лактоферрин, альфа-токоферол, гамма-токоферол, никотиновую кислоту, ретинол, DFSLTHN, FSLTNH3, GSLT6, LnNT, LNT, 6’-SL и SLTNTC. Раскрыты также упаковка, содержащая указанную композицию, и применение указанной композиции для оптимизации роста и развития или для поддержания здорового роста младенцев, родившихся преждевременно, с крайне низким весом при рождении (КНВР) и/или очень низким весом при рождении (ОНВР), а также для профилактики и/или лечения состояния, выбранного из группы, состоящей из недостаточности роста и/или развития, замедления роста, инфекции, заболевания легких, задержек в развитии, слепоты и/или метаболического заболевания костей. Изобретение обеспечивает оптимизированный состав композиции обогатителя грудного молока для недоношенных детей. 7 н. и 10 з.п. ф-лы, ...

СОСТАВЫ, ОБЛАДАЮЩИЕ ЛИПИДОПОНИЖАЮЩИМИ СВОЙСТВАМИ

Предложены способ снижения содержания в циркулирующей крови ЛНП-холестерина, триглицеридов, общего холестерина и их смесей, включающий введение эффективного количества одного или более фосфатных производных одного или более агентов электронного переноса, представляющих собой монотокоферилфосфат, дитокоферилфосфат, монотокотриенилфосфат, дитокотриенилфосфат и их смеси, их применение для изготовлении лекарственного средства того же назначения и их применение для облегчения симптомов, лечения и/или предупреждения заболевания, выбранного из группы, состоящей из хронической почечной недостаточности, первичных и вторичных гиперлипемий и дислипемии, ретинопатии, увеличения печени и селезенки, ксантом и их комбинаций путем снижения содержания липидов в циркулирующей крови. Показано снижение под действием заявленных токоферилфосфатов уровней общего холестерина, ЛНП у мышей, несмотря на их содержание на диете с 21% жира и 0,15% холестерина, и снижение у них атеросклеротических поражений. У людей ...

Продукт для пероральной доставки

Изобретение относится к композиции для пероральной доставки витаминов и минеральных веществ субъекту, содержащей витамины, минеральные вещества, ароматизаторы или вкусовые агенты, связывающее вещество, которое включает сахарный спирт, представляющий собой изомальт, и экспициенты, выбранные из прежелатинизированного крахмала и карбоксиметилцеллюлозы, где композиция может растворяться во рту указанного субъекта или может быть пережевана и проглочена указанным субъектом и где калорийность композиции составляет приблизительно 5 калорий, а твердость композиции составляет от 17 кгс до 28 кгс. 7 з.п. ф-лы, 8 пр., 10 табл.

КОМПОЗИЦИЯ, ВКЛЮЧАЮЩАЯ ДИИНДОЛИЛМЕТАН И РЕТИНОИД ДЛЯ ЛЕЧЕНИЯ КОЖНОЙ ПАТОЛОГИИ

Изобретение относится к способу лечения акне у субъекта, нуждающегося в этом, включающему введение композиции, включающей: (а) первый компонент, включающий 3,3' дииндолилметан, имеющий следующую структуру,и (b) второй компонент, включающий соединение витамина А. Изобретение оказывает синергетическое действие при лечении и предотвращении кожных патологий. 21 з.п. ф-лы, 4 ил., 2 табл.

СРЕДСТВО ДЛЯ ЛЕЧЕНИЯ ФИБРОЗА ПОЧЕК

Настоящее изобретение относится к носителю для доставки вещества в продуцирующие внеклеточный матрикс клетки в почке, причем носитель содержит ретиноид в качестве нацеливающего агента. Настоящее изобретение также относится к средству для лечения фиброза почек вследствие диабетического нефрита и уменьшения фиброза в мезангиальной области и окружающей среде тубулярных клеток, в котором применяется указанный носитель. Кроме того, настоящее изобретение относится к способам получения носителя и средства, наборам для получения и способу и тому подобному для лечения фиброза почек с применением средства для лечения фиброза почек. 4 н. и 6 з.п. ф-лы, 3 ил., 3 пр.

Способ комплексного лечения паразитарных болезней домашних северных оленей

Изобретение относится к ветеринарии и может быть использовано для лечения паразитарных заболеваний молодняка северных оленей. Для этого животному 3 дня проводят подкормку смесью комбикорма с минерально-витаминной добавкой. Одна доза смеси содержит 150 г комбикорма, 15 г цеолита, 5-7 г кемпендяйской соли, 30000 ME витамина А, 40000 ME витамина D, 20 мг витамина Е. На 4-й день дополнительно в смесь добавляют антигельминтный препарат «Альбен» в дозе 7,5 мг/кг и продолжают подкормку смесью комбикорма с минерально-витаминной добавкой в течение 7-10 дней. Изобретение позволяет снизить токсический и иммуноподавляющий эффект препаратов при лечении паразитарных заболеваний молодняка северных оленей.

ФАРМАЦЕВТИЧЕСКАЯ КОМПОЗИЦИЯ НА МАСЛЯНОЙ ОСНОВЕ ДЛЯ ЛЕЧЕНИЯ ЖЕЛУДОЧНО-КИШЕЧНЫХ ЗАБОЛЕВАНИЙ

Настоящее изобретение относится к области медицины и химико-фармацевтической промышленности, а именно к композиции с повышенной пеногасящей активностью для перорального применения при лечении желудочно-кишечных патологий, включающей симетикон в концентрации 3-12 мас.% и диоксид кремния в концентрации 0,1-5 мас.% относительно массы композиции в оливковом масле. Изобретение обеспечивает повышение активности средства, образование более тонкой дисперсии симетикона. В том числе преимуществами являются отсутствие консервантов и возможность назначения детям. 6 з.п. ф-лы, 1 пр., 5 табл., 8 ил.

СПОСОБ ПОДГОТОВКИ СВИНОМАТОК К ОПОРОСУ

Изобретение относится к области животноводства и представляет собой способ подготовки свиноматок к опоросу, включающий использование витаминно-минеральных препаратов, отличающийся тем, что свиноматкам за 45 дней до опороса вводят внутримышечно однократно комплексный витаминный препарат Аквитин в дозе 0,35 мл на 10 кг и одновременно дополнительно в основной рацион вводят препарат Алексанат Зоо в дозе 40 мл на голову на 1 л воды в течение 14 дней. Заявленное изобретение эффективно для профилактики и предупреждения стресса у свиноматок перед опоросом и после, позволяет получить здоровых поросят и повысить их сохранность. 4 ил., 3 табл.

НОВЫЙ СОСТАВ ДЛЯ МЯГКИХ ЖЕЛАТИНОВЫХ КАПСУЛ, СОДЕРЖАЩИХ РЕТИНОИД

Изобретение относится к фармакологии. Фармацевтический состав ретиноидов включает мягкую желатиновую капсулу, заполненную наполнителем, содержащим ретиноид в качестве действующего вещества, от 50 до 80 мас.% натурального растительного масла, от 15 до 35 мас.% частично гидрогенизированного натурального растительного масла и от 3 до 20 мас.% среднецепочечных триглицеридов, причем наполнитель дополнительно включает от 1 до 10 мас.% натурального воска. В особо предпочтительном варианте осуществления изобретения мягкая желатиновая капсула содержит комбинацию вышеуказанного состава и оболочки капсулы, содержащей свиной желатин. Изобретение обеспечивает улучшение растворимости состава. 16 з.п. ф-лы, 1 табл., 3 ил.

ПОЛИВИТАМИННЫЕ И МИНЕРАЛЬНЫЕ ПИЩЕВЫЕ ДОБАВКИ

Изобретение относится к фармацевтической промышленности, в частности к поливитаминной и минеральной добавке для снижения холестерина в крови. Поливитаминная и минеральная добавка для снижения холестерина в крови. Способ дополнения рациона человека для содействия снижения холестерина крови, предусматривающий предоставление человеку эффективного количества поливитаминной и минеральной добавки. Способ дополнения рациона человека для снижения в крови уровней холестерина, гомоцистеина или окисления холестерина липопротеинов низкой плотности, предусматривающий обеспечение человека эффективным количеством поливитаминной и минеральной добавки. Вышеописанная поливитаминная и минеральная добавка эффективно снижает холестерин в крови. 4 н. и 26 з.п. ф-лы, 5 ил., 3 табл.

СОДЕРЖАЩИЕ РЕТИНОИД ФАРМАЦЕВТИЧЕСКИЕ КОМПОЗИЦИИ ДЛЯ МЕСТНОГО ПРИМЕНЕНИЯ ТИПА ЭМУЛЬСИИ "МАСЛО В ВОДЕ"

Группа изобретений относится к химико-фармацевтической промышленности и представляет собой фармацевтическую композицию для лечения дерматологических заболеваний типа эмульсии "масло в воде", содержащую: масляную фазу, содержащую 3"-трет-бутил-4'-(2-гидроксиэтокси)-4"-пирролидин-1-ил-[1,1';3',1"]-терфенил-4-карбоновую кислоту, феноксиэтанол и масляные вспомогательные растворители; водную фазу, содержащую поверхностно-активное вещество из группы сложных эфиров сахарозы, полиол и очищенную воду. Данная фармацевтическая композиция пригодна для лечения угрей и ихтиозов. Группа изобретений позволяет получить физически и химически стабильные фармацевтические композиции, которые демонстрируют лучшую переносимость и легко наносятся на кожу пациента, обеспечивая постепенное проникновение активных веществ. 3 н. и 15 з.п. ф-лы, 3 ил., 16 табл., 13 пр.

Диета, имитирующая голодание (FMD), в качестве иммунорегуляторного лечения желудочно-кишечных аутоиммунных/воспалительных заболеваний

Группа изобретений относится к медицине и касается способа лечения желудочно-кишечного воспалительного заболевания, выбранного из группы, состоящей из болезни Крона (CD), язвенного колита (UC), синдрома раздражённого кишечника, целиакии, микроскопического колита и болезни Бехчета, включающего введение диеты, имитирующей голодание (FMD), субъекту, имеющему указанное желудочно-кишечное воспалительное заболевание, в течение 1, 2, 3, 4, 5, 6, 7, 8, 9 или 10 суток. Группа изобретений также касается применения диетического набора для введения диеты, имитирующей голодание, для лечения желудочно-кишечного воспалительного заболевания, выбранного из группы, состоящей из болезни Крона (CD), язвенного колита (UC), синдрома раздражённого кишечника, целиакии, микроскопического колита и болезни Бехчета, где набор содержит набор рационов для диеты, имитирующей голодание (FMD), и инструкции по введению диетического набора субъекту для лечения указанного желудочно-кишечного воспалительного заболевания, включающие ...

ЖИДКИЙ ЛЕЧЕБНЫЙ СОСТАВ ДЛЯ ВНУТРИВЕННОГО ВВЕДЕНИЯ, СОДЕРЖАЩИЙ ДЕКСТРОЗУ И ИНСУЛИН

Жидкий лечебный состав применяется в области медицины и предназначен для вывода пациента из критического состояния. Жидкий состав для лечения способом внутривенного введения содержит инсулин от 16 до 40 I.U. на 500 мл воды, раствор декстрозы от 10 до 20%, воду, от 0,6875 до 1,375 г глюконата кальция и от 0,75 до 1,5 г хлорида калия. Состав может содержать дополнительно витамины, гепарин, аминокислоты, липиды и другие жизненно необходимые вещества. Применение жидкого состава позволяет минимизировать последствия повышенного метаболизма, который развивается в организме в состоянии стресса и при критических условиях. 16 з.п. ф-лы, 19 табл.

СПОСОБ ПОВЫШЕНИЯ ПРИВЕСОВ ПРИ ОДНОВРЕМЕННОЙ ПРОФИЛАКТИКЕ ОКСИДАТИВНОГО СТРЕССА У ЦЫПЛЯТ-БРОЙЛЕРОВ

Изобретение относится к области птицеводства и ветеринарии и может быть использовано как способ повышения привесов цыплят-бройлеров, профилактики оксидативного стресса и, как следствие, увеличения их продуктивности. Способ включает пероральное введение птицам с 3-суточного возраста кормовой добавки «Абиовит» с водой для поения в дозе 1 мл/л воды каждые 5 суток до 33-суточного возраста и кормовой добавки «Абиопептид» с водой для поения в дозе 1 мл/л воды через день до 35-суточного возраста. Осуществление данного изобретения обеспечивает повышение привесов и профилактику оксидативного стресса у цыплят-бройлеров. 2 табл.

Композиция для повышения физической выносливости и работоспособности

Изобретение относится к фармацевтической и пищевой промышленности и может быть использовано для приготовления энергетического продукта, в частности композиции функционального назначения, повышающей работоспособность и физическую выносливость, необходимую, например, для лиц, специализирующихся в силовых видах спорта или занятых тяжелым физическим трудом. Создана композиция для повышения физической выносливости и работоспособности, содержащая альфа-токоферола ацетат, ретинола ацетат, янтарную кислоту и шоколадную массу при следующем соотношении компонентов, мас.%: ретинола ацетат - 2,1-4,5; альфа-токоферола ацетат - 0,35-0,75; янтарная кислота - 0,25-0,65; шоколадная масса - остальное. Композиция по изобретению обладает хорошими вкусовыми качествами, имеет удобную форму для приема, а также обеспечивает в течение короткого времени повышение работоспособности и физической выносливости за счет приема комплекса активных веществ, оптимально подобранных и в количестве, достаточном для достижения ...

БИОЛОГИЧЕСКИ АКТИВНОЕ АСТАКСАНТИНОСОДЕРЖАЩЕЕ ВЕЩЕСТВО, ОБЛАДАЮЩЕЕ АНТИОКИСЛИТЕЛЬНОЙ АКТИВНОСТЬЮ

Изобретение относится к области биологически активных препаратов, обладающих высокой антиокислительной активностью. Предложено биологически активное астаксантиносодержащее вещество. Вещество изготавливают в виде жидкой или твердой смеси гомогенно распределенных в ней компонентов. Биологически активное вещество включает астаксантиносодержащий комплекс: бета-каратина, кантаксантина, астацена, полу-астацена, лютеина, зеаксантина, а также растворителей, вспомогательных компонентов и инертных наполнителей. При этом содержание астаксантиносодержащего комплекса в веществе составляет 0,01-12 вес.%. Комплекс состоит из ди-цис-астаксантина, транс-астаксантина, 9-цис-астаксантина, 13-цис-астаксантина и 15-цис-астаксантина, выбранных при определенном соотношении. Все остальные компоненты заявленного вещества также используются в определенных соотношениях. Изобретение позволяет наиболее рационально оптимизировать содержание компонентов в веществе, повысить его биологическую активность, в частности в ...

КОМБИНАЦИЯ КОМПОНЕНТОВ ДЛЯ УЛУЧШЕНИЯ ФИЗИЧЕСКИХ ПОКАЗАТЕЛЕЙ У ЛИЦ, ЗАНИМАЮЩИХСЯ ТЯЖЕЛЫМИ ФИЗИЧЕСКИМИ НАГРУЗКАМИ

Изобретение относится к фармацевтической промышленности и представляет собой композицию для поддержания и/или восстановления организма во время и/или после тяжелых физических нагрузок, содержащую L-таурин, L-лейцин, L-изолейцин, L-валин, экстракт листьев зеленого чая, йохимбин гидрохлорид, элеутерококка колючего корневищ и корней экстракт, левзеи сафлоровидной корневищ с корнями экстракт, родиолы розовой корневищ с корнями экстракт, экстракт кожуры горького апельсина, рибофлавина натрия фосфат, холина альфосцерат, пантотенат кальция, пиридоксина гидрохлорид, фолиевую кислоту, цианокобаламин, биотин, никотинамид, L-карнитин, бета-аланин, калия оротат, метилурацил, инозин, кофеин, экстракт листьев, соцветий и корневищ иван-чая, креатина моногидрат, L-тирозин, аскорбиновую кислоту, магний в форме бис-глицината, медь в форме бис-глицината, цинк в форме бис-глицината, L-глутамин, тиамина гидрохлорид, холекальциферол 5000 МЕ, кальция малат, натрия дигидрофосфат, альфа-токоферола ацетат, L-селенметионин ...

Способ лечения хронического пародонтита

Изобретение относится к медицине, а именно, к стоматологии, и может быть использовано при лечении хронического пародонтита. Способ включает введение лекарственного препарата в виде масляного раствора на основе биологически активной добавки «Ягель», витамина «А» и экстракта шалфея, получаемого смешиванием компонентов при следующем составе, в масс.%: биологически активная добавка «Ягель», сухой остаток – 54-55, масляный раствор витамина «А» – 33-35, экстракт шалфея – 10-13. Далее приготовленный раствор вводят непосредственно в патологический пародонтальный карман с последующей фиксацией нанесением антисептической самотвердеющей пасты. При этом дневная процедура включает в себя одноразовое введение раствора и нанесение пасты, курс лечения составляет 7-10 процедур. Изобретение обеспечивает эффективное лечение хронического пародонтита и способствует предупреждению осложнений патологических процессов в тканях пародонта. 3 табл., 6 ил.

Способ комплексного последовательного применения патогенетических средств в лечении детей с туберкулёзной инфекцией

Настоящее изобретение относится к медицине, а именно к фтизиатрии, и касается комплексного последовательного применения патогенетических средств для лечения детей с туберкулезной инфекцией. Для этого ежедневно однократно водят веторон по 0,5-0,6 мл, разведенный в 100 мл кипяченой воды, после еды, курсом 1-3 месяца с повтором через 1 месяц. Дополнительно при развитии дисбактериоза кишечника 2-3 степени тяжести назначают ежедневный однократный прием кумыса через 2 часа после приема медикаментов, медленными глотками, при этом разовая питьевая доза кумыса составляет 100-150 мл, а курс приема – 3 месяца. Такая последовательность введения витаминных и кисломолочных средств обеспечивает повышение эффективности лечения туберкулезной инфекции за счет повышения иммунного статуса и устранения побочных реакций гепатотоксического характера, развивающихся в процессе лечения противотуберкулезными препаратами. 2 пр.

ВАГИНАЛЬНАЯ КОМПОЗИЦИЯ

... 1. Вагинальная композиция, включающая жизнеспособные микроорганизмы лактобациллы и/или бифидобактерии, предпочтительно Lactobacillus bifidus, не жизнеспособные культуры сахаромицеты, предпочтительно Saccharomyces cerevisiae, сахарид(ы), витамин А ретинол и цинк. 2. Вагинальная композиция по п.1, отличающаяся тем, что она дополнительно содержит селен, особенно селенсодержащие дрожжи, предпочтительно в количестве 0,001-0,06 вес.% селена. 3. Вагинальная композиция по п.1 и/или 2, отличающаяся тем, что она дополнительно содержит Melaleuca aetheroleum, предпочтительно в количестве от 0,5 до 10 вес.%, и/или экстракт из цветов ромашки, предпочтительно в количестве от 0,01 до 5 вес.%. 4. Вагинальная композиция по п.1 или 2, отличающаяся тем, что она дополнительно содержит D-альфа-токоферол, предпочтительно в количестве от 0,5 до 5 вес.%, и/или пантотенат, предпочтительно в количестве от 0,1 до 3 вес.%. 5. Вагинальная композиция по п.3, отличающаяся тем, что она дополнительно содержит D-альфа-токоферол ...

ФАРМАЦЕВТИЧЕСКИЕ КОМПОЗИЦИИ МЕСТНОГО ПРИМЕНЕНИЯ, СОДЕРЖАЩИЕ ПРОТИВОУГРЕВОЕ СОЕДИНЕНИЕ И АНТИБИОТИЧЕСКОЕ СОЕДИНЕНИЕ

... 1. Фармацевтическая композиция для местного применения, включающая (a) терапевтически эффективное количество адапалена или его фармацевтически приемлемой соли или сложного эфира; (b) клиндамицин или его фармацевтически приемлемую соль или сложный эфир; и (c) гидрофильную матрицу, способную обеспечивать постоянное и равномерное высвобождение активных фармацевтических ингредиентов.2. Фармацевтическая композиция для местного применения по п.1, где адапален или его фармацевтически приемлемая соль или сложный эфир присутствует в количестве от примерно 0,01 мас.% до примерно 0,2 мас.% и клиндамицин или его фармацевтически приемлемая соль или сложный эфир присутствует в количестве от примерно 0,5 мас.% до примерно 5 мас.%.3. Фармацевтическая композиция для местного применения по п.1 или 2, где гидрофильная матрица включает полиалкиленоксид, имеющий среднемассовую молекулярную массу, равную, по меньшей мере, примерно 100000.4. Фармацевтическая композиция для местного применения по п.1 или 2, где ...

СПОСОБ ПРИГОТОВЛЕНИЯ СИРОПНОГО ПРОДУКТА, СОДЕРЖАЩЕГО ВИТАМИНЫ

... 1. Способ приготовления сиропного продукта, включающего витамины, который содержит следующие стадии:a) продувка инертным газом всего оборудования, используемого в способе;b) введение в указанное оборудование сахарного сиропа и введение витаминов в инертной атмосфере;c) добавление обезвоженной и обескислороженной глюкозы в инертной атмосфере;d) обескислороживание сиропного продукта, полученного таким образом;e) упаковка сиропного продукта в инертной атмосфере.2. Способ по п. 1, в котором введение витаминов в инертной атмосфере выполняют последовательно.3. Способ по любому из предыдущих пунктов, в котором стадия введения витаминов также включает в себя введение ПАВ химического происхождения или природного происхождения, выбранного из желатинов, пектинов, казеина, гуммиарабиков или галактоманнанов, и также предварительно очищенной и обескислороженной воды.4. Способ по п. 1, который включает промежуточную стадию хранения сиропного продукта в резервуаре в инертной атмосфере при перемешивании ...

НОВЫЙ СОСТАВ ДЛЯ МЯГКИХ ЖЕЛАТИНОВЫХ КАПСУЛ, СОДЕРЖАЩИХ РЕТИНОИД

... 1. Фармацевтический состав ретиноидов, содержащий мягкую желатиновую капсулу, заполненную наполнителем, содержащим ретиноид в качестве действующего вещества, натуральное растительное масло и среднецепочечные триглицериды. 2. Фармацевтический состав по п.1, в котором наполнитель дополнительно содержит натуральный воск. 3. Фармацевтический состав по п.1 или 2, в котором наполнитель дополнительно содержит антиоксидант. 4. Фармацевтический состав по п.1 или 2, в котором натуральное растительное масло выбирают из соевого масла, кукурузного масла, подсолнечного масла, рапсового масла, льняного масла, конжутного масла, оливкового масла, кокосового масла, арахисового масла, сафлорового масла, касторового масла и хлопкового масла или смеси двух или более этих масел. 5. Фармацевтический состав по п.4, в котором натуральное растительное масло представляет собой соевое масло. 6. Фармацевтический состав по п.1 или 2, в котором среднецепочечные триглицериды выбирают из триглицеридов насыщенных жирных ...

Способ получения нанокапсул витаминов в пектине

Изобретение относится в области нанотехнологии, медицины и пищевой промышленности. Описан способ получения нанокапсул витаминов А, С, Е, D или Qв оболочке из низкоэтерифицированного или высокоэтерифицированного яблочного или цитрусового пектина. Для получения нанокапсул согласно способу по изобретению к суспензии указанного пектина в гексане с 0,01 г Е472с в качестве поверхностно-активного вещества медленно прибавляют 1 г указанного витамина при перемешивании 1000 об/мин. Затем добавляют хлороформ. Полученную суспензию нанокапсул отфильтровывают, сушат при комнатной температуре, при этом массовое соотношение в нанокапсулах ядро:оболочка составляет 1:3. Процесс получения нанокапсул осуществляется при 25С в течение 15 минут. Способ по изобретению обеспечивает упрощение и ускорение процесса получения нанокапсул и увеличение выхода по массе. 20 пр.

СПОСОБ ЛЕЧЕНИЯ РАН И ТРОФИЧЕСКИХ ЯЗВ

Изобретение относится к медицине и фармацевтической промышленности, а именно к способу лечения ран и трофических язв. Способ лечения ран и трофических язв, заключающийся в том, что в течение 8-15 суток с условием ежедневной однократной замены на рану или трофическую язву выполняют аппликации, пропитанные композицией из 0,9% масляного раствора бета-каротина и 10% масляной вытяжки прополиса в соотношении компонентов 10:1 соответственно, при этом через каждые 4-5 дней и по окончании курса лечения осуществляют контроль наличия микрофлоры в ране или трофической язве путем анализа мазков-отпечатков с раны и пробы с раневой поверхности. Вышеописанный способ позволяет обеспечить излечение или длительную ремиссию во всех фазах раневого процесса благодаря сочетанию антибактериальных, защитных и регенераторных свойств ее компонентов. 4 ил., 2 пр.

Способ получения нанокапсул АЕКола

СРЕДСТВО ДЛЯ ЛЕЧЕНИЯ МИЕЛОФИБРОЗА

... 1. Доставляющий вещество носитель для доставки вещества к клетке костного мозга, продуцирующей внеклеточный матрикс, содержащий ретиноид в качестве направляющего агента. ! 2. Носитель по п.1, где ретиноид содержит ретинол. ! 3. Носитель по п.1 или 2, где содержание ретиноида составляет 0,2-20 мас.% от общей массы носителя. ! 4. Носитель по п.1 или 2, где носитель имеет форму липосомы, и молярное отношение ретиноида к липидам, содержащимся в липосоме, составляет 8:1-1:4. ! 5. Композиция для лечения миелофиброза, содержащая лекарственное средство, которое контролирует активность или рост клетки костного мозга, продуцирующей внеклеточный матрикс. ! 6. Композиция по п.5, дополнительно содержащая носитель по любому из пп.1-4. ! 7. Композиция по п.5 или 6, где лекарственное средство, которое контролирует активность или рост клетки костного мозга, продуцирующей внеклеточный матрикс, выбирается из группы, состоящей из средства для ингибирования активности или продуцирования биоактивного вещества ...

Способ лечения гепатозов у крупного рогатого скота

КОМПОЗИЦИЯ, ВКЛЮЧАЮЩАЯ ДИИНДОЛИЛМЕТАН И РЕТИНОИД ДЛЯ ЛЕЧЕНИЯ КОЖНОЙ ПАТОЛОГИИ

... 1. Композиция для применения при лечении кожной патологии, композиция, включающая:(a) первый компонент, включающий замещенное или незамещенное соединение дииндолилметана; и(b) второй компонент, включающий замещенное или незамещенное ретиноидное соединение.2. Композиция по п.1, в котором композиция включает дополнительный компонент, выбранный из одного или более из следующих: дополнительное замещенное или незамещенное ретиноидное соединение, антибиотическое соединение, замещенное или незамещенное соединение азелаиновой кислоты, противозачаточное соединение для перорального введения, сера, серосодержащее соединение, замещенное или незамещенное соединение салициловой кислоты, замещенное или незамещенное соединение резорцина, растительный продукт, минерал, витамин и нутрицевтический продукт.3. Композиция по п.1 или 2, в котором первый компонент включает соединение дииндолилметана, обладающее следующей структурой:,в которой группы R могут одинаковыми или различными и выбранными из атомов водорода ...

НОСИТЕЛИ ЛЕКАРСТВЕННЫХ СРЕДСТВ

... 1. Терапевтическая композиция для лечения и облегчения заболеваний и расстройств, относящихся к раковым заболеваниям, содержащая:носитель, выбранный из группы, включающей некатионный полимерный носитель, липосомный носитель, дендритный носитель, носитель на основе наноматериала, биоструктурный носитель и мицеллярный носитель;нацеливающий агент, функционально связанный с носителем, при этом указанный нацеливающий агент содержит ретиноид; итерапевтический агент, функционально связанный с носителем, при этом указанный терапевтический агент проявляет терапевтическую активность при доставке в целевой орган или целевую ткань; при этом указанная терапевтическая активность представляет собой ингибирование роста раковых клеток в указанном целевом органе или целевой ткани.2. Терапевтическая композиция по п.1, отличающаяся тем, что ретиноид выбран из группы, включающей ретинол, ретиналь и ретиноевую кислоту.3. Терапевтическая композиция по п.1, отличающаяся тем, что ретиноид выбран из группы, включающей ...

Комбинации лекарственных средств и способы стимуляции эмбрионоподобной регенерации для лечения сахарного диабета и других заболеваний

ФАРМАЦЕВТИЧЕСКОЕ СРЕДСТВО

КОМПОЗИЦИЯ, ВКЛЮЧАЮЩАЯ РЕТИНОЛ, ЕГО ПРЕДШЕСТВЕННИК ИЛИ ПРОДУКТ ЕГО РЕАКЦИИ И ЭКСТРАКТ ИЗ ПО МЕНЬШЕЙ МЕРЕ ОДНОГО РАСТЕНИЯ CHAMOMILLA, ДЛЯ ЛЕЧЕНИЯ РАКА

... 1. Композиция, включающая(i) витамин А, продукт его реакции, его метаболит или предшественник, выбранные из витамин А, ретиноевой кислоты, полностью транс-ретиноевой кислоты, 13-цис-ретиноевой кислоты, сложных эфиров витамина А, в частности, ретинилпальмитата, ретинола, ретиналя, ретинилацетата, алитретиноина, бета-каротина, альфа-каротина, гамма-каротина, бета-криптоксантина, и провитамина А, и(ii) экстракт из растения ромашки, выбранного из водного экстракта, спиртового жидкого экстракта и безводного спиртового жидкого экстракта,для применения для предупреждения, лечения или улучшения ракового или опухолевого заболевания, в которой компоненты (i) и (ii) представляют собой единственные активные ингредиенты.2. Композиция по п.1, характеризующаяся тем, что экстрактом из растения предпочтительно является эфирное масло ромашки, предпочтительно Matricaria recutita.3. Композиция по п.1 или 2, характеризующаяся тем, что экстрактом из растения является ромашковый экстракт, приготовленный из трубчатых ...

Способ получения нанокапсул АЕКола

СУБЛИНГВАЛЬНОЕ ИЛИ БУККАЛЬНОЕ ВВЕДЕНИЕ DIM ДЛЯ ЛЕЧЕНИЯ ЗАБОЛЕВАНИЙ КОЖИ

ЭКСТЕНСИОНАЛЬНАЯ ВЯЗКОСТЬ, СПОСОБСТВУЮЩАЯ БЕЗОПАСНОМУ ГЛОТАНИЮ ПИЩЕВЫХ БОЛЮСОВ

... 1. Пищевой продукт, содержащий питательную композицию и пищевой полимер, способный повышать экстенсиональную вязкость питательной композиции, при этом пищевой продукт имеет коэффициент Троутона по меньшей мере 6, предпочтительно - примерно от 6 до 15.2. Пищевой продукт по п.1, который имеет коэффициент Троутона около 10.3. Пищевой продукт по п.1 или 2, экстенсиональная вязкость которого составляет выше 100 мПа∙•с (миллипаскаль-секунда).4. Пищевой продукт по п.1, в котором пищевой полимер выбран из группы, включающей экстрагированные из растений камеди, слизи растительного происхождения и их комбинаций.5. Пищевой продукт по п.4, в котором экстрагированные из растений камеди выбраны из группы, включающей камедь окры (бамии), конжак маннан, камедь тары, камедь бобов рожкового дерева, гуаровую камедь, камедь пажитника, камедь тамаринда, камедь кассии, камедь акации, камедь гхатти, пектины, целлюлозы, трагакантовую камедь, камедь карайи или любые комбинации перечисленного, и предпочтительно ...

ИНГИБИТОР РАЗЛОЖЕНИЯ ГИАЛУРОНОВОЙ КИСЛОТЫ, ВКЛЮЧАЮЩИЙ ЭКСТРАКТ РОЗМАРИНА И РЕТИНОЛАЦЕТАТА

... 1. Ингибитор гиалуронидазы, включающий экстракт розмарина и витамин А, или его предшественник, или его производное.2. Ингибитор гиалуронидазы по п. 1, где указанный витамин А выбирают из группы, состоящей из ретинола, ретинол ацетата и ретинол пальмитата.3. Ингибитор гиалуронидазы по п. 2, где указанный витамин А представляет собой ретинол ацетат.4. Средство для наружного применения на коже для облегчения или предупреждения кожных проблем, выбранных из группы, состоящей из старения кожи, морщинистой кожи, грубой кожи, сухой и шершавой кожи, угрей и атопического дерматита, включающее ингибитор гиалуронидазы по п. 1.5. Средство по п. 4, где указанный витамин А выбирают из группы, состоящей из ретинола, ретинол ацетата и ретинол пальмитата.6. Средство по п. 5, где указанный витамин А представляет собой ретинол ацетат.7. Способ косметического лечения, включающий применение экстракта розмарина и витамина А или его предшественника или его производного к субъекту, страдающему от снижения уровня ...

СПОСОБЫ И КОМПОЗИЦИИ, ПРИМЕНИМЫЕ ДЛЯ КОНТРОЛЯ ГЛЮКОЗЫ В КРОВИ ЖИВОТНЫХ

... 1. Способ контроля глюкозы в крови у животного, включающий введение животному терапевтически эффективного количества комбинации, по меньшей мере, двух из числа: одного или нескольких антиоксидантов; одного или нескольких агентов, препятствующих гликированию; одного или нескольких агентов, снижающих содержание жира в организме; одного или нескольких агентов, повышающих чувствительность к инсулину; и одного или нескольких противовоспалительных агентов.2. Способ по п.1, в котором животное является животным с избыточной массой или с ожирением.3. Способ по п.1, в котором животное является собакой.4. Способ по п.1, в котором животное является кошкой.5. Способ по п.1, в котором антиоксиданты выбирают из группы, состоящей из витамина С, полифенолов, проантоцианидинов, антоцианинов, биофлавоноидов, селена, альфа-липоевой кислоты, глутатиона, катехина, эпикатехина, эпигаллокатехина, эпигаллокатехин галлата, эпикатехин галлата, цистеина, витамина Е, гамма-токоферола, альфа-каротина, бета-каротина, ...

ДЕПИГМЕНТИРУЮЩИЙ ВОДНО-СПИРТОВОЙ ГЕЛЬ

... 1. Депигментирующая композиция, содержащая в физиологически приемлемой среде фенольное производное, ретиноид, в частности, диспергированный, и, в известных случаях, солнцезащитный фильтр, отличающаяся тем, что она представляет собой водно-спиртовой гель. 2. Композиция по п.1, отличающаяся тем, что водно-спиртовой гель содержит от 1 до 30% спирта. 3. Композиция по п.1, отличающаяся тем, что спирт представляет собой этанол. 4. Композиция по п.1, отличающаяся тем, что водно-спиртовой гель содержит, равным образом, один или несколько из следующих ингредиентов: а) карбомер, б) другой желирующий компонент, в) антиоксидант, г) и хелатирующую добавку. 5. Композиция по одному из пп.3 или 4, отличающаяся тем, что водно-спиртовой гель содержит 4,00% фенольного производного, 0,10% ретиноида, 20,00% этанола, 0,40% карбомера, 0,60% другого желирующего компонента, 0,40% солей сернистой кислоты, 0,10% ЭДТК (EDTA). 6. Композиция по п. 1, отличающаяся тем, что фенольное производное представляет собой гидрохинон ...

СПОСОБ ЛЕЧЕНИЯ АКНЕ С ПРИМЕНЕНИЕМ ФОТОТЕРАПИИ И ВНУТРИДЕРМАЛЬНОГО ВВЕДЕНИЯ ПЛАЗМЫ

Изобретение относится к медицине, а именно к дерматологии, и может быть использовано для лечения акне. Принимают изотретиноин в дозировке 10 мг в сутки в течение 4-8 месяцев, при этом лазерную терапию очагов поражения начинают через 3,5-4 месяца от начала приема изотретиноина и проводят с использованием неодимового лазера Nd:YAG на длине волны 1064 нм, с диаметром пятна - 9 мм, плотностью энергии - 22 Дж/см2, длительностью импульса 10000 мкс на расстоянии 10 см манипулы до поверхности кожи, при общем времени воздействия на очаги поражения 3 мин. Одновременно с лазерной терапией проводят курс введения аутологичной плазмы методом интрадермального введения по папульной технике на глубину 1-2 мм с интервалом 1 см иглой 32G 0.23×4 курсом 4 процедуры один раз в 2 недели. Способ позволяет предупредить формирование постакне, снизить риск появления нежелательных побочных явлений, сократить срок лечения и увеличить срок ремиссии за счет комплексной терапии с одномоментным пероральным приемом системного ...

Verwendung von Retinoiden zur Verringerung von Hautbeschädigung

Verwendung von 9-cis-Retinsäure sowie ihre Salze und Ester, zur Behandlung von Epitheltumore

Lutein-enthaltende Zusammensetzung

Lutein-enthaltende Zusammensetzung, dadurch gekennzeichnet, dass die Zusammensetzung Lutein sowie Zink- und Kupferverbindungen, vorzugsweise in Form von Zinkgluconat und Kupfer(II)-gluconat, umfasst.

Mundspülöl mit Tocotrienol zur Pflege von Zahnfleisch, Zähnen und Mundhöhle

Mittel, bestehend aus einer lipophilen Substanz, die mittelkettige Fettsäuren enthält oder freisetzen kann mit 0,1% bis 70% Tocotrienolen, Derivaten von Tocotrienolen, Tocotrienol-reichen Fraktionen von Naturprodukten oder Mischungen davon für die Einbringung in die Mundhöhle zum Zweck der Pflege des Mund und Rachenraumes, der Gesundheit des Zahnfleisches und der Zähne und zur Behandlung von entzündlichen und anderen Erkrankungen in der Mundhöhle.

ZUSAMMENSETZUNG ENTHALTEND EIN ENZYM UND EINEN STAILITÄT DES ENZYMS ZU VERBESSERN, SEINEN ABBAU ZU VERHINDERN, UM ES ZU SCHÜTZEN UND/ODER UM ES ZU IMMOBILISIEREN

Verfahren zur Verhütung der Hautalterung mittels Retinoiden

Oil-in-water-emulsion, useful e.g. in the non-therapeutic treatment of wrinkle, acne and impure skin, comprises a retinoid, a wax component, preferably pentaerythritol ester and/or dipentaerythritol ester, an oil component and water

Oil-in-water-emulsion (I) comprises at least a retinoid; 0.1-40 wt.% of at least a wax component with a melting point of at least 30[deg] C, preferably pentaerythritol ester, dipentaerythritol ester and/or tripentaerythritol ester; 1-30 wt.% of at least an oil component, which is liquid at 25[deg] C; and 40-95 wt.% of water.

Ointment, useful e.g. for treating salt deficiency, acute and chronic trauma, comprises ointment base and homeopathically diluted mineral salt including e.g. calcium phosphate, iron phosphate, potassium chloride and potassium phosphate

Ointment comprises an ointment base and at least one homeopathically diluted mineral salt including calcium phosphate, iron phosphate, potassium chloride, potassium phosphate, potassium sulfate, magnesium phosphate, sodium chloride, sodium phosphate, sodium sulfate, silica or calcium sulfate. The ointment base contains aqueous vitamin solution comprising vitamin A (0.08-1 mu g), vitamin B1 (0.1-8 mu g), vitamin B2 (0.1-8 mu g), vitamin B3 (0.1-8 mu g), vitamin B5 (0.8-10 mu g), vitamin B6 (0.04-5 mu g), vitamin B12 (0.1-2 ng), vitamin C (5-100 mu g), vitamin D3 (0.1-5 ng) and vitamin E (0.8-10 mu g). Ointment comprises an ointment base and at least one homeopathic diluted mineral salt (0.000001-0.0168%) including calcium phosphate, iron phosphate, potassium chloride, potassium phosphate, potassium sulfate, magnesium phosphate, sodium chloride, sodium phosphate, sodium sulfate, silica or calcium sulfate. The ointment base contains an aqueous vitamin solution (1%) comprising vitamin A (0.08 ...

Ester des Retinols und/oder der Retinsäure enthaltende Aerosol-Inhalate.

Kosmetische und/oder dermatologische Wirkstoffkombination

Kosmetische und/oder dermatologische O/W-Emulsion mit einem Gehalt an Retinoiden, Glycerylstearat und Cyclodextrinen.

STERILES RETINOID ENTHALTENDES BIODEGRADIERBARES IMPLANTAT MIT VERBESSERTER BIOCOMPATIBILITÄT UND VERFAHREN ZU DESSEN HERSTELLUNG

Dietary supplement

A composition or dietary supplement for a pet is provided. The composition comprises: a supplement for joint health, such as glucosamine, methylsulfonlymethane, chondroitin, pine bark extract, or omega 3 fatty acids; a supplement for digestive health such as digestive enzymes; a probiotic such as Lactobacillus spp. or Enterococcus faecium; a prebiotic such as fibre or chicory extract; at least one vitamin and at least one mineral. The composition may also comprise cardiovascular health supplements such as L-arginine; weight loss supplements such as L-carnitine L-tartrate; energy supplements such as L-citrulline DL-malate; urinary or kidney tract health supplements such as taurine; liver health supplements such as milk thistle; and bone health supplements such as calcium. Also described are methods of treatment using the composition.

Prevention and/or treatment of neurodegenerative disease

Pharmaceutical formulation for treating liver disorders

A pharmaceutical formulation comprising (a) an inorganic or organic selenium compound, preferably L-seleno-methionine; (b) ascorbic acid (Vitamin C) or a salt or ester thereof; (c) -tocopherol (Vitamin E) or derivative thereof; (d) methionine or cysteine or N-acetyl-cysteine or S-adenosyl-methionine; (e) Co-enzyme Q10 (Ubiquinone); (f) #-carotene and/or (g) Vitamin A (retinol) has been found to be an effective treatment for the symptoms of primary biliary cirrhosis (PBC). A preferred formulation comprising L-seleno-methionine, ascorbic acid, vitamin E, L-methionine, Co-enzyme Q10 and #-carotene was prepared in a gelatin capsule form and was tested clinically as a treatment for PBC. This formulation may also be useful in the treatment of other diseases besides PBC where an excess of free radicals may also play a causative role such as myocardial infarction or arthritis. It may also be useful in the treatment of inflammatory bowel diseases such as colitis, mitochondrial diseases such as Huntingdon's ...

VITAMIN COMPOSITIONS

MEDICINAL COMPOSITION FOR THE TREATMENT OR PREVENTION OF ACNE BY ORAL ADMINISTRATION

PCT No. PCT/FR85/00011 Sec. 371 Date Jul. 11, 1985 Sec. 102(e) Date Jul. 11, 1985 PCT Filed Jan. 24, 1985 PCT Pub. No. WO85/03226 PCT Pub. Date Aug. 1, 1985.This composition contains, by way of main active principle, in a pharmaceutically acceptable carrier, at least one substance belonging to the carotenoid family and chosen, in particular, from the group consisting of alpha -carotene, delta -carotene, gamma -carotene, +62, beta -carotene-4,4'-dione, ethyl 8'-apo- beta -caroten-8'-oate, beta -apo-8'-carotenal, psi , psi -carotene, psi , psi -carotene-16,16'-diol and psi , psi -caroten-16-ol. This composition preferably contains from 0.001 to 10% by weight of active principle relative to the total weight of the composition and takes the form of a suspension, tablets or gelatin capsules. The pharmacological activity of this drug is an activity which inhibits comedo formation, the latter being due to an irritation caused by an excess of lipid oxide (oxidized squalene).

Pharmaceutically-active carotenoid antioxidants

Lutein and other hydrophillic carotenoids are disclosed for use in treatment by therapy or prophylaxis of diseases having an oxygenation mechanism. The carotenoids disclosed are especially useful in treatment of coronary heart disease and may be combined with eg aspirin.

Prevention and/or treatment of neurodegenerative disease

A composition comprising at least one carotenoid selected from the group consisting of lutein, zeaxanthin and meso-zeaxanthin; and a composition comprising at least one omega-3 fatty acid; for use in the prevention and/or treatment of dementia in a human subject is provided. The omega-3 fatty acid is preferably docosahexaenoic acid (DHA). A further omega-3 fatty acid, preferably eicosapentaenoic acid (EPA) may be present. The omega-3 fatty acid is preferably provided as a component of fish oil. The composition comprising at least one carotenoid may contain each of lutein, zeaxanthin and meso-zeaxanthin. The compositions may be formulated for oral consumption, preferably in the form of a capsule or tablet. The form of dementia is preferably Alzheimer’s disease.

Vitamin compositions

A vitamin or mineral composition with enhanced bioavailability is disclosed including at least one vitamin or mineral, a polyoxyethylene sorbitan ester, and a diluent, such as polyols or vegetable oils.

Nutrient compositions

Methods for improving the microbiome and its systemic effect

Production of materials useful for producing vitamin a

A Vitamin A intermediate which is an aldehyde or a nitrile or a mixture of an aldehyde and a nitrile, is obtained in a process which comprises reacting an amine with activated manganese dioxide in the presence of an inert solvent; the said amine being a -ionylidene ethylamine or b -ionylidene ethylamine or an amine which has Vitamin A activity and which has the following characteristics: (1) an absorption maximum in the ultra-violet region of the spectrum at 3250 and an extinction coefficient at that wavelength of approximately 1000; (2) an infra-red pattern with a characteristic amine band; (3) when treated with hydrobromic acid gives a product having an adsorption maximum in the ultra-violet region of the spectrum at 3300 ; (4) when treated with phosphoric acid gives a product having an adsorption maximum in the ultra-violet region of the spectrum at 3280 to 3300 ; (5) a Kjeldahl nitrogen content of approximately 9.6%; (6) when treated with iodine is converted into Vitamin A aldehyde; ...

Tissue repair

Vitamin A for use in the treatment of tissue damage in a human subject following a neurological injury, wherein the vitamin A is administered systemically by oral or intravenous administration in a dose of >10,000 IU to 100,000 IU vitamin A per day is provided. The neurological injury may comprise a spinal cord injury (SCI), a brain injury or a peripheral nerve injury. The vitamin A may be the form of a retinyl ester, retinol, a carotenoid (beta-carotene, alpha-carotene, beta-cryptoxanthin), retinal or retinoic acid. The vitamin A may inhibit glial scar tissue formation. A multi-dose formulation for use in the treatment of tissue damage in a human subject following a neurological injury wherein the formulation comprises a plurality of unit doses comprising >10,000 IU to 100,000 IU of vitamin A is provided. Vitamin A for use in treating soft tissue injuries wherein the soft tissue comprises ligaments and tendons is described. The combination of vitamin A and one or more regenerative cells ...

COMPOSITION FOR ENHANCING IMMUNITY

“System of continuous release of the vitamin has in feed water”.

Bioavailable dosage form of isotretinoin

System for continuos liberation of vitamin A and other active principles into drinking water.

The invention provides an apparatus allowing continuos and regular liberation of an active principle, ...

Bioavailable dosage form of isotretinoin.

The present invention relates to a bioavailable pharmaceutical composition of 13-cis vitamin A acid (also known as 13-cis retinoic acid and isotretinoin) and a process for preparing the same. 13-cis vitamin A acid is a relatively water insoluble compound that degrades when exposed to light and atmospheric oxygen. Due to its instability and relative insolubility, the bioavailability of the drug after oral administration is difficult to achieve and has always been a challenge to a development pharmacist. It would therefore be desirable to provide a dosage form in which the drug is stable and predictably bioavailable.

LIBERATION OF VITAMIN INTO DRINKING WATER

Composition for regulating lipid metabolism

COMPOSITION FOR ENHANCING IMMUNITY

ENCAPSULATION OF HYDROPHOBIC BIOLOGICALLY ACTIVE COMPOUNDS

Bioavailable dosage form of isotretinoin.

Moisturizing vehicle for topical application of vitamin a acid.

Bioavailable dosage form of isotretinoin

LIBERATION OF VITAMIN INTO DRINKING WATER

Composition for regulating lipid metabolism

ENCAPSULATION OF HYDROPHOBIC BIOLOGICALLY ACTIVE COMPOUNDS

ENCAPSULATION OF HYDROPHOBIC BIOLOGICALLY ACTIVE COMPOUNDS

Composition for regulating lipid metabolism

COMPOSITION FOR ENHANCING IMMUNITY

STABILIZED COMPOSITIONS, THE OXYGEN-SENSITIVE CONNECTION RETINOL CONTAINING

RETINOLTHALTIGES, STABILIZATION SKIN CARE MEANS FOR OUTWARD APPLICATION

PROCEDURE FOR THE PRODUCTION OF MICRO-CRYSTALLINE VITAMIN A-ACETATE

USE OF RETINOID RECEPTOR ANTAGONIST FOR THE TREATMENT OF BONES AND CARTILAGE PATHOLOGIEN

RETINSÄUREDERIVATE

SPRAYINGCASH COMPOSITION FOR ADORNMENT

USE OF TOPI COMPOSITIONS

ACTIVE SUBSTANCE-STABILIZING O/W EMULSIONS II

COMPOSITION FOR THE REGULARIZATION OF THE LIPIDSTOFFWECHSELS

GEL WITH AT LEAST A RETINOID AND BENZOYLPEROXID

Anti-oxidant lozenges for the prevention and treatment of radiation induced mucositis, precancerous lesions, oral cancer and other oral cavity mucosal disorders

A method for treating or preventing oral cavity mucosal disorders, comprising a step of providing a lozenge containing an antioxidant selected from the group of Vitamin A, Vitamin C, Vitamin E; and other ingredients and a step of placing the lozenge within the oral cavity for a period of time required for dissolution of the lozenge.

Drug carrier and drug carrier kit for inhibiting fibrosis

An astrocyte-specific drug carrier containing a retinoid derivative and/or a vitamin A analog as a constituent; a drug delivery method with the use of the same; a drug containing the same; and a therapeutic method with the use of the drug. By binding a drug carrier to a retinoid derivative such as vitamin A or a vitamin A analog or encapsulating the same in the drug carrier, a drug for therapeutic use can be delivered specifically to astrocytes. As a result, an astrocyte-related disease can be efficiently and effectively inhibited or prevented while minimizing side effects. As the drug inhibiting the activity or growth of astrocytes, for example, a siRNA against HSP47 which is a collagen-specific molecule chaperone may be encapsulated in the drug carrier. Thus, the secretion of type I to type IV collagens can be inhibited at the same time and, in its turn, fibrosis can be effectively inhibited.

Compositions and methods of treatment for inflammatory diseases

Inflammatory bowel diseases are represented by two idiopathic disorders, which include ulcerative colitis and Crohn's disease. Ulcerative colitis is restricted to the colon and involves uncertain and inflammation of the lining (mucosa) of the large intestine. Crohn's disease, on the other hand, can involve the mucosa of the small and/or large intestine and may involve deeper layers of the bowel wall. The present invention in a preferred embodiment is a combination of 5-aminosalicylic acid or 4-aminosalicylic acid and one or more antioxidants (e.g., N-acetylcysteine) for treating such inflammatory bowel diseases.

Compositions and applications of carotenoids of improved absorption and bioavailability

Micro micellar form of carotenoids or xanthophylls, which show improved absorption and biovailability by living organisms, providing higher levels of carotenoids in the blood stream, and consequently are deposited at the target tissues at a faster rate, and more efficiently than crystalline carotenoids, which does not contain any crystal forms of carotenoids, and which are obtained as micro micelles after melting Lutein diacetate or Lutein dipropionate in their natural original lipid vegetable matrix, in the presence of lipids, phospholipids, fatty acids, emulsifiers and moisture, and are ingested in a dosage between 2 to 50 mg, to provide an absorption of the carotenoid solubilizate which is at least 20% above than that of crystalline carotenoids, and provides a macular pigment deposit which exceeds at least 10% of Macular Pigment Optical Density, than the deposition obtained by ingesting crystalline Lutein. Thus preventing tissue degeneration, UV light damage to skin and the retina, and in general to act as more effective and efficient antioxidants than when administered in crystalline form.

Treatment of acne by conditioned media

Disclosed are methods and compositions for treatment of acne or acneform conditions, particularly but not limited to, acne vulgaris with products generated from culture of stem or progenitor cells. Specifically, compositions of matter are disclosed which are useful for the treatment of acne and acne associated disease states, in particular acne vulgaris, by topical administration of products derived from stem cells or progenitor cells.

Administration of 6-[3-(1-adamantyl)-4-methoxyphenyl]-2-naphthoic acid for the treatment of dermatological disorders

Dermatological disorders having an inflammatory or proliferative component are treated with pharmaceutical compositions containing on the order of 0.3% by weight of 6-[3-(1-adamantyl)-4-methoxyphenyl]-2-naphthoic acid (adapalene) or salt thereof, formulated into pharmaceutically acceptable media therefor, advantageously topically applicable gels, creams or lotions.

T type calcium channel blockers and the treatment of diseases

The present invention provides a method for treating a disease or condition in a mammal associated with influx of extracellular calcium via T type calcium channels, which comprises administering to the mammal a therapeutically effective amount of a T type calcium channel inhibitor, a prodrug thereof, or a pharmaceutically acceptable salt of said inhibitor or prodrug, wherein the T type calcium channel inhibitor blocks a splice variant of an α1H isoform of T type calcium channels.

Methods and Compounds Useful to Induce Apoptosis in Cancer Cells

The present invention provides a method for treating cancer in a mammal comprising contacting the cancer cells with a compound which is a apogossypol, derivative.

Dry glassy composition comprising a bioactive material

The present invention relates to formulations and methods for stabilizing and protecting of biologic materials during harsh storing and use conditions, wherein the formulations relate to embedded bioactive materials and biologics, including live bacteria, in a protective glassy matrix.

Drug carrier and drug carrier kit for inhibiting fibrosis

An astrocyte-specific drug carrier containing a retinoid derivative and/or a vitamin A analog as a constituent; a drug delivery method with the use of the same; a drug containing the same; and a therapeutic method with the use of the drug. By binding a drug carrier to a retinoid derivative such as vitamin A or a vitamin A analog or encapsulating the same in the drug carrier, a drug for therapeutic use can be delivered specifically to astrocytes. As a result, an astrocyte-related disease can be efficiently and effectively inhibited or prevented while minimizing side effects. As the drug inhibiting the activity or growth of astrocytes, for example, a siRNA against HSP47 which is a collagen-specific molecule chaperone may be encapsulated in the drug carrier. Thus, the secretion of type I to type IV collagens can be inhibited at the same time and, in its turn, fibrosis can be effectively inhibited.

Topical pharmaceutical formulations containing a low concentration of benzoyl peroxide in suspension in water and a water-miscible organic solvent

An aqueous formulation for topical application to the skin comprising water, a water-miscible organic solvent, and benzoyl peroxide, wherein the concentration of the organic solvent is sufficient to provide a stable suspension of benzoyl peroxide in the aqueous formulation without the inclusion of a surfactant in the formulation, wherein the ratio of concentrations of water and organic solvent in the formulation is sufficient to maintain the benzoyl peroxide in saturated solubility in the formulation following, application to the skin, and wherein the concentration of benzoyl peroxide in the formulation is less than 5.0% and at least 1.0% w/w. The formulation may further contain a chemical compound in addition to benzoyl peroxide that is effective in the treatment of acne. The aqueous formulations of the invention are useful in the treatment of acne and acne rosacea.

Multicarotenoid beadlets and related method

A controlled release beadlet that sequentially releases carotenoids over time within the gastrointestinal tract of a subject, as well as a method of administering the carotenoids. The beadlet provides a specific ratio of carotenoids which release from the beadlet at preselected times during passage through the gastrointestinal tract. The method includes releasing the carotenoids in preselected ratios at specific time intervals in the gastrointestinal tract to mitigate competition between the carotenoids for their uptake, and/or to potentially maximize the uptake of individual carotenoids within a mixed carotenoid formulation.

Pegylated opioids with low potential for abuse and side effects

Provided are methods for reducing the addiction potential and/or reducing one or more CNS-side effects related to the administration of an opioid analgesic drug by administering the opioid analgesic drug in the form of an oligomeric polyethylene glycol conjugate compound. The compounds provided demonstrate notably reduced potential for substance abuse, and possess altered pharmacokinetic profiles relative to the opioid agonists alone, but are not subject to the risk of physical tampering that allows for the recovery and abuse of the opioid agonist associated with certain alternative delivery formulations.

COMPOSITIONS AND METHODS FOR TREATING METABOLIC DISEASES

In one aspect of the present invention, a pharmaceutical composition for treating a metabolic disease in a mammalian subject includes a therapeutically effective amount of (R)-all-trans-13,14-dihydroretinol and a pharmaceutically acceptable carrier or diluent. In another aspect of the present invention, pharmaceutical composition for treating a metabolic disease in a mammalian subject includes a therapeutically effective amount of (S)-all-trans-13,14-dihydroretinol and a pharmaceutically acceptable carrier or diluent. In a further aspect of the present invention, a method is provided for treating a metabolic disease in a mammalian subject. The method includes administering to the subject a pharmaceutical composition comprising at least one all-trans-13,14-dihydroretinoid, all-trans-13,14-dihydroretinoid derivative, or agent capable of modulating the level of at least one all-trans-13,14-dihydroretinoid or all-trans-13,14-dihydroretinoid derivative in the subject. 123-. (canceled)24. A method of treating obesity or an obesity related condition in a mammalian subject , the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising at least one all-trans-13 ,14-dihydroretinoid , all-trans-13 ,14-dihydroretinoid derivative , all-trans-retinol:all-trans-13 ,14-dihydroretinol saturase or a compound that modulates the level and/or activity of all-trans-retinol:all-trans-13 ,14-dihydroretinol saturase , wherein the obesity or obesity related condition is associated with improved glucose tolerance , abnormal fasting response manifested by visceral fat retention , or decreased hepatic triglyceride levels.25. The method of claim 24 , the pharmaceutical composition being administered to at least one cell expressing G-protein-coupled receptor 40 (GPR40) and/or a polynucleotide encoding GPR40.26. The method of claim 24 , the pharmaceutical composition promoting lipolysis in the subject.27. The method of claim 24 , ...

TRANSDERMAL ABSORPTION PROMOTER, AND EXTERNAL SKIN FORMULATION THEREOF

The present invention provides a substance which promotes the transdermal absorption of a pharmacologically active component while little irritating the skin. The present invention relates to a transdermal absorption promoter which comprises, as the active component, at least one member selected from among isopulegol, 2-(menthoxy)ethanol and 2-methyl-3-(menthoxy)propane-1,2-diol; and an external skin formulation which comprises a pharmacologically active component such as a psychotropic component, an anti-inflammatory component, an analgesic component, an antipyretic component, a whitening component or a hair growth-promoting component, together with the aforesaid transdermal absorption promoter. 1. A transdermal absorption promoter , comprising , as an active component , at least one member selected from the group consisting of isopulegol , 2-(menthoxy)ethanol and 2-methyl-3-(menthoxy)propane-1 ,2-diol.2. The transdermal absorption promoter according to claim 1 , which further comprises at least one component selected from the group consisting of menthol claim 1 , menthone claim 1 , camphor claim 1 , pulegol claim 1 , cineole claim 1 , 3-menthoxypropane-1 claim 1 ,2-diol claim 1 , N-alkyl-p-menthane-3-carboxamide claim 1 , 3-menthoxy-2-methylpropane-1 claim 1 ,2-diol claim 1 , p-menthane-3 claim 1 ,8-diol claim 1 , 3-menthoxypropan-1-ol claim 1 , 4-1-menthoxybutan-1-ol (menthyl 3-hydroxybutanoate) claim 1 , menthyl 3-hydroxybutanoate claim 1 , 1-(2-hydroxy-4-methyl-cyclohexyl)ethanone claim 1 , menthyl lactate claim 1 , menthol glycerol ketal claim 1 , N-methyl-2 claim 1 ,2-isopropylmethyl-3-methylbutaneamide claim 1 , menthyl glyoxylate claim 1 , menthyl succinate claim 1 , menthyl glutarate claim 1 , peppermint oil claim 1 , spearmint oil claim 1 , eucalyptus oil and mint oil.3. The transdermal absorption promoter according to claim 1 , which further comprises at least one warming substance selected from the group consisting of vanillyl ethyl ether claim 1 , ...

Compositions, kits and methods for nutrition supplementation

The present invention relates to compositions, kits and methods for the administration of various vitamin, mineral and nutrient compositions, and in a specific embodiment, the compositions, kits and methods may utilize or include twelve carbon chain fatty acids and/or twelve carbon chain acylglycerols, vitamin D, iodine, vitamin B1, vitamin B6, vitamin B12, vitamin B2, vitamin B9, vitamin B3, vitamin E, vitamin A, vitamin C, iron, zinc, copper, magnesium, omega 3 fatty acids and one or more pharmaceutically acceptable carriers.

COSMETIC COMPOSITION CONTAINING RETINOL STABILIZED BY POROUS POLYMER BEADS AND NANOEMULSION

The present invention relates to a method for stabilizing retinol (Vitamin A), an unstable fat-soluble material, to use the same in cosmetics. The present invention provides an anti-inflammatory and skin wrinkle reducing cosmetic composition containing retinol stabilized by nano-emulsification, wherein a retinol polymer nanocapsule formed by capturing retinol with porous polymer particles is nano-emulsified by a mung bean MCT (medium chain triglyceride) extract and lecithin for stabilizing retinol. 1. An anti-inflammatory and skin wrinkle reducing cosmetic composition containing retinol stabilized by nano-emulsification , wherein a retinol polymer nanocapsule formed by adsorbing retinol with mesoporous polymer beads is nano-emulsified to a size of 50˜200 nm using a mung bean MCT (medium chain triglyceride) extract and lecithin to stabilize the retinol.2. The cosmetic composition of claim 1 , wherein the mesoporous polymer beads are made of polymethylmethacrylate crosslinked with ethyleneglycol dimethacrylate.3. The cosmetic composition of claim 1 , wherein the retinol claim 1 , an active ingredient claim 1 , is included in the retinol polymer nanocapsule in an amount of 0.5˜10 wt %.4. The cosmetic composition of claim 1 , wherein the lecithin is at least one selected from the group consisting of hydrogenated lecithin claim 1 , phosphatidylcholine claim 1 , phospholipid claim 1 , hydrogenated lysophosphatidylcholine claim 1 , hydrogenated lysolecithin claim 1 , hydroxylated lecithin claim 1 , and unsaturated lecithin.5. The cosmetic composition of claim 1 , wherein the stabilized retinol is included in an amount of 0.0001 wt %˜50 wt % based on a total amount of the cosmetic composition.6. The cosmetic composition of claim 1 , wherein the formulation of the cosmetic composition is soft wash claim 1 , nutritive wash claim 1 , massage cream claim 1 , nutritive cream claim 1 , skin packs claim 1 , gel claim 1 , skin cream claim 1 , lipstick claim 1 , makeup base claim 1 ...

Low toxicity topical active agent delivery system

An active agent delivery composition is provided that allows topical delivery of active agents including vitamin A and its derivatives. A polyhalogenic vehicle such as methoxyonafluorobutane or ethoxyonafluorobutane serves as a coupler for an active agent and a silicone carrier so as to allow solubilization of active agents not normally miscible in silicones and providing a moisture maintaining composition.

HAIR GROWTH STIMULANT

A composition of a mixture of vitamin and herbal supplements. Supplementation of the composition promotes hair growth and thickness by increasing the number of hairs and preventing hair loss. The concentration of the vitamin and herbal supplements in the composition is suitably about 0.01-100%. The composition may comprise a suitable carrier, solvent and/or emulgent. The composition may be, for example, an internally ingested tablet, a capsule, drops or a suspension. This formulation will enhance the hair thickness and provide elements for growing hair in humans and animals. 1. Promoting hair growth and preventing hair loss thereof administering a composition of mixed vitamin and herbal supplements wherein said concentration of a mixed vitamin and herbal supplements is about 0.1%.2. The composition of claim 1 , wherein said composition of vitamin and herbal supplements are a mixture of Biotin claim 1 , Calcium claim 1 , Chromium claim 1 , Copper claim 1 , DHA-docosahexaenoic acid claim 1 , EPA-eicosapentaenoic acid claim 1 , Fish oil claim 1 , Folic acid claim 1 , Ginkgo biloba claim 1 , Ginseng claim 1 , Iodine claim 1 , Iron claim 1 , Magnesium claim 1 , Manganese claim 1 , Molybdenum claim 1 , Niacin claim 1 , Omega-3 claim 1 , Pantothenic acid claim 1 , Riboflavin claim 1 , Saw palmetto claim 1 , Selenium claim 1 , Thiamin claim 1 , Vitamin A claim 1 , Vitamin B12 claim 1 , Vitamin B6 claim 1 , Vitamin C claim 1 , Vitamin D-cholecalciferol claim 1 , Vitamin E claim 1 , Vitamin K claim 1 , and Zinc.3. The composition of claim 2 , wherein said composition comprises a suitable carrier claim 2 , solvent and/or emulgent.4. The composition of claim 2 , wherein said composition is administered in the form of an oral dosage.5. The composition of claim 2 , wherein said oral dosage is in the form of an internally ingested tablet claim 2 , a capsule claim 2 , drops or a suspension.6. The composition of claim 1 , wherein said oral dosage promotes healthy micronutrient ...

Compositions and methods for treating Alzheimer's disease and related disorders and promoting a healthy nervous system

Methods of inhibiting the onset and progression of Alzheimer's disease (AD), mild cognitive impairment (MCI), and related neurodegenerative disorders involving amyloidosis are provided. The methods involve administering a composition comprising a therapeutically effective amount of D-pinitol to individuals who are at risk of developing the disease or have one or more symptoms of the disease. Also provided are methods of treating or preventing Alzheimer's disease or MCI that involve the use of such compositions. Also provided are methods of using D-pinitol to promote a healthy nervous system and as a food supplement. 1. A method of promoting a healthy nervous system comprising administering D-pinitol to an individual in an amount and for a period of time , to promote said healthy nervous system in said individual.2. The method of wherein said D-pinitol administered in said amount and said time to achieve a concentration of D-pinitol in blood or plasma of about 1 to 19 μM.3. The method of wherein said D-pinitol is administered to said individual at a daily dose of over 10 mg/kg.4. The method of wherein said D-pinitol is administered to said individual at a daily dose of about 80 to 100 mg/kg.5. The method of wherein said D-pinitol is administered orally.6. The method of wherein said D-pinitol is administered in a tablet.7. The method of wherein said D-pinitol is administered in a single claim 6 , daily dose.8. The method of wherein said D-pinitol is administered in two or more doses per day.9. The method of wherein said D-pinitol is administered in a food item.10. The method of further comprising restricting the caloric intake of said individual.11. The method of wherein said individual is a human.12. A method of supplementing a diet comprising ingesting D-pinitol at a predetermined interval and in an amount and for a period of time to achieve a concentration of D-pinitol in blood or plasma of about 1 to 19 μM claim 1 , to supplement said diet.13. The method of ...

ENCAPSULATED PINK TOURMALINE FOR SKIN

Disclosed is a particle, compositions having the particle, and methods of using the particle or composition, that includes a core having an active ingredient, a coating surrounding the core, and pink tourmaline that is included in the core and/or in the coating. 1. A particle comprising a core having an active ingredient , a coating surrounding the core , and pink tourmaline that is included in the core and/or in the coating.2. The particle of claim 1 , wherein the core consists of the active ingredient.3. The particle of claim 1 , wherein the core consists of the active ingredient and the pink tourmaline.4. The particle of claim 1 , wherein the active ingredient is a combination of an oil-soluble vitamin C derivative and retinol claim 1 , wherein the oil-soluble vitamin C derivative is ascorbyl tetraisopalmitate.5. The particle of claim 4 , comprising 1 to 10% by weight of ascorbyl tetraisopalmitate and 1 to 10% by weight of retinol.6. The particle of claim 5 , comprising 7% by weight of ascorbyl tetraisopalmitate and 7% by weight of retinol.7. The particle of claim 1 , wherein the coating is a polymeric coating comprising polymethyl methacrylate.8. The particle of claim 1 , wherein the particle has a pink hue.9. The particle of claim 1 , comprising 0.1 to 10% by weight of pink tourmaline.10. The particle of claim 1 , wherein the coating further comprises an antioxidant or a plasticizer or a combination thereof.11. The particle of claim 10 , wherein the antioxidant is butylated hydroxytoluene and the plasticizer is tricaprylin.12. The particle of claim 1 , wherein the particle is comprised in a cosmetic composition.13. The particle of claim 12 , wherein the particle is dispersed in a continuous phase of the composition.14. The particle of claim 12 , wherein the composition is a cream claim 12 , lotion claim 12 , gel claim 12 , serum claim 12 , or emulsion.15. The particle of claim 12 , wherein the composition further includes a moistuization agent claim 12 , a UV ...

MIR27B IS A NOVEL TARGET FOR TREATMENT OF LIVER FIBROSIS

Methods are provided for treating fibrosis of a tissue, including fibrosis of the liver, using combinations of antagomirs and/or locked nucleic acids. Compositions therefor are also provided. 1. A method of treating fibrosis of a tissue in a subject , or of reducing development of fibrosis of a tissue in a subject at risk of fibrosis of a tissue , comprising administering to the subject an amount of a combination of three different molecules , each molecule being , independently , a nucleic acid or nucleic acid analogue directed to microRNAs chosen from miR-23b , miR-27b and miR-24 , effective to treat fibrosis of the tissue or to reduce development of fibrosis of the tissue.2. The method of claim 1 , wherein the combination comprises three different molecules each directed to a different one of miR-23b claim 1 , miR-27b and miR-24.3. The method of claim 2 , wherein the three different molecules are nucleic acids claim 2 , each complementary to the microRNA it is targeted to.4. The method of claim 3 , wherein the nucleic acids are antagomirs claim 3 , each fully complementary to the microRNA it is targeted to.5. The method of claim 2 , wherein the three different molecules are nucleic acid analogues claim 2 , each complementary to the microRNA they are targeted to claim 2 , wherein the nucleic acid analogues are analogues by virtue of comprising a methylene bridge connecting a 2′-O atom and a 4′-C atom of at least one ribose thereof.6. The method of claim 5 , wherein the three different nucleic acids analogues are each fully complementary to the microRNA they are targeted to.7. The method of claim 1 , wherein the nucleic acids are ribonucleic acids.8. (canceled)9. The method of claim 1 , wherein the miR-23b has the sequence AUCACAUUGCCAGGGAUUACC (SEQ ID NO:1) claim 1 , wherein the miR-27b has the sequence UUCACAGUGGCUAAGUUCUGC (SEQ ID NO:2) claim 1 , and wherein the miR-24 has the sequence UGGCUCAGUUCAGCAGGAACAG (SEQ ID NO:3).11. The method of claim 1 , wherein one ...

Composition for regenerating normal tissue from fibrotic tissue

The present invention relates to a pharmaceutical composition and a method for regenerating normal tissue from fibrotic tissue, the pharmaceutical composition and the method employing a collagen-reducing substance. In accordance with the present invention, normal tissue can be therapeutically regenerated from fibrotic tissue.

SUPER-SATURATING DELIVERY VEHICLES FOR POORLY WATER-SOLUBLE PHARMACEUTICAL AND COSMETIC ACTIVE INGREDIENTS AND SUPRESSION OF CRYSTALLIZATION OF PHARMACEUTICAL ACTIVE INCREDIENTS

A pharmaceutical or cosmetic composition, comprising a substantially poorly water-soluble pharmaceutical active ingredient; and a nanoporous folic acid material, wherein the active pharmaceutical ingredient is incorporated inside the nanoporous channels of the particles. 1. A pharmaceutical or cosmetic composition , comprising:A substantially poorly water-soluble pharmaceutical active ingredient; andA nanoporous folic acid material, wherein the active pharmaceutical ingredient is incorporated inside the nanoporous channels of the particles.2. The composition of claim 1 , wherein said substantially poorly water-soluble pharmaceutical active ingredient is composed of one or more species selected from the group of: antifungal agents claim 1 , analgesic agents claim 1 , cholesterol absorption inhibitors claim 1 , anti-pyretics claim 1 , anti-inflammatory claim 1 , decongestants claim 1 , antihistamine claim 1 , antiretroviral drugs claim 1 , and cancer drugs.3. The composition of claim 1 , wherein said substantially poorly water-soluble cosmetic active ingredient is composed of one or more species selected from the group of: fat-soluble vitamins and pro-vitamins and stabilized vitamins and stabilized provitamins.4. The composition of claim 1 , wherein said poorly water-soluble pharmaceutical or cosmetic active ingredient is present at about 0.1 wt % to 90 wt % claim 1 , and preferably between 15-55 wt % of the total weight of the nanoporous material.5. The composition of claim 1 , wherein said poorly water-soluble compounds are active ingredients with solubility <10 g/L and preferably <1 g/L in water at 25° C. claim 1 , or by having partition constants above 2 claim 1 , or by violating at least one of Lipinski's rule-of-5.6. The composition of claim 1 , wherein the particle size of said nanoporous materials is in the range between 50 nm to 100 μm.7. The composition of claim 1 , wherein the said pore size of said nanoporous materials is between 1 nm to 50 nm.8. The ...

Drug carrier and drug carrier kit for inhibiting fibrosis

Disclosed is a stellate cell-specific drug carrier comprising a stellate cell-specific amount of a retinoid derivative and/or a vitamin A analogue, and a drug carrier component other than the retinoid derivative and/or a vitamin A analogue. Also disclosed in a medicine comprising the stellate cell-specific drug carrier, and a drug in an amount effective for controlling the activity or growth of stellate cells.

Inhibition of Cancer Cell Proliferation Using Oleoylethanolamide

A pharmaceutical composition including oleoylethanolamide (OEA) is administered to inhibit tumor/cancer cell proliferation. The pharmaceutically composition may additionally include vitamin A, carotenoids, ω-3 polyunsaturated fatty acid, ω-6 polyunsaturated fatty acid and/or conjugated linolenic acid. The tumor/cancer may be colorectal cancer, lung adenocarcinoma, breast cancer, hepatoma, oral cancer and/or stomach adenocarcinoma.

Composition Comprising SOD, Lutein and Zeaxanthin

The invention relates to a composition comprising an enzyme selected from the group comprising superoxide dismutase (SOD) and SOD mimics and the like, in association with lutein and at least one stereoisomer of zeaxanthin; the invention also includes a kit of parts comprising such composition, wherein the kit comprises a first part comprising the enzyme, and a second part comprising lutein and at least one zeaxanthin isomer; according to the invention, the composition or the kit of part may be included in a functional food, a nutraceutical composition or a food or dietary supplement, a medicament or a pharmaceutical composition, or a veterinarian product; the invention also relates to a composition for use in treating, preventing or stabilizing a disease, condition or disorder of the eye associated to oxidative stress, comprising administering to a subject in need thereof a medicament or a pharmaceutical composition according to the invention.

RETINOID REPLACEMENTS AND OPSIN AGONISTS AND METHODS FOR THE USE THEREOF

Compositions of and methods for using synthetic retinoids as retinoid replacements and opsin agonists are provided. 158-. (canceled)59. A method of treating a visual disorder in an aging subject due to a deficiency of 11-cis retinal in an eye of the aging human subject , comprising:administering a therapeutically effective amount of a synthetic retinoid to an eye of the aging human subject in need of such, wherein the human subject has a deficiency of endogenous 11-cis-retinal in the eye and the synthetic retinoid is a cis-retinoid that forms a functional opsin/chromophore complex in the eye.60. The method of claim 59 , wherein the visual disorder associated with a deficiency of endogenous 11-cis-retinal in the eye is selected from decrease of night vision claim 59 , decrease of contrast sensitivity claim 59 , and age-related macular degeneration.61. The method of claim 60 , wherein the age-related macular degeneration (AMD) comprises dry AMD.62. The method of claim 59 , wherein the aging subject is at least 45 years old.63. The method of claim 59 , wherein administering the synthetic retinoid comprises locally administering to the eye of the human subject.64. The method of claim 63 , wherein the locally administering is by eye drops claim 63 , intraocular injection or periocular injection.65. The method of claim 63 , wherein administering the synthetic retinoid comprises systemically administering by an oral dosage form or an injection.67. The method of claim 59 , wherein the synthetic retinoid is 9-cis-retinal.68. A method of treating age-related macular degeneration (AMD) claim 59 , a decrease of night vision claim 59 , or a decrease of contrast sensitivity in an aging human subject claim 59 , comprising:administering a synthetic retinoid to an eye of the aging human subject, wherein the human subject has a deficiency of endogenous 11-cis-retinal in the eye and the synthetic retinoid is a cis-retinoid that forms a functional opsin/chromophore complex in the eye. ...

AGENT FOR INHIBITING ODOR OF PYRAZINE DERIVATIVES

Provided is an agent for reducing odors of pyrazine derivatives based on an olfactory receptor antagonism. The agent for reducing odors of pyrazine derivatives includes at least one antagonist of olfactory receptor OR5K1 as an active ingredient. 1. A method of reducing an odor of a pyrazine derivative , wherein the method comprises coexisting an odor of a pyrazine derivative with at least one compound selected from the group consisting of the following compounds:2-ethyl-4-(2,2,3-trimethyl-3-cyclopenten-1-yl)-2-buten-1-ol;5-methyl-2-(1-methylethyl)-phenol;3,7-dimethyl-2,6-octadienal;phenylethyl salicylate;1-(5,6,7,8-tetrahydro-3,5,5,6,8,8-hexamethyl-2-naphthalenyl)-ethanone;isolongifolanone;4-(2,6,6-trimethyl-2-cyclohexen-1-yl)-3-buten-2-one (α-ionone);4-(2,6,6-trimethyl-1-cyclohexen-1-yl)-3-buten-2-one (β-ionone);vetiverol;7-acetyl-1,2,3,4,5,6,7,8-octahydro-1,1,6,7-tetramethyl-naphthalene;α-amylcinnamic aldehyde;α-methyl-4-(1-methylethyl)-benzenepropanal;4-methyl-3-decen-5-ol;1-(2-tert-butylcyclohexyloxy)-2-butanol;2-methoxy-1-(phenylmethoxy)-4-(1-propenyl)-benzene;α-methyl-β-(p-tert-butylphenyl)-propionaldehyde;l(−)-menthol;ω-6-hexadecenelactone;2-(2-(4-methyl)-3-cyclohexen-1-yl)-propylcyclopentanone;formaldehyde cyclododecyl ethyl acetal;1-(2,3,4,7,8,8a-hexahydro-3,6,8,8-tetramethyl-1H-3a,7-methanoazulen-5-yl)-ethanone;β-methyl naphthyl ketone;cedryl acetate;(5E)-3-methylcyclopenta-5-decen-1-one;cinnamaldehyde;4-(1-ethoxyvinyl)-3,3,5,5-tetramethylcyclohexanone;α-hexylcinnamic aldehyde;2-phenylpropionaldehyde;3,7-dimethyl-6-octenal;dodecahydro-3a,6,6,9a-tetramethylnaphtho[2,1-b]furan;4,7,7-trimethyl-spirobicyclo[2.2.1]heptane-2,1-cyclopentan-3-one;α-isomethyl ionone;3,7-dimethyl-1-octanol;cedryl methyl ether;muscone;2-methyl-4-(2,2,3-trimethyl-3-cyclopenten-1-yl)-2-buten-1-ol;2-cyclohexylpropanal;γ-undecalactone;cyclopentadecanolide;1-(2,6,6-trimethyl-1,3-cyclohexadien-1-yl)-2-buten-1-one;2,4-dimethyl-3-cyclohexene-1-carboxyaldehyde;2,4,6-trimethyl-3-cyclohexene-1- ...

Anti-Cellulite Composition and Method of Treating Cellulite

A cellulite-reducing topical composition comprising a lecithin organogel, an ethylene oxide-propylene oxide-ethylene oxide triblock copolymer, caffeine, a retinoid, and optionally at least one vitamin, vitamin derivative or vitamin precursor. 1. A cellulite-reducing topical composition comprising:(a) about 5% to about 13% by weight of a lecithin organogel,(b) 1% to 3% by weight of a ethylene oxide-propylene oxide-ethylene oxide triblock copolymer,(c) 1% to 5% caffeine, and(d) a dermatologically acceptable carrier base.2. The cellulite reducing topical composition of further comprising about 0.1% to about 3.0% claim 1 , by weight claim 1 , of a retinoid.3. The cellulite reducing topical composition of wherein the retinoid is retinol.4. The cellulite reducing topical composition of further comprising about 0.1% to about 6.0% claim 1 , by weight claim 1 , of at least one vitamin claim 1 , vitamin derivative or vitamin precursor.5. The cellulite reducing topical composition of wherein the at least one vitamin derivative is tocopherol acetate claim 4 , ascorbyl palmitate claim 4 , or a mixture thereof.6. The cellulite reducing topical composition of wherein the organogel is comprised of soy lecithin and isopropyl palmitate.7Centella asiatica, Coleus forskolii, Ginkgo biloba. The cellulite reducing topical composition of wherein the organogel further comprises at least one anti-cellulite active ingredient selected from the group of: anti-inflammatory agents; extracts of ; ursolic acid; short-chain peptides having from 2 to 12 amino acids; MMP-inhibitors; theophylline and derivatives thereof; carnitine and derivatives thereof.8. The cellulite reducing topical composition of wherein the ethylene oxide-propylene oxide-ethylene oxide triblock copolymer comprises about 70% claim 1 , by weight claim 1 , ethylene oxide.9. A method of reducing cellulite in human skin claim 1 , and the visual manifestations thereof claim 1 , comprising the step of applying to the skin an amount of ...

TRANSDERMAL COMPOSITIONS AND METHODS FOR TREATING STRETCH MARKS

A transdermal delivery device for treating or preventing scars, such as stretch marks, comprising a composition comprising vitamin E, hyaluronan, biotin, , collagen, and a heat generating ingredient, and methods therefor. 1. A transdermal delivery device comprising:{'i': 'Rosmarinus officinalis', 'a composition comprising vitamin E, hyaluronan, biotin, , and collagen; and'}a heat generating ingredient.2Lavendula augustifoliaSalvia officinalis, Pelargonium graveolens, Humulus lupulus. The transdermal delivery device of claim 1 , wherein the composition further comprises one or more of jojoba claim 1 , claim 1 , cocoa butter claim 1 , aloe vera claim 1 , vitamin C claim 1 , caffeine claim 1 , taurine claim 1 , claim 1 , panthenol claim 1 , linalool claim 1 , theobroma oil claim 1 , vitamin H claim 1 , vitamin B7 claim 1 , ascorbic acid claim 1 , L-ascorbic acid claim 1 , ascorbyl palmitate claim 1 , sodium ascorbyl phosphate claim 1 , retinyl ascorbate claim 1 , tetrahexyldecyl ascorbate claim 1 , magnesium ascorbyl phosphate claim 1 , or caffeine sodium benzoate.3Lavendula augustifoliaRosmarinus officinalisSalvia officinalisPelargonium graveolensHumulus lupulus. The transdermal delivery device of claim 2 , wherein the composition comprises: about 2 mg/ml to about 40 mg/ml jojoba; about 2 mg/ml to about 40 mg/ml ; about 1 mg/ml to about 50 mg/ml cocoa butter; about 1 mg/ml to about 50 mg/ml vitamin E; about 0.2 mg/ml to about 25 mg/ml hyaluronan; about 0.5 mg/ml to about 50 mg/ml aloe vera; about 0.5 μg/ml to about 200 μg/ml vitamin C; about 50 mg/ml to about 200 mg/ml caffeine; about 0.2 mg/ml to about 40 mg/ml taurine; about 0.1 mg/ml to about 10.5 mg/ml ; about 0.8 mg/ml to about 10.7 mg/ml ; about 0.039 mg/ml to about 19 mg/ml ; about 0.4 mg/ml to about 60 mg/ml ; about 5 mg/ml to about 40 mg/ml panthenol; and about 1 mg/ml to about 100 mg/ml collagen.4. The transdermal delivery device of claim 1 , wherein the heat generating ingredient comprises one or more of ...

Composition for Treating Phonatory and Olfactory Apparatus Disorders

A composition is described consisting of coenzyme Q10, vitamin A and suitable excipients for treating phonatory and olfactory apparatus disorders, such as anosmia and dysosmia. 1. Composition consisting of coenzyme Q10 , Vitamin A and pharmaceutically acceptable excipients.2. The composition of claim 1 , wherein coenzyme Q10 is in an amount of 1-25 wt % claim 1 , Vitamin A 0.3-10 wt % claim 1 , on the composition weight.3. The composition of claim 2 , wherein coenzyme Q10 is in an amount of 2-20 wt % claim 2 , Vitamin A 0.5-8 wt % claim 2 , on the composition weight.4. The composition of claim 3 , wherein coenzyme Q10 is in an amount of 3-15 wt % claim 3 , Vitamin A 1-6 wt % claim 3 , on the composition weight.5. The composition of claim 4 , wherein coenzyme Q10 is in an amount of 5-10 wt % claim 4 , Vitamin A 1.5-5 wt % claim 4 , on the composition weight.6. The composition of claim 1 , wherein said pharmaceutically acceptable excipients are colloidal silica claim 1 , dibasic calcium phosphate claim 1 , maltodextrins claim 1 , sugar esters claim 1 , microcrystalline cellulose claim 1 , lactose claim 1 , talc claim 1 , magnesium stearate claim 1 , calcium stearate claim 1 , aluminum silicate or magnesium silicate claim 1 , or mixtures thereof.7. (canceled)8. Method of treating phonatory apparatus disorders and olfactory apparatus disorders claim 1 , such as anosmia and dysosmia claim 1 , comprising the step of administering an effective amount of the composition of in a subject in need thereof.9. The method of claim 8 , wherein the composition is in the form of a unitary dose containing 3.3-83 mg of Coenzyme Q10 and 1-26.6 mg of Vitamin A.10. The method of claim 9 , wherein the composition is in the form of a unitary dose containing 15-35 mg of Coenzyme Q10 and 5-15 mg of Vitamin A.11. The method of claim 8 , wherein the composition is administered by oral claim 8 , inhalative claim 8 , aerosol claim 8 , spray claim 8 , transdermic claim 8 , intravenous claim 8 , ...

Cyclodextrin-Based Microemulsions, and Dermatological Uses Thereof

Described herein are cyclodextrin-stabilized microemulsion systems useful for increasing the solubility, stability, bioavailability, or safety of an active agent for delivery to the skin. The microemulsions may reduce the occurrence of skin irritation or odor upon application. In certain embodiments, the active agent is substantially insoluble in water. The microemulsions may be formulated as semi-solids, for example creams, or as aerosol or non-aerosol foams. Also described are methods of treating skin disorders, comprising the step of applying to an affected area of a subject in need thereof a therapeutically-effective amount of an inventive microemulsion. 1. A formulation comprisinga microemulsion; an active agent; a moisturizer or emollient; a third surfactant; an antioxidant or preservative; a viscosity modifying agent; and a pH adjuster.2. The formulation of claim 1 , wherein the microemulsion consists essentially of:(i)water, in an amount of about 80% by weight of the microemulsion;hydroxypropyl β-cyclodextrin, in an amount of about 5% by weight of the microemulsion; andcaprylocaproyl macrogol-8 glycerides or caprylocaproyl polyoxyl-8 glycerides, in an amount of about 15% by weight of the microemulsion; or(ii)water, in an amount of about 90% by weight of the microemulsion;hydroxypropyl β-cyclodextrin, in an amount of about 3% by weight of the microemulsion; andcaprylocaproyl macrogol-8 glycerides or caprylocaproyl polyoxyl-8 glycerides, in an amount of about 7% by weight of the microemulsion.3. The formulation claim 1 , wherein the active agent is selected from the group consisting of salicylic acid claim 1 , papain claim 1 , sulfur claim 1 , glycolic acid claim 1 , pyruvic acid claim 1 , resorcinol claim 1 , N-acetylcysteine claim 1 , retinoids such as retinoic acid (e.g. claim 1 , tretinoin) and its derivatives (e.g. claim 1 , cis and trans isomers claim 1 , esters) claim 1 , retinol claim 1 , alpha hydroxy acids claim 1 , beta hydroxy acids claim 1 , coal ...

Cyclodextrin-Based Microemulsions, and Dermatological Uses Thereof

Described herein are cyclodextrin-stabilized microemulsion systems useful for increasing the solubility, stability, bioavailability, or safety of an active agent for delivery to the skin. The microemulsions may reduce the occurrence of skin irritation or odor upon application. In certain embodiments, the active agent is substantially insoluble in water. 1. An active agent-containing microemulsion , consisting essentially of: an active agent and a microemulsion , wherein the microemulsion consists essentially of an aqueous phase , a first surfactant , and a second surfactant; and the first surfactant is a cyclodextrin or a derivative of a cyclodextrin.2. The active agent-containing microemulsion of claim 1 , wherein the active agent comprises retinol.3. The active agent-containing microemulsion of claim 1 , wherein the active agent is retinol.4. The active agent-containing microemulsion of claim 1 , wherein the active agent is present in an amount from about 0.01% to about 5% by weight of the active agent-containing microemulsion.5. The active agent-containing microemulsion of claim 1 , wherein the aqueous phase is present in an amount from about 75% to about 95% by weight of the microemulsion.6. The active agent-containing microemulsion of claim 1 , wherein the aqueous phase comprises a moisturizer or emollient.7. The active agent-containing microemulsion of claim 6 , wherein the moisturizer or emollient is selected from the group consisting of panthenol claim 6 , allantoin claim 6 , sodium hyaluraonate claim 6 , pentylene glycol claim 6 , and combinations/mixtures thereof.8. The active agent-containing microemulsion of claim 6 , wherein the moisturizer or emollient is present in an amount from about 0.8% to about 2.3% by weight of the aqueous phase.9. The active agent-containing microemulsion of claim 1 , wherein the aqueous phase comprises an anti-inflammatory agent.10. The active agent-containing microemulsion of claim 9 , wherein the anti-inflammatory agent is ...

Micro-RNA Family That Modulates Fibrosis and Uses Thereof

The present invention relates to the identification of a microRNA family, designated miR-29a-c, that is a key regulator of fibrosis in cardiac tissue. The inventors show that members of the miR-29 family are down-regulated in the heart tissue in response to stress, and are up-regulated in heart tissue of mice that are resistant to both stress and fibrosis. Also provided are methods of modulating expression and activity of the miR-29 family of miRNAs as a treatment for fibrotic disease, including cardiac hypertrophy, skeletal muscle fibrosis other fibrosis related diseases and collagen loss-related disease. 188-. (canceled)89. A method of inducing collagen deposition in a tissue of a subject in need thereof comprising contacting said tissue with an antisense oligonucleotide comprising a sequence that is at least partially complementary to a miR-29a , miR-29b , and/or miR-29c sequence.90. The method of claim 89 , wherein the antisense oligonucleotide comprises a sequence that is at least partially complementary to SEQ ID NO: 18 claim 89 , SEQ ID NO: 19 claim 89 , and/or SEQ ID NO: 20.91. The method of claim 90 , wherein the antisense oligonucleotide comprises a sequence that is at least 85% complementary to SEQ ID NO: 18 claim 90 , SEQ ID NO: 19 claim 90 , and/or SEQ ID NO: 20.92. The method of claim 90 , wherein the antisense oligonucleotide comprises a sequence that is at least 95% complementary to SEQ ID NO: 18 claim 90 , SEQ ID NO: 19 claim 90 , and/or SEQ ID NO: 20.93. The method of claim 90 , wherein the antisense oligonucleotide comprises a sequence that is 100% complementary to SEQ ID NO: 18 claim 90 , SEQ ID NO: 19 claim 90 , and/or SEQ ID NO: 20.94. The method of claim 89 , wherein the antisense oligonucleotide comprises a sequence that is substantially complementary to a pre-miR-29a claim 89 , pre-miR-29b claim 89 , or pre-miR-29c sequence.95. The method of claim 89 , wherein the antisense oligonucleotide is about 15 to about 50 nucleotides in length.96. ...

Compositions for Topical Treatment of Medical Conditions Including Wounds and Inflammation

A method for treating a patient suffering from a wound, ulcer, or inflammation includes providing a topical formulation comprising a carrier and a combination of active ingredients that includes at least one retinoid and at least one blood vessel dilator, and applying the topical formulation to the skin of the patient to cause healing, accelerated healing or prevention of the wound, ulcer or inflammation. Additional active ingredients may include a promoter of mitochondrial function or an antioxidant. 118-. (canceled)19. A formulation for topical administration comprising a carrier and a combination of active ingredients consisting essentially of a retinoid and a blood vessel dilator.20. A formulation for topical administration comprising a carrier and a combination of active ingredients consisting essentially of a retinoid , a blood vessel dilator , and an antioxidant.21. A formulation for topical administration comprising a carrier and a combination of active ingredients consisting essentially of a retinoid , a blood vessel dilator , and a promoter of mitochondrial function.22. A formulation for topical administration comprising a carrier and a combination of active ingredients consisting essentially of a retinoid , a blood vessel dilator , an antioxidant and a promoter of mitochondrial function.23. A formulation according to claim 19 , wherein the retinoid is vitamin A retinal claim 19 , 9-cis-retinoic acid claim 19 , tretinoin claim 19 , isotretinoin claim 19 , etretinoin .etretinoin claim 19 , or acitretin.24. A formulation according to claim 23 , further comprising a fatty acid ester.25. A formulation according to claim 24 , wherein the fatty acid ester is palmitate or oleate.26. A formulation according to claim 19 , wherein the blood vessel dilator is selected from the group consisting of methyl nicotinate and arginine.27. A formulation according to claim 20 , wherein the antioxidant is selected from the group consisting of ascorbate claim 20 , coenzyme Q10 ...

Method for Treating Hearing Loss

A method of treating hearing loss includes the step administering a composition to the mammal, wherein the composition consists essentially of a biologically effective amount of vitamin A, vitamin E, vitamin C, a vasodilator comprising magnesium, and, optionally, a withanolide, and/or resveratrol. 1. A method of treating hearing loss , said method comprising the step of internally administering a composition to the mammal , wherein the composition consists essentially of a biologically effective amount of vitamin A , vitamin E , vitamin C , a vasodilator comprising magnesium , and , optionally , a withanolide , and/or resveratrol.2. A method as set forth in wherein the step of internally administering the composition is further defined as orally administering the composition to the mammal.3. A method as set forth in wherein the step of internally administering the composition is further defined as intravenously administering the composition to the mammal.4. A method as set forth in further comprising the step of detecting hearing loss in a mammal.5. A method as set forth in wherein the step of internally administering the composition occurs prior to the step of detecting the hearing loss in the mammal.6. A method as set forth in wherein an average difference in threshold shift in mammals from baseline threshold sensitivity at 4 claim 5 , 8 claim 5 , and 16 kHz claim 5 , as compared to an untreated control claim 5 , is at least 25 decibels when the trauma results from exposure to 120 decibel SPL Octave Band Noise centered at 4 kHz for five hours.7. A method as set forth in wherein the composition further comprises resveratrol.8. A method as set forth in wherein the vitamin A is present in the composition in an amount of at least 830 IU.9. A method as set forth in wherein the vitamin C is present in the composition in an amount of at least 4 claim 1 ,000 IU.10. A method as set forth in wherein the vitamin E is further defined as a water-soluble analogue of alpha- ...

Skin anti-oxidant enhancing formulation and associated method

The present invention describes novel applications of an oil formulation rich in carotenoids and poly-unsaturated fatty acids (PUFA) for skin care, lip care and cosmetic use. The formulation contains natural oil extract of Spreng also known as gac, spiny melon, Redmelon™. The formulation contains carotenoid antioxidants (beta-carotene and lycopene), pro-vitamin A carotenoid (alpha and beta-carotene), and vitamin E. In addition, the formulation contains omega-3, omega-6, omega-9 fatty acids, the essential fatty acids important in enhancing skin integrity, elasticity. The oil-based formulation helps skin to retain water, Carotenoids in the formula protects skin from oxidative damage. The novelty of this invention is in the mixture of antioxidants, retinol and essential fatty acids to deliver a stable, bioavailable and nutritious composition for skin care. In addition, the formulation provides vitamin E and retinol beneficial in skin therapeutic and cosmetic applications. 1. A composition to enrich skin antioxidants by combining into a carrier lipid with an effective amount of Gac fruit oil2Momordica cochinchinensis. The composition method in wherein the gac fruit oil is an oil extracted from redmelon also known as gac fruit claim 1 , spiny gourd whose scientific name is Spreng3. The method of claim 1 , wherein oil reconstituted from dried gac powder may be used.4. The method of claim 1 , wherein the dermatologically acceptable vehicle consists of any combination of fruit oils including coconut oil claim 1 , safflower oil olive oil claim 1 , avocado oil.5. The method of claim 1 , wherein the vehicle might contain botanical or fruit extracts to impart fragrances6. The method of claim 1 , wherein the composition is in the form of a lotion claim 1 , cream claim 1 , gel claim 1 , serum claim 1 , solid claim 1 , or emulsion.7. The method in claim 1 , wherein the composition contains plant-based and non-toxic form of retinol.8. The method in claim 1 , wherein the composition ...

PROCESS FOR PRODUCING AQUEOUS SOLUTION CONTAINING FAT-SOLUBLE SUBSTANCE

The purpose of the present invention is to provide a process for producing an aqueous solution containing a fat-soluble substance. A combination of a super dissolution aid, cyclodextrin and a fat-soluble substance or a combination of the super dissolution aid and a cyclodextrin complex of the fat-soluble substance is used for dissolving the fat-soluble substance, whereby it becomes possible to provide an aqueous solution containing the fat-soluble substance at a high concentration and an aqueous solution having improved transdermal absorbability of the fat-soluble substance contained therein. 1. A method for producing an aqueous solution containing at least one fat-soluble substance selected from the group consisting of: polyphenols , flavonoids , tocopherols , retinols , menaquinones , carotenoids , propolis or cinnamic acid derivatives , diterpenes , terpenes , coenzyme Q10 and α-lipoic acid , said method comprising adding to water a solubilizer and at least one of (a) cyclodextrin and the at least on fat-soluble substance , wherein the solubilizer is a member selected from the group consisting of:1) an alkali salt or bile acid selected from the group consisting of taurocholate, glycocholate, cholic acid, lithocholic acid and deoxycholic acid,2) glycosides of polyphenols or hesperidin,3) an emulsifier selected from the group consisting of glycerin fatty acid ester, sorbitan fatty acid ester, propylene glycol fatty acid ester, and, sucrose fatty acid ester,4) a lecithin agent selected from the group consisting of enzymatically decomposed lecithin, lecithin derived from soybean and, lecithin derived from egg yolk,5) a saponin selected from the group consisting of glycyrrhizic acid or an alkali salt thereof, soybean saponin and quillaja saponin,6) a casein or alkali salt thereof,7) a polysorbate (fatty acid polyoxyethylene sorbitan),8) a cellulose or alkali salt thereof selected from the group consisting of methylcellulose, carboxymethyl cellulose and hydroxyethyl ...

ZEAXANTHIN-ENRICHED POULTRY EGG

An object of the present invention is to provide zeaxanthin-enriched poultry eggs containing zeaxanthin at high concentrations. The present invention specifically relates to zeaxanthin-enriched poultry eggs obtained by feeding poultry with a poultry feedstuff containing zeaxanthin-producing bacteria. 1. A poultry egg containing zeaxanthin in yolk at 3.5 mg to 10 mg per 100 g of yolk.2. The poultry egg according to claim 1 , wherein the poultry are chickens.3. A zeaxanthin-enriched poultry egg claim 1 , which is obtained by feeding poultry with a poultry feedstuff containing zeaxanthin-producing bacteria.4Paracoccus.. The zeaxanthin-enriched poultry egg according to claim 3 , wherein the bacteria belong to the genus5. The zeaxanthin-enriched poultry egg according to claim 3 , wherein the amount of zeaxanthin in the feedstuff is 1 mg or more per 100 g of the feedstuff.6. The zeaxanthin-enriched poultry egg according to claim 3 , containing zeaxanthin in yolk at 1.5 mg to 10 mg per 100 g of yolk.7. The zeaxanthin-enriched poultry egg according to claim 3 , wherein the poultry are chickens.8. A method for producing a zeaxanthin-enriched poultry egg comprising a step of feeding poultry with a poultry feedstuff containing zeaxanthin-producing bacteria.9Paracoccus.. The method according to claim 8 , wherein the bacteria belong to the genus10. The method according to claim 8 , wherein the amount of zeaxanthin in the feedstuff is 1 mg or more per 100 g of the feedstuff.11. The method according to claim 8 , wherein the zeaxanthin-enriched poultry egg contains zeaxanthin in yolk at 1.5 mg to 10 mg per 100 g of yolk.12. The method according to claim 8 , wherein the poultry are chickens.13. A poultry feedstuff containing zeaxanthin-producing bacteria.14Paracoccus.. The poultry feedstuff according to claim 13 , wherein the bacteria belong to the genus15. The poultry feedstuff according to claim 13 , wherein the amount of zeaxanthin to be added is 1 mg or more per 100 g of the ...

AQUEOUS OPHTHALMIC COMPOSITION

This invention relates to an aqueous ophthalmic composition comprising (A) polyoxyethylene castor oil in which the number of moles of added ethylene oxide is 2 to 30, and (B) at least one member selected from the group consisting of castor oil and vitamin A. According to the aqueous ophthalmic composition of the present invention, the defoaming time can be reduced even when foam is generated by vibration or impact. 1. An aqueous ophthalmic composition comprising (A) polyoxyethylene castor oil in which the number of moles of added ethylene oxide is 2 to 30 , and (B) at least one member selected from the group consisting of castor oil and vitamin A.2. The aqueous ophthalmic composition according to claim 1 , wherein component (A) is polyoxyethylene castor oil in which the average number of moles of added ethylene oxide is 2 to 12.3. The aqueous ophthalmic composition according to claim 1 , wherein the total content of component (A) is 0.0005 to 5 w/v % based on the total amount of the aqueous ophthalmic composition.4. The aqueous ophthalmic composition according to claim 2 , wherein the total content of component (A) is 0.0005 to 5 w/v % based on the total amount of the aqueous ophthalmic composition.5. The aqueous ophthalmic composition according to claim 1 , which further comprises at least one member selected from the group consisting of boric acids and salts thereof.6. The aqueous ophthalmic composition according to claim 2 , which further comprises at least one member selected from the group consisting of boric acids and salts thereof.7. The aqueous ophthalmic composition according to claim 3 , which further comprises at least one member selected from the group consisting of boric acids and salts thereof.8. The aqueous ophthalmic composition according to claim 4 , which further comprises at least one member selected from the group consisting of boric acids and salts thereof.9. The aqueous ophthalmic composition according to claim 1 , which further comprises at ...

EXCIPIENT SYSTEM FOR TOPICAL DELIVERY OF PHARMACEUTICAL AGENTS

The subject invention is based upon the discovery that a wide variety of pharmaceutical agents can be delivered into the skin, fingernails, and toenails of patients by dissolving or dispersing the pharmaceutical agent in a solvent system which is comprised of a combination of an alkyl lactate and Simmondsia chinesis seed oil. The subject invention more specifically discloses a pharmaceutical serum which is comprised of (1) an alkyl lactate, wherein the alkyl group in the alkyl lactate contains from 2 to about 12 carbon atoms, (2) Simmondsia chinesis seed oil, and (3) a pharmaceutical agent. Some representative examples of pharmaceutical agent which can be incorporated into the pharmaceutical serums of this invention include, hormones, growth factors (cytokines), antimicrobials, antibacterials, antibiotics, non-steroidal anti-inflammatory agents, immunodilators, anesthetics, plant extracts, vitamins, corticosteroids, hair growth stimulants, and the like. 1. A pharmaceutical serum which is comprised of (1) an alkyl lactate , wherein the alkyl group in the alkyl lactate contains from 2 to about 12 carbon atoms , (2) Simmondsia chinesis seed oil , and (3) a pharmaceutical agent.2. A pharmaceutical serum as specified in wherein the alkyl lactate contains from 4 to 6 carbon atoms.3. A pharmaceutical serum as specified in wherein the alkyl lactate is isoamyl lactate.4. A pharmaceutical serum as specified in wherein the Simmondsia chinesis seed oil is golden Simmondsia chinesis seed oil.5. A pharmaceutical serum as specified in wherein the Simmondsia chinesis seed oil is filtered.6. A pharmaceutical serum as specified in wherein the Simmondsia chinesis seed oil is refined.7. A pharmaceutical serum as specified in wherein the alkyl lactate is present at a level which is within the range of about 5 weight percent to about 90 weight percent claim 3 , wherein the Simmondsia chinesis seed oil is present at a level of about 5 weight percent to about 90 percent claim 3 , and ...

Derivatives of tetracaine

Disclosed herein are derivatives of tetracaine that, among other things, block cyclic nucleotide gated (CNG) channels and are useful in the treatment of diseases characterized by overactive CNG channels such as retinal degeneration diseases.

Method and Composition for Ameliorating the Effects tor a Subject Exposed to Radiation or Other Sources of Oxidative Stress

Radiation-oxidative exposure treatment compositions comprise a mixture of micronutrient multivitamin and trace elements, a mixture of antioxidants and chemopreventative agents, and optionally a mixture of fatty acids. Micronutrient multivitamin and trace elements mixtures include vitamins A, Bp, B1, B2, B3, B5, B6, B7, B9, B12, C, D, E and K; inositol; calcium, iodine, magnesium, zinc, selenium, copper, manganese, chromium, molybdenum, potassium, boron and vanadium. Mixtures of non-essential antioxidants and chemopreventative agents include bioflavins, alpha lipoic acid, N-acetyl-L-cysteine (optionally) lutein, lycopene, astaxanthin, plant sterols, isoflavones, garlic extract, which provides allicin; green tea extract, cruciferous vegetable extract, fruit extracts, coenzyme Q-10, and resveratrol. Fatty acid mixtures include eicosapentaenoic acid and docosahexaenoic acid. 2. The composition of where the mixture of micronutrient multivitamin and trace elements comprises:biotin in an amount of about 0.187 mg;folate in an amount of about 0.25;iodine in an amount of about 0.0187 mg;manganese in an amount of about 1.25 mg;pantothenic acid in an amount of about 12.5 mg;selenium in an amount of about 0.0875 mg;vitamin B1 in an amount of about 1.9 mg;vitamin B12 in an amount of about 0.0075 mg;vitamin B2 in an amount of about 2.1 mg;vitamin B3 in an amount of about 25 mg;vitamin B6 in an amount of about 2.5 mg;vitamin C in an amount of about 75 mg;vitamin D in an amount of about 0.0125 mg;vitamin E in an amount of about 20 mg;vitamin K in an amount of about 0.056 mg;lycopene in an amount of about 1.25 mg;zinc in an amount of about 18.7 mg;alpha lipoic acid in an amount of about 125 mg;astaxanthin in an amount of about 0.31 mg;lutein in an amount of about 6.25 mg;vitamin A in an amount of about 0.938 mg;quercetin in an amount of about 64 mg;glutathione in an amount of about 125 mg; andwhere calcium, chromium, copper, magnesium, molybdenum, inositol and resveratrol are not ...

O-(substituted benzyl) phosphoramidate compounds and therapeutic use

This application discloses novel phosphoramidate and phosphonoamidate prodrugs of nucleosides, nucleotides, C-nucleosides, C-nucleotides, phosphonates, and other alcohol-containing drugs; use of these prodrugs for treatment of infectious diseases and cancers, in particular, liver infections and cancers; and methods of preparing these novel phosphoramidate and phosphonoamidate prodrugs.

PREVENTION OF ALCOHOL REACTION WITH DIETARY SUPPLEMENTS

The present invention is directed to compositions for preventing or reducing the flush and other unpleasant symptoms that sometimes accompany the consumption of alcoholic beverages, and methods for use of said compositions. The compositions comprise an agent, or combinations of various agents, such as an agent capable of increasing intracellular or intramitochondrial concentration of NAD in the subject; an agent capable of increasing glutathione concentration in the subject; an anti-oxidant; alpha-lipoic acid or a precursor to alpha-lipoic acid; and/or an agent capable of increasing the level of Coenzyme A in the subject; where the agent or agents are present or administered in amounts effective to prevent or reduce the alcohol reaction in a subject who has consumed one or more alcoholic beverages. 1. A composition for use by a subject to prevent or reduce the alcohol reaction , said composition comprising:a) an agent capable of increasing intracellular or intramitochondrial concentration of NAD in the subject; andb) an agent capable of increasing glutathione concentration in the subject;wherein said agents are present in the composition in an amount sufficient to prevent or reduce the alcohol reaction in the subject.2. The composition of claim 1 , further comprising an agent capable of increasing the level of Coenzyme A in the subject.3. The composition of claim 2 , further comprising an agent which is an anti-oxidant.4. The composition of claim 3 , further comprising alpha-lipoic acid or a precursor to alpha-lipoic acid.5. The composition of claim 4 , further comprising an agent capable of raising the blood level of all-trans retinoic acid.6. The composition of claim 1 , wherein the agent capable of increasing intracellular or intramitochondrial concentration of NAD in the subject is selected from the group consisting of nicotinamide claim 1 , nicotinamide riboside claim 1 , niacin claim 1 , and oxaloacetate.7. The composition of claim 1 , wherein the agent ...

Compositions and methods for prophylactic and therapeutic supplementation of nutrition in subjects

The present invention relates to compositions and methods for prophylactic nutritional supplementation and therapeutic nutritional supplementation. Specifically, the composition provides a nutritional supplement with a beneficial increased supplementation of vitamin D and the method involves administering to an individual a composition comprising carotenoids, vitamin E, vitamin D, vitamin C, thiamine, riboflavin, niacin, folic acid, pyridoxine, biotin, pantothenic acid, cobalamin, magnesium, manganese, zinc, selenium, chromium, copper, alpha lipoic acid, and lutein.

Controlled Release Mucoadhesive Systems

Formulations for chemoprevention of oral cancer and precancerous lesions, and for methods for preparing the formulations are described.

Anitbacterial or preserving composition containing 3-butoxy-1,2-propanediol

The present invention relates to an antibacterial and/or preserving composition which contains 3-butoxy-1,2-propanediol as a preserving agent. The antibacterial or preserving composition according to the present invention has an excellent resistance to microorganisms and has an excellent moisturizing effect, and hardly causes skin troubles.

Capsicum variety exhibiting a hyper-accumulation of zeaxanthin and products derived therefrom

The present invention is concerned with Capsicum plants producing greater than about 0.4% zeaxanthin, by weight in the dried, ripe fruit pod flesh, which plants have been developed from commercially grown Capsicum cultivars by plant breeding techniques. Zeaxanthin is the dominant carotenoid in the dried ripe fruit pod flesh, when measured in non-esterified forms. Alternatively, these plants may be characterized as exhibiting a high pigmentation measured as an ASTA value and further characterized by the predominant presence of zeaxanthin. The zeaxanthin derived from these Capsicum plants can be used in applications that include nutritional supplements, foods, functional foods, cosmetics, animal feeds, aquaculture feeds, and pharmaceuticals.

METHOD FOR TREATING AN AUTOIMMUNE NEUROLOGICAL DISEASE AND/OR NEURODEGENERATIVE DISEASE AND PHARMACEUTICAL FORMULATIONS FOR A LIQUID DOSAGE FORM AND A CONTROLLED RELEASE DOSAGE FORM

A method for treating an autoimmune neurological disease and/or a neurodegenerative disease is provided. The method includes administering an effective amount of at least one compound having Formula (I), Formula (II) or Formula (III), or its geometric isomer, enantiomer or diastereomer to a subject in need thereof: 5. The method for treating an autoimmune neurological disease and/or a neurodegenerative disease as claimed in claim 1 , wherein the at least one compound having Formula (I) claim 1 , Formula (II) or Formula (III) claim 1 , or its geometric isomer claim 1 , enantiomer claim 1 , diastereomer or pharmaceutically acceptable salt is the at least one compound having Formula (I).7. The method for treating an autoimmune neurological disease and/or a neurodegenerative disease as claimed in claim 6 , wherein the sobrerol comprises (+) trans-sobrerol claim 6 , (−) trans-sobrerol claim 6 , (+) cis-sobrerol claim 6 , (−) cis-sobrerol or a combination thereof.8. The method for treating an autoimmune neurological disease and/or a neurodegenerative disease as claimed in claim 7 , wherein the sobrerol is (+) trans-sobrerol.9. The method for treating an autoimmune neurological disease and/or a neurodegenerative disease as claimed in claim 7 , wherein the sobrerol is (−) trans-sobrerol.10. The method for treating an autoimmune neurological disease and/or a neurodegenerative disease as claimed in claim 7 , wherein the sobrerol is a mixture of (+) trans-sobrerol and (−) trans-sobrerol.11. The method for treating an autoimmune neurological disease and/or a neurodegenerative disease as claimed in claim 1 , wherein the autoimmune neurological disease comprises multiple sclerosis claim 1 , Neuromyelitis optica claim 1 , Lambert-Eaton myasthenic syndrome claim 1 , autoimmune inner ear disease claim 1 , narcolepsy claim 1 , neuromyotonia claim 1 , Guillain-Barre syndrome claim 1 , myasthenia gravis claim 1 , systemic lupus erythematosus claim 1 , transverse myelitis or acute ...

Methods of using cannabinoids and/or molecular similars for modulating, waking-up and/or disabling cellular functions involved in causing disease -- reinvigorating metabolism with anandamide, 2-arachidonoylglycerol and similarly acting compounds

Methods using cannabinoids and/or molecular similars for modulating, waking-up and/or disabling cellular functions involved in causing disease are provided for reinvigorating metabolism, including human metabolism. As humans age stresses they encounter cause their cells to respond opportunistically to counter each stress. Each of these responses involves at least minor shifts or compromises in metabolism. As these metabolic compromises multiply, metabolism continues to deviate from its optimum. Several lipophilic compounds are active in membranes of cells, including the plasma membrane, nuclear membrane, endoplasmic reticulum membrane and mitochondrial membrane. These lipophilic compounds, act with cannabinoid receptors to affect virtually all cell functions. By choosing specific endocannabinoids and/or analogues and targeting them at opportunistically deteriorated portions of metabolism through one of several specific endocannabinoid receptor proteins in a stepwise manner metabolism can be reinvigorated towards its optimal status. 1. A method of advancing physiological welfare in a mammal , said method comprising: in an individual identified as being compromised by at least one cannabinoid related physiological deficit , delivering to said individual a combination of cannabinoid activity and/or cannabinoid effect modulating interventions selected to ameliorate at least one of said cannabinoid related physiological deficits with an effect that at least one of said cannabinoid related physiological deficits is ameliorated.2. The method of wherein the modulated cannabinoid activity and/or cannabinoid effect comprises binding at least one selected from the group consisting of: 5-HT claim 1 , 5-HT claim 1 , CB claim 1 , CB claim 1 , TRPV claim 1 , GPR18 claim 1 , GPR55 claim 1 , GPR119 claim 1 , GPR120 claim 1 , PPARα claim 1 , PPARγ and PPARδ.3. The method of wherein the modulated cannabinoid activity and/or cannabinoid effect comprises activating at least one G ...

COMPOSITION COMPRISING A DIINDOLYLMETHANE AND A RETINOID TO TREAT A SKIN CONDITION

Provided is a composition for use in treating a skin condition, the composition comprising: 134-. (canceled)36. The dosage form of claim 35 , wherein the ratio (mg:μg) of the first and the second component is from about 10:3000 to about 500:200.37. The dosage form of claim 35 , wherein the ratio (mg:μg) of the first and the second component is from about 75:800 to about 300:200.38. The dosage form of claim 35 , wherein the ratio (mg:IU) of the first and the second component is from about 75:10000 to about 300:2500.39. The dosage form of claim 35 , wherein the ratio (mg:mg) of the first and the second component is from about 75:5.3 to about 300:1.3.40. The dosage form of claim 35 , wherein the dosage form comprises a first capsule comprising the first component and a second capsule comprising the second component.41. The dosage form of claim 35 , wherein the dosage form comprises a capsule comprising the first component and the second component claim 35 , wherein the first and the second component are provided in a single formulation.42. The dosage form of claim 41 , wherein the single formulation comprises a blended powder comprising the first and the second component.43. The dosage form of claim 35 , wherein the dosage form comprises a first tablet comprising the first component and a second tablet comprising the second component.44. The dosage form of claim 35 , wherein the dosage form comprises a tablet comprising the first component and the second component claim 35 , wherein the first and the second component are provided in a single formulation.45. The dosage form of claim 35 , wherein the first component is in a microencapsulated form.46. The dosage form of claim 35 , further comprising at least one excipient selected from the group consisting of: tricalcium phosphate claim 35 , cellulose fiber claim 35 , ascorbic acid claim 35 , silicon dioxide claim 35 , magnesium stearate claim 35 , and any combination thereof.47. The dosage form of claim 35 , wherein a ...

ZEAXANTHIN FOR TUMOR TREATMENT

A composition comprising a pharmaceutically effective amount of zeaxanthin or its derivative for use in treating a malignant tumor and a method of using a pharmaceutically effective amount of zeaxanthin or its derivative either alone or together with one or more pharmaceutical agents for treating a malignant tumor. The tumor may be, but is not limited to breast cancer, cervix cancer, colon cancer, cutaneous melanoma, cutaneous squamous carcinoma, hepatocellular carcinoma, lung cancer, osteosarcoma, prostate cancer, and uveal melanoma. The pharmaceutically effective amount of zeaxanthin is generally above about 0.5 mg/kg/d to about 20 mg/kg/d. 19-. (canceled)10. A method of treating a malignant tumor comprising administering a composition comprising zeaxanthin in combination with one or more anti-malignant tumor agents to a subject in need thereof.11. The method of claim 10 , wherein the composition further comprises one or more pharmaceutically acceptable additives claim 10 , excipient claim 10 , adjuvant or carriers.12. The method of claim 10 , wherein the anti-malignant tumor agent is selected from 5-Fluorouracil claim 10 , Adriamycin claim 10 , Cytoxan claim 10 , Cisplatin claim 10 , and Avastin®.13. The method of claim 10 , wherein the subject is a patient diagnosed with a malignant tumor.14. The method of claim 10 , wherein the zeaxanthin is administered in an amount sufficient to induce apoptosis of the malignant tumor.15. The method of claim 10 , wherein the zeaxanthin is administered in an amount sufficient to delay progression of the malignant tumor.16. The method of claim 10 , wherein apoptosis is induced in the malignant tumor cells when exposed to zeaxanthin and wherein apoptosis is not induced in non-malignant tumor cells.17. The method of claim 10 , wherein the malignant tumor is selected from breast cancer claim 10 , cervix cancer claim 10 , colon cancer claim 10 , cutaneous melanoma claim 10 , cutaneous squamous carcinoma claim 10 , hepatocellular ...

FOOD BASED DELIVERY OF THERAPEUTIC AGENT FOR TREATMENT OF HEPATIC ENCEPHALOPATHY

Described herein are compositions, methods, and kits for treating hepatic encephalopathy. A composition for treating or preventing hepatic encephalopathy comprises one or more therapeutic agents and a delivery modality comprising an edible food, beverage, candy, or gum. The one or more therapeutic agents are mixed with one or more food ingredients so that the therapeutic agent is incorporated in the delivery modality. 1. A method for treating or preventing hepatic encephalopathy in an individual in need thereof , comprising a delivery modality comprising one or more food ingredients; and', 'one or more therapeutic agents;', 'wherein the one or more therapeutic agents are mixed together with the one or more food ingredients., 'providing to the individual a therapeutic composition comprising'}2. The method of claim 1 , wherein the one or more therapeutic agents comprise a laxative.3. The method of claim 2 , wherein the laxative comprises polyethelyne glycol.4. The method of claim 3 , wherein the polyethelyne glycol is PEG 3350.5. The method of claim 2 , wherein the laxative comprises lactulose.6. The method of claim 1 , wherein the one or more therapeutic agents comprises an antibiotic.7. The method of claim 6 , wherein the antibiotic comprises rifaxamin.8. The method of claim 6 , wherein the antibiotic comprises neomycin.9. The method of claim 6 , wherein the antibiotic comprises metronidazole.10. The method of claim 6 , wherein the antibiotic comprises nitanoxinide.11. The method of claim 1 , wherein the one or more therapeutic agents comprises sodium benzoate.12. The method of claim 1 , wherein the one or more therapeutic agents comprises AST-120.13. The method of claim 1 , wherein the one or more therapeutic agents comprises OCR-002.14. The method of claim 1 , wherein the one or more therapeutic agents comprises L-ornithine-L-aspartate.15. The method of claim 1 , wherein the one or more therapeutic agents comprise sodium benzoate and L-ornithine-L-aspartate.16. ...

COMPOUNDS FOR TARGETING DRUG DELIVERY AND ENHANCING siRNA ACTIVITY

Here described are compounds consisting of the structure (targeting molecule) m -linker-(targeting molecule) n , wherein the targeting molecule is a retinoid or a fat soluble vitamin having a specific receptor on the target cell; wherein m and n are independently 0, 1, 2 or 3; and wherein the linker comprises a polyethylene glycol (PEG) or PEG-like molecule, as well as compositions and pharmaceutical formulations including these compounds which are useful for the targeting and delivery of therapeutic agents; and methods of using these compositions and pharmaceutical formulations.

DIETARY SUPPLEMENTS AND FORMULATIONS

Provided are dietary supplements, formulations, kits and methods for administration to an individual with type II diabetes or at risk of developing type II diabetes. Provided herein are formulations, kits and methods useful for treating, preventing, supporting, controlling, restoring, and/or maintaining blood sugar levels in individuals with type II diabetes or at risk of developing the same. Also provided are formulations, kits and methods useful for reducing and/or eliminating requirement of ex-vivo insulin administration in an individual diagnosed with type II diabetes. 1. A dietary supplement in a form selected from the group consisting of a tablet , capsule , pill , emulsion , ointment , lotion , suppository , and aerosol , the dietary supplement consisting essentially of:{'i': 'Cornus officinalis', 'at least one component selected from the group consisting of maca, fruit extract, and a combination thereof;'}{'i': 'Gymnema sylvestre', 'at least one component selected from the group consisting of berberine, bitter melon extract, leaf extract, banaba, carnitine, and combinations thereof;'}{'i': Panax ginseng', 'Rhodiola rosea', 'Eleutherococcus senticosus, 'at least one component selected from the group consisting of vitamin C, root extract, Aswagandha root extract, holy basil leaf extract, extract, extract, vitamin B5, cactus stem extract, phosphatidylserine, vitamin D, and combinations thereof;'}{'i': Cordyceps sinesis', 'Gingko biloba', 'Garcinia cambogia', 'Rehmannia glutinosa', 'Poria cocos', 'oblonga', 'stevia, 'at least one component selected from the group consisting of extract, leaf extract, suma root, extract, extract, root extract, cinnamon extract, Fenugreek, Guggul, citrimax extract, salacia extract, vitamin E, thiamin, riboflavin, niacin, vitamin B6, folate, vitamin B12, biotin, magnesium, zinc, selenium, manganese, chromium, vanadium, zinc, calcium, alpha lipoic acid, N-acetyl-cysteine, 4-aminobenzoic acid (PABA), choline bitartrate, glutamine, ...

DIETARY SUPPLEMENTS AND FORMULATIONS

Provided are dietary supplements, formulations, kits and methods for administration to an individual with type II diabetes or at risk of developing type II diabetes. Provided herein are formulations, kits and methods useful for treating, preventing, supporting, controlling, restoring, and/or maintaining blood sugar levels in individuals with type II diabetes or at risk of developing the same. Also provided are formulations, kits and methods useful for reducing and/or eliminating requirement of ex-vivo insulin administration in an individual diagnosed with type II diabetes. 1. A dietary supplement in a form selected from the group consisting of a tablet , capsule , pill , emulsion , ointment , lotion , suppository , and aerosol , the dietary supplement consisting essentially of:cactus stem extract;{'i': 'Gymnema sylvestre', 'at least one component selected from the group consisting of berberine, bitter melon extract, leaf extract, banaba, carnitine, and combinations thereof;'}{'i': Garcinia cambogia', 'Rehmannia glutinosa', 'Poria cocos, 'at least one component selected from the group consisting of extract, extract, root extract, cinnamon extract, Fenugreek, Guggul, and combinations thereof;'}{'i': 'stevia', 'at least one component selected from the group consisting of vitamin D, vitamin E, thiamin, riboflavin, niacin, vitamin B6, folate, vitamin B12, biotin, vitamin B5, magnesium, zinc, selenium, manganese, chromium, vanadium, alpha lipoic acid, N-acetyl-cysteine, 4-aminobenzoic acid (PABA), choline bitartarate, citrimax extract, taurine, coenzyme Q10, calcium, vitamin K2, vitamin C, protein, fiber, inositol, molybdenum, luo han guo, extract rebaudioside, and combinations thereof; and'}an excipient.2. The dietary supplement of claim 1 , wherein the excipient is selected from the group consisting of gelatin claim 1 , cellulose claim 1 , medium-chain triglyceride (MCT) oil claim 1 , silicon dioxide claim 1 , stearic acid claim 1 , and combinations thereof.3. The ...

EMULSIONS PROVIDING STABLE VITAMIN COMPOSITIONS AND METHODS OF FORMING COMPOSITIONS THEREOF

Stable vitamin oil-in-water emulsions and methods of making those emulsions are described herein. The emulsions may be used to make beverage products that include fat-soluble vitamins. The emulsions may also be used in beverage products that are colored and which maintain color stability for an extended period of time. 1. An oil-in-water emulsion comprising:an oil phase wherein the primary oil among all oils in said oil phase is limonene;wherein up to about 40% by weight of all oils in said oil phase are selected from the group consisting of corn oil, sunflower oil, soybean oil, and combinations thereof;beta-carotene in an amount between about 1% and about 5% by weight; anda surfactant portion of a quillaja extract in an amount between about 2.5% to about 20% by weight.2. The oil-in-water emulsion of further comprising water in an amount of no more than about 50% by weight.3. The oil-in-water emulsion of further comprising vitamin E in an amount of about 0.1% to about 5% by weight.4. (canceled)5. (canceled)6. The oil-in-water emulsion of wherein said limonene is present in an amount of about 15% to about 50% by weight.7. (canceled)8. The oil-in-water emulsion of wherein up to about 10% of all oils in said oil phase are oils other than limonene.9. The oil-in-water emulsion of wherein said oils other than limonene consist of saturated and monounsaturated fatty acids.10. (canceled)11. (canceled)12. The oil-in-water emulsion of wherein a source of said quillaja extract is Q-Naturale.13. The oil-in-water emulsion of wherein said oil phase comprises particles with an average size of about 0.1 microns to about 0.5 microns.14. (canceled)15. The oil-in-water emulsion of wherein said emulsion is photostable for at least about 4 months.16. An oil-in-water emulsion comprising:an oil phase wherein the primary oil among all oils in said oil phase is limonene;wherein up to about 30% by weight of all oils in said oil phase are carrier oils;vitamin A in an amount between about 1% ...

MULTI-NUTRIENT SUPPLEMENT COMPOSITION AND USES THEREOF

Various embodiments of the invention relate to compositions comprising vitamins, minerals and trace elements, antioxidants, amino acids, probiotics, and other components and methods for using such compositions to treat or prevent diseases associated with oxidative stress, including cardiovascular disease. 1. (canceled)2. A method of delaying or preventing the onset of a disease and/or condition associated with oxidative stress comprising administering to a human subject a therapeutically effective amount of a composition comprising:(i) vitamin A, vitamin B1 vitamin B2, vitamin B3, vitamin B5, vitamin B6, vitamin B12, vitamin C, vitamin D, vitamin E, vitamin K, folic acid, calcium source, potassium source, magnesium source, phosphate source, iodine, copper source, chromium source, manganese source, molybdenum source, selenium source, zinc source, lycopene, one or more carotenoids, one or more flavonoids, biotin, inositol, choline, one or more amino acids,(ii) a probiotic composition comprising the powder of one or more dried fruits and pollen extract or Terminalia arjuna or an extract thereof,(iii) fish oil, and(iv) one or more pharmaceutically acceptable excipients;wherein the composition delays or prevents the onset of a disease and/or condition associated with oxidative stress.3. The method of claim 2 , wherein the composition comprises vitamin A (0.01-10 mg) claim 2 , vitamin B(1-50 mg) claim 2 , vitamin B(1-50 mg) claim 2 , vitamin B(1-100 mg) claim 2 , vitamin B(1-100 mg) claim 2 , vitamin B(0.5-50 mg) claim 2 , vitamin B(0.0001-2 mg) claim 2 , vitamin C (0.1-1000 mg) claim 2 , vitamin D (0.0001-1 mg) claim 2 , vitamin E (1-500 mg) claim 2 , vitamin K (0.001-5 mg) claim 2 , folic acid (0.0001-5 mg) claim 2 , calcium source (0.1-1000 mg) claim 2 , potassium source (0.1-1000 mg) claim 2 , magnesium source (0.1-1000 mg) claim 2 , phosphate source (1-500 mg) iodine source (0.0001-5 mg) claim 2 , copper source (0.0001-10 mg) claim 2 , chromium source (0.0001-10 rug) ...

Topical composition using a two-part form factor

According to some embodiments, a topical composition and method of forming the same are provided, comprising a powder complex including an active component, wherein the powder complex has a pre-defined first dosage; and a universal activator serum having a pre-defined second dosage, wherein the combination of the powder complex and the universal activator serum generates the topical composition having a third pre-defined dosage and a viscosity of 10-30K centipoise (CPS). Numerous other aspects are provided.

VITAMIN A COMPOSITION

The present invention relates to a composition comprising triglycerides, surfactant, self-assembled structures and vitamin A or provitamin A. Further aspects of the invention are a food product, the use of a composition comprising triglycerides, surfactant and self-assembled structures to stabilize vitamin A or provitamin A and a process for preparing a stabilized vitamin A or provitamin A composition. 1. Composition comprising triglycerides , surfactant , self-assembled structures and vitamin A or provitamin A wherein the self-assembled structures are selected from the group consisting of L2 phase , reversed microemulsion , reversed micellar cubic structure , reversed bicontinuous cubic structure , reversed sponge phase , reversed hexagonal structure , lamellar phase and combinations of these.2. A composition according to wherein at least part of the vitamin A or provitamin A is dissolved in the triglycerides.3. A composition according to wherein the surfactant is selected from the group consisting of monoglycerides claim 1 , galactolipids claim 1 , phospholipids claim 1 , polyoxyethylene sorbitan fatty acid esters and combinations of these.4. A composition according to wherein the surfactant is present at a level of between 0.1 and 30 wt. % in the triglycerides.5. A composition according to wherein the composition further comprises an antioxidant.6. A composition according to wherein the antioxidant is selected from the group consisting of rosemary extract claim 5 , green tea extract claim 5 , a butylated phenol and combinations of these.7. A composition according to further comprising water and having a water activity greater than 0.3.8. Food product comprising a composition comprising triglycerides claim 1 , surfactant claim 1 , self-assembled structures and vitamin A or provitamin A wherein the self-assembled structures are selected from the group consisting of L2 phase claim 1 , reversed microemulsion claim 1 , reversed micellar cubic structure claim 1 , ...

Composition And Method For Treating Congenital Cytomegalovirus Induced Hearing Loss

A method of treating congenital cytomegalovirus (cCMV) induced hearing loss includes the step administering a composition to the mammal, wherein the composition consists essentially of a biologically effective amount of vitamin A, vitamin E, vitamin C, a vasodilator comprising magnesium, and, optionally, a withanolide, and/or resveratrol. 1. A method of treating congenital cytomegalovirus induced hearing loss , said method comprising the step of internally administering a composition to the mammal , wherein the composition consists essentially of a biologically effective amount of vitamin A , vitamin E , vitamin C , a vasodilator comprising magnesium , and , optionally , a withanolide , and/or resveratrol.2. A method as set forth in wherein the step of internally administering the composition is further defined as orally administering the composition to the mammal.3. A method as set forth in wherein the step of internally administering the composition is further defined as intravenously administering the composition to the mammal.4. A method as set forth in further comprising the step of detecting congenital cytomegalovirus induced hearing loss in a mammal.5. A method as set forth in wherein the step of internally administering the composition occurs prior to the step of detecting the congenital cytomegalovirus induced hearing loss in the mammal.6. A method as set forth in wherein reduction in congenital cytomegalovirus induced hearing loss is measured as an average difference in threshold shift from baseline threshold sensitivity at 8 claim 5 , 16 claim 5 , and 32 kHz claim 5 , as compared to an untreated control claim 5 , after intracerebral inoculation with murine congenital cytomegalovirus.7. A method as set forth in wherein the composition further comprises resveratrol.8. A method as set forth in wherein the vitamin A is present in the composition in an amount of at least 830 IU.9. A method as set forth in wherein the vitamin C is present in the composition in ...

RETINOID REPLACEMENTS AND OPSIN AGONISTS AND METHODS FOR THE USE THEREOF

Compositions of and methods for using synthetic retinoids as retinoid replacements and opsin agonists are provided. 158-. (canceled)59. A method of treating a visual disorder in an aging subject due to a deficiency of 11-cis retinal in an eye of the aging human subject , comprising:administering a therapeutically effective amount of a synthetic retinoid to an eye of the aging human subject in need of such, wherein the human subject has a deficiency of endogenous 11-cis-retinal in the eye and the synthetic retinoid is a cis-retinoid that forms a functional opsin/chromophore complex in the eye.60. The method of claim 59 , wherein the visual disorder associated with a deficiency of endogenous 11-cis-retinal in the eye is selected from decrease of night vision claim 59 , decrease of contrast sensitivity claim 59 , and age-related macular degeneration.61. The method of claim 60 , wherein the age-related macular degeneration (AMD) comprises dry AMD.62. The method of claim 59 , wherein the aging subject is at least 45 years old.63. The method of claim 59 , wherein administering the synthetic retinoid comprises locally administering to the eye of the human subject.64. The method of claim 63 , wherein the locally administering is by eye drops claim 63 , intraocular injection or periocular injection.65. The method of claim 63 , wherein administering the synthetic retinoid comprises systemically administering by an oral dosage form or an injection.67. The method of claim 59 , wherein the synthetic retinoid is 9-cis-retinal.68. A method of treating age-related macular degeneration (AMD) claim 59 , a decrease of night vision claim 59 , or a decrease of contrast sensitivity in an aging human subject claim 59 , comprising:administering a synthetic retinoid to an eye of the aging human subject, wherein the human subject has a deficiency of endogenous 11-cis-retinal in the eye and the synthetic retinoid is a cis-retinoid that forms a functional opsin/chromophore complex in the eye. ...

Pharmaceutical composition for preventing and/or treating disease caused by coronavirus and/or rotavirus

The present invention provides a pharmaceutical composition for prevention and/or treatment of diseases induced by viruses of genus coronavirus and/or genus rotavirus. The pharmaceutical composition includes the following components by weight percent: 0.5-100% of taurine, 0-85% of a vitamin complex, and 0-15% of a flavoring agent.

METHOD AND SYSTEM FOR MAKING PERSONALIZED NUTRITIONAL AND PHARMACEUTICAL FORMULATIONS USING ADDITIVE MANUFACTURING

The presently disclosed subject matter is directed to a system and method of preparing personalized nutritional and/or pharmaceutical formulations using additive manufacturing technology. Active pharmaceutical or dietary supplement ingredients are suspended in thixotropic stable carrier medias. The thixotropic suspensions are deposited onto a surface of a solid substrate, which can be a snack bar or small wafer used as a mechanical carrier. The disclosed system enables each additive active ingredient to be variably dosed based on a formula that is determined for each specific individual and manufactured on demand. Once the active ingredients are deposited on substrate, the entire assembly can be enrobed with one or more edible solid coatings to seal the active ingredients and provide taste-masking agent characteristics to the assembly. 1. A solid assembly for oral consumption , the assembly comprising:a substrate defining one or more depressions;one or more suspensions deposited within the depressions of the solid substrate, wherein each suspension comprises a homogenous dispersion of one or more active pharmaceutical ingredients (APIs) and a carrier,wherein each suspension is viscous and/or thixotropic;one or more coatings applied over one or more surfaces of the solid substrate;wherein each API is variably dosed based on a formula that is determined for each subject consuming the solid assembly.2. The solid assembly of claim 1 , wherein the substrate is an excipient that is selected from one or more fillers claim 1 , pH adjusting agents claim 1 , preservatives claim 1 , anti-adhesives claim 1 , plasticizers claim 1 , opacifiers claim 1 , coloring agents claim 1 , pigments claim 1 , surfactants claim 1 , diluents claim 1 , anti-foaming agents claim 1 , lubricants claim 1 , binders claim 1 , granulating aids claim 1 , taste modifying agents claim 1 , and glidants.3. The solid assembly of claim 1 , wherein the depressions are configured as a plurality of longitudinal ...

Snacks, Beverages, And Edible Additives With Sun Defense Nutriments And Methods Of Manufacture Thereof

The present disclosure provides generally for snacks with sun defense nutriments that may allow participants to safely engage in sun activities and methods related to manufacturing sun defense nutriments. Sun defense nutriments may comprise sun defense attributes that may provide sun activity protection when the sun defense nutriment is ingested. Snacks with sun defense nutriments may be customized to provide effective protection measures for a particular sun activity. In some aspects, methods of manufacturing may allow for the generation of combinations of sun defense nutriments for production of snacks. In some implementations, the combinations may be generated based on one or more criterion related to sun defense attributes, sun activities, flavors, or nutriment types, as non-limiting examples. 1. A snack with sun defense nutriments comprisinga first sun defense nutriment comprising a first sun defense attribute and a first predefined flavor; anda second sun defense nutriment comprising a second sun defense attribute and a second predefined flavor, wherein, as the snack is ingested, release of the first sun defense attribute and the second sun defense attribute initiates protection against one or more sun activity side effects associated with a predefined sun activity.2. The snack of claim 1 , wherein the snack comprises a bar.3. The snack of claim 1 , wherein the snack comprises a chew.4. The snack of claim 1 , wherein the snack comprises other ingredients that do not comprise sun defense attributes.5. The snack of claim 1 , wherein the first sun defense attribute comprises a water-soluble antioxidant claim 1 , fat-soluble antioxidant claim 1 , or a combination thereof.6. The snack of claim 1 , wherein at least one of the one or more sun activity side effects comprises sun exposure.7. The snack of claim 6 , wherein one or both the first sun defense attribute and the second sun defense attribute comprises Vitamin C claim 6 , Vitamin E claim 6 , or both. ...

OIL-BASED PHARMACEUTICAL COMPOSITION FOR THE TREATMENT OF GASTROINTESTINAL DISEASES

The present invention relates to a composition for oral use in the treatment of gastrointestinal pathologies comprising silicone antifoaming agents in an oily solvent medium, wherein the concentration of said silicone antifoaming agents is between 0.1% and 80% by weight. 1. Composition for oral use in the treatment of gastrointestinal pathologies , comprising silicone antifoaming agents in an oily solvent medium , wherein the concentration of said silicone antifoaming agents is between 0.1% and 80% by weight.2. Composition according to claim 1 , wherein said silicone antifoaming agents comprise simethicone in a concentration between 0.5% and 15% by weight.3. Composition according to claim 2 , wherein said simethicone is comprised in a concentration between 3% and 12% by weight.4. Composition according to claim 1 , wherein said silicone antifoaming agents comprise silicon dioxide in a concentration between 0.01% and 10% by weight with respect to the composition weight.5. Composition according to claim 4 , wherein said silicone antifoaming agents comprise silicon dioxide in a concentration between 0.1% and 5% by weight with respect to the composition weight.6. Composition according to claim 1 , wherein said oily solvent medium comprises olive oil.7. Composition according to claim 1 , wherein said silicon antifoaming agents comprise simethicone in an amount between 6% and 8% and silicon dioxide in a quantity between 1.5% and 3%.10Helicobacter pylori,. A method for the treatment of disorders of the gastro-intestinal tract claim 1 , in particular of dyspeptic disorders claim 1 , disorders which require the reduction of the gastric emptying time claim 1 , in the treatment of in the irritable bowel syndrome (IBS) claim 1 , as well as gas claim 1 , bloating claim 1 , flatulence claim 1 , and in the treatment of intestinal colics claim 1 , especially in children and infants claim 1 , comprising administering a composition according to to a person in need thereof.11. ...

COMPOSITIONS AND METHODS FOR MANAGING DIGESTIVE DISORDERS AND A HEALTHY MICROBIOME

Disclosed is a prebiotic composition comprising a combination of 2′fucosyllactose (2′FL) and isomaltooligosaccharide (IMO). The 2′FL and IMO are present in the prebiotic composition in a weight ratio of from 1:1 to 1:10. The prebiotic composition is effective for use in methods of preventing and/or treating a gastrointestinal (GI) condition in an animal, such as irritable bowel syndrome (IBS), inflammatory bowel disease(s) (IBD), Crohn's disease, and ulcerative colitis (UC). A foodstuff or beverage, a medical food, a nutritional composition, and a kit presentation, each including the prebiotic composition, and each suitable for use in methods of reducing or suppressing inflammation in an animalian tract, are also disclosed. A method of using the prebiotic composition to prevent and/or treat a GI condition in an animal is further disclosed. The method comprises administering the prebiotic composition to the animal. 1. A prebiotic composition comprising a combination of 2′fucosyllactose (2′FL) and isomaltooligosaccharide (IMO) in a weight ratio of from 1:1 to 1:10.2. The prebiotic composition of claim 1 , wherein the combination comprises the 2′FL and IMO in a weight ratio of from 1:2 to 1:5 claim 1 , alternatively of 1:2.53. The prebiotic composition of claim 1 , wherein the prebiotic composition is (i) adapted to be consumed as a liquid; (ii) a dry powder; (iii) adapted to be mixed with a foodstuff; or (iv) any combination of (i) to (iii).4. The prebiotic composition of claim 1 , further comprising at least one additive comprising: (i) an amino acid; (ii) a peptide; (iii) a protein; (iv) a lipid; (v) a vitamin; (vi) a carbohydrate; (vii) a nucleic acid; (viii) a mineral; (ix) an anabolic nutrient; (x) an antioxidant; (xi) a probiotic bacterial strain; (xii) a lipotropic agent; or (xiii) any combination of (i) to (xii).5. The prebiotic composition of claim 4 , wherein the at least one additive comprises the (i) amino acid claim 4 , the (ii) peptide claim 4 , and/or ...

METHODS AND PRODUCTS TO PROVIDE ORAL NUTRITIONAL CARE TO SUBJECTS WITH DEMENTIA

The present invention provides food products, nutritional programs, and methods for meeting nutritional needs of subjects with dementia and related cognitive disorders. In one embodiment, the invention provides a food product comprising a reversibly sealed container and a soup, wherein the soup is in the container and comprises a total volume of 200-2000 mls, a vegetable or meat component, 300 to 2500 calories, a macronutrient caloric distribution comprising: 20-80% fat, 10-45% protein, and 10-65% carbohydrate, about 2% to about 40% medium chain triglycerides, omega 3 fatty acids in an amount of 100 to 2000 mg and less than 20 solid food particles having a volume greater than about 20 cm. Such food products, when administered to affected subjects, can positively impact (i) nutritional status; (ii) quality of life; (iii) disease course; (v) the demand for assistance from a care giver; (vi) subject compliance with a nutritional plan using the food product, and (vii) ease of monitoring compliance by the caregiver for verification. 1. A product comprising a reversibly closed container and a soup , wherein the soup is in the container and comprises:a. a total volume of 200 to 2000 ml;b. at least one of a vegetable component and a meat component;c. 300 to 2500 calories; i. 20% to 80% fat;', 'ii. 10% to 45% protein; and', 'iii. 10% to 65% carbohydrate; and', 'iv. about 2% to about 40% medium chain triglycerides,, 'd. a macronutrient caloric distribution comprisinge. optionally one or more antioxidants in a total amount of at least 100 mg equivalents of vitamin C by FRSA;f. optionally omega 3 fatty acids in an amount of at least 100 mg; andg. optionally a means for extending the stability of the product.2. The product of comprising omega 3 fatty acids in an amount of 100 to 2000 mg claim 1 , and comprising antioxidants in a total amount of 100 mg to 500 mg equivalents of vitamin C by FRSA.3. The product of wherein the product claim 1 , when provided daily to a subject with ...

COMPOSITION FOR REGENERATING NORMAL TISSUE FROM FIBROTIC TISSUE

The present invention relates to a pharmaceutical composition and a method for regenerating normal tissue from fibrotic tissue, the pharmaceutical composition and the method employing a collagen-reducing substance. In accordance with the present invention, normal tissue can be therapeutically regenerated from fibrotic tissue.

COMPOSITIONS OF NUTRITION SUPPLEMENTATION FOR NUTRITIONAL DEFICIENCIES AND METHOD OF USE THEREOF

A nutritional supplement composition for treating nutritional deficiencies caused by a medical condition in subjects is disclosed. The present application further discloses a method of using a nutritional supplements composition for treating a subject with complications resulting from sickle cell anemia. The method comprises administering to a subject an effective amount of the nutritional supplement. 127.-. (canceled)28. A method for treating conditions associated with abnormally slow energy metabolism or high energy requirement , comprising:administering to a subject in need of such treatment a daily nutritional supplement having total calories of about 700-980 kcal, wherein about 10-20% of the total calories are derived from protein, about 25-40% of the total calories are derived from fat, and about 45-65% of the total calories are derived from carbohydrate.29. The method of claim 28 , wherein the conditions associated with abnormally slow energy metabolism include malnutrition claim 28 , anorexia claim 28 , cancers claim 28 , AIDS and aging.30. The method of claim 28 , wherein the conditions associated with high energy requirement include sickle cell anemia claim 28 , pregnancy claim 28 , lactation claim 28 , growth claim 28 , exercise claim 28 , infectious diseases and recovery from surgical and other injuries.31. The method of claim 30 , wherein the condition associated with high energy requirement is sickle cell anemia.32. The method of claim 28 , wherein the nutritional supplement is administered orally in the form of a snack.33. The method of claim 32 , wherein the nutritional supplement is administered orally as the last snack before sleeping.34. The method of claim 32 , wherein the nutritional supplement is administered as snacks after each meal.35. A nutritional supplement to normal diet for treating conditions associated with abnormally slow energy metabolism or high energy requirement claim 32 , comprising:protein in an amount that provides about 10-20 ...

Treatment of Diseases Using Combination of Ultraviolet Blood Irradiation and Probiotics

A method of and composition for treating a patient having Mycobacterium avium complex (MAC), and in embodiments including Mycobacterium avium subspecies paratuberculosis (MAP) and/or Mycobacterium avium subspecies hominissuis (MAH), causing one or more diseases, one embodiment of the method including administering to the patient an effective amount of one or more probiotics and administering to the patient an effective amount of ultraviolet blood irradiation (UVBI) treatment, and an embodiment of the composition including an effective amount of one or more probiotics and an effective amount of UVBI treated blood of the patient.

POLYTHERAPY MODULATING CATHELICIDIN GENE EXPRTESSION MODULATION FOR THE TREATMENT OF ALZHEIMER'S DISEASE AND OTHER CONDITIONS

A polytherapy of orally available compounds is disclosed that synergistically modulates and induces the expression of the cathelicidin gene (CAMP), which encodes the host defense peptide LL-37. By providing a number of different CAMP-inducing compounds together at the same time, stronger gene induction is achieved than with just one or two compounds, because the mechanism of induction broadens. Induction also may vary in different parts of the body depending on which compounds are used, and at what levels. We show for the first time that the polytherapy can induce cathelicidin expression in the brain, which may help to treat or prevent Alzheimer's Disease. Systemic cathelicidin gene induction may help treat numerous other conditions including Type 2 Diabetes/Metabolic Syndrome, or chronic bacterial, viral, or fungal infections associated with increased cancer risk or neurodegeneration. By increasing cellular autophagy and macroautophagy and supporting mitochondrial biogenesis and homeostasis, CAMP gene upregulation may reduce the effects of cellular aging and increase longevity. 193-. (canceled)94. A method for modulating microglia-mediated neuroinflammation , comprising:monitoring the level of a cytokine in microglia tissues of a subject, wherein the cytokine is selected from the group consisting of TNFα and 11-6; andadministering to the subject a pharmaceutically active composition which reduces the level of the cytokine in the microglia tissues of the subject, wherein the pharmaceutically active composition induces the expression of a physiologically effective binding partner for jβ-amyloid in microglia tissues of the subject.95. The method of claim 94 , wherein said pharmaceutically active composition includes a mixture of at least four materials selected from the group consisting of phenylbutyrate claim 94 , bexarotene claim 94 , curcumin claim 94 , resveratrol claim 94 , retinol claim 94 , phenylbutyrate claim 94 , cholecalciferol claim 94 , fatty acids claim ...

Aqueous Ophthalmic Composition

The present invention relates to an aqueous ophthalmic composition comprising (A) polyoxyethylene castor oil, (B) polyethylene glycol monostearate, and (C) at least one member selected from the group consisting of sesame oil, castor oil, vitamin A, and chlorobutanol. 1. An aqueous ophthalmic composition , comprising (A) polyoxyethylene castor oil , (B) polyethylene glycol monostearate , and (C) at least one member selected from the group consisting of sesame oil , castor oil , vitamin A , and chlorobutanol.2. The aqueous ophthalmic composition according to claim 1 , further comprising (D) a buffer.3. The aqueous ophthalmic composition according to claim 1 , further comprising (E) a surfactant other than components (A) and (B).4. The aqueous ophthalmic composition according to claim 1 , wherein the aqueous ophthalmic composition is eye drops claim 1 , an eye wash claim 1 , a solution for wearing a contact lens claim 1 , or a contact lens care solution.57-. (canceled)8. The aqueous ophthalmic composition according to claim 2 , further comprising (E) a surfactant other than components (A) and (B).9. The aqueous ophthalmic composition according to claim 2 , wherein the aqueous ophthalmic composition is eye drops claim 2 , an eye wash claim 2 , a solution for wearing a contact lens claim 2 , or a contact lens care solution.10. The aqueous ophthalmic composition according to claim 8 , wherein the aqueous ophthalmic composition is eye drops claim 8 , an eye wash claim 8 , a solution for wearing a contact lens claim 8 , or a contact lens care solution.11. The aqueous ophthalmic composition according to claim 1 , wherein total content of component (C) is 0.00002 to 10 claim 1 ,000 parts by weight based on 1 part by weight of total content of component (A).12. The aqueous ophthalmic composition according to claim 1 , wherein total content of component (C) is 0.00002 to 10 claim 1 ,000 parts by weight based on 1 part by weight of total content of component (B).13. The aqueous ...

NUTRITIONAL SUPPLEMENT FOR GROWTH ENHANCEMENT

Provided are nutritional supplements designed for enhancing the growth, particularly the linear growth, of pre-pubertal children with a stature measure short compared to the norm. The nutritional composition includes an energy source, arginine and a combination of micronutrients. 1. A nutritional supplement in a powder form having per 100 g powder a total caloric content of from about 300 kcal to about 500 kcal comprising per 100 g powder arginine in an amount of from about 250 mg to about 1000 mg and a micronutrient combination comprising calcium in an amount of from about 250 mg to about 750 mg; vitamin C in an amount of from about 15 mg to about 350 mg; zinc in an amount of from about 2.0 mg to about 15 mg; iron in an amount of from about 2.0 mg to about 10 mg; vitamin A in an amount of from about 50 μg to about 350 μg; and vitamin D in an amount of from about 2 μg to about 10 μg.2. The nutritional supplement of claim 1 , wherein 40% to 70% of the total caloric content is carbohydrates.3. The nutritional supplement of claim 1 , wherein 10% to 40% of the total caloric content is lipids.4. The nutritional supplement of claim 1 , wherein 10% to 40% of the total caloric content is proteins.5. The nutritional supplement of claim 1 , said supplement comprises per 100 g powder arginine in an amount of from about 500 mg to about 1000 mg; calcium in an amount of from about 300 mg to about 400 mg; vitamin C in an amount of from about 15 mg to about 50 mg; zinc in an amount of from about 2.0 mg to about 5.0 mg; iron in an amount of from about 3.0 mg to about 5.0 mg; vitamin A in an amount of from about 50 μg to about 150 μg; and vitamin D in an amount of from about 2 μg to about 3.5 μg.6. The nutritional supplement of claim 1 , said composition having per 100 g powder a total caloric content of about 420 kcal; arginine in an amount of about 826-992 mg; calcium in an amount of about 413 mg; vitamin C in an amount of about 24-28 mg; zinc in an amount of from about 4 mg; iron ...

MICRO- AND NANO-QUANTITY SLEEP ENHANCING NUTRIENT COMPOSITION AND METHOD OF ENHANCING CENTRAL NERVOUS SYSTEM PROTEIN CLEARANCE USING SAME

The present invention relates to a dietary supplement, composition, nutraceutical, and/or system for inducing or treating biological responses or conditions (namely sleep or sleep disorders) which utilize ultra-low dosage amounts of vitamins, minerals, amino acids, co-enzymes, stimulants, and/or similar ingredients in a highly bio-active delivery system which bypasses first pass metabolism. In particular, the present invention relates to a nutraceutical composition/formulation which substantially bypasses first pass metabolism and such as, but not limited to, activation of the glymphatic system to facilitate clearance of neuronal metabolites from the CSF and interstitial fluids in the brain. 1. A nutraceutical composition comprising micro- or nano-quantities of the following ingredients in an oral preparation suitable for oral administration to a person in need thereof , the ingredients comprising , in combination at least one mineral or salts thereof selected from the group consisting of magnesium , sodium , potassium , calcium , chromium , copper , iron and zinc , at least one vitamin selected from the group consisting of A , B1 , B2 , B3 , B6 , B12 , folic acid , C , D3 , E and H , at least one antioxidant , and at least one amino acid.2. The nutraceutical composition of claim 1 , wherein the at least one mineral further comprises a chloride salt claim 1 , a carbonate claim 1 , an ascorbate claim 1 , a nitrite claim 1 , a picolinate claim 1 , a polynicotinate claim 1 , a benzoate or an iodide.3. The nutraceutical composition of claim 1 , wherein the at least one mineral further comprises claim 1 , in combination claim 1 , magnesium chloride claim 1 , sodium ascorbate claim 1 , sodium nitrite claim 1 , potassium carbonate claim 1 , calcium ascorbate claim 1 , potassium benzoate claim 1 , chromium picolinate claim 1 , chromium polynicotinate claim 1 , potassium sorbate claim 1 , potassium iodide claim 1 , calcium carbonate claim 1 , iron claim 1 , copper and zinc.4 ...

Composition for prevention and/or treatment of chronic inflammation and concomitant biofilms in the gastrointestinal tract

A pharmaceutical or neutraceutical composition for preventing or treating of chronic inflammation and concomitant biofilms in the gastrointestinal tract (GI tract). The multidimensional clinically tested composition accelerates intestinal epithelium recovery and it destabilises Gram-negative bacteria in their habitat, but it also eliminates their LPS molecules, which are highly allergenic. The synergistic composition contains a pharmaceutically effective amount of at least L-glutamine with zinc and vitamine A for recovery of the epithelium cells of the gastrointestinal tract, at least enzymes selected from the group of polysaccharidases, proteases, lipases and/or antioxidants, for decomposing a bio film that is present in the gut, at least one chelator for inorganic components such as iron and at least one binder for organic components originating from the decomposition of the biofilm and/or bacteria. 1. A pharmaceutical composition for use in the treatment of chronic inflammation of the gastrointestinal tract , containing a pharmaceutically effective amount of at least(i) enzymes selected from the group of polysaccharidases, proteases, lipases and/or antioxidant enzymes, capable of decomposing a biofilm that is present in the gut;(ii) at least one chelator, comprising lactoferrin, for binding inorganic components such as iron; and(iii) at least one binder, capable of binding organic components originating from the decomposition of the biofilm and/or bacteria;(iv) glutamine, vitamin A, vitamin D and zinc, for facilitating recovery of mucosa cells of the gut.2. Composition for use according to claim 1 , further comprising chitosan claim 1 , for an antibacterial activity against Gram-negative bacteria.3Rosmarinus officinalis. Composition for use according to claim 1 , further comprising extract claim 1 , for reducing activity and adhesion of the biofilm.4. Composition for use according to claim 1 , wherein the binder comprises at least one binder capable of binding ...

Nanosized carotenoid cyclodextrin complexes

Methods for the preparation of nanosized nutrient formulations for enhanced absorption of nutritional agents. The methods include the complexation of cyclodextrin with carotenoids and incorporation of the complexes into the nutritional supplements without intermediate collection, isolation, and drying steps.

MATERIAL AND METHOD FOR TREATING INTERNAL CAVITIES

Disclosed herein are materials, means and methods for sustained release of therapeutic agents for topical treatments. In particular, disclosed are means and methods for topical treatment of diseases of internal body cavities by embedding therapeutic agents in a slowly degrading biocompatible mixture applied to affected tissue. 115.-. (canceled)17. The method according to claim 16 , wherein said step of incorporating is performed up to two weeks claim 16 , preferably up to 48 hours claim 16 , and most preferably up to 24 hours prior to said step of applying.18. The method according to claim 16 , wherein said disorder is selected from the group consisting of urinary incontinence or urge due to unstable bladder or unstable detrusor sphincter; voiding complications; spinal cord injury; stroke or multiple sclerosis; bladder pathologies wherein a spasms are involved; interstitial cystitis; stress incontinence; urge incontinence; and neurogenic bladder.19. The method according to claim 17 , wherein said disorder is selected from the group consisting of urinary incontinence or urge due to unstable bladder or unstable detrusor sphincter; voiding complications; spinal cord injury; stroke or multiple sclerosis; bladder pathologies wherein a spasms are involved; interstitial cystitis; stress incontinence; urge incontinence; and neurogenic bladder.20. The method according to claim 16 , wherein the pharmaceutically active agent is selected from the comprising about 0.2-20 U/kg body weight of botulinum toxin; preferably about 1.5-15.0 U/kg body weight of botulinum toxin; and more preferably about 2.0-7.0 U/kg body weight of botulinum toxin.21. The method according to claim 16 , wherein said step of applying comprises:instilling topically into said urinary tract said biocompatible mucoadhesive thermoreversible hydrogel at a temperature at which said hydrogel is liquid; and,allowing said biocompatible mucoadhesive thermoreversible hydrogel to gel at body temperature while in contact ...

Treatment or prevention of surgery-induced cachexia and/or expression of myeloid-derived suppressor cells and pro-inflammatory cytokines

A specialized immunonutrition supplement can be administered to a surgical patient to reduce post-operative complications by restraining the expansion of myeloid-derived suppressor cells. The supplement includes one or more of L-arginine, omega-3 fatty acids, vitamin A, and dietary nucleotides, preferably all four of these compounds. The supplement is administered to the patient at least once per day for a time period extending from a pre-operative day that is three to seven days prior to a bladder surgery of the patient to a post-operative day that is three to seven days after the bladder surgery. The supplement can be administered to treat or prevent post-operative paralytic ileus in a bladder cancer patient; treat or prevent surgery-induced, inflammation-induced or cancer-induced cachexia; reduce the incidence of chronic infections resulting from expansion of myeloid-derived suppressor cells in a patient; and/or reduce mRNA expression of pro-inflammatory cytokines in a patient.

MATERIALS AND METHODS FOR STOPPING RESPIRATORY VIRUS INFECTIONS

The subject invention pertains to the use of zinc, zinc ionophore, one or more vitamins, folate, selenium, garlic, and/or Echinacea as a treatment of viral infections, and the training needed for subjects to recognize such symptoms to be able to stop respiratory viral infections including colds flu and coronavirus, or to prevent respiratory virus infections, such as SARS-CoV-2 infections. The subject invention further pertains to pharmaceutical compositions, packaged dosage formulations, and kits for stopping respiratory virus infections, or for preventing respiratory virus infections in contact subjects that might have such infections. 1. A method for treating or preventing an upper respiratory viral infection , or a symptom thereof , in a human subject , said method comprising administering to the subject an initial Round 1 treatment comprising:i) First, drinking 8 to 16 ounces of water rapidly;{'sub': 3', '6', '12, 'ii) Second, dissolving in the mouth about 18.3 mg of zinc, together with elderberry fruit extract blend, about 300 μg vitamin A, about 500 mg vitamin C, about 20 μg vitamin D, about 15 mg vitamin E, about 1.7 mg vitamin B, about 2.4 μg vitamin B, about 666 μg folate, and about 15 μg selenium; and'}iii) Third, swallowing with a liquid about 800 mg Echinacea, about 4000 mg garlic allicin, and about 335 mg elderberry fruit extract after ingredients of step ii) have dissolved.2. The method of claim 1 , wherein claim 1 , if after the initial treatment of Round 1 claim 1 , a symptom of viral infection persists claim 1 , the method further comprises:iv) Fourth, repeating steps i), ii) and iii) of Round 1 one-time, two-times, or three-times within about three hours to about six hours of the initial step i).3. The method of claim 2 , wherein claim 2 , if after step iv) a symptom of viral infection persists claim 2 , the method further comprises administering an initial Round 2 treatment claim 2 , approximately 4 hours to approximately 18 hours after the ...

Composition comprising angiotensin ii receptor antagonist and antioxidant for maintaining and/or improving skin properties

The present invention relates to a topical composition comprising at least one angiotensin II receptor antagonist and at least one antioxidant.

COMPOSITION FOR PREVENTING OR TREATING MUSCLE DISEASES, COMPRISING SUBERIC ACID OR PHARMACEUTICALLY ACCEPTABLE SALT THEREOF AS ACTIVE INGREDIENT

The present invention relates to a composition for preventing or treating a muscular disease or improving muscle function. The composition includes suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient. 1. A method for preventing or treating a muscular disease , the method comprising: administering a composition which comprises suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient to a subject in need thereof.2. The method of claim 1 , wherein the composition increases the expression of a p-4E-BP1 or p-p70S6K1 protein in the subject in need thereof.3. The method of claim 1 , wherein the composition decreases the expression of MuRF1(Muscle Ring-Finger Protein) or MaFbx(Muscle atrophy F-box) in the subject in need thereof.4. The method of claim 1 , wherein the muscular disease is a muscular disease caused by muscle dysfunction claim 1 , a decrease in muscle mass claim 1 , muscle wasting claim 1 , or muscle degeneration.5. The method of claim 1 , wherein the muscular disease comprises one or more selected from the group consisting of atony claim 1 , muscular atrophy claim 1 , muscular dystrophy claim 1 , myasthenia claim 1 , cachexia claim 1 , rigid spine syndrome claim 1 , amyotrophic lateral sclerosis (Lou Gehrig's disease) claim 1 , Charcot-Marie-Tooth disease claim 1 , and sarcopenia.6. The method of claim 1 , wherein the composition is a pharmaceutical composition claim 1 , a health functional food composition claim 1 , or a livestock feed composition.7. A method for promoting muscle differentiation or regenerating or strengthening muscles claim 1 , the method comprising: administering a composition claim 1 , which comprises suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient to a subject in need thereof.8. The method of claim 7 , wherein the composition is a pharmaceutical composition claim 7 , a health functional food composition claim 7 , or a livestock feed composition.910 ...

Composition for the treatment of type i allergic hypersensitivities by immune desensitization through slit immunotherapy with unadulterated allergen, vitamin a, vitamin d and an immuno-effective amount of adjuvant of essential oils

In one embodiment, the invention provides a composition that includes therapeutically effective amount of any unadulterated pollen listed in FIG. 1. The invention is comprised of specific mass(es) of the unadulterated pollen composition of one or multiple pollens per daily dose, a range of mass of vitamin A, a range of mass of vitamin D, and an immune-effective amount of an adjuvant comprised of one or more of the essential oils Eucalyptol, Thymus, Oregano, Bergamot, Fennel, Tea Tree, Peppermint, Fennel, Cinnamon and Clove. The duration of the therapeutically effective amount of unadulterated pollen will preferably be administered 0-52 weeks prior to exposure to the allergen and for a period of 6-8 weeks. It could also be administered as a maintenance treatment during the allergic exposure and for multiple years. In some embodiments, the invention provides a method for treating allergies.

COMBINATION OF ANTI-FGFR4-ANTIBODY AND BILE ACID SEQUESTRANT

The present invention relates to the amelioration of toxic effects that are caused by therapies aimed at FGFR4-inhibition. In particular, the invention relates to the combination of FGFR4 inhibitors and agents capable of reducing bile acid levels and to the use thereof in the treatment of diseases. 117-. (canceled)18. A method for preventing , alleviating , or treating a disease selected from a hyperproliferative disorder , a cardiovascular disease , in hypertension left ventricular hypertrophy , heart hypertrophy , a chronic kidney disease , muscular dystrophy , a metabolic disease , obesity , and diabetes , said method comprising administrating an effective amount of an FGFR4 inhibitor combination comprising an anti-FGFR4 antibody in co administration combination with a bile acid sequestrant , to a subject in need thereof.19. The method of claim 18 , wherein the anti-FGFR4 antibody comprises a heavy chain comprising a CDRH1 as shown in SEQ ID NO: 3 claim 18 , a CDRH2 as shown in SEQ ID NO: 8 and a CDRH3 as shown in SEQ ID NO: 15 and a light chain comprising a CORL 1 as shown in SEQ ID NO: 23 claim 18 , a CDRL2 as shown in SEQ ID NO: 25 and a CDRL3 as shown in SEQ ID NO: 30.20. The method of or claim 18 , wherein the hyperproliferative disorder to be treated is cancer claim 18 , selected from the group consisting of hepatocellular carcinoma claim 18 , rhabdomyosarcoma claim 18 , soft tissue sarcoma claim 18 , head and neck squamous carcinoma claim 18 , lung adenocarcinoma claim 18 , kidney cancer claim 18 , bladder cancer claim 18 , brain cancer claim 18 , esophagus cancer claim 18 , gastric cancer claim 18 , pancreas cancer claim 18 , small intestine cancer claim 18 , colon cancer claim 18 , breast cancer claim 18 , lung cancer claim 18 , liver cancer claim 18 , spleen cancer claim 18 , thyroid cancer claim 18 , pituitary cancer claim 18 , adrenal cancer claim 18 , ovarian cancer claim 18 , cervix cancer claim 18 , testis cancer claim 18 , prostate cancer claim 18 ...

NUTRITIONAL COMPOSITIONS

In some aspects, the disclosure relates to compositions useful for the dietary management of inborn errors of metabolism (e.g., PKU, MSUD, HCU, IVA, and MMA/PA). In some embodiments, the disclosure provides a composition comprising a protein source, a fat source, a carbohydrate source, at least one vitamin, and at least one mineral, wherein the protein source comprises at least six free amino acids. In some aspects the disclosure relates to compositions that support bone health. 1. A composition comprising: Vitamin D , calcium , phosphorus , zinc , magnesium , and Vitamin K , wherein the Vitamin D is between about 500 IU and about 770 IU of the total weight of the composition , calcium is between about 36% and about 56% of the total weight of the composition , phosphorus is between about 31% and about 48% of the total weight of the composition , zinc is between about 0.25% and about 0.40% of the total weight of the composition , magnesium is between about 8% and about 13% of the total weight of the composition , and Vitamin K is between about 1.2% and about 3.5% of the total weight of the composition.2. A composition comprising Vitamin D , calcium , phosphorus , zinc , magnesium , and Vitamin K , wherein in about 1.5 g to about 4.0 g of composition , Vitamin D is between about 500 IU and 770 IU , calcium is between about 500 mg and about 840 mg , phosphorus is between about 475 mg and about 720 mg , zinc is between about 4 mg and about 6 mg , magnesium is between about 125 mg and about 195 mg , and Vitamin K is between about 20 μg and about 50 μg.34-. (canceled)5. The composition of claim 1 , further comprising inulin.6. (canceled)7. The composition of claim 5 , wherein from about 0 g to about 2.5 g inulin is present in 3.5 g of the composition.89-. (canceled)10. A composition comprising a composition of and a protein source claim 1 , wherein Vitamin D is between about 500 IU per 20 g Protein Equivalent (PE) and 770 IU per 20 g PE claim 1 , calcium is between about ...

Topical formulation

A formulation for topical dermatological delivery of a medicinal or cosmeceutical or cosmetic active including a functional co-enhancer delivery system. The delivery system generally comprises a water-miscible solvent and C 12 or C 14 fatty acids or C 14 alcohol in combination with a hydrocarbyl methyl siloxane emollient.

Treatment of Diseases Using Combination of Ultraviolet Blood Irradiation and Antibiotics

A method of and composition for treating a patient having complex (MAC), and in one embodiment subspecies (MAP), causing one or more diseases, an embodiment of the method including administering to the patient an effective amount of one or more antibiotics and administering to the patient an effective amount of ultraviolet blood irradtiation (UVBI) treatments, and an embodiment of the composition including an effective amount of one or more antibiotics and an effective amount of UVBI treated blood of the patient. 1Mycobacterium aviumparatuberculosis. A composition for treating a patient having subspecies (MAP) causing one or more autoimmune diseases , comprising:an effective amount of one or more antibiotics; andan effective amount of ultraviolet blood irradiation (UVBI) treated blood of the patient.2. The composition of claim 1 , wherein the one or more antibiotics comprise one or more of clarithromycin claim 1 , azithromycin claim 1 , rifampicin claim 1 , rifabutin claim 1 , clofazimine claim 1 , ciprofloxacin claim 1 , and m etronidazole.3. The composition of claim 2 , further comprising at least one of Vitamin A and Vitamin D.4. The composition of claim 1 , wherein the one or more antibiotics comprise clarithromycin.5. The composition of claim 4 , wherein the one or more antibiotics further comprise at least one of rifabutin and rifampin.6. The composition of claim 5 , wherein the one or more antibiotics further comprise at least one of ciprofloxacin and levofloxacin.7. The composition of claim 1 , wherein the one or more autoimmune diseases comprise one or more of Crohn's disease claim 1 , ulcerative colitis claim 1 , type 1 diabetes mellitus claim 1 , multiple sclerosis claim 1 , complex regional pain syndrome claim 1 , hypothyroidism claim 1 , idiopathic thrombocytopenic purpura claim 1 , lymphangiomatosis claim 1 , sarcoidosis claim 1 , Sjogren's disease claim 1 , myasthenia gravis claim 1 , scleroderma claim 1 , systemic lupus erythematosis claim 1 , ...

COMPOSITION FOR PREVENTING, ALLEVIATING OR TREATING BURNOUT SYNDROME

The present specification relates to a composition for preventing, alleviating or treating burnout syndrome, containing a natural extract as an active ingredient. According to one aspect of the present invention, the composition contains a fruit extract, and thus is useful for preventing, treating and alleviating burnout syndrome. In addition, according to one aspect of the present invention, the composition further contains fruit and one or more selected from the group consisting of red , and , so as to maximize the synergistic effect among two or more ingredients, thereby exhibiting excellent effects on the prevention, treatment and alleviation of burnout syndrome. Therefore, there is an advantage of making individuals and society mentally and physically healthy since burnout syndrome can be prevented, treated and alleviated, by using the composition of the present invention. 1ginseng. A method for preventing or improving burnout syndrome , comprising administering an effective amount of a berry extract to a subject in need thereof.2. (canceled)3ginseng. The method according to claim 1 , wherein the composition comprises 0.01-70 wt % of the berry extract based on the total weight of the composition.4ginseng. The method according to claim 1 , wherein the berry extract comprises 8.0-30.0 wt % of ginsenoside Re based on the total weight of the composition.5ginseng. The method according to claim 4 , wherein the berry extract comprises each 0.1-10 wt % of a ginsenoside Rb1 claim 4 , a ginsenoside Rb2 claim 4 , a ginsenoside Rb3 claim 4 , a ginsenoside Rc claim 4 , a ginsenoside Rd claim 4 , a ginsenoside Rg1 or a ginsenoside Rg2 based on the total weight of the composition.6ginseng. The method according to claim 1 , wherein the berry extract comprises 23-80 wt % of total ginsenosides.7ginseng. The method according to claim 1 , wherein a ratio of PD ginsenosides to PT ginsenosides in the berry extract is 0.63-1.5.8ginsengangelica. The method according to claim 1 , ...

DRY GLASSY COMPOSITION COMPRISING A BIOACTIVE MATERIAL

The present invention relates to formulations and methods for stabilizing and protecting of biologic materials during harsh storing and use conditions, wherein the formulations relate to embedded bioactive materials and biologics, including live bacteria, in a protective glassy matrix. 1. A composition , comprising a bioactive material , at least one matrix forming agent and at least two glass forming agents.2. The composition of claim 1 , wherein the composition is a dry glassy composition comprising a bioactive material3. The composition of claim 1 , wherein the formulation comprises total solids ranging from about 30 weight percent to about 70 weight percent.4. The composition of claim 1 , wherein the bioactive material comprises a cell claim 1 , a microbe claim 1 , a virus claim 1 , a cell culture claim 1 , a bacteria claim 1 , a probiotic bacteria claim 1 , a plant and soil probiotic bacteria claim 1 , a yeast claim 1 , a protein claim 1 , a recombinant protein claim 1 , an enzyme claim 1 , a peptide claim 1 , a hormone claim 1 , a vaccine claim 1 , a drug claim 1 , an antibiotic claim 1 , a vitamin claim 1 , a carotenoid claim 1 , a mineral claim 1 , a microbiocide claim 1 , a fungicide claim 1 , a herbicide claim 1 , an insecticide or a spermicide.5. The composition according to wherein the matrix forming agent is a polysaccharide selected from the group consisting of: cellulose acetate phthalate (CAP) claim 1 , carboxy-methyl-cellulose claim 1 , pectin claim 1 , sodium alginate claim 1 , salts of alginic acid claim 1 , hydroxylpropyl methyl cellulose (HPMC) claim 1 , methyl cellulose claim 1 , carrageenan claim 1 , guar gum claim 1 , gum acacia claim 1 , xanthan gum claim 1 , locust bean gum claim 1 , chitosan and chitosan derivatives claim 1 , starches and modified starches claim 1 , cyclodextrins claim 1 , inulin claim 1 , maltodextrins claim 1 , dextrans claim 1 , and combinations thereof.6. The composition of claim 1 , wherein the matrix forming agent is ...

Capsule, Tablet or Pill

Disclosed is a capsule, tablet or pill comprising a formulation at least two of the fat-soluble vitamins vitamin A, vitamin D, vitamin E and vitamin K; and one or more kinds of medium-chain triglyceride; also disclosed are foods, drinks and pharmaceutical compositions comprising the capsule, tablet or pill; and methods of treatment of a patient comprising administration of an effective amount of the capsule, tablet or pill. The capsule, tablet or pill is particularly, but not exclusively, suitable for use in treating cystic fibrosis patients.

HIGH-DOSE ANTIOXIDANTS IN CANCER TREATMENT

This invention proposes that a mixture of high doses of multiple antioxidants in combination with therapeutic agents may improve the management of cancer without toxicity. 1. A composition comprising at least one antioxidant , at least one vitamin , at least one phytonutrient , and at least one mineral.2. The composition of wherein said antioxidant is selected of a group comprising of R-alpha-lipoic acid claim 1 , Coenzyme Q10 claim 1 , Vitamin A claim 1 , Vitamin C claim 1 , Vitamin E and combinations thereof.3. The composition of wherein said vitamin is selected from a group comprising of Vitamin D3 claim 1 , Vitamin B1 claim 1 , methylfolate Vitamin B2 claim 1 , Vitamin B3 claim 1 , Vitamin B5 claim 1 , Vitamin B6 claim 1 , Vitamin B9 claim 1 , Vitamin B12 and combinations thereof.4. The composition of wherein said phytonutrient is selected from a group comprising of curcumin claim 1 , resveratrol claim 1 , Quercetin and combinations thereof.5. The composition of wherein said mineral is selected form a group comprising selenomethanine claim 1 , zinc glycinate and combinations thereof.6. The composition of wherein said composition comprises from about 1.8 mg to about 20 claim 1 ,000 mg of said antioxidant.7. The composition of wherein said composition comprises from about 8 mcg to about 1800 mcg of said vitamin.8. The composition of wherein said composition comprises from about 800 mg to about 2 claim 1 ,000 mg of said phytonutrient.9. The composition of wherein said composition comprises from about 50 mcg to about 40 claim 1 ,000 mcg of said mineral.10. The composition of having from about 6 claim 2 ,000 IU to about 25 claim 2 ,000 IU of Vitamin A.11. The composition of wherein said Vitamin A is retinyl palmitate.12. The composition of having from about 5 claim 2 ,000 IU to about 20 claim 2 ,000 mg of Vitamin C.13. The composition of wherein said Vitamin C is calcium ascorbate.14. The composition of having from about 3 claim 3 ,000 IU to about 12 claim 3 ,000 IU ...

COMPOSITIONS FOR MANAGEMENT OF DISORDERS OF THE GASTROINTESTINAL TRACT

Effective and economical compositions and methods are disclosed for the treatment, and prevention of diseases and disorders associated with inflammation and/or damage to the gastrointestinal tract, including environmental enteric dysfunction. Compositions are provided comprising a synergistic combination of colostrum, immune egg, and optionally one or more additional active agents. 133-. (canceled)34. A method of treating or preventing a disease or disorder associated with inflammation or damage of the gastrointestinal tract in a subject in need thereof , the method comprising administering a non-neonate human effective amount of a composition comprising:a) an immune egg antibody product comprising at least one specific avian antibody, or antigen binding fragment thereof, that specifically binds to an antigenic region of a pathogenic component selected from a pathogenic organism, a pathogen-related toxin, a pathogen-related adhesion element, or combinations thereof; andb) a bovine colostrum.35. The method of claim 34 , wherein the method further comprises co-administering an effective amount of additional active agent.36. The method of wherein the composition further comprises an additional active agent.37. The method of claim 34 , wherein the disease or disorder is selected from the group consisting of environmental enteric disorder (EED) claim 34 , tropical sprue claim 34 , severe acute malnutrition claim 34 , inflammatory bowel disease claim 34 , irritable bowel syndrome claim 34 , non-steroidal antiinflammatory drug (NSAID) gastrointestinal disorder claim 34 , chemotherapy-induced mucositis claim 34 , radiation-induced mucositis claim 34 , pseudomembranous colitis claim 34 , gastritis claim 34 , peptic ulcers claim 34 , and necrotizing entercolitis.38. The method of claim 37 , wherein the inflammatory bowel disease is ulcerative colitis claim 37 , indeterminate colitis claim 37 , or Crohn's disease.39. The method claim 34 , wherein the subject is a non-neonate ...

SYMBIOTIC SUPPLEMENT FORMULATION FOR IMPROVING INTESTINAL MICROBIOTA

Described is a symbiotic formulation for the oral consumption of probiotics and prebiotics with an aqueous extract of roselle, with vitamins and proteins for humans. The invention belongs to the field of nutrition and has been developed to help to maintain a healthy digestive system by restoring and/or improving the intestinal microbiota. The purpose of the antioxidants and the synergic effect of the symbiotic formulation is to reduce the inflammatory process so as to facilitate the absorption of nutrients and thus improve the good nutritional state of people. An oral symbiotic formulation based on an aqueous roselle extract with encapsulated probiotics and which can contribute to the consumption of antioxidants of natural origin, the ingestion of proteins and micronutrients for re-establishing or improving the state of the intestinal microbiota, as well as the nutritional state of adults and older people, has not been found in the prior art. 1. A food supplement formulation to be administered orally in humans with a symbiotic effect to improve the nutritional state and to be used to maintain the intestinal microbiota characterized in that each 100 g comprises:{'i': 'Hibiscus sabdariffa', 'i. Aqueous extract of roselle (): 90 ml'}ii. Prebiotic (agave inulin): 40 giii. Encapsulated probiotic mixture: 500 mg of probiotics:a. A formulation encapsulated in a polymer matrix of sodium alginate for oral administration to adults of an aqueous extract of roselle of natural origin which contains:iv. Protein: range 3.3g -20 gv. Caloric value: 200-267 kcalvi. Sodium: 70 mgvii. Potassium: <10 mgviii. Mixture of micronutrients:ix. It may also contain up to 8 g of agar as a thickener. The present invention relates to the field of medicine and nutrition, specifically to a formulation characterized in that it is a source of probiotics, prebiotics, vitamins and proteins with antioxidants from an aqueous extract of roselle to assist in the preservation of intestinal microbiota, ...

METHODS OF TREATING DISEASES ASSOCIATED WITH HIGH-FAT DIET AND VITAMIN A DEFICIENCY USING RETINOIC ACID RECEPTOR AGONISTS

This invention relates to pharmaceutical composition and methods of using vitamin A and/or RARβ agonist for the treatment or prevention of diseases or conditions associated with high fat diet and/or vitamin deficiency. 1. A method of treating or preventing a pancreatic disease in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).2. The method of claim 1 , wherein said pancreatic disease is associated with obesity.3. The method of claim 1 , wherein said pancreatic disease is caused by a high fat diet.4. The method of claim 1 , wherein said pancreatic disease is diabetes.5. The method of claim 1 , wherein said diabetes is type I or type II diabetes claim 1 , or gestational diabetes.6. The method of claim 1 , wherein said pancreatic disease is associated with reduced vitamin A level in the pancreas.7. A method of treating or preventing the degeneration of pancreatic beta cells in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).8. A method of maintaining or improving the function of pancreatic beta cells in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).9. A method of maintaining or improving pancreatic insulin secretion in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).10. A method of maintaining or improving insulin sensitivity in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).11. A method of maintaining or improving the level of glucagon in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).12. A method of treating or preventing fat deposit in a subject comprising administering to said subject vitamin .A or an agonist of retinoic acid receptor-beta (RARβ).13. A method of treating or ...

ENCAPSULATION OF HYDROPHOBIC BIOLOGICALLY ACTIVE COMPOUNDS

A composition comprising hydrophobic droplets coated by a shell and dispersed in a matrix and a consumable product comprising the composition are provided. The hydrophobic droplets comprise a hydrophobic compound, the shell comprises an irreversibly denatured protein, and the matrix comprises a protein, a starch, and a polysaccharide. Also provided are methods for preparing the composition and the consumable product. 1. A composition comprising hydrophobic droplets coated by a shell and dispersed in a matrix , wherein the hydrophobic droplets comprise a hydrophobic compound , wherein the shell comprises an irreversibly denatured protein , wherein the matrix comprises a protein , a starch , and a polysaccharide , and wherein the composition comprises less than 20 wt % water.2. The composition of claim 1 , wherein the hydrophobic compound is a bioactive agent selected from the group consisting of vitamins claim 1 , antibiotics claim 1 , carotenoids claim 1 , plant extracts claim 1 , fruit extracts claim 1 , vegetable extracts claim 1 , antioxidants claim 1 , lipids claim 1 , steroids claim 1 , phytochemicals and drugs.3. The composition of claim 1 , wherein the irreversibly denatured protein is prepared by applying two different external stressors claim 1 , wherein each external stressor is selected from the group consisting of an acid claim 1 , a base claim 1 , an inorganic salt claim 1 , an enzyme claim 1 , an organic solvent claim 1 , heat and sheer force claim 1 , and a combination thereof.4. The composition of claim 1 , wherein the hydrophobic droplets have a particle size within the range of 0.1 μm to 5.0 μm.5. The composition of claim 1 , wherein the ratio between the irreversibly denatured protein and the hydrophobic droplet is within the range of 0.1:1 to 1:1 by weight.6. The composition of claim 1 , wherein the protein is a globular or randomly coiled protein.7. The composition of claim 6 , wherein the globular or randomly coiled protein is selected from the ...

Composition and method for treation oligoovulation, oligomenorrhea and amenorhea

A kit for treating Oligoovulation and/or Oligomenorrhea and/or Amenorrhea comprising a menstruation inducing composition comprising effective amounts of Vitamin A, Vitamin C, Vitamin D, Vitamin E, Vitamin B-1, Vitamin B-2, Vitamin B-3, Vitamin B-5, Vitamin B-6, Vitamin B-7, Vitamin B-9, Vitamin B-12, Iron, Iodine, Magnesium, Zinc, Selenium, Copper, Manganese, Chromium, Molybdenum, Boron, and Choline; and an ovulation regulating composition comprising effective amounts of calcium citrate, and magnesium citrate/aspartate. 1. A kit for treating a condition selected from the group consisting of Oligoovulation or Oligomenorrhea , or Amenorrhea and combinations thereof comprising: 'an effective amount of each of the following: Vitamin A, Vitamin C, Vitamin D, Vitamin E, Vitamin B-1, Vitamin B-2, Vitamin B-3, Vitamin B-5, Vitamin B-6, Vitamin B-7, Vitamin B-9, Vitamin B-12, Calcium, Iron, Iodine, Magnesium, Zinc, Selenium, Copper, Manganese, Chromium, Molybdenum, Boron and Choline; and', 'a menstruation inducing composition comprising'}an ovulation regulating composition comprising an effective amount of each of calcium citrate, and magnesium citrate/aspartate.2. The kit according to wherein the menstruation inducing composition comprises:approximate amount per serving of each of 4500 IU Vitamin A, 120 mg Vitamin C, 400 IU Vitamin D, 30 IU Vitamin E, 1.40 mg Vitamin B-1, 1.60 mg Vitamin B-2, 18.00 mg Vitamin B-3, 7.00 mg Vitamin B-5, 10.00 mg Vitamin B-6, 35.00 mcg Vitamin B-7, 1000.00 mcg Vitamin B-9, 8.00 mcg Vitamin B-12, 600.00 mg Calcium, 18.00 mg Iron, 290.00 mcg Iodine, 200.00 mg Magnesium, 15.00 mg Zinc, 70.00 mcg Selenium, 1.30 mg Copper, 2.60 mg Manganese, 45.00 mcg Chromium, 50.00 mg Molybdenum, 150.00 mcg Boron, and 550.00 mcg Choline.3. The kit according to wherein the ovulation regulating composition comprises:approximate amount per serving of each of 100.00 mg Calcium Citrate, and 50.00 mg Magnesium Citrate/Aspartate.4. The kit according to wherein the ...

Formulations that Provide Support During Vaccinations and Adaptive Immune System Response

The present invention provides formulations that support an individuals body during routine vaccination and adaptive immune response. The individuals who can benefit front these formulations are infants, children and adults. The formulations comprise ingredients that can be administered prior to, concurrent with or subsequent to the vaccination. The formulations of the present invention preferably act by targeting enzymatic reactions an individual's various metabolic pathways, maintaining balance between oxidative stress and methylation, maintaining balance between Th1 and Th2 responses, or a combination thereof during vaccination and adaptive immune response. 1. A formulation , comprising:thiamine (Vitamin B1), a derivative thereof or an analog thereof; riboflavin (Vitamin B2a derivative thereof or an analog thereof, niacin (Vitamin B3), a derivative thereof or an analog thereof; pantothenic acid (Vitamin B5), a derivative thereof or an analog thereof; Vitamin B6, a derivative thereof or an analog thereof; folate (Vitamin B9), a derivative thereof or an analog thereof; cobalamin (Vitamin B12), a derivative thereof or an analog thereof; Vitamin A, a derivative thereof or an analog thereof; Vitamin D, a derivative thereof or an ,analog thereof; Vitamin F. derivative thereof or an analog thereof; Vitamin C, a derivative thereof or an analog thereof; Vitamin K, a derivative thereof or an analog thereof; calcium, a derivative thereof or an analog thereof; iodine, a derivative thereof or an analog thereof; magnesium, a derivative thereof or an analog thereof; zinc, a derivative thereof or an analog thereof; selenium, a derivative thereof or an analog thereof; manganese, a derivative thereof or an analog thereof; chromium, a derivative thereof or an analog thereof; molybdenum, a derivative thereof or an analog thereof; trimethylglycine (betaine), a derivative thereof or analog thereof; choline, a derivative thereof or an analog thereof; acetyl-L-carnitine, a derivative ...

TRANSMUCOSAL AND TRANSDERMAL DELIVERY SYSTEMS

Provided herein are transmucosal and transdermal delivery systems comprising: at least one non-ionic surfactant; at least one polyol; and at least one active agent; and optionally further comprising at least one oil. In particular embodiments, the delivery system has an average particle size of from about 5 nm to about 200 nm. 1. A transmucosal and/or transdermal delivery system comprising:at least one non-ionic surfactant;at least one polyol; andat least one active agent.2. The delivery system of claim 1 , wherein the delivery system is delivered vial the oral mucosa.3. The delivery system of claim 1 , wherein the delivery system is delivered vial the nasal mucosa.4. The delivery system of any one of to claim 1 , further comprising at least one oil.5. The delivery system of claim 4 , wherein the at least one oil is ethyl oleate claim 4 , ethyl linoleate claim 4 , caproic acid claim 4 , caprylic acid claim 4 , capric acid claim 4 , or lauric acid claim 4 , or a combination thereof.6. The delivery system of claim 5 , wherein the at least one oil is a natural oil or is derived from a natural oil.7. The delivery system of claim 6 , wherein the natural oil is coconut oil claim 6 , palm kernel oil claim 6 , palm oil claim 6 , lemon oil claim 6 , or sunflower oil claim 6 , or a combination thereof.8. The delivery system of any one of to claim 6 , wherein the at least one non-ionic surfactant is selected from the group consisting of a polyethoxylated castor oil claim 6 , polyoxyethylene sorbitan monolaurate claim 6 , polyoxyethylene sorbitan monoleate claim 6 , tocopheryl polyethylene glycol succinate and mixtures thereof.9. The delivery system of any one of to claim 6 , wherein the at least one non-ionic surfactant is a polyethoxylated castor oil.10. The delivery system of any one of to claim 6 , wherein the at least one non-ionic surfactant is obtained by reacting castor oil or hydrogenated castor oil with ethylene oxide.11. The delivery system of any one of to claim 6 , ...