ПОЛИМЕРНЫЕ НАНОЧАСТИЦЫ, ПОКРЫТЫЕ ОКСИДОМ МАГНИТНОГО МЕТАЛЛА, И ИХ ПРИМЕНЕНИЕ

Изобретение относится к наночастицам для доставки лекарственного вещества, причем наночастицы состоят из хелатирующего металл полимера, и активного агента, представляющего собой родственный TNF лиганд, индуцирующий апоптоз (TRAIL), где активный агент ковалентно связан с полимером. Изобретение также относится к фармацевтической композиции для индуцирования апоптоза в раковой клетке, уменьшения роста опухоли и/или ингибирования роста опухоли, которая включает указанные наночастицы и фармацевтически приемлемый носитель. Заявлен также способ приготовления наночастицы, который включает смешивание водного раствора хелатирующего металл полимера с растворимой солью металла, оксидирование ионов металла и образование наночастицы путем доведения pH до основного. Далее повторяют стадии добавления металла, оксидирования и доведения раствора до основного pH. Затем проводят функционализацию наночастицы и ее контактирование с TRAIL с последующим блокированием остающихся активных сайтов на поверхности наночастицы ...

МАГНИТНАЯ НАНОЧАСТИЦА ДЛЯ ЛЕЧЕНИЯ И/ИЛИ ПРОФИЛАКТИКИ РАКА, НА ЕЕ ОСНОВЕ ИНФУЗИОННЫЙ РАСТВОР И ФАРМАЦЕВТИЧЕСКАЯ КОМПОЗИЦИЯ

Группа изобретений относится к медицине и касается магнитных наночастиц для лечения и/или профилактики рака, выполненных из оксидов железа или чистого железа, содержащего оксидный слой, где по меньшей мере одно терапевтически активное вещество связано с указанными частицами. При этом высвобождение по меньшей мере одного терапевтически активного вещества вызывается или инициируется, или существенно ускоряется переменным магнитным полем. Группа изобретений обеспечивает уменьшение неконтролируемого высвобождения терапевтически активных веществ во время транспортировки наночастиц к раковым клеткам. 3 н. и 10 з.п. ф-лы. 11 пр.

БИОКОМПОЗИТ ДЛЯ ОБЕСПЕЧЕНИЯ ВОССТАНОВИТЕЛЬНЫХ ПРОЦЕССОВ ТКАНЕЙ И ОРГАНОВ ПОСЛЕ ПОВРЕЖДЕНИЯ, НАБОР ДЛЯ ЕГО ИЗГОТОВЛЕНИЯ, СПОСОБ ЕГО ПОЛУЧЕНИЯ (ВАРИАНТЫ) И ПРИМЕНЕНИЯ БИОКОМПОЗИТА

... 1. Биокомпозит для обеспечения восстановительных процессов после повреждения у млекопитающего, состоящий из носителя и, по меньшей мере, одной нуклеиновой кислоты, отличающийся тем, что дополнительно содержит клетки, обеспечивающие репаративную регенерацию.2. Биокомпозит по п.1, отличающийся тем, что носитель может быть твердым органической или неорганической природы: металлический, коллагеновый, хитозановый, кальцийфосфатный, гидроксиапатитовый, биокерамический, биостеклянный, алюминатный материал, очищенные белки, продукты внеклеточного матрикса или их комбинации.3. Биокомпозит по п.1, отличающийся тем, что носитель может быть жидким: 0,9% раствор NaCL, растворы декстранов, солевые растворы, растворы гиалуроновой и хондроитинсерной кислот.4. Биокомпозит по п.1, отличающийся тем, что носитель может быть: коллагеновый, альгинатный, желатиновый гель, золь, мазь, крем или их комбинации.5. Биокомпозит по п.1, отличающийся тем, что носитель содержит твердые, жидкие, гелевые, мазевые и кремовые ...

ПОЛИМЕРНЫЕ НАНОЧАСТИЦЫ, ПОКРЫТЫЕ ОКСИДОМ МАГНИТНОГО МЕТАЛЛА, И ИХ ПРИМЕНЕНИЕ

... 1. Наночастица, содержащая полимер, хелатирующий металл, оксид магнитного металла и, по меньшей мере, одно активное средство, ковалентно связанное с указанным полимером.2. Наночастица по п.1, где указанный полимер, хелатирующий металл, представляет собой желатин, полиметиленимин, хитозан или полилизин.3. Наночастица по п.1, где указанный оксид магнитного металла представляет собой оксид железа или феррит, происходящий из оксида железа.4. Наночастица по п.3, где указанный оксид железа представляет собой магнетит, оксимагнетит или их смесь.5. Наночастица по п.1, где указанное, по меньшей мере, одно активное средство представляет собой флуоресцентный краситель, контрастное средство, пептид или пептидомиметик, полипептид, антифолатное лекарственное средство, антибиотик, противовоспалительное средство, химиотерапевтическое средство антрациклинового ряда или любую их комбинацию.6. Наночастица по п.5, где указанный флуоресцентный краситель представляет собой родамин или флуоресцеин.7. Наночастица ...

МАГНИТНАЯ НАНОЧАСТИЦА ДЛЯ ЛЕЧЕНИЯ И/ИЛИ ПРОФИЛАКТИКИ РАКА, НА ЕЕ ОСНОВЕ ИНФУЗИОННЫЙ РАСТВОР И ФАРМАЦЕВТИЧЕСКАЯ КОМПОЗИЦИЯ

Группа изобретений относится к медицине и касается магнитных наночастиц для лечения и/или профилактики рака, выполненных из оксидов железа или чистого железа, содержащего оксидный слой, где по меньшей мере одно терапевтически активное вещество связано с указанными частицами. При этом высвобождение по меньшей мере одного терапевтически активного вещества вызывается или инициируется, или существенно ускоряется переменным магнитным полем. Группа изобретений обеспечивает уменьшение неконтролируемого высвобождения терапевтически активных веществ во время транспортировки наночастиц к раковым клеткам. 3 н. и 10 з.п. ф-лы, 11 пр.

СПОСОБ ЛЕЧЕНИЯ АУТОИММУННОГО ЗАБОЛЕВАНИЯ С ИСПОЛЬЗОВАНИЕМ БИОСОВМЕСТИМЫХ БИОАБСОРБИРУЕМЫХ НАНОСФЕР

... 1. Способ диагностики, предупреждения или лечения аутоиммунного нарушения, включающий введение субъекту комплекса антиген-МНС, функционально связанного с биологически совместимой биоабсорбируемой наносферой в количестве, достаточном для пролиферации антипатогенных аутореактивных Т клеток.2. Способ увеличения и/или развития популяций антипатогенных аутореактивных Т-клеток у субъекта, включающий введение этому субъекту комплекса аутоантигенный эпитоп-МНС-биологически совместимая биодеградируемая наносфера, в котором указанный комплекс вводят в количестве и с частотой, достаточных для увеличения указанных популяций.3. Способ по п.2, в котором в составе указанного комплекса аутоантигенный эпитоп-МНС биологически совместимая биоадеградируемая наносфера содержится множество аутоантигенных эпитопов.4. Способ по п.3, в котором указанное множество аутоантигенных эпитопов являются производными единственного аутоантигена.5. Способ по п.3, в котором указанное множество аутоантигенных эпитопов являются ...

КОМПОЗИЦИИ И СПОСОБЫ ПРОФИЛАКТИКИ И ЛЕЧЕНИЯ ЗЛОКАЧЕСТВЕННЫХ НОВООБРАЗОВАНИЙ

... 1. Способ лечения опухоли или злокачественного новообразования у объекта, включающий введение объекту комплекса опухолевый антиген/МНС/ко-стимулирующая молекула, функционально связанного с наночастицей, имеющий диаметр от около 1 до около 100 нм, в количестве, достаточном для наработки популяции антигенспецифичных противоопухолевых Т-клеток, специфичных к опухоли или злокачественному новообразованию, благодаря чему опухоль или злокачественное новообразование подвергается лечению.2. Способ по п.1, где указанная наработанная популяция противоопухолевых Т-клеток представляет собой антигенспецифичные противоопухолевые эффекторные Т-клетки.3. Способ по п.2, дополнительно включающий введение комплексов антиген/МНС/наночастица без ко-стимулирующих молекул.4. Способ по п.1, где диаметр наночастицы составляет от около 5 нм до около 25 нм.5. Способ по п.1 или 3, где антигенспецифичные противоопухолевые Т-клетки представляют собой CD8+ Т-клетки.6. Способ по п.1 или 3, в котором МНС представляют собой ...

МАГНИТНЫЕ НАНОЧАСТИЦЫ ДЛЯ ПРИМЕНЕНИЯ ПРИ ГИПЕРТЕРМИИ, ИХ ПРИГОТОВЛЕНИЕ И ПРИМЕНЕНИЕ В КОНСТРУКТАХ ДЛЯ ФАРМАКОЛОГИЧЕСКОГО ИСПОЛЬЗОВАНИЯ

... 1. Конструкты, включающие магнитную нанометровую частицу, функционализированную бифункциональными соединениями, полимер, возможно содержащий фармакологически активную молекулу, и, когда указанный полимер является нерастворимым в воде, внешний защитный слой поверхностных агентов. ! 2. Конструкты по п.1, в которых указанная фармакологически активная молекула, если она присутствует, соединена с полимером или диспергирована в нем. ! 3. Конструкты по п.1, в которых указанные магнитные нанометровые частицы являются шпинелями и оксидами MIIMIII 2O4 типа, где MII=Fe, Co, Ni, Zn, Mn; MIII=Fe, Cr в нанометровой форме. ! 4. Конструкты по п.3, в которых указанные магнитные нанометровые частицы выбраны из: феррита кобальта, магнетита и маггемита. ! 5. Конструкты по п.1, в которых указанные бифункциональные соединения выбраны из: тиолов, карбоновых кислот, гидроксамовых кислот, фосфорных кислот, их эфиров и солей, имеющих алифатическую цепь, несущую вторую функциональную группу в концевом положении ( ...

KOLLOIDALE METALLKONJUGATE

Nanoparticles

Functionalised silicon nanoparticles

Magnetic carrier and medical preparation for controllable delivery and release of active substances, a method of production and method of treatment using ther

Use of magnetic proteins in medicine

Labelling of dry powder formulations for inhalation

NANOPARTICULATE TITANIUM DIOXIDE NANOMATERIAL MODIFIED WITH FUNCTIONAL GROUPS AND WITH CITRIC EXTRACTS ADSORBED ON THE SURFACE, FOR THE REMOVAL OF A WIDE RANGE OF MICROORGANISMS

NANOPARTICULATE TITANIUM DIOXIDE NANOMATERIAL MODIFIED WITH FUNCTIONAL GROUPS AND WITH CITRIC EXTRACTS ADSORBED ON THE SURFACE, FOR THE REMOVAL OF A WIDE RANGE OF MICROORGANISMS

NANOPARTICULATE TITANIUM DIOXIDE NANOMATERIAL MODIFIED WITH FUNCTIONAL GROUPS AND WITH CITRIC EXTRACTS ADSORBED ON THE SURFACE, FOR THE REMOVAL OF A WIDE RANGE OF MICROORGANISMS

NANO-PARTICLE

PROCEDURE FOR THE PRODUCTION OF MAGNETIC NANO-PARTICLES WITH IMPROVED MAGNET CHARACTERISTICS

AQUEOUS DISPERSION FROM SUPER+PARAMAGNETIC A DOMAIN PARTICLES, THEIR PRODUCTION AND USE TO THE DIAGNOSIS AND THERAPY

OPTICALLY ABSORBING NANO-PARTICLE FOR THE IMPROVED FABRIC REPAIR

MAGNETIC PARTICLES FOR USE IN THERAPY AND DIAGNOSTICS

NANO-CRYSTALLINE MAGNETIC FERRIC OXIDE PARTICLES FOR APPLICATION IN DIAGNOSTICS AND THERAPY

NANO-PARTICLE

RADIONUCLIDES ABSTENTION SILICONE IMPLANT FOR BRACHYTHERAPIE

Tumor-targeting bead vectors and methods of using the same

The disclosed bead vectors direct entry into a cell of monocytic origin and cause the expression of an extracellular domain of PD-1, an anti-CTLA4 antibody, or an antibody that is specific for a checkpoint protein. The bead vectors can comprise a nucleic acid component, a lysosome evading component and a bead particle that can be phagocytized. The disclosed vectors are useful in various methods of cancer therapy, treatment, and prevention. Due to the ability of monocytic cells to target tumors, the disclosed vectors are particularly well suited for use in anti-tumor applications and directing expression of target genes in tumor-associated macrophages.

Use of cyclodextrins in diseases and disorders involving phospholipid dysregulation

In some embodiments, the present disclosure provides certain compositions and methods that may be useful in the treatment and/or prevention of malignant, neurodegenerative, vascular, metabolic, inflammatory, autoimmune, pulmonary, fibrotic, hepatic, lysosomal storage, or viral disease, disorder, or condition, such as carcinomas, Alzheimer's and Parkinson's disease, multiple sclerosis, Paget' s disease, or other aspects of aging, such as atherosclerosis or type-2 diabetes. In some such embodiments, compositions are provided that contain at least one cyclodextrin active agent, such as alpha-cyclodextrin, or an analogue or derivative thereof. In some embodiments, the composition is a clathrate of hydroxypropyl-alpha- cyclodextrin and sodium caprate.

IMMUNOMAGNETIC NANOCAPSULE, FABRICATION METHOD AND USE THEREOF, AND KIT FOR TREATING CANCER

An immunomagnetic composition, a preparation method and a use thereof, and a kit for treating a cancer. The immunomagnetic composition comprises a core layer, a shell layer, and an outer layer. The shell layer is composed of a composite and encapsulates the core layer. The composite is formed by the combination of fucoidan, oxidized dextran, and a plurality of superparamagnetic iron oxide nanoparticles by hydrophobic interaction. The outer layer comprises at least one antibody.

Nanoparticle/active ingredient conjugate

Nanoparticle delivery system

NANOPARTICLE DELIVERY SYSTEM

Magnetic nanoparticles for the application in hyperthermia, preparation thereof and use in constructs having a pharmacological application

Nanoparticles comprising antigens and adjuvants and immunogenic structure

Nanoparticles comprising adjuvants and antigens, such as tumour and pathogen antigens, are disclosed and their use in a range of applications such as for the treatment of cancer and infectious diseases. Immunogenic structures based on nanoparticles or antibodies with carbohydrate ligands, and their use for therapeutic and prophylactic purposes, and for the isolation and detection of antibodies directed against the carbohydrate structures.

Temperature-dependent activation of catalytic nucleic acids for controlled active substance release

The present invention relates to an active substance release system containing two compounds. The first compound comprises a nanoparticle, combined with an oligonucleotide inhibition strand that is hybridized with a catalytically active nucleic acid. The second compound comprises a carrier, combined with a substrate molecule that is coupled to a therapeutic active substance. By means of external stimulation, the catalytically active nucleic acid of the first compound is released and specifically binds to the substrate molecule of the second compound. This leads to cleavage of the substrate molecule, whereby the active substance bound thereto is released.

Delivery of therapeutic agents using oligonucleotide-modified nanoparticles as carriers

Disclosed are drug delivery compositions comprising an oligonucleotide-modified nanoparticle and a therapeutic agent. Specifically, disclosed are compositions comprising a number of oligonucleotide molecules in a ratio to therapeutic agent molecules to allow a sufficient transportation of the therapeutic agent molecules into a cell. The therapeutic agents include both hydrophobic and hydrophilic. Different attachments of therapeutic agents in a composition are also described.

TREATMENT OF DISEASE STATES CHARACTERIZED BY EXCESSIVE OR INAPPROPRIATE ANGIOGENESIS

Nanoparticles

METHODS AND COMPOSITIONS FOR TREATING INFLAMMATION

This disclosure provides therapeutic compositions and methods for inducing an anti inflammatory response and/or treating inflammation in the gastrointestinal tract and/or accumulating gut microbial antigen-specific anti-inflammatory T cells in a patient in need thereof ...

Tolerogenic synthetic nanocarriers for allergy therapy

Disclosed are synthetic nanocarrier compositions, and related methods, comprising immunosuppressants and MHC Class Il-restricted epitopes of an allergen that provide tolerogenic immune responses specific to the allergen.

Porous silicon microparticle-based cancer vaccines and methods for potentiating anti-tumoral immunity

Porous silicon (pSi) microparticles (PSM) are disclosed, which provide an important advance in the area of cancer immunotherapeutics and molecular nanomedicine. In particular, potent PSM-based adjuvants are disclosed for dendritic cell-based vaccines compositions, and methods for their use in a variety of cancer immunotherapies. The PSM of the present invention are also useful in developing other types of vaccines, including those not necessarily related to the treatment of cancers, such as vaccines for the treatment of acne, Alzheimer's disease, asthma, atherosclerosis, autoimmune disorders, autoinflammatory disease, celiac disease, colitis, Crohn's disease, diabetes, glomerulonephritis, infectious diseases, inflammatory bowel disease, irritable bowel syndrome, ischemia, Lupus, pelvic inflammatory disease, reperfusion injury, rheumatoid arthritis, sarcoidosis, transplant rejection, and related illnesses.

Compositions and methods related to scavanger particles

The disclosure provides, among other things, compositions that bind to and inhibit the biological activity of soluble biomolecules, as well as pharmaceutical compositions thereof. The compositions may comprise a plurality of particles that specifically bind a target, such as a soluble biomolecule or a biomolecule on the surface of a pathogen, to inhibit the target (or pathogen) from interacting with other molecules or cells. Also provided herein are a number of applications (e.g., therapeutic applications) in which the compositions are useful.

Compositions and methods for inhibiting the biological activity of soluble biomolecules

The disclosure provides, among other things, compositions that bind to and inhibit the biological activity of soluble biomolecules, as well as pharmaceutical compositions thereof. Also provided herein are a number of applications (e.g., therapeutic applications) in which the compositions are useful.

Methods and compositions for enhancing CD4+ regulatory T cells

Tolerogenic synthetic nanocarriers to reduce or prevent anaphylaxis in response to a non-allergenic antigen

TOLEROGENIC SYNTHETIC NANOCARRIERS FOR ALLERGY THERAPY

Disclosed are synthetic nanocarrier compositions, and related methods, comprising immunosuppressants and MHC Class Il-restricted epitopes of an allergen that provide tolerogenic immune responses specific to the allergen. See Fig. 8. WO 2012/149268 PCT/US2012/035383 0C0 5000 ml. Fig. 8 ...

Use of beta GalNac(1-4)beta Gal conjugates to treat Candida infection

Mesoporous silica nanoparticles with lipid bilayer coating for cargo delivery

A nanocarrier including a silica body having a surface and defining a plurality of pores that are suitable to receive molecules therein is described. The nanocarrier also includes a lipid bilayer coating the surface, and a cargo-trapping agent within the phospholipid bilayer. The phospholipid bilayer stably seals the plurality of pores. The cargo-trapping reagent can be selected to interact with a desired cargo, such as a drug.

Methods and compositions for enhancing immune response and for the production of in vitro mabs

Particle compositions

Sulfated nonionic block copolymer surfactants as stabilizer coatings for nanoparticle compositions

Use of charged phospholipids to reduce nanoparticle aggregation

TEMPLATED NANOCONJUGATES

The present disclosure is directed to compositions comprising templated nanoconjugates and methods of their use.

SYNTHETIC NANOSTRUCTURES FOR DELIVERY OF OLIGONUCLEOTIDES

Articles, compositions, kits, and methods relating to nanostructures, including synthetic nanostructures, are provided. Certain embodiments described herein include structures having a core-shell type arrangement; for instance, a nanostructure core may be surrounded by a shell including a material, such as a lipid bilayer, and may include other components such as oligonucleotides. In some embodiments, the structures, when introduced into a subject, can be used to deliver nucleic acids and/or can regulate gene expression. Accordingly, the structures described herein may be used to diagnose, prevent, treat or manage certain diseases or bodily conditions. In some cases, the structures are both a therapeutic agent and a diagnostic agent.

POLYVALENT RNA-NANOPARTICLE COMPOSITIONS

The present invention concerns nanoparticles functionalized with duplex RNA for a variety of uses, including but not limited to gene regulation. More specifically, the disclosure provides a new strategy for conjugating RNA to a nanoparticle to achieve increased stability and activity.

DERMAL DELIVERY COMPOSITIONS COMPRISING ACTIVE AGENT-CALCIUM PHOSPHATE PARTICLE COMPLEXES AND METHODS OF USING THE SAME

Dermal delivery compositions are provided. Aspects of the dermal delivery compositions include the presence of active agent-calcium phosphate particle complexes, where these complexes include uniform, rigid, spherical nanoporous calcium phosphate particles associated with one or more active agents. Also provided are methods of using the compositions in active agent delivery applications.

GOLD NANOPARTICLE-APTAMER CONJUGATE-BASED ANTIBODY DELIVERY SYSTEM, AND PREPARATION METHOD THEREOF

The present invention relates to a gold nanoparticle-aptamer conjugate-based antibody delivery system, and a preparation method thereof. In the antibody delivery system according to the present invention, a gold nanoparticle is bound to an IgG Fc domain-specific aptamer or FITC-specific aptamer, and the aptamer is specifically bound to an antibody to be delivered, so that the antibody can be effectively delivered to not only the nucleus and cytoplasm of a cell but also mitochondria thereof. In addition, the system uses the gold nanoparticle having very little cytotoxicity so as to be harmless to a human body, as well as reflects light at various wavelengths so that the position thereof within cells can be easily identified. Thus, the antibody delivery system is expected to be usefully employed in the diagnosis or treatment of diseases.

HUMANIZED MONOCLONAL ADVANCED GLYCATION END-PRODUCT ANTIBODY

A humanized monoclonal antibody that binds to an advanced glycation end- product-modified protein or peptide on a cell comprises a heavy chain and a light chain. The antibody binds a carboxymethyllysine-modified protein or peptide. A composition comprises a humanized monoclonal antibody that binds to an advanced glycation end-product-modified protein or peptide on a cell and a pharmaceutically acceptable carrier.

MAGNETIC NANOPARTICLES FOR TARGETED DELIVERY

A nanoparticle capable of crossing tissue has an iron oxide core, a first therapeutic agent, and a polymeric coating. The nanoparticles can be sterilized or part of a lyophilized formation.

REPEATED ADMINISTRATION OF NON-IMMUNOSUPRESSIVE ANTIGEN-SPECIFIC IMMUNOTHERAPEUTICS

This invention relates to repeated administration of antigen- specific immunotherapeutics using protocols, or elements thereof, that do not induce immunosuppression. In some embodiments, the protocol has been previously shown not induce immunosuppression in a subject.

METHODS AND COMPOSITIONS FOR ATTENUATING ANTI-VIRAL TRANSFER VECTOR IMMUNE RESPONSES

Provided herein are methods and related compositions for administering viral transfer vectors and antigen-presenting cell targeted immunosuppressants.

METHODS AND COMPOSITIONS FOR ATTENUATING GENE EXPRESSION MODULATING ANTI-VIRAL TRANSFER VECTOR IMMUNE RESPONSES

Provided herein are methods and related compositions for administering viral transfer vectors and antigen-presenting cell targeted immunosuppressants.

NANOPARTICLE PEPTIDE COMPOSITIONS

The present invention relates to teriparatide peptide-carrying nanoparticles, particularly for use in medicine, and includes methods for treatment of disorders, e.g., of bone density. Nanoparticle composition comprise a nanoparticle comprising a core comprising a metal and/or a semiconductor; and a corona comprising a plurality of ligands covalently linked to the core, wherein said plurality of ligands comprise at least one glutathione; and at least one teriparatide peptide that is non-covalently bound to the corona.

TOLEROGENIC NANOPARTICLES FOR TREATING DIABETES MELLITUS

Methods and compositions for increasing the number and/or activity of regulatory T cells (Tregs) in vivo and in vitro, to induce tolerance to diabetogenic autoantigens.

NANOPARTICLE FILM DELIVERY SYSTEMS

A therapeutic or bioeffecting film delivery system which includes nanoparticles having actives bound to or associated with the nanoparticles and which when administered allow the active to perform a therapeutic or bioeffecting function.

SYSTEM AND METHOD FOR MULTIPHASIC RELEASE OF GROWTH FACTORS

A system for multiphasic delivery of at least one growth factor at a treatment site comprises a delivery vehicle for releasing at least one growth factor in an initial release profile and a carrier for releasing at least one growth factor in a sustained release profile. The initial release profile releases at least one growth factor over a period of hours to days, wherein the growth factor is released in a large amount initially, with the remainder being released in progressively lower amounts. The sustained release profile releases at least one growth factor over a period of days to weeks, wherein the growth factor is released at a generally constant amount over such period. The system of the invention is particularly suited for applications on bioimplants. The invention also comprises methods and kits for multiphasic delivery of at least one growth factor.

PARTICLE-NUCLEIC ACID CONJUGATES AND THERAPEUTIC USES RELATED THERETO

This disclosure relates to particles conjugated to therapeutic nucleic acids. In certain embodiments, the nucleic acid comprises a sequence that catalytically cleaves RNA, e.g., DNAzyme or RNAzyme. In certain embodiments, the particles contain nucleic acids with both DNAzyme and/or RNAzyme and siRNA sequences. The cleaving nucleic acids optionally comprise a sequence functioning to hybridize to a target of interest and/or the particles are further conjugated to a targeting moiety. In certain embodiments, conjugated particles are used in the treatment or prevention of cancer or viral infections or bacterial infections. In certain embodiments, conjugated particles are used in detecting metal ions and other small molecule analytes.

A BIOCOMPOSITE FOR REGENERATION OF INJURED TISSUE AND ORGANS, A KIT FOR MAKING THE BIOCOMPOSITE, A METHOD OF MAKING THE BIOCOMPOSITE AND A METHOD OF TREATING INQUIRIES

... ?Provided is a biocomposite including cells, a genetic construction, and a scaffold and a method for repairing tissue and organs in mammalians with the biocomposite. The interaction of the components of the biocomposite provides a complex effect on reparative regeneration processes. Also provided is a method for administration of gene-cellular therapeutic constructions to a recipient which can be used in medicine and veterinary to provide reparative processes. After administering the biocomposite to a recipient, the scaffold structure releases the nucleic acids which enter into the cells of a recipient bed and cells of the transplanted product. The nucleic acids are expressed, which results in the increased concentration of a target product responsible for reparative processes.

A METHOD FOR TRANSPLANTING CELLS INTO THE BRAIN AND THERAPEUTIC USES THEREFOR

... 2128630 9314790 PCTABS00024 A method for grafting a cell in the brain of a mammalian subject is accomplished by attaching the cell to a support matrix so that the cell attaches to the matrix surface, and implanting the support matrix with the attached cell into the brain. Preferred support matrices are glass or plastic microbeads, either solid or porous, having a diameter from about 90 to about 125 .mu.m. The method employs cells of different types, preferably cells of neural or paraneural origin, such as adrenal chromaffin cells. Also useful are cell lines grown in vitro. Cells not of neural or paraneural origin, such as fibroblasts, may also be used following genetic alteration to express a desired neural product such as a neurotransmitter or a neuronal growth factor. The method is used to treat neurological diseases such as Parkinson's disease, Alzheimer's disease, Huntington's disease, epilepsy, and traumatic brain injury.

THERAPEUTIC INHIBITORS OF VASCULAR SMOOTH MUSCLE CELLS

Methods are provided for inhibiting stenosis following vascular trauma or disease in a mammalian host, comprising administering to the host a therapeutically effective dosage of a therapeutic conjugate containing a vascular smooth muscle binding protein that associates in a specific manner with a cell surface of the vascular smooth muscle cell, coupled to a therapeutic agent dosage form that inhibits a cellular activity of the muscle cell. Methods are also provided for the direct and/or targeted delivery of therapeutic agents to vascular smooth muscle cells that cause a dilation and fixation of the vascular lumen by inhibiting smooth muscle cell contraction, thereby constituting a biological stent.

TREATMENT OF TRAVELLER'S DIARRHEA

This invention relates to treatment of traveller's diarrhea, including diarrhea caused by enterotoxigenic E. coli (ETEC), using oligosaccharide compositions which bind E. coli heat-labile toxin (LT) and/or one or more serotypes of enterotoxigenic E. coli organisms. More specifically, the invention concerns neutralization and removal of LT associated with traveller's diarrhea. This invention also relates to prevention of ETEC from colonizing the intestinal tract and inducing disease.

TOLEROGENNYE SYNTHETIC NANOCARRIERS, REDUCE IMMUNE RESPONSE TO THERAPEUTIC PROTEINS

NANOCARRIERS, CAUSING IMMUNE TOLERANCE, FOR WIFI CLIENT CONTINUOUSLY NY MATING REACTION CYTOTOXIC T - LYMPHOCYTES

COMPOSITION FOR DERMAL DELIVERY, CONTAINING COMPLEXES ACTIVE AGENT WITH PARTICLES OF CALCIUM PHOSPHATE, AND METHODS OF THEIR APPLICATION

TOLEROGENNYE SYNTHETIC NANOCARRIERS

tolerogennye synthetic nanocarriers, reduce immune response on therapeutic proteins

CAUSING IMMUNE TOLERANCE SYNTHETIC NANOCARRIERS FOR THERAPEUTIC TREATMENT OF ALLERGY

NANOCARRIERS, GENERATING IMMUNE TOLERANCE, FOR GENERATION CD8 + REGULATORY T CELLS-

METHOD OF PRODUCING NANOPARTICLES BORON NITRIDE FOR DELIVERY OF ANTITUMOR PREPARATIONS

tolerogennye synthetic nanocarriers for induction of regulatory b-cells

NANOCARRIERS, CAUSING IMMUNE TOLERANCE, FOR LOWER CONDENSATE RESPONSE CYROTOXIC T - LYMPHOCYTES

COMPOSITIONS AND METHODS, CONNECTED WITH GRIPPING PARTICLES

METHODS AND COMPOSITIONS FOR ATTENUATION OF IMMUNE RESPONSES TO VIRAL GENE KORREKTIRUShchIM TRANSFERRING VECTORS

LOCAL ASSOCIATED INTRODUCTION OF TOLEROGENNYKh SYNTHETIC NANOCARRIERS FOR YOUR CONDENSATE HYPERSENSITIVITY TYPE I AND HYPERSENSITIVITY TYPE IV

MODULAR COMPOSITION FOR UTILIZATION OF SOLUBLE BIOMOLECULES AND CONNECTED WITH THIS METHODS

NANOCARRIERS, GENERATING IMMUNE TOLERANCE, FOR ANTIGENSPETsIFIChESKOGO REMOVING T - EFFECTOR CELLS

DELIVERY OF IMMUNODEPRESSORS, HAVING A CERTAIN FARMAKODINAMIChESKI EFFECTIVE PERIOD, AND ANTIGEN FOR INDUCTION OF IMMUNE TOLERANCE

THE NANOMATERIAL IN FORM OF NANOPARTICLES OF TITANIUM DIOXIDE, MODIFIED FUNCTIONAL GROUPS AND EXTRACTS OF CITRUS, ADSORBED ON THE SURFACE OF, FOR REMOVING OF WIDE RANGE OF MICROORGANISMS

DOSING COMBINATIONS FOR WIFI CLIENT CONTINUOUSLY NY UNDESIRABLE HUMORAL IMMUNE RESPONSES

METHODS AND COMPOSITIONS FOR AMPLIFICATION CD4 + REGULATORY T-CELLS

tolerogennye synthetic nanocarriers for Your condensate or prevention of anaphylaxis in response to neallergennyi antigen

METHODS AND COMPOSITIONS FOR ATTENUATION OF IMMUNE RESPONSES AGAINST VIRAL VECTOR FOR TRANSFER OF

LOCAL ASSOCIATED INTRODUCTION OF TOLEROGENNYKh SYNTHETIC NANOCARRIERS FOR YOUR CONDENSATE HYPERSENSITIVITY TYPE I AND HYPERSENSITIVITY TYPE IV

Reducing or preventing non-allergenic antigen in response to the allergic reaction of the tolerogenic synthetic nano-carrier

USE OF MICRORNA-146A AND NANOCERIA CONJUGATE TO IMPROVE WOUND HEALING AND PROMOTE TISSUE REGENERATION

NOVEL NANOPARTICLES OF MESOPOROUS ORGANOSILICA, THEIR METHOD OF PREPARATION AND USES THEREOF.

La présente invention concerne des nanoparticules d'organosilice mésoporeuses, leur méthode de préparation et leurs utilisations dans le traitement par thérapie photodynamique ou dans l'imagerie.

A DELEVERY SYSTEM OF ANTI-CANCER AGENT USING pH SENSITIVE METAL NANOPARTICLE

다층 고분자막 금나노입자, 그 제조방법, 및 그의 용도

... 본 발명의 일 양상은 금 나노입자; 및 상기 금 나노입자 표면상에 BIBB (Bis[2-(2-bromo isobutyryloxy) undecyl] disulfide)를 개시제로 하고 DAMA (2-(dimethylamino)ethyl methacrylate) 및 HEMA (2-hydroxyethyl methacrylate)를 단량체로 하는 표면개시고분자리빙중합 (SI-ATRP) 반응에 의해 형성된 고분자막을 포함하는 고분자막 금 나노입자, 그 고분자막 금 나노입자 및 항암제를 포함하는 복합체, 그 복합체를 포함하는 암 치료용 약학 조성물, 및 이들의 제조방법을 제공한다.

Nanoparticle-Peptide Compositions

TOLEROGENIC SYNTHETIC NANOCARRIERS TO REDUCE IMMUNE RESPONSES TO THERAPEUTIC PROTEINS

Targeted multi-epitope dosage forms for induction of an immune response to antigens

Provided herein are compositions and methods related to MHC II binding peptides. In some embodiments, the peptides are obtained or derived from a common source. In other embodiment, the peptides are obtained or derived from an infectious agent to which a subject has been repeatedly exposed.

Compositions and methods for the prevention and treatment of cancer

Conventional cancer immunotherapy falls short at efficiently expanding T cells that specifically target cancerous cells in numbers sufficient to significantly reduce the tumor size or cancerous cell number in vivo. To overcome this limitation, provided herein are nanoparticles coated with MHC class I and/or class II molecules presenting tumor-specific antigens and co-stimulatory molecules and their use to expand antigen-specific anti-tumorigenic T cells to levels not achieved in current immunotherapeutic techniques. These antigen-specific anti-tumorigenic T cells include cytotoxic T cells, effector T cells, memory T cells, and helper T cells that are necessary to initiate and maintain a substantial immune response against metastatic or non-metastatic cancerous, pre-cancerous, or neoplastic cells in vivo. The present invention describes a systemic approach to targeting cancerous or pre-cancerous cells that are circulating cells, as in lymphomas, migratory metastatic cells, and solid tumors.

Targetted drug delivery to the bone

The present invention relates to a complex of a bisphosphonate compound, methods of preparing such complex and uses thereof.

Therapeutic Inhibitor of Vascular Smooth Muscle Cells

Methods are provided for inhibiting stenosis following vascular trauma or disease in a mammalian host, comprising administering to the host a therapeutically effective dosage of a therapeutic conjugate containing a vascular smooth muscle binding protein that associates in a specific manner with a cell surface of the vascular smooth muscle cell, coupled to a therapeutic agent dosage form that inhibits a cellular activity of the muscle cell. Methods are also provided for the direct and/or targeted delivery of therapeutic agents to vascular smooth muscle cells that cause a dilation and fixation of the vascular lumen by inhibiting smooth muscle cell contraction, thereby constituting a biological stent.

Tolerogenic synthetic nanocarriers for generating cd8+ regulatory t cells

Disclosed are synthetic nanocarrier methods, and related compositions, comprising administering MHC Class I-restricted and/or MHC Class II-restricted epitopes of an antigen and immunosuppressants in order to generate tolerogenic immune responses against the antigen, such as the generation of antigen-specific CD8+ regulatory T cells.

Tolerogenic synthetic nanocarrier compositions with transplantable graft antigens and methods of use

Disclosed are synthetic nanocarrier compositions, and related methods, comprising APC presentable transplant antigens and immunosuppressants that provide tolerogenic immune responses (e.g., a reduction in CD8+ T cell proliferation and/or activity) specific to the APC presentable transplant antigens.

Tolerogenic synthetic nanocarriers to reduce cytotoxic t lymphocyte responses

Disclosed are synthetic nanocarrier compositions, and related methods, comprising MHC Class I-restricted and/or MHC Class II-restricted epitopes associated with undesired CD8+ T cell responses and immunosuppressants that provide tolerogenic immune responses against antigens that comprise the epitopes.

Tolerogenic synthetic nanocarriers

This invention relates, at least in part, to compositions comprising synthetic nanocarriers and immunosuppressants that result in immune suppressive effects. Such compositions can further comprise antigen and provide antigen-specific tolerogenic immune responses.

Magnetic nanostructures as theranostic agents

The present invention relates to magnetic nanostructures as theranostic agents, which provide dual function as diagnostic and therapeutic agents. In particular, the present invention relates to compositions comprising magnetic nanostructures and their use as targeted therapeutic agents for cancers (e.g., medulloblastoma) and Alzheimer's disease and related diseases and conditions.

Synthetic nanostructures including nucleic acids and/or other entities

Articles, compositions, kits, and methods relating to nanostructures, including synthetic nanostructures, are provided. Certain embodiments described herein include structures having a core-shell type arrangement; for instance, a nanostructure core may be surrounded by a shell including a material, such as a lipid bilayer, and may include other components such as oligonucleotides. In some embodiments, the structures, when introduced into a subject, can be used to deliver nucleic acids and/or can regulate gene expression. Accordingly, the structures described herein may be used to diagnose, prevent, treat or manage certain diseases or bodily conditions. In some cases, the structures are both a therapeutic agent and a diagnostic agent.

Smart polymers functionalized hollow silica vesicles

The present invention provides a porous hollow silica micro- or nanoparticle with a polymer grafted thereon, wherein the polymer is selected from poly(methacrylic acid) and copolymers thereof. The polymer may be covalently linked to the silica particle via a bridging group. Provided is also a method of covalently coupling a poly(methacrylic acid) to a silica surface of a hollow silica particle. The method comprises contacting a silica surface of a hollow silica particle that carries amino functional or halogen functional groups with a poly(methacrylic acid) or a copolymer or a respective monomer thereof. The method further comprises allowing the carboxyl group of the monomer or the poly(methacrylic acid) and an amino functional group or a halogen functional group on the silica surface to undergo a coupling reaction, thereby covalently coupling the polymer to the silica surface.

Use of Gold Nanoclusters in Ameliorating Oxidate Stress and/or Aging

Disclosed herein is the novel use of a gold nanocluser for ameliorating oxidative stress and/or aging of a cultured cell or a subject having an oxidative stress and/or aging condition mediated by a vascular factor. The gold nanocluster has a particle size ranging from about 0.1 to 20 nm, and preferably is dihydrolipoic acid (DHLA) coated gold nanocluster.

Composition for nucleic acid delivery using metal nanoparticles and preparing method thereof

The present invention relates to a composition for nucleic acid delivery and a method for preparing the same, more particularly to a composition for nucleic acid delivery having excellent stability in the body environment and excellent intracellular delivery efficiency of nucleic acid, and enabling target directed delivery of nucleic acid, and a method for preparing the same.

Equipment and methodologies for magnetically-assisted delivery of therapeutic agents through barriers

Magnetic gradients are used to transport Magnetic Nano Particles through a barrier, for example, the cribiform (also spelled “cribriform”) plate, which is a porous bony structure which separates the nasal cavity from the cranial vault. By utilizing a configuration of magnets (whether of the electromagnetic type or permanent magnets), MNPs can be propelled, pushed, pulled or otherwise manipulated in relation to an anatomical and/or physiological barrier, to position, re-position or maintain the position(s) of the MNPs.

Antimicrobial nanoparticle conjugates

The present invention provides antimicrobial nanoparticle conjugates and an efficient method of preparing same. In particular, the invention relates to the preparation of antifungal nanoparticle conjugates comprising amphotericin B covalently immobilized to nanoparticles. The conjugates, and suspensions thereof, can be used to form antifungal coatings with particular application to medical devices and materials.

Protease degradable polypeptides and uses thereof

Provided herein are polypeptides that are selectively cleaved by cathepsin E. Also provided are methods of detecting cathepsin E. The methods comprise contacting cathepsin E with the polypeptides provided herein and detecting fluorescence. Further provided are methods of diagnosing cancer or pre-cancerous conditions in a subject. Also provided herein is a multilayered nanoparticle or a composition comprising the multilayer nanoparticle, wherein the multilayered nanoparticle comprises a negatively charged nanoparticle core or capsule coated with alternating positive and negative layers. Optionally, the positive layer comprises a positively charged protease degradable polypeptide. Optionally, the negative layer comprises a negatively charged therapeutic agent or a therapeutic agent and a means for providing the agent with a negative charge. For example, optionally, the therapeutic agent is linked to a negatively charged polymer. Further provided are methods of treating or preventing a disease characterized by expression of a protease in a subject using the nanoparticle.

Particulate substances comprising ceramic particles for delivery of biomolecules

A particulate substance comprising particles of a ceramic matrix bearing a functional group, the functional group being capable of promoting penetration of the particles into cells, and a biomolecule disposed within pores of the particles, the biomolecule being releasable from the particles by dissolution of the ceramic matrix.

Compositions comprising saccharide binding moieties and methods for targeted therapy

The disclosure relates to uses of saccharide binding moieties, e.g., lectins for targeting cells, typically cancer stem cells. In certain embodiments, the disclosure relates to conjugates comprising: a) a saccharide binding moiety; b) a polymer; and c) a therapeutic agent; wherein the saccharide binding protein is covalently attached to the polymer.

Nitric oxide-releasing particles for nitric oxide therapeutics and biomedical applications

The presently disclosed subject matter relates to nitric oxide-releasing particles for delivering nitric oxide, and their use in biomedical and pharmaceutical applications.

Self-Assembling Nanoparticles for the Release of Bisphosphonates in the Treatment of Human Cancers

The present invention describe nanocomplexes also called auto-assembling nanoparticles comprising biphosphonates, lipid nanovectors and inorganic nanovectors. In particular the invention describes zoledronic acid complexed with calcium phosphate base nanoparticles; said particles in their turn mixed with lipidic particles e.g. liposomes. Said nanocomplexes are useful, and showed to be efficient in vivo, as pharmaceutical formulations of biphosphonates for the treatment or prevention of tumor growth and/or metastasis. Tumors can be solids and/or haematological such as prostate, lung, head/neck, colon, liver, breast, pancreas, kidneys, bladder, male and female urogenital tract, bones, multiple myeloma, primitive and secondary tumours of the central nervous system and lymphomas.

NANOPARTICLES FOR SUSTAINED OPHTHALMIC DRUG DELIVERY AND METHODS OF USE

Disclosed is a compound having the Formula (I): X-[NH—CHR—C(O)—NH—CHR—C(O)]—Y (I) or a pharmaceutically acceptable salt or tautomer thereof, wherein Ris H or the side chain of a neutral amino acid; Ris the side chain of a basic amino acid R; x is inclusive; X is H or a residue of a therapeutic agent; Y is OH, or a residue of a therapeutic agent; Ris: [Formula should be inserted here]; Ris a residue of a therapeutic agent; and provided that when Ris R, X is H and Y is —OH. Also disclosed is a method of treating an ocular disorder, comprising: (a) intravitreal administration to an eye of a subject in need thereof with an effective amount of a therapeutic nanoparticle composition, the therapeutic nanoparticle composition comprising (i) at least one population of nanostructures and (ii) at least one peptide attached to the at least one population of nanostructures. The nanostructures may be exposed to light in the eye thereby electrostimulating the eye and treating the ocular disorder. Also disclosed is a method of treating an ocular disorder, comprising contacting the eye of a subject in need thereof with an effective amount of a therapeutic nanoparticle composition, the therapeutic nanoparticle composition comprising (i) at least one population of nanostructures, (ii) a peptide attached to the at least at least one population of nanostructures, (iii) a therapeutic agent useful for the treatment of the ocular disorder attached to the at least one population of nanostructures or to the peptide; and (iv) optionally, a linkage between the at least one population of nanostructures or the peptide and the therapeutic agent. 132-. (canceled)33. A method of treating an ocular disorder , comprising contacting the eye of a subject in need thereof with an effective amount of a therapeutic nanoparticle composition , the therapeutic nanoparticle composition comprising (i) at least one population of nanostructures , (ii) a peptide attached to the at least one population of ...

Uniform core-shell tio2 coated upconversion nanoparticles and use thereof

An upconversion nanoparticle (UCN) coated with a layer of semiconductor material is disclosed. The UCN core acts as a nanotransducer to convert near infrared (NIR) to visible and/or ultraviolet (UV) light while the semiconductor shell serves as a photocatalyst. Upon excitation by NIR light, the UCN upconverts NIR light to UV and/or visible light of different wavelengths. Spectral overlap between the emitted UV and absorption wavelength of the coated TiO 2 activates the TiO 2 layer to generate cytotoxic reactive oxygen species (ROS), which can be used in photodynamic therapy for the treatment of cancer cells. Stability and uptake of the nanoparticles can be increased by altering the coating of the nanoparticle, such as by a polymer and a dispersion stabilizer.

CONJUGATES COMPRISING OCULAR ANGIOGENESIS GROWTH FACTOR APTAMERS AND USES THEREOF IN THE DETECTION AND TREATMENT OF OPHTHALMOLOGICAL ANGIOGENESIS INDICATIONS

Provided is an antiangiogenic agent in the form of a vehicle, e.g., a nanoparticle associated (directly or indirectly) with at least one ocular angiogenesis growth factor aptamer, wherein said association labile to interaction between the aptamer and an ocular angiogenesis growth factor. 1. An antiangiogenic agent comprising a vehicle having a plurality of nucleic acids associated therewith , each nucleic acid in said plurality of nucleic acids having a sequence comprising at least 9 nucleic acid bases hybridized to at least 9 nucleic acid bases of a complementary nucleic acid sequence comprised within a sequence of at least one ocular angiogenesis growth factor (OAGF) aptamer , wherein said hybridization dissociates upon binding of at least one ocular angiogenesis growth factor to said at least one aptamer.23.-. (canceled)4. The agent according to claim 1 , wherein the vehicle is in the form of a nanoparticle selected from the group consisting of carbon quantum dots (C-dots) claim 1 , graphene oxide nanoparticles claim 1 , DNA based nanoparticles claim 1 , carbon nitride nanoparticles claim 1 , metal organic framework nanoparticles claim 1 , polymeric nanoparticles claim 1 , polysaccharide nanoparticles and combinations thereof.52. The agent according to claim claim 1 , wherein the vehicle is C-dot.6. The agent according to claim 5 , wherein the C-dot is surface-associated with a plurality of nucleic acids claim 5 , each nucleic acid in said plurality of nucleic acids having a sequence comprising at least 9 nucleic acid bases hybridized to at least 9 nucleic acid bases of a complementary nucleic acid sequence comprised within a sequence of at least one ocular angiogenesis growth factor (OAGF) aptamer.7. The agent according to claim 6 , wherein the C-dot is surface-associated with each of the nucleic acids via a covalent bond or the C-dot is surface associated with each of the nucleic acids via non-covalent interaction or the C-dot is functionalized with amine or ...

LIPOSOMAL SPHERICAL NUCLEIC ACID (SNA) CONSTRUCTS FOR SURVIVAL OF MOTOR NEURON (SMA) INHIBITORS

Compositions related to spherical nucleic acids (SNAs) and structures with antisense oligonucleotides and methods of treatment of diseases and disorders are disclosed herein. 1. A spherical nucleic acid (SNA) , comprisinga core and an antisense oligonucleotide comprised of 8 to 50 linked nucleosides in length targeted to a regulatory site of Survival of Motor Neuron 2 (SMN2) pre-mRNA, and wherein the antisense oligonucleotide is attached to the core and forms an oligonucleotide shell.2. The SNA of claim 1 , wherein the core has a minimal number mean diameter of about 8 nm.3. The SNA of claim 1 , wherein the core has a minimal number mean diameter of about 10 nm.4. The SNA of claim 1 , wherein the core has a minimal number mean diameter of about 15 nm.5. The SNA of claim 1 , wherein the core has a number mean diameter of about 10 nm to about 50 nm.6. The SNA of claim 1 , wherein the core has a number mean diameter of about 20 nm to about 25 nm.7. The SNA of claim 1 , wherein the core has a number mean diameter of about 20 nm.8. The SNA of claim 1 , wherein the core has a number mean diameter of about 10 nm to about 15 nm.9. The SNA of claim 1 , wherein the core has a number mean diameter of about 13 nm.10. The SNA of claim 1 , wherein the regulatory site is a ISS-N1 site.11. The SNA of claim 1 , wherein the regulatory site is a E1 site claim 1 , a 3′ splice site of exon 8 site or a ISS+100 site.12. The SNA of claim 1 , wherein the core is a lipid bilayer containing core or liposomal core and the antisense oligonucleotide is attached to the lipid bilayer containing core or liposomal core.13. The SNA of any one of - claim 1 , wherein the core is a metal core.14. The SNA of any one of - claim 1 , wherein the core is a gold core.15. The SNA of claim 14 , wherein the antisense oligonucleotide is attached to the gold core through a covalent interaction.16. The SNA of or claim 14 , wherein the antisense oligonucleotide is 18 nucleotides in length.17. The SNA of or claim 14 ...

Nanoparticle-Based Liver-Targeting Therapy

The present invention provides a nanoparticle comprising: a core comprising a metal and/or a semiconductor; and a plurality of ligands covalently linked to the core, wherein said ligands comprise: at least one liver-targeting ligand, such as C2-alpha galactose; at least one payload ligand comprising a bioactive agent, such as maytansinoid DM1; and at least one dilution ligand comprising a poly(ethyleneglycol) (PEG) moiety, such as PEG COOH. Also provided are pharmaceutical compositions comprising the nanoparticle, and uses of the nanoparticle in methods of treatment of liver disorders, including liver cancers such as hepatocellular carcinoma (HCC). 1. A nanoparticle comprising:a core comprising a metal and/or a semiconductor; anda plurality of ligands covalently linked to the core, (iv) at least one liver-targeting ligand;', '(v) at least one payload ligand comprising a bioactive agent; and', '(vi) at least one dilution ligand comprising a polyethyleneglycol (PEG) moiety., 'wherein said ligands comprise2. The nanoparticle according to claim 1 , wherein the liver-targeting ligand comprises galactose.3. The nanoparticle according to any one of the preceding claims claim 1 , wherein the liver-targeting ligand is covalently linked to the core via a first linker claim 1 , said first linker having a chain length of 2 to 50 atoms.4. The nanoparticle according to claim 3 , wherein said first linker comprises a group —(CH)— and/or —(OCHCH)— claim 3 , wherein n and m are independently ≥1.5. The nanoparticle according to any one of the preceding claims claim 3 , wherein said first linker is bound to the core via a terminal sulphur atom.6. The nanoparticle according to any one of the preceding claims claim 3 , wherein the at least one payload ligand comprises a therapeutic agent.7. The nanoparticle according to claim 6 , wherein the therapeutic agent is a chemotherapeutic or cytotoxic compound.8. The nanoparticle according to claim 7 , wherein the payload ligand comprises a ...

Nasal pharmaceutical compositions with a porous excipient

Described herein are nasal pharmaceutical compositions comprising a porous excipient and an active agent, wherein the active agent is loaded onto a surface of the porous excipient located inside pores of the porous excipient, and wherein the composition is adapted for nasal administration. Also described herein are methods of making and using nasal pharmaceutical compositions.

Multifunctional Metal Nanoparticles Having a Polydopamine-Based Surface and Methods of Making and Using the Same

The present invention provides nanoparticles including a metallic core having a length along each axis of from 1 to 100 nanometers and a coating disposed on at least part of the surface of the metallic core, wherein the coating comprises polydopamine, along with methods for making and using such nanoparticles. The metallic core may be gold, silver or iron oxide and the polydopamine coating may have other substances bound to it, such as silver, targeting ligands or antibodies, or other therapeutic or imaging contrast agents. The disclosed nanoparticles can be targeted to cells for treating cancer or bacterial infections, and for use in diagnostic imaging. 1. A nanoparticle comprising:(a) a metallic core having a length along each axis of from 1 to 100 nanometers; and(b) a coating disposed on at least part of the surface of the metallic core, wherein the coating comprises polydopamine.2. The nanoparticle of claim 22 , wherein the metallic core is a nanorod having a substantially cylindrical shape.3. The nanoparticle of claim 1 , wherein the coating is disposed on the entire surface of the metallic core.4. The nanoparticle of claim 1 , wherein the metallic core is selected from the group consisting of gold claim 1 , silver or iron oxide.5. The nanoparticle of claim 4 , wherein the metallic core consists essentially of gold.6. The nanoparticle of claim 1 , wherein the coating further comprises silver claim 1 , iron oxide claim 1 , or a mixture thereof.7. The nanoparticle of claim 1 , further comprising one or more antibodies claim 1 , polyethylene glycol claim 1 , functionalized polyethylene glycol claim 1 , or a mixture thereof bound to the coating.8. The nanoparticle of claim 7 , wherein the antibody is an anti-cancer cell surface receptor antibody or an anti-bacterial surface antibody.9. The nanoparticle of claim 1 , further comprising a polymer claim 1 , a polysaccharide claim 1 , a sugar-containing peptoid claim 1 , a pharmaceutical agent claim 1 , or a mixture ...

ACTIVE TARGETING OF CELLS BY MONOSIZED PROTOCELLS

In one aspect, the disclosure provides mesoporous silica nanoparticles (MSNPs), monodisperse populations of MSNPs and related protocells which exhibit cell binding specificity. For example, MSNPs and protocells of the disclosure may be used to target specific delivery of therapeutic agents to CD19 or EGFR expressing cancer cells, or target specific delivery of therapeutic agents to other cell types. Related protocells, pharmaceutical compositions and therapeutic and diagnostic methods are also provided. 1. A population of protocells comprising a lipid bi- or multi-layer , monodispersemesoporous silica nanoparticles (MSNPs), a cargo, and a CD19 targeting ligand, or an EGFR targeting ligand, wherein the MSNPs have a diameter ranging from about 1 nm to about 300 nm.2. The population of wherein the targeting ligand is an antibody claim 1 , an antibody fragment or a scFv.3. (canceled)4. The population of wherein the lipid bi- or multi-layer is PEGylated.5. (canceled)6. The population of wherein the cargo comprises peptides claim 1 , proteins claim 1 , antibodies claim 1 , nucleic acids claim 1 , or drugs.7. The population of wherein the drug comprises vincristine claim 6 , daunorubicin claim 6 , doxorubicin claim 6 , cytarabine claim 6 , L-asparaginase claim 6 , PEG-L-asparaginase claim 6 , etoposide claim 6 , teniposide claim 6 , 6-mercaptopurine claim 6 , methotrexate claim 6 , cyclophosphamide claim 6 , predisone claim 6 , dexamethasone claim 6 , imatinib claim 6 , dasatinib claim 6 , nilotinib claim 6 , ponatinib claim 6 , nelarabine claim 6 , rituximab claim 6 , blinatumumab claim 6 , or inotuzumab.8. The population of wherein the lipid bi- or multi-layer comprises DSPC claim 1 , cholesterol claim 1 , PEG-DSPC claim 1 , or a combination thereof.9. The population of wherein the amount of DSPC is about 45 mol % to about 80 mol % or about 50 mol % to about 78 mol %.10. (canceled)11. The population of wherein the amount of cholesterol is about 10 mol % to about 50 mol % ...

Polynucleotide encapsulation and preservation using self-assembling membranes

Polynucleotides such as DNA are stored inside vesicles formed from self-assembling membranes. The vesicles may be protocells, liposomes, micelles, colloidosomes, proteinosomes, or coacervates. The vesicles may include surface functionalization to improve polynucleotide encapsulation and/or to bind polynucleotides having specific sequences. Encapsulation in vesicles provides protection for the polynucleotides. Additional protection is provided by addition of one or more stabilizers. The stabilizer may be nucleic-acid stabilizers that stabilize the polynucleotides or may be a protective structural layer around the vesicles such as a layer of silica. A process for stably storing polynucleotides in vesicles and a process for recovering stored polynucleotides from vesicles are both disclosed. The polynucleotides may be used for storage of digital information.

Nanoparticle compositions and uses thereof

The present developments provide methods and compositions for treating and/or preventing autoimmune diseases. In certain aspects, the present disclosure relates to the use of short peptides loaded inside of nanoparticle nanospheres, nanocapsules, or PEGylated nanoparticles. Additionally, peptide-metal nanoparticle drug conjugates are described and disclosed. In some embodiments, these nanoparticles, whether polymer based or metal-conjugated, when linked or coupled to bioactive peptides provided herein, may be capable of interacting with CD40 proteins or CD40 complexes, and thereby may interfere with the ability of CD40 to interact with CD154. The present disclosure also relates to the use of such nanoparticle-peptide conjugates in reducing the inflammatory response, and in particular, the autoimmune inflammatory response. The present disclosure also relates to the use of such short peptides to prevent or reverse autoimmune disease, in particular in type 1 diabetes and multiple sclerosis, in individuals suffering from such diseases.

NANOPARTICLE DELIVERY SYSTEM

A conjugate () comprising a nanoparticle () for delivery of a drug to a treatment site in the body of a subject; a drug molecule () releasably linked to said nanoparticle (), wherein said drug molecule () has a therapeutic effect at the treatment site in the body of the subject; and a disease targeting molecule () releasably linked to said nanoparticle (); wherein upon said conjugate () being adjacent diseased tissue () of a subject, said disease targeting molecule () retains the conjugate () adjacent said diseased tissue (); said drug molecule () is released from said nanoparticle () so as to provide a therapeutic effect to said diseased tissue (); and said disease targeting molecule () is subsequently released from said nanoparticle () such that retention of the nanoparticle () is released, and such that the nanoparticle () is dispersible from said diseased tissue (). 1. A conjugate comprising:a nanoparticle for delivery of a drug to a treatment site in the body of a subject;a drug molecule releasably linked to said nanoparticle, wherein said drug molecule has a therapeutic effect at the treatment site in the body of the subject; and wherein upon said conjugate being adjacent diseased tissue of a subject, said disease targeting molecule retains the conjugate adjacent said diseased tissue;', 'said drug molecule is released from said nanoparticle so as to provide a therapeutic effect to said diseased tissue; and', 'said disease targeting molecule is subsequently released from said nanoparticle such that retention of the nanoparticle is released, and such that the nanoparticle is dispersible from said diseased tissue., 'a disease targeting molecule releasably linked to said nanoparticle;'}2. A conjugate according to claim 1 , wherein the nanoparticle is a nanodiamond which has a size in the range of from 25 nm to 80 nm.3. A conjugate according to claim 1 , wherein the nanoparticle is a nanodiamond which has a size in the range of from 35 nm to 65 nm.4. A conjugate ...

NANOCARRIER SYSTEMS FOR IMAGING AND DELIVERY OF ACTIVE AGENTS

Synthetic nanocarrier constructs and related compositions comprising a lipid-based bilayer membrane infused with one or more NK-92 cell membrane proteins, which encapsulates a liquid receiving interior space or coats at least a portion of a solid core. Methods of targeted delivery of an active/diagnostic/imaging agent to a specific cell type or a region of a patient by administering a plurality of nanocarrier constructs to the patient. MRI imaging methods and novel MRI contrast agent constructs are also disclosed. 1. A synthetic nanocarrier construct comprising a lipid-based bilayer membrane infused with one or more NK-92 cell membrane proteins.2. The nanocarrier construct of claim 1 , wherein said NK-92 cell membrane proteins are surface protein receptors.3. The nanocarrier construct of claim 2 , wherein said surface protein receptors are CD56 claim 2 , NKG2-D claim 2 , NKp30 claim 2 , NKp44 claim 2 , CD16 claim 2 , or a combination thereof.4. The nanocarrier construct of claim 1 , said lipid-based bilayer membrane comprising a mixture of lipids and NK-92 cell membrane phospholipids.5. The nanocarrier construct of claim 4 , wherein said lipids are selected from the group consisting of phosphoethanolamines claim 4 , phosphatidylcholines claim 4 , phosphoglycerols claim 4 , phosphatidic acids claim 4 , Sphingolipids claim 4 , Sphingomyelin claim 4 , and combinations thereof.6. The nanocarrier construct of claim 4 , wherein said membrane comprises at least two different types of lipids.7. The nanocarrier construct of claim 4 , further comprising cholesterol and/or oleic acid.8. The nanocarrier construct of claim 1 , wherein said NK-92 cell membrane proteins are located at the exterior surface of the lipid bilayer claim 1 , in the core of the lipid bilayer claim 1 , and/or at the interior surface the lipid bilayer.9. The nanocarrier construct of claim 1 , wherein said membrane encapsulates a liquid-receiving interior space.10. The nanocarrier construct of claim 9 , ...

COMPOSITION FOR INHIBITING ANGIOGENESIS COMPRISING NANOPARTICLE-VITREOUS BODY-BASED PROTEIN COMPLEX AS ACTIVE INGREDIENT, AND USE THEREOF

Provided is a nanoparticle-vitreous body-based protein complex, and more particularly, to a composition for inhibiting angiogenesis which includes the complex as an active ingredient, and a composition for preventing or treating an angiogenesis-related disease or a retinal disease. When the nanoparticle-vitreous body-based protein complex according to the subject matter is locally injected into the vitreous body, the complex exhibits significantly excellent binding strength with a vascular endothelial growth factor and thus can inhibit angiogenesis, thus being easily used to prepare a therapeutic agent for preventing, alleviating, or treating retinal and choroidal angiogenesis-related diseases. 17.-. (canceled)8. A method of screening a protein suitable for treating a retinal disease , the method comprising the following processes:(1) injecting nanoparticles into a vitreous body in vitro;(2) separating complexes of the nanoparticles and proteins in the vitreous body;(3) binding the complexes to a vascular endothelial growth factor (VEGF); and(4) selecting complexes bound to the VEGF.9. A method of inhibiting angiogenesis , including administering a pharmaceutically effective amount of a pharmaceutical composition to an individual , wherein the pharmaceutical composition comprises a complex consisting of nanoparticles and a vitreous body-based protein surrounding surfaces of the nanoparticles , as an active ingredient.10. The method of inhibiting angiogenesis of claim 9 , wherein the nanoparticles are gold or silica.11. The method of inhibiting angiogenesis of claim 9 , wherein the nanoparticles have a diameter of 20 nm to 100 nm.12. The method of inhibiting angiogenesis of claim 9 , wherein the angiogenesis is involved in retinopathy of prematurity claim 9 , diabetic macular edema (DME) claim 9 , diabetic retinopathy claim 9 , central serous (chorio)retinopathy claim 9 , age-related macular degeneration claim 9 , or proliferative retinopathy.13. The method of ...

LACTOFERRIN-CONJUGATED NANOPARTICLE COMPLEX AND USE THEREOF

The present invention relates to a lactoferrin-conjugated nanoparticle complex and a novel use thereof. In the nanoparticle complex according to the present invention, lactoferrin or polyethylene glycol-lactoferrin is bound to metal nanoparticles, and according to this construction, it can be confirmed that the metal nanoparticles are not only efficiently targeted to the brain tumor tissues, but also the stability of the metal nanoparticles can be maintained even in the in vivo conditions, and thus it is expected in the treatment of brain tumors to be treatable to targets by approaching more fundamentally. 1. A nanoparticle complex comprising gold nanoparticles , glutathione and lactoferrin covalently linked to said gold nanoparticles , and said lactoferrin is bound with polyethylene glycol.2. The nanoparticle complex according to claim 1 , wherein said glutathione is bound to the gold nanoparticles by disulfide bonds.3. The nanoparticle complex according to claim 1 , wherein said nanoparticle complex has an average diameter of 4 to 20 nm.4. The nanoparticle complex according to claim 1 , wherein said nanoparticle complex is orally administered.5. The nanoparticle complex according to claim 1 , wherein said nanoparticle complex is used for a photothermal or photodynamic treatment.6. The nanoparticle complex according to claim 1 , wherein said nanoparticle complex is used for a treatment of brain tumors. This application is a divisional of U.S. patent application Ser. No. 15/471,905, filed Mar. 28, 2017, entitled “LACTOFERRIN-CONJUGATED NANOPARTICLE COMPLEX AND USE THEREOF”, which application claims priority to and the benefit of Korean Patent Application No. 10-2016-0037860, filed on Mar. 29, 2016, the disclosures of which are incorporated herein by reference in their entirety.The present invention relates to a lactoferrin-conjugated nanoparticle complex and a use thereof.The aging rate in Korea is the fastest around the world, and demand for therapeutic agents of ...

Mitochondrial Function using a Poly-Oxygenated Metal Hydroxide

A method of treating a mammal comprising administering a therapeutically effective amount of a poly-oxygenated aluminum hydroxide composition to the mammal to improve mitochondrial function and efficiency, wherein the poly-oxygenated aluminum hydroxide composition comprises a clathrate containing available free oxygen gas (O) molecules. The poly-oxygenated aluminum hydroxide composition mitigates the development and the progression of sarcopenia, reduces muscle atrophy, and generates triphosphate (ATP). The poly-oxygenated aluminum hydroxide composition may have a particle size under 1 micron allowing it to improve the mitochondrial function. 1. A method of treating a mammal , comprising:{'sub': '2', 'administering a therapeutically effective amount of a poly-oxygenated aluminum hydroxide composition to the mammal to improve mitochondrial function and efficiency, wherein the poly-oxygenated aluminum hydroxide composition comprises a clathrate containing free oxygen gas (O) molecules.'}2. The method as specified in claim 1 , wherein the poly-oxygenated aluminum hydroxide composition mitigates the development and the progression of sarcopenia.3. The method as specified in claim 2 , wherein the poly-oxygenated aluminum hydroxide composition reduces muscle atrophy.4. The method as specified in claim 1 , wherein the poly-oxygenated aluminum hydroxide composition generates adenosine triphosphate (ATP).5. The method as specified in claim 1 , wherein the poly-oxygenated aluminum hydroxide composition has particles sized under 1 micron. This application is a Continuation-in-Part (CIP) of U.S. patent application U.S. Ser. No. 16/405,287 entitled A POLY-OXYGENATED METAL HYDROXIDE AND CBD filed May 7, 2019, which is a Continuation-in-Part (CIP) of U.S. patent application U.S. Ser. No. 15/983,922 entitled REDUCING THE PROLIFERATION OF CARCINOMA CELLS BY ADMINISTRATION OF A POLY-OXYGENATED METAL HYDROXIDE, which is a Continuation-in-Part (CIP) of U.S. patent application U.S. Ser. ...

SILICA NANOSPHERE FOR IMMUNOTHERAPY

The present disclosure relates to a field of hollow silica nanospheres. Particularly, the present disclosure relates to silica nanoparticles as adjuvant to induce or enhance immune response or as carrier to deliver antigen to a body. 1. A method for inhibiting tumor growth in a subject in need thereof , comprising administration of hollow silica nanospheres (HSNs) to the subject thereby increasing tumor-infiltrating immune cells in tumor , wherein the HSNs comprises a single or multi-layered silica shells , wherein each shell has meso-pores and encloses an closed hollow space , optionally the innermost hollow closed space has a solid silica core , wherein the space is defined by the distance between any two silica shells or the solid silica core , and wherein the hydrodynamic size of HSNs in a medium measured via Dynamics Light Scattering (DLS) is no greater than 150 nm , wherein the medium is biologically similar to or equivalent to phosphate buffered saline (PBS).2. The method of claim 1 , wherein the hydrodynamic size of HSNs is no greater than 100 nm.3. The method of claim 1 , wherein the administration route of HSNs can be systemic administration or local administration.4. The method of claim 3 , wherein the systemic administration is intravenous injection or infusion.5. A method for inducing an immune response in a subject in need thereof claim 3 , comprising administration of hollow silica nanospheres (HSNs) to the subject claim 3 , wherein the HSNs comprises a single or multi-layered silica shells claim 3 , wherein each shell has meso-pores and encloses an closed hollow space claim 3 , optionally the innermost hollow closed space has a solid silica core claim 3 , wherein the space is defined by the distance between any two silica shells or the solid silica core claim 3 , and wherein the hydrodynamic size of HSNs in a medium measured via Dynamics Light Scattering (DLS) is no greater than 200 nm claim 3 , wherein the medium is biologically similar to or ...

Near infrared absorbing dye-based composite particles exhibiting photothermal effect, method for manufacturing the same, and use thereof

The present invention relates to near-infrared-absorbing dye-based composite particles which exhibit a photothermal effect and/or photoacoustic signal upon photoirradiation, a preparation method thereof, and a use thereof. The near-infrared-absorbing composite particles comprise: a water-insoluble salt of a near-infrared-absorbing dye, which comprises anions of the near-infrared-absorbing dye and metal cations capable of forming a precipitation product with the anions of the near-infrared-absorbing dye; and particles of a polymeric surfactant, in which a water-insoluble salt of the near-infrared-absorbing dye is supported in the hydrophobic part of the polymeric surfactant.

LIGHT UPCONVERSION SILICA PARTICLES

A composition, method, and article of manufacture are disclosed. The composition and the article of manufacture include a silica particle and light upconversion molecules incorporated into the silica particle. The method includes obtaining sidechain-modified light upconversion molecules, and incorporating the sidechain-modified light upconversion molecules into a silica particle to form a light upconversion particle. 1. A composition , comprising:a silica particle; andlight upconversion molecules incorporated into the silica particle.2. The composition of claim 1 , wherein the light upconversion molecules comprise molecular sensitizers.3. The composition of claim 1 , wherein the light upconversion molecules comprise molecular annihilators.4. The composition of claim 1 , wherein the light upconversion molecules are matrix-bound in the silica particle.5. The composition of claim 1 , wherein the silica particle is a hybrid organic/inorganic silica particle.6. The composition of claim 1 , wherein the silica particle is porous.7. The composition of claim 6 , wherein the light upconversion molecules are incorporated into pores of the porous silica particle.8. The composition of claim 7 , wherein the pores are capped by a thermally sensitive polymer.9. A method claim 7 , comprising:obtaining sidechain-modified light upconversion molecules; andincorporating the sidechain-modified light upconversion molecules into a silica particle to form a light upconversion particle.10. The method of claim 9 , wherein the sidechain-modified light upconversion molecules comprise a molecular sensitizer claim 9 , a molecular annihilator claim 9 , or a mixture thereof.11. The method of claim 9 , further comprising forming a reaction environment claim 9 , the reaction environment comprising:the light upconversion particle;a photocatalyst; anda substrate.12. The method of claim 11 , wherein the photocatalyst is a cationic transition metal complex.13. The method of claim 9 , wherein the ...

Gold nano-delivery system for pain and cancer therapy

The present invention relates to development of a novel cannabinoid-based gold nanoparticle drug delivery system for intravenous or localized administration of cannabinoid drugs. More specifically, the gold nanoparticles with a specific size range are conjugated with various cannabinoid molecules (CBD and THC molecules) to synthesize a stable and biocompatible nano-delivery system suitable for both localized and intravenous administration.

OSTEOTROPIC NANOPARTICLES FOR PREVENTION OR TREATMENT OF BONE METASTASES

The present disclosure is directed to protocells or nanoparticles, which are optionally coated with a lipid bilayer, which can be used for targeting bone tissue for the delivery of bioactive agents useful in the treatment and/or diagnosis of bone cancer, often metastatic bone cancer which often occurs secondary to a primary cancer such as prostate cancer, breast cancer, lung cancer and ovarian cancer, among numerous others. These protocells or nanoparticles target bone cancer especially metastatic bone cancer with bioactive agents including anticancer agents and/or diagnostic agents for purposes of treating, diagnosing and/or monitoring the therapy of the bone cancer. Osteotropic protocells or nanoparticles, pharmaceutical compositions comprising a population of osteotropic protocells or nanoparticles and methods of diagnosing, treating and/or monitoring therapy of bone cancer are representative aspects. 1. A bone-cell targeting mesoporous silica nanoparticle (MSNP) , optionally with a supported lipid bilayer coating said nanoparticle , the MSNP comprising at least one bisphosphonate moiety , wherein the bisphosphonate moiety is conjugated to the nanoparticle or to the lipid bilayer , and optionally further comprising at least one cargo selected from the group consisting of at least one non-bisphosphonate anticancer agent , a reporter , a DNA that produces an anticancer effect in situ and RNA compound that produces an anticancer effect in situ.2. The nanoparticle of wherein the at least one bisphosphonate moiety is conjugated to the surface of the nanoparticle via a linker.3. The nanoparticle of wherein the at least one bisphosphonate moiety is conjugated to the nanoparticle via a zwitterionic molecule.4. The nanoparticle of wherein the zwitterionic molecule is a silane claim 3 , polyethylene glycol or block co-polymer.5. The nanoparticle of according to wherein the nanoparticle comprises the supported lipid bilayer.6. The nanoparticle of wherein the at least one ...

Silicon nanoparticle with platinum anti-cancer agent

Disclosed herein, inter alia, are compositions and methods of using the same for treating cancer.

Nanoparticle-protein complex for intracellular protein delivery

Various embodiments disclosed relate to a nanoparticle-protein complex for intracellular protein delivery. In various embodiments, the present invention provides a nanoparticle-protein complex including a nanoparticle including an amine-containing ligand. The nanoparticle-protein complex also includes a protein comprising a carboxylic acid-containing tag.

POLYPHOSPHATE-FUNCTIONALIZED INORGANIC NANOPARTICLES AS HEMOSTATIC COMPOSITIONS AND METHODS OF USE

A hemostatic composition is provided. The hemostatic composition includes a hemostatically effective amount of a hemostatic agent that includes a nanoparticle and a polyphosphate polymer attached to the nanoparticle. Also provided are medical devices and methods of use to promote blood clotting. 120.-. (canceled)21. A method of promoting blood clotting in a subject , the method comprising:administering to the subject a hemostatic composition for a period of time sufficient to at least initiate blood clotting,wherein the hemostatic composition comprises: a nanoparticle; and', 'a polyphosphate polymer attached to the nanoparticle., 'a hemostatically effective amount of a hemostatic agent comprising22. The method of claim 21 , wherein the administering comprises intravenously administering the hemostatic composition to the subject.23. The method of claim 21 , wherein the hemostatic composition initiates blood clotting through the FXa coagulation pathway in the subject.24. The method of claim 21 , wherein the subject has a coagulopathic condition and the method is effective for treating the coagulopathic condition in the subject.25. The method of claim 24 , wherein a concentration of a procoagulant factor in the subject is insufficient to have a hemostatic effect.26. The method of claim 24 , wherein the coagulopathic condition comprises dilution of a procoagulant factor in the subject.27. The method of claim 24 , wherein the coagulopathic condition comprises hypothermia in the subject.28. The method of claim 24 , wherein the coagulopathic condition comprises acidosis in the subject.29. The method of claim 24 , wherein the coagulopathic condition comprises an increase in an anticoagulant factor in the subject.30. The method of claim 21 , wherein the method further comprises administering a biologically active agent to the subject.31. The method of claim 30 , wherein the biologically active agent comprises a second hemostatic agent.32. The method of claim 31 , wherein the ...

COMPOSITIONS AND METHODS FOR TREATING DISEASE USING SALMONELLA T3SS EFFECTOR PROTEIN (SipA)

The invention provides compositions and methods for reducing one or more symptoms of disease by administering compositions comprising SipA. The invention's compositions and methods are particularly advantageous in reducing symptoms of diseases that are associated with overexpression of P-gp and/or p53. The invention's compositions and methods are useful in reducing cancer symptom and/or cancer multidrug resistance (MDR). The invention provides a method for reducing one or more symptoms of cancer in a mammalian subject in need thereof, comprising administering to said subject a composition comprising purified SipA. In one embodiment, said SipA is operably conjugated to a nanoparticle. In another embodiment, said cancer comprises cancer cells resistant to at least one cytotoxin. 1. A method for reducing one or more symptoms of cancer in a mammalian subject in need thereof , comprising administering to said subject(a) a composition comprising purified SipA operably conjugated to a targeting agent that specifically binds to cells of said cancer, and(b) One or more cytotoxins,said administering reduces said one or more symptoms of said cancer.2. The method of claim 1 , wherein said SipA is operably conjugated to a nanoparticle.3. The method of claim 1 , wherein said cancer comprises cancer cells resistant to at least one cytotoxin.4. The method of claim 1 , wherein said cancer comprises cancer cells that overexpress one or more of P-gp and p53 compared to a control cell.5. (canceled)6. The method of claim 1 , wherein said SipA is administered in an amount that is effective in one or more ofa) reducing the level of expression of P-gp in cells of said cancer,b) reducing the level of un-cleaved P-gp in cells of said cancer, andc) increasing the level of expression of PERP in cells of said cancer.7. The method of claim 1 , wherein said method further comprises determining the level of expression of P-gp in cells of said cancer.8. The method of claim 1 , wherein said SipA is ...

Iron oxide nanoparticles and methods of use thereof

The presently disclosed subject matter relates to iron oxide nanoparticle compositions and formulations thereof for: (1) the treatment and elimination of biofilms; (2) the prevention of biofilm formation; (3) biofilm extracellular matrix degradation; (4) the inhibition of bacterial viability and growth within the biofilm; and (5) the prevention of tooth or apatitic demineralization. In particular, the presently disclosed subject matter provides a composition for the prevention and treatment of an oral disease (e.g., dental caries) that includes one or more iron oxide nanoparticles and hydrogen peroxide.

DELIVERING FUNCTIONAL NUCLEIC ACIDS TO MAMMALIAN CELLS VIA BACTERIALLY-DERIVED, INTACT MINICELLS

Intact bacterially derived minicells containing functional nucleic acids or plasmids encoding functional nucleic acids can reduce, in targeted mammalian cells, drug resistance, apoptosis resistance, and neoplasticity, respectively. Methodology that employs minicells to deliver functional nucleic acids, targeting the transcripts of proteins that contribute to drug resistance or apoptosis resistance, inter alia, can be combined with chemotherapy to increase the effectiveness of the chemotherapy. 160-. (canceled)61. A composition comprising:(a) a first intact, bacterially derived minicell comprising a payload selected from a drug, a functional nucleic acid, and a plasmid comprising a segment that encodes a functional nucleic acid molecule;(b) a second intact, bacterially derived minicell comprising a payload selected from a drug, a functional nucleic acid, and a plasmid comprising a segment that encodes a functional nucleic acid molecule, wherein the first and second minicell payloads are different; and(c) a pharmaceutically acceptable carrier.62. The composition of claim 61 , wherein the drug is selected from chemotherapeutic agents claim 61 , immunosuppressive agents claim 61 , cytokines claim 61 , cytotoxic agents claim 61 , nucleolytic compounds claim 61 , radioactive isotopes claim 61 , receptors claim 61 , and pro-drug activating enzymes.63. The composition of claim 61 , wherein the functional nucleic acid is an siRNA claim 61 , shRNA claim 61 , miRNA claim 61 , RNAi claim 61 , antisense claim 61 , or ribozyme molecule.64. The composition of claim 61 , wherein the plasmid comprises a promoter dependent on RNA polymerase operably linked to the segment that encodes a functional nucleic acid.65. The composition of claim 61 , wherein the functional nucleic acid targets the transcript of a protein that contributes to drug resistance.66. The composition of claim 61 , wherein the functional nucleic acid molecule targets the transcript of MRP2 claim 61 , BCR-ABL claim 61 ...

THERANOSTIC COMPOSITIONS AND USES THEREOF

Provided herein are theranostic compositions comprising a Janus nanoparticle-coated microbubble that are useful for imaging (e.g., MRI, or ultrasound) and for delivering a therapeutic or bioactive agent (e.g., nucleic acid(s), drugs, etc), among other uses. 1. A composition comprising: a microbubble with a Janus nanoparticle associated with the surface , wherein the Janus nanoparticle comprises a superparamagnetic iron oxide nanoparticle having a nucleic acid delivery face and a targeting face , and wherein the nucleic acid delivery face and the targeting face are distinct from one another.2. The composition of claim 1 , wherein the Janus nanoparticle is less than 75 nm in size.3. The composition of claim 1 , wherein the superparamagnetic iron oxide nanoparticle is less than 20 nm in size.4. The composition of claim 1 , wherein the Janus nanoparticle is asymmetrically shaped.5. The composition of claim 4 , wherein the Janus nanoparticle is avocado shaped.6. (canceled)7. The composition of claim 1 , wherein the targeting face comprises a targeting moiety selected from the group consisting of: a targeting peptide claim 1 , a polyclonal antibody claim 1 , a monoclonal antibody claim 1 , an antibody binding fragment claim 1 , a composite antibody claim 1 , a recombinant antibody claim 1 , a cell penetrating peptide and a matrix interacting peptide.8. (canceled)9. The composition of claim 1 , wherein the carrier face comprises a polymer.10. The composition of claim 9 , wherein the polymer comprises a polyelectrolyte.11. The composition of claim 10 , wherein the polyelectrolyte is a cationic polyelectrolyte or an anionic polyelectrolyte.12. The composition of claim 1 , wherein the Janus nanoparticle comprises an iron oxide core with a PEG brush.13. The composition of claim 12 , wherein the PEG brush is a mixed 3:1 short-long PEG brush.14. (canceled)15. The composition of claim l claim 12 , wherein the iron oxide core is encapsulated within a polymer.16. The composition of ...

Methods and compositions for targeted delivery of protein fragments

The present invention is related to the field of targeted drug delivery. In particular, the particles and compositions described herein are used to deliver drugs to treat the diseases and conditions of interest. These particles and compositions include, but are not limited to, the lipopeptide complexes that mimic human high-density lipoproteins but contain apolipoprotein fragments or combination thereof.

Nanoparticle-Based Therapy of Inflammatory Disorders

The present invention provides a nanoparticle comprising: a core comprising a metal and/or a semiconductor; and a plurality of ligands covalently linked to the core, wherein said ligands comprise: (i) at least one dilution ligand comprising a carbohydrate, glutathione or a polyethyleneglycol moiety; and (ii) a ligand of the formula MTX-L-, wherein MTX-L-represents methotrexate coupled to said core via a linker L. Also provided are pharmaceutical compositions of the nanoparticle, including gel formulations, and medical uses of the nanoparticle and pharmaceutical compositions, including for the treatment of an inflammatory or autoimmune disorder, such as psoriasis. 1. A nanoparticle comprising:a core comprising a metal and/or a semiconductor; anda plurality of ligands covalently linked to the core, wherein said ligands comprise:(i) at least one dilution ligand comprising a carbohydrate, glutathione or a polyethyleneglycol moiety; and(ii) a ligand of the formula MTX-L-, wherein MTX-L-represents methotrexate coupled to said core via a linker L.2. The nanoparticle of claim 1 , wherein L comprises a linear chain of 2 to 100 atoms in length between the methotrexate and the core.3. The nanoparticle of or claim 1 , wherein L comprises a group —(CH)— and/or —(OCHCH)— claim 1 , wherein n and m are independently 1.4. The nanoparticle of any one of the preceding claims claim 1 , wherein L is of the formula: L-Z-L{'sub': 1', '2', '1', '2', '1', '2, 'wherein Lcomprises a first linker portion comprising a C2-C12 glycol and/or C1-C12 alkyl chain, Lcomprises a second linker portion comprising a C2-C12 glycol and/or C1-C12 alkyl chain, wherein Land Lmay be the same or different, and wherein Z represents a divalent linker group of up to 10 atoms linking Land Land Z comprises at least 2 heteroatoms.'}5. The nanoparticle of claim 4 , wherein Z comprises a 3-10 membered carboaromatic claim 4 , a 3-10 membered carbocycle claim 4 , a 3-10 membered heterocycle claim 4 , a 3-10 membered ...

Substances Containing AuCs and Preparation Method and Use Thereof

Disclosed are a pharmaceutical use of a gold cluster and a substance containing the gold cluster and the preparation method and use thereof. The gold cluster and substance containing the gold cluster can inhibit the aggregation of Aβ and α-syn, has excellent effects on the levels of cell models and animal models, and can be used to prepare drugs for preventing and treating Alzheimer's disease and/or Parkinson's disease. 1. A pharmaceutical composition for preventing or treating Alzheimer's disease in a subject , said pharmaceutical composition comprising a substance containing gold clusters (AuCs); wherein said substance comprises:AuCs; anda ligand Y coating the AuCs externally, anda pharmaceutically acceptable excipient.2. The pharmaceutical composition according to claim 1 , wherein the AuCs has a gold core diameter smaller than 3 nm.3. The pharmaceutical composition according to claim 1 , wherein the ligand Y is one selected from the group consisting of L(D)-cysteine and its derivatives claim 1 , cysteine-containing oligopeptides and their derivatives claim 1 , and other thiol-containing compounds.4. The pharmaceutical composition according to claim 3 , wherein the L(D)-cysteine and its derivatives are L(D)-cysteine claim 3 , N-isobutyryl-L(D)-cysteine (L(D)-NIBC) claim 3 , or N-acetyl-L(D)-cysteine (L(D)-NAC).5. The pharmaceutical composition according to claim 3 , wherein the cysteine-containing oligopeptides and their derivatives are preferably cysteine-containing dipeptides claim 3 , cysteine-containing tripeptides or cysteine-containing tetrapeptides.6. The pharmaceutical composition according to claim 5 , wherein the cysteine-containing dipeptides are L cysteine-L-arginine dipeptide (CR) claim 5 , L-arginine-L-cysteine dipeptide (RC) claim 5 , L-histidine-L-cysteine dipeptide (HC) claim 5 , or L-cysteine-L-histidine dipeptide (CH).7. The pharmaceutical composition according to claim 5 , wherein the cysteine-containing tripeptides are glycine-L-cysteine-L- ...

Substances Containing AuCs and Preparation Method and Use Thereof

Disclosed are a pharmaceutical use of a gold cluster and a substance containing the gold cluster and the preparation method and use thereof. The gold cluster and substance containing the gold cluster can inhibit the aggregation of Δβ and α-syn, has excellent effects on the levels of cell models and animal models, and can be used to prepare drugs for preventing and treating Alzheimer's disease and/or Parkinson's disease. 1. A pharmaceutical composition for preventing or treating Parkinson's disease in a subject , said pharmaceutical composition comprising a substance containing gold clusters (AuCs); wherein said substance comprises:AuCs;a ligand Y coating the AuCs externally, anda pharmaceutically acceptable excipient.2. The pharmaceutical composition according to claim 1 , wherein the AuCs has a gold core diameter smaller than 3 nm.3. The pharmaceutical composition according to claim 1 , wherein the ligand Y is one selected from the group consisting of L(D)-cysteine and its derivatives claim 1 , cysteine-containing oligopeptides and their derivatives claim 1 , and other thiol-containing compounds.4. The pharmaceutical composition according to claim 3 , wherein the L(D)-cysteine and its derivatives are L(D)-cysteine claim 3 , N-isobutyryl-L(D)-cysteine (L(D)-NIBC) claim 3 , or N-acetyl-L(D)-cysteine (L(D)-NAC).5. The pharmaceutical composition according to claim 3 , wherein the cysteine-containing oligopeptides and their derivatives are cysteine-containing dipeptides claim 3 , cysteine-containing tripeptides or cysteine-containing tetrapeptides.6. The pharmaceutical composition according to claim 5 , wherein the cysteine-containing dipeptides L-cysteine-L-arginine dipeptide (CR) claim 5 , L-arginine-L-cysteine dipeptide (RC) claim 5 , L-histidine-L-cysteine dipeptide (HC) claim 5 , or L-cysteine-L-histidine dipeptide (CH).7. The pharmaceutical composition according to claim 5 , wherein the cysteine-containing tripeptides glycine-L-cysteine-L-arginine tripeptide (GCR) ...

Delivery of Oligonucleotide-Functionalized Nanoparticles

The present invention relates to compositions and methods for delivering an oligonucleotide-functionalized nanoparticle. 1. A method of dermal delivery of an oligonucleotide-functionalized nanoparticle comprising the step of:administering a therapeutically effective amount of a composition comprising the oligonucleotide-functionalized nanoparticle and a dermal vehicle to the skin of a patient in need thereof.2. The method of wherein the delivery of the oligonucleotide-functionalized nanoparticle is transdermal.3. The method of wherein the delivery of the oligonucleotide-functionalized nanoparticle is topical.4. The method of claim 1 , said dermal vehicle comprising an ointment.5. The method of wherein the ointment is Aquaphor.6. A method of regulating gene expression comprising the step of:administering a therapeutically effective amount of a composition comprising an oligonucleotide-functionalized nanoparticle to skin under conditions wherein the oligonucleotide-functionalized nanoparticle hybridizes to a target and regulates gene expression.7. The method of wherein the target is a polypeptide.8. The method of wherein the target is a polynucleotide.9. The method of wherein the polynucleotide is RNA.10. The method of or wherein the administration of the composition ameliorates a skin disorder.11. The method of wherein the skin disorder is selected from the group consisting of cancer claim 10 , a genetic disorder claim 10 , aging claim 10 , inflammation claim 10 , infection claim 10 , and cosmetic disfigurement.12. The method of wherein the cancer is selected from the group consisting of squamous cell carcinoma claim 11 , basal cell carcinoma claim 11 , breast cancer and melanoma.13. The method of wherein the target is a gene product expressed by a gene selected from the group consisting of Ras claim 12 , IκBα claim 12 , hedgehog claim 12 , B-Raf claim 12 , Akt and cyclin D.14. The method of wherein the genetic disorder is selected from the group consisting of ...

TOPICAL SILK COMPOSITIONS AND METHODS OF USING

Methods of protecting skin of a mammal by application of silk-derived compositions useful for treating or preventing a wide variety of skin conditions. Silk solutions and silk mats are prepared and applied to the skin surface. The silk compositions may be self-adhesive or sutured to cover a wound or area of skin exposed to physical stresses and strains, thereby preventing a wound and/or promoting wound healing. 1. A method of protecting skin of a mammal comprising:applying a solution of silk fibroin fibers to the skin of a mammal; andapplying a silk fibroin mat over the solution of silk fibroin fibers applied to the skin of the mammal;thereby increasing the elastic modulus of the skin of the mammal2. The method of claim 1 , wherein the silk fibroin fibers in the solution have a diameter in a range of about 1 to about 1 claim 1 ,000 nm.3. The method of claim 1 , wherein the silk fibroin fibers in the solution are obtained from another solution containing a dissolved silkworm silk or a dissolved spider silk.4. (canceled)5. (canceled)6. (canceled)7. The method of claim 1 , wherein the silk fibroin fibers in the solution have a sericin content of less than 5%.8. (canceled)9. The method of claim 1 , wherein the silk fibroin fibers in the solution have a concentration of about 0.1 to about 25 weight percent of the solution.10. The method of claim 1 , wherein the solution of silk fibroin fibers is an aqueous solution or an alcohol solution.11. (canceled)12. The method of claim 1 , wherein the solution of silk fibroin fibers further comprises a biocompatible polymer selected from the group comprising polyethylene oxide (PEO) claim 1 , polyethylene glycol (PEG) claim 1 , collagen claim 1 , fibronectin claim 1 , keratin claim 1 , polyaspartic acid claim 1 , polylysine claim 1 , alginate claim 1 , chitosan claim 1 , chitin claim 1 , hyaluronic acid claim 1 , pectin claim 1 , polycaprolactone claim 1 , polylactic acid claim 1 , polyglycolic acid claim 1 , polyhydroxyalkanoates ...

MESOPOROUS SILICA NANOPARTICLES AND SUPPORTED LIPID BI-LAYER NANOPARTICLES FOR BIOMEDICAL APPLICATIONS

The present disclosure is directed to methods of producing monosized protocells from monosized mesoporous silica nanoparticles (mMSNPs) and their use for targeted drug delivery formulations and systems and for biomedical applications. The present disclosure is also directed in part to a multilamellar or unilamellar protocell vaccine to deliver full length viral protein and/or plasmid encoded viral protein to antigen presenting cells (APCs) in order to induce an immunogenic response to a virus. 124-. (canceled)25. A multilamellar protocell comprising:a nanoporous silica or metal oxide core and a multilamellar lipid bi-layer coating said core, the multilamellar lipid bi-layer comprising at least an inner lipid bi-layer and an outer lipid bi-layer and optionally an inner aqueous layer and/or an outer aqueous layer, said inner aqueous layer separating said core from said inner lipid bi-layer and said outer aqueous layer separating said inner lipid bi-layer from said outer lipid bi-layersaid outer lipid bi-layer comprising: at least one Toll-like receptor (TLR) agonist; a fusogenic peptide; and optionally at least one cell targeting species which selectively binds to a target on antigen presenting cells (APCs);said inner lipid bi-layer comprising an endosomolytic peptide.26. A unilamellar protocell comprising:a nanoporous silica or metal oxide core and a lipid bi-layer coating said core and an optional aqueous layer separating said core from said lipid bi-layer,said lipid bi-layer comprising: at least one Toll-like receptor (TLR) agonist; a fusogenic peptide; optionally at least one cell targeting species which selectively binds to a target on antigen presenting cells (APCs); and an endosomolytic peptide.27. The protocell of claim 25 , wherein said Toll-like receptor (TLR) agonist comprises Pam3Cys claim 25 , HMGB1 claim 25 , Porins claim 25 , HSP claim 25 , GLP claim 25 , BCG-CWS claim 25 , HP-NAP claim 25 , Zymosan claim 25 , MALP2 claim 25 , PSK claim 25 , dsRNA claim ...

Compositions and methods for delivering therapeutic and imaging agents to the sinuses and middle ear

The present invention features compositions and methods for targeted delivery of a therapeutic or imaging agent to a site accessible through the nose or mouth that may be difficult to effectively and efficiently treat otherwise (e.g., the middle ear, sinuses, or lung). The therapeutic or imaging agent is deposited onto a magnetic nanoparticle that is drawn through a passage or tissue that leads away from the nose or mouth by a magnetic field applied over the targeted site (e.g., by magnets within the ear canal or surrounding the ear).

METAL OXIDE NANOPARTICLE FOR CELL LYSIS

A nanostructure comprises a MOX NP and a bidentate ligand on a surface of the MOX NP. A cancer recognition molecule is covalent coupled to the surface of the MOX NP via the bidentate ligand. A biocatalyst is also coupled to the surface of the MOX nanoparticle via the bidentate ligand. The cancer recognition molecule includes a structure configured to selectively recognize a corresponding antigen on a surface of a cancer cell and bind to the antigen. The biocatalyst is structured to selectively catalyze the oxidation of a light emitting compound to produce photons. The photons transform the MOX NPs into an excited state such that the MOX NPs generate reactive oxygen species (ROS) in the vicinity of the cancer cells in the excited state. The reactive oxygen species lyse or cause apoptosis in the cancer cells in situ. The biocatalyst includes luciferase and the light emitting compound includes luciferin. 1. A nanostructure , comprising:a metal oxide (MOX) nanoparticle;a bidentate ligand disposed on a surface of the MOX nanoparticle;a cancer recognition molecule covalently coupled to the surface of the MOX nanoparticle via the bidentate ligand; anda biocatalyst coupled to the surface of the MOX nanoparticle via the bidentate ligand,wherein, the cancer recognition molecule comprises a structure configured to selectively recognize a corresponding antigen on a surface of a cancer cell and bind to the antigen, and wherein the biocatalyst is structured to selectively catalyze the oxidation of a light emitting compound to produce photons, the photons transforming the MOX nanoparticles into an excited state, the MOX nanoparticles generating reactive oxygen species in the vicinity of the cancer cells in the excited state, the reactive oxygen species configured to at least one of lyse the cancer cell or cause apoptosis in the cancer cell.2. The nanostructure of claim 1 , wherein the MOX nanoparticles include at least one of TiO claim 1 , FeO claim 1 , CeO claim 1 , ZrO claim 1 , ...

Methods and pharmaceutical compositions for the treatment of hiv infection

The present invention relates to methods and pharmaceutical compositions for the treatment of HIV infection. In particular, the present invention relates to a method of treating HIV infection in a subject in need thereof comprising administering the subject with a therapeutically effective amount of the oligonucleotide comprising the sequence as set forth in SEQ ID NO:

DISCRETE CARBON NANOTUBES WITH TARGETED OXIDATION LEVELS AND STABLE GEL FORMULATIONS THEREOF

Discrete, individualized carbon nanotubes having targeted, or selective, oxidation levels and/or content on the interior and exterior of the tube walls are claimed. Such carbon nanotubes can have little to no inner tube surface oxidation, or differing amounts and/or types of oxidation between the tubes' inner and outer surfaces. These new discrete carbon nanotubes are useful in plasticizers, which can then be used as an additive in compounding and formulation of elastomeric, thermoplastic and thermoset composite for improvement of mechanical, electrical and thermal properties. 1. In a composition comprising a plurality of discrete carbon nanotubes , wherein the discrete carbon nanotubes comprise an interior and exterior surface , the interior surface comprising an interior surface oxidized species content and the exterior surface comprising an exterior surface oxidized species content , the improvement comprising: a stable gel composition wherein the plurality of discrete carbon nanotubes are coated with a fluid which prevents the carbon nanotubes from agglomerating , the stable gel comprising from about 1 to about 20% solids by weight.2. The improvement of claim 1 , wherein the stable gel comprises from about 2 to about 15% solids by weight.3. The improvement of claim 1 , wherein the stable gel comprises from about 3 to about 7% solids by weight.4. The improvement of claim 1 , wherein the wherein the interior surface oxidized species content differs from the exterior surface oxidized species content by at least about 20% claim 1 , and as high as 100%.5. The improvement of claim 1 , wherein the interior surface oxidized species content comprises from about 0.01 to less than about 1 percent relative to carbon nanotube weight and the exterior surface oxidized species content comprises more than about 1 to about 3 percent relative to carbon nanotube weight.6. The improvement of claim 1 , wherein the stable gel is substantially free from surfactants.7. The improvement ...

Compositions and methods for inhibiting the biological activity of soluble biomolecules

The disclosure provides, among other things, compositions that bind to and inhibit the biological activity of soluble biomolecules, as well as pharmaceutical compositions thereof. Also provided herein are a number of applications (e.g., therapeutic applications) in which the compositions are useful.

Nano-Enhanced Optical Delivery of Exogenous Molecules to Cells and Tissues

Principles of the present disclosure are directed to novel methods and devices for efficient and targeted delivery of impermeable exogenous materials such as small molecules, proteins, antibodies, and genes into cells, both in vitro as well as in vivo, which is of great importance for drug, vaccine and gene delivery for various therapeutic applications. Specifically, the invention provides device and method for targeted nano-enhanced optical delivery of opsins for vision restoration in patients with retinal photodegeneration by conventional intravitreal/sub-retinal injection of gold nano-rods and opsin plasmids followed by scanned/spatially modulated laser beam matching the pathological areas determined by Fundoscopy, OCT or scanning ophthalmoscope. 1. A method of delivering a first agent to a first cell type comprising:a. providing a first functionalized nanoparticle to a population of cells, whereby said first nanoparticle binds a first cell type;b. providing to said population of cells a first agent;c. providing a first irradiation of said population of cells with a near-infrared (NIR) laser beam tuned to the Surface Plasmon resonance (SPR) of said first nanoparticles, whereby said first cell types bound by said first nanoparticles allow entry of said first agent into said first cell type.2. The method according to claim 1 , wherein following said first irradiation a second cell type remains incapable of allowing entry of said first agent.3. The method according to claim 1 , wherein said first cell type is in a population of cells and said method further comprises:a. providing a second functionalized nanoparticle to said population of cells, whereby said second nanoparticle binds a second cell type;b. providing to said population of cells a second agent;c. providing a second irradiation of said population of cells with a laser tuned to the SPR of said second nanoparticle, whereby said second cell types bound by said second nanoparticle allow entry of said second ...

Nanoparticle production

The present invention provides a process for producing nanoparticles, comprising: providing a first liquid comprising a metal salt and at least one species of ligand having a functional group capable of binding to a metal surface, providing a second liquid comprising a reducing agent; providing at least one liquid droplet generator operable to generate liquid droplets, causing the at least one liquid droplet generator to form liquid droplets of the first liquid, passing the liquid droplets through a gas to contact the second liquid so as to cause the metal salt and the at least one species of ligand to come into contact with the reducing agent, thereby causing self-assembly of nanoparticles, said nanoparticles having a core of said metal and a corona comprising a plurality of said ligands covalently bound to the core. Also provided are nanoparticles produced by the process of the invention and use of such nano particles in medicine.

Particles and compositions comprising the same for transfection

The present invention relates to the localized delivery of nucleic acids to cells using polyelectrolyte assemblies in the form of particles that are prepared by layer-by-layer deposition of nucleic acid and specific polycation. It also relates to compositions comprising said particles and methods for the treatment of disorders or diseases by administration of such particles.

CURCUMIN-BASED MAGNETIC NANOSTRUCTURED SYSTEM FOR DUAL RESPONSE OF IMAGING AND THERAPEUTICS

Silica nanocarriers hybridized with superparamagnetic iron oxide nanoparticles (“SPIONs”) and curcumin through equilibrium or enforced adsorption technique. Methods for dual delivery of SPIONs and curcumin to a target for diagnosis or therapy, for example, for SPION-based magnetic resonance imaging or for targeted delivery of curcumin to a cell or tissue. The technique can be extend to co-precipitation of mixed metal oxide involving Ni, Mn, Co and Cu oxide. The calcination temperature can be varied from 500-900° C. The nanocombination is functionalized with chitosan, polyacrylic acid, PLGA or another agent to increase its biocompatibility in vivo. 1. A composition comprising:a platform of nanoporous structured silica selected from the group consisting of SiSBA-16, Q-10 silica, mesocellular foam, silicalite, mesosilicalite, SiKIT-6, ULPFDU-12 or SiMCM-41, high silica zeolites based on ZSM-5, Beta, USY, Mordenite, ZSM-11, ZSM-12, ZSM-22, ZSM-23, mesocarbon, graphene oxide and mixtures thereof, superparamagnetic iron oxide nanoparticles (“SPIONS”) in an amount ranging from about 5 wt % to about 30 wt % based on total weight of the composition, andat least one curcuminoid through equilibrium or enforced adsorption technique.2. The composition of claim 1 , wherein the platform of nanoporous structured silica comprises MSU-foam.3. The composition of claim 1 , wherein the platform of nanoporous structured silica comprises SiSBA-16.4. The composition of claim 1 , wherein the platform of nanoporous structured silica comprises Q-10.5. The composition of claim 1 , wherein the SPIONs comprise FeOor a mixture of NiFeO claim 1 , CuFeO claim 1 , MnFeOor CoFeO.6. The composition of claim 1 , wherein the SPIONs comprise γ-FeO.7. The composition of claim 1 , wherein the SPIONs have an average particle size ranging from about 7 to about 18 nm when the platform of nanoporous structured silica is MSU-foam; about 9 to 21 nm when the platform of nanoporous structured silica is SiSBA-16; ...

Oligonucleotide specific uptake of nanoconjugates

Disclosed are nanoparticles functionalized with an oligonucleotide and a domain, wherein the domain increases cellular uptake of the nanoparticles. The domain is a sequence of nucleobases or phosphate groups, such as a poly thymidine (polyT) sequence or a phosphate polymer (C3 residue) and may be located 5′ to the oligonucleotide 3′ to the oligonucleotide, within, or colinear with the oligonucleotide. Usage of the nanoparticles including modulating gene regulation is contemplated.

METHOD FOR ISOLATING AND DETECTING CANCER STEM CELLS

Disclosed is the in vitro use of at least one lectin for marking cancer stem cells of hormone-dependent cancer target organs, selected from the lectins lectin II (MAH-II), lectin (EEL), lectin I (PTL-I) and lectin II (GSL-II), in particular at least two lectins selected from MAH-II, EEL, PTL-I and GSL-II, in particular the two lectins MAH-II and EEL, in order to obtain cancer stem cells of labeled hormone-dependent cancer target organs in a biological sample. 113-. (canceled)14Maackia amurensisEuonymus europaeusPsophocarpus tetragonolobusGrijfonia simplicifolia. An in vitro method of labeling by using of at least one lectin for the labeling of cancer stem cells of hormone-dependent cancer target organs , chosen from the lectins lectin II (MAH-II) , lectin (EEL) , lectin I (PTL-I) and lectin II (GSL-II) , to obtain labeled cancer stem cells of hormone-dependent cancer target organs , in a biological sample.15. The in vitro method according to claim 14 , wherein at least two lectins are chosen from MAH-II claim 14 , EEL claim 14 , PTL-I and GSL-II.16. The in vitro method according to claim 15 , wherein at least two lectins are used claim 15 , said at least two lectins being in equal amount or in unequal amount claim 15 , in particular in unequal amount in a weight ratio of 2:1 claim 15 , and preferably both lectins being MAH-II/EEL in unequal amount in a 2:1 weight ratio.17. The in vitro method according to claim 14 , wherein the MAH-II lectin recognizes O-linked glycans claim 14 , the PTL-I lectin recognizes-linked glycans claim 14 , the EEL lectin recognizes galactosylated glycans claim 14 , and the GSL-II lectin recognizes N-linked glycans.18. The in vitro method according to claim 17 , wherein the MAH-II lectin recognizes the disialyl-T group [NeuAc α2-3Gal α1-3 (NeuAc α2-6) GalNAc].19. The in vitro method according to claim 17 , wherein the PTL-I lectin recognizes the Gal α 1-3 (Fuc α 1-2) Gal and GalNAc α 1-3 (Fuc α 1-2) Gal groups of the B and A antigens.20. ...

NANOCLUSTER CAPPED MESOPOROUS NANOPARTICLES, METHODS OF MAKING AND USE

Embodiments of the present disclosure describe a conjugate comprising a mesoporous nanoparticle having a plurality of pores, wherein the mesoporous nanoparticle is positively charged, wherein an active agent is disposed in the pore; and a plurality of metal nanoclusters, wherein the metal nanocluster has a negative charge, wherein a gate agent is attached to the metal nanocluster. Embodiments of the present disclosure also describe a method of using a conjugate comprising exposing a conjugate to microbes sufficient to release an active agent and treating the microbes with the released active agent. Embodiments of the present disclosure further describe a method of using a conjugate comprising exposing a conjugate to microbes and detecting a presence of the microbes. 1. A conjugate , comprisinga mesoporous nanoparticle having a plurality of pores, wherein the mesoporous nanoparticle is positively charged, wherein an active agent is disposed in the pore;a plurality of metal nanoclusters, wherein the metal nanocluster has a negative charge, wherein a gate agent is attached to the metal nanocluster;wherein an electrostatic interaction causes the metal nanoclusters to seal in the active agent in the pore, wherein the gate agent is positioned on the outside surface of the conjugate so that it interacts with a gate target, wherein the active agent moves out of the pore upon removal of the metal nanocluster.2. The conjugate of claim 1 , wherein the mesoporous nanoparticle is a mesoporous silicon nanoparticle.3. The conjugate of claim 1 , wherein the active material is selected from the group consisting of: an antimicrobial agent claim 1 , anti-corrosion agent claim 1 , antioxidant agent claim 1 , antiscalant agent claim 1 , and a combination thereof.4. The conjugate of claim 3 , wherein the antimicrobial agent is an antibacterial agent.5. The conjugate of claim 4 , wherein the antibacterial agent is kanamycin.6. The conjugate of claim 1 , wherein the metal nanocluster is a ...

5-aminolevulinic acid conjugated quantum dot nanoparticle

A 5-aminolevulinic acid conjugated quantum dot nanoparticle is useful for treating cancer by administering the 5-aminolevulinic acid conjugated quantum dot nanoparticle in photodynamic therapy as a precursor of both a fluorescence label and a photosensitizer.

Glycosaminoglycan-coated metallic nanoparticles and uses thereof

The present invention is a composition comprising a plurality of nanoparticles of at least one noble metal each coated with a plurality of linker molecules, at least some of which are attached to at least one of a plurality of glycosaminoglycan chains.

HOLLOW SILICA NANOPARTICLES WITH ENCAPSULATED BIOACTIVE INGREDIENTS, PREPARATION PROCESS AND APPLICATIONS THEREOF

The present invention relates to hollow silica nanoparticles as a drug delivery system loading bioactive ingredients. Particularly, the present invention relates to silica nanoparticles comprising multi-layered silica shells with one or more bioactive ingredients encapsulated within and their applications in drug delivery; and processes of preparing the same. 1. A silica nanoparticle , comprisinga multi-layered silica shells, wherein each shell has meso-pores and encloses a closed hollow space, optionally the innermost hollow closed space has a solid silica core; andone or more bioactive ingredients encapsulated within the space, wherein the bioactive ingredient has a size larger than the pore size of the shell encapsulating it, and wherein the bioactive ingredient in each space may be the same or different.2. The silica nanoparticle according to claim 1 , which has a particle size ranging from about 20 nm to about 500 nm.3. The silica nanoparticle according to claim 1 , which has a particle size ranging from about 20 nm to about 150 nm.4. The silica nanoparticle according to claim 1 , which has two or more shells.5. The silica nanoparticle according to claim 1 , wherein each shell has organosilica residues.6. The silica nanoparticle according to claim 1 , wherein the pore size of the shell is less than 5 nm.7. The silica nanoparticle according to claim 1 , wherein the shells each independently have a thickness of about 2 nm to about 15 nm.8. The silica nanoparticle according to claim 1 , wherein the size of the space is adjustable.9. The silica nanoparticle according to claim 1 , wherein the size of the space between the shells ranges from 2 nm to 75 nm.10. The silica nanoparticle according to claim 1 , wherein the bioactive ingredient with or without a surface modification can be dispersed in or dissolved in an aqueous phase.11. The silica nanoparticle according to claim 1 , wherein the bioactive ingredient is an enzyme claim 1 , a protein drug claim 1 , an ...

METHODS OF ADMINISTERING IMMUNOSUPPRESSANTS HAVING A SPECIFIED PHARMACODYNAMIC EFFECTIVE LIFE AND THERAPEUTIC MACROMOLECULES FOR THE INDUCTION OF IMMUNE TOLERANCE

This invention relates to methods that provide immunosuppressants and therapeutic macromolecules that are administered within a pharmacodynamically effective window of the immunosuppressants to induce immune tolerance to the therapeutic macromolecules. The methods allow shifting the immune response in favor of tolerogenic immune response development specific to the therapeutic macromolecule. 1. A method comprising:administering an immunosuppressant to a subject in a first class of subjects at an administration dose that provides an administration pharmacodynamic effective-life, with respect to a therapeutic macromolecule, the duration of which pharmacodynamic effective-life ranges from a minimum of 20 hours to a maximum of 1 month; andadministering the therapeutic macromolecule to the subject within the duration of the administration pharmacodynamic effective-life of the immunosuppressant;wherein the therapeutic macromolecule and immunosuppressant are not attached to one another, and the therapeutic macromolecule is not attached to a synthetic nanocarrier.2. The method of claim 1 , wherein the method further comprises:determining the administration dose of the immunosuppressant based on a test dose of the immunosuppressant;wherein the test dose possesses a test pharmacodynamic effective-life with respect to the therapeutic macromolecule the duration of which pharmacodynamic effective-life ranges from a minimum of 20 hours to a maximum of 1 month in a second class of subjects.3. An immunosuppressant for use in a method of inducing tolerance to a therapeutic macromolecule claim 1 , said method comprising: (a) administering the immunosuppressant to a subject at a dose sufficient to elicit a pharmacodynamic effective-life the duration of which pharmacodynamic effective-life is between 20 hours to 1 month; and (b) administering the therapeutic macromolecule to said subject within the duration of said pharmacodynamic effective-life claim 1 , wherein the therapeutic ...

MICRO AND NANOPARTICULATE COMPOSITIONS COMPRISING ANTI-MICROBIALLY ACTIVE GROUPS

The present invention relates to anti-microbially active micro and nanoparticles, compositions comprising same, and use thereof for inhibiting bacterial growth and biofilm formation on surfaces or devices, e.g., dental surfaces or devices. The present invention further discloses methods of making such anti-microbially active micro or nanoparticles. 3. The particle of claim 1 , wherein the anti microbial active group is at a surface density of between 0.001-4 groups per 1 sq nm of the surface of the core.4. The particle of claim 1 , wherein Ris a terpenoid moiety.5. The particle of claim 4 , wherein Ris a C-Calkyl.613-. (canceled)14. The particle of claim 1 , wherein the core is an inorganic material claim 1 , Ris nothing claim 1 , alkyl claim 1 , terpenoid moiety claim 1 , cycloalkyl claim 1 , aryl claim 1 , heterocycle claim 1 , a conjugated alkyl claim 1 , alkenyl claim 1 , alkynyl or any combination thereof and Ris a terpenoid moiety.15. The particle of wherein the inorganic material is selected from silica claim 14 , silicate (SiO) claim 14 , surface activated metal and metal oxide.16. The particle of claim 15 , wherein said inorganic material comprises:{'sub': '2', '(a) silica (SiO) in a form selected from the group consisting of amorphous silica, dense silica, aerogel silica, porous silica, mesoporous silica and fumed silica;'}{'sub': '4', 'sup': '−4', '(b) glasses or ceramics of silicate (SiO) selected from the group consisting of aluminosilicate, borosilicate, barium silicate, barium borosilicate and strontium borosilicate;'}(c) surface activated metals selected from the group consisting of silver, gold, platinum, palladium, copper, zinc and iron;(d) metal oxides selected from the group consisting of zirconium dioxide, titanium dioxide, vanadium dioxide, zinc oxide, copper oxide and magnetite; or(e) artificial or natural zeolites.17. The particle of claim 15 , wherein said core has a solid uniform morphology with low porosity or a porous morphology having ...

THERAPEUTIC NANOPARTICLES AND METHODS OF USE THEREOF

Provided herein are therapeutic nanoparticles having a diameter of between 10 nm to 30 nm, and containing a polymer coating, and a nucleic acid containing a sequence complementary to a sequence within a micro-RNA identified as having a role in cancer cell metastasis or anti-apoptotic activity in a cancer cell (e.g., miR-10) or a sequence within an mRNA encoding a pro-apoptotic protein that is covalently linked to the nanoparticle. Also provided are pharmaceutical compositions containing these therapeutic nanoparticles. Also provided herein are methods of decreasing cancer cell invasion or metastasis in a subject having a cancer and methods of treating a metastatic cancer in a lymph node in a subject that require the administration of these therapeutic nanoparticles to a subject. 1. A therapeutic nanoparticle , wherein said nanoparticle:comprises a polymer coating, anda nucleic acid comprising at least 10 contiguous nucleotides within the sequence of CACAAATTCGGTTCTACAGGGTA (SEQ ID NO: 18) that is covalently linked to the therapeutic nanoparticle at a molar ratio between 1:8 and 1:30 oligonucleotides per nanoparticle.2. The therapeutic nanoparticle of claim 1 , wherein the nucleic acid comprises SEG ID NO: 18.3. The therapeutic nanoparticle of claim 1 , wherein the nucleic acid comprises at least one modified nucleotide.4. The therapeutic nanoparticle of claim 3 , wherein the at least one modified nucleotide is a locked nucleotide.5. The therapeutic nanoparticle of claim 1 , wherein the nanoparticle further comprises a covalently-linked fluorophore.6. The therapeutic nanoparticle of claim 5 , wherein the fluorophore absorbs near-infrared light.7. The therapeutic nanoparticle of claim 5 , wherein the fluorophore is covalently-linked to the nanoparticle through a chemical moiety comprising a secondary amine.810.-. (canceled)11. The therapeutic nanoparticle of claim 1 , wherein the polymer coating comprises dextran.12. The therapeutic nanoparticle of claim 1 , wherein ...

SYSTEM FOR THERMOTHERAPY TREATMENT OR PREVENTION OF ANTIMICROBIAL RESISTANT OR BIOFILM INFECTIONS

The system comprises a support to receive a nanoparticle assembly (NPA) and to be conveyed towards a localized area of an organism infected or at risk to be infected by microorganisms; said nanoparticle assembly (NPA) comprising a plurality of nanoparticles (NPs) each one (NP) having a metal core and a surface surrounding said metal core, the metal core being reactable to thermal energy; and an energy unit () configured to apply at least one thermal shot on said localized area exposed to the nanoparticle assembly, increasing the temperature of said localized area via the. nanoparticle assembly (NPA), so enabling a nanotheranostic multimodal antimicrobial therapy, wherein the metal core being made of silver, gold, iron or a mixture of silver and gold. 2. The system of claim 1 , wherein at least one antimicrobial agent (Ab) being attached to the nanoparticle surface claim 1 , said at least one antimicrobial agent (Ab) by itself being configured to act as aptamer of said localized area.3. The system according to claim 1 , wherein the surface of each nanoparticle (NP) comprises a mPEG covering in order the nanoparticle not being recognized by the organism as a foreign body.4. The system according to previous claims claim 1 , further comprising a control unit configured to control that said increase of temperature of the localized area after the at least one thermal shot is applied not exceeds 40° C.5. The system according to claim 2 , wherein the nanoparticles (NPs) comprise the metal core joint to the at least one antimicrobial agent.6. The system according to claim 1 , wherein said thermal shot comprises one of near infrared energy claim 1 , low-intensity pulsed ultrasound energy claim 1 , low ultrasound energy claim 1 , phototherapy claim 1 , low voltage electric heating claim 1 , low voltage electric heating with electrolysis or radiotherapy.7. The system according to claim 1 , wherein the support includes at least one of a mesh claim 1 , a vascular or urinary ...

USE OF NANO-SIZED CLAY CRYSTALLITES TO RESTORE ADHESION AMONG TUMOR AND AGING STEM CELLS

A method for enhancing or restoring adhesion to cells that have partially or completely loss the ability to adhere to a substrate or other cells using nanosized clay crystallites. 1. A method for treating a cancer , neoplasm , tumor or proliferative disease , disorder or condition comprising contacting cells associated with a cancer , neoplasm , tumor or proliferative disease , disorder or condition with nanosized smectite for a time and in an amount sufficient to increase the adhesion of the cells to a substrate , to each other , or to other cells compared to otherwise identical cells not treated with the nanosized smectite.2. The method of claim 1 , wherein said cells are primary cancer claim 1 , neoplasm claim 1 , or tumor cells.3. The method of claim 1 , wherein said cells are primary cancer claim 1 , neoplasm claim 1 , or tumor cells which are localized to an organ or tissue.4. The method of claim 1 , wherein said cells are cancer claim 1 , neoplasm claim 1 , or tumor cells localized to lymph nodes.5. The method of claim 1 , wherein said cells have metastasized to other parts of the body other than the organ claim 1 , tissue or lymph nodes.6. The method of claim 1 , wherein the nanosized smectite comprises Na-montmorillonite crystallites.7. The method of claim 1 , wherein the nanosized smectite has an average diameter of no more than 25 nm.8. The method of claim 1 , wherein the contacting comprises exposing the cells to a concentration of no more than 10 mg/ml of the smectite.9. The method of claim 1 , wherein the nanosized smectite has a CEC value of at least 130 meq/100 g.10. The method of claim 1 , wherein said contacting increases the adhesion of breast claim 1 , cervical claim 1 , colon claim 1 , prostate claim 1 , or lung cancer cells to cells in an organ in which they originated.11. The method of claim 1 , wherein said contacting increases adhesion of the cells to extracellular matrix (ECM) in an organ in which they originated.12. The method of that is ...

Magnetic Nanoparticle-Polymer Complexes and uses Thereof

The present invention relates to magnetic nanoparticles coated with block copolymers. The invention further relates to methods of increasing cellular uptake of magnetic nanoparticles and use of the coated magnetic particles to selectively kill cancer cells, treat cancer, detect cancer, and for biomedical imaging. 1. A magnetic nanoparticle polymer complex (MNPC) comprising a magnetic nanoparticle coated with one or more polymers , such as a block copolymer , such as an amphiphilic block copolymer.23-. (canceled)4. The MNPC of claim 1 , wherein the at least one block copolymer comprises a polyacid block.5. The MNPC of claim 4 , wherein the polyacid block is polyacrylic acid or polymethacrylic acid.6. The MNPC of claim 1 , wherein the at least one block copolymer is polyacrylic acid-poloxamer.7. (canceled)8. The MNPC of claim 1 , wherein the at least one polymer is attached to the nanoparticle by a polyelectrolyte chain claim 1 , hydrophilic nonionic polymer claim 1 , or anchoring group claim 1 , such as by a covalent link.9. (canceled)10. The MNPC of claim 8 , wherein the polyelectrolyte chain is a polyanion or a polycation.11. (canceled)12. The MNPC of claim 8 , wherein the hydrophilic nonionic polymer is poly(ethylene oxide) claim 8 , poly(2-methyl-2-oxazoline) claim 8 , poly(2-ethyl-2-oxazoline claim 8 , or polysarcosine.13. The MNPC of claim 1 , wherein the nanoparticle is hydrophobically modified and non-covalently linked to a hydrophobic block of the at least one block copolymer.14. The MNPC of claim 1 , wherein the nanoparticle is non-covalently linked to a hydrophilic block of the at least one block copolymer.15. The MNPC of claim 1 , wherein the MNPC comprises a micelle formed by hydrophilic and hydrophobic blocks of the at least one block copolymer.16. (canceled)17. The MNPC of claim 1 , wherein the nanoparticle has a diameter of less than about 50 nm.18. (canceled)19. The MNPC of claim 1 , wherein the MNPC has a diameter of less than about 100 nm.20. The ...

Nitric oxide-releasing particles for nitric oxide therapeutics and biomedical applications

The presently disclosed subject matter relates to nitric oxide-releasing particles for delivering nitric oxide, and their use in biomedical and pharmaceutical applications.

TITANIUM NITRIDE PLASMONIC NANOPARTICLES FOR CLINICAL THERAPEUTIC APPLICATIONS

Disclosed herein are nanoparticle-based plasmonic solutions to therapeutic applications employing titanium nitride (TiN) and other non-stoichiometric compounds as the plasmonic material. Current solutions are suboptimal because they require complex shapes, large particle sizes, and a narrow range of sizes, in order to achieve plasmonic resonances in the biological window. The nanoparticles discloses herein provide plasmonic resonances occurring in the biological window even with small sizes, simple shapes, and better size dispersion restrictions. Local heating efficiencies of such nanoparticles outperform currently used Au and transition metal nanoparticles. The use of smaller particles with simpler shapes and better heating efficiencies allows better diffusion properties into tumor regions, larger penetration depth of light into the biological tissue, and the ability to use excitation light of less power. 1. A method of destroying a defective cell in a human body , for local-heating clinical therapeutic application , comprising:chemically synthesizing titanium nitride nanoparticles;coupling surfactants to said nanoparticles;injecting said nanoparticles with coupled surfactants into a body having the defective cells;said surfactants binding said nanoparticles to the defective cell;directing an electromagnetic radiation at said nanoparticles from an external source of radiation, wherein said radiation is emitted at a resonant wavelength corresponding to a resonance of said nanoparticles resonance, thus delivering energy to the nanoparticles and raising a temperature of said nanoparticles to form a heat source;wherein said heat source increases a temperature of the defective cell to destroy only the defective cell without seriously affecting a surrounding tissue.2. The method of claim 1 , wherein the defective cell is a cancer cell.3. The method of claim 1 , wherein the defective cell is a fat cell.4. The method of claim 1 , wherein the nanoparticles remain stable ...

TARGETED NANOPARTICLE CONJUGATES

A composition for treating a disorder in a subject includes a polyethylene glycolylated (PEGylated) nanoparticle, at least one hydrophobic therapeutic agent coupled to the surface of the nanoparticle; and at least one targeting moiety coupled to polyethylene glycol of the nanoparticle for targeting the composition to a cell associated with disorder. 117-. (canceled)18. A method for treating cancer comprising:(a) contacting a cancer cell with an effective dose of a composition comprising:a polyethylene glycolylated (PEGylated) nanoparticle;at least one hydrophobic anti-cancer agent non-covalently coupled to the surface of the nanoparticle, wherein the at least one hydrophobic anti-cancer agent has an amino or amine functionality for attachment to the surface of the nanoparticle; andat least one targeting moiety coupled to polyethylene glycol of the nanoparticle for targeting the composition to a cancer cell, wherein the at least one anti-cancer agent is released from the nanoparticle and differentially up taken by the cancer cell upon targeting with reduced nanoparticle accumulation in the cancer cell.19. The method of claim 18 , wherein the anti-cancer agent comprises Phthalocyanine 4.20. The method of claim 19 , further comprising exposing the cancer cell to light claim 19 , thereby inducing cytoxic effects of Phthalocyanine 4 up taken by the cancer cell.21. The method of claim 18 , wherein the at least one targeting moiety comprises a polypeptide that binds to epidermal growth factor receptor (EGFR).22. The method of claim 21 , wherein the polypeptide comprises an epidermal growth factor (EGF) peptide having the amino acid sequence of SEQ ID NO: 1.23. A method of treating brain cancer in a subject in need thereof claim 21 , the method comprising:administering systemically to the subject with brain cancer a therapeutically effective amount of a composition comprising:a polyethylene glycolylated (PEGylated) nanoparticle;at least one hydrophobic anti-cancer agent non ...

Particle-Nucleic Acid Conjugates and Therapeutic Uses Related Thereto

This disclosure relates to particles conjugated to therapeutic nucleic acids. In certain embodiments, the nucleic acid comprises a sequence that catalytically cleaves RNA, e.g., DNAzyme or RNAzyme. In certain embodiments, the particles contain nucleic acids with both DNAzyme and/or RNAzyme and siRNA sequences. The cleaving nucleic acids optionally comprise a sequence functioning to hybridize to a target of interest and/or the particles are further conjugated to a targeting moiety. In certain embodiments, conjugated particles are used in the treatment or prevention of cancer or viral infections or bacterial infections. In certain embodiments, conjugated particles are used in detecting metal ions and other small molecule analyte.

Methods of Performing Neutron Capture Therapy

Biodegradable Periodic Mesoporous Organosilica (BPMO) nanomaterials and methods of making BPMOs loaded with Neutron Capture Agents are disclosed herein. Consequently, the BPMOs loaded with Neutron Capture Agents provide a method of treating cancer, immunological disorders and other disease by utilizing a Neutron Capture Therapy modality. 1) A method of performing neutron capture therapy in the treatment of human cancer comprising:a) loading a biodegradable periodic mesoporous organosilica (BPMO) nanomaterial with neutron capture agent, wherein the BPMO is modified with a disulfide bond, a tetrasulfide bond, or a protease sensitive bond;b) administering the loaded BPMO into a human cancer tumor, whereby said loaded BPMO accumulates into a human cancer tumor cell; andc) irradiating the loaded BPMO with neutrons.2) The method of claim 1 , whereby the neutron capture agent comprises the Boron isotope B or a derivative thereof.3) The method of claim 1 , wherein the neutron capture agent comprises B-4 borono L-phenylalanine (BPA).4) The method of claim 1 , whereby the neutron capture agent comprises the Lithium isotope Li or a derivative thereof.5) The method of claim 1 , whereby the neutron capture agent comprises the Cadmium isotope Cd or a derivative thereof.6) The method of claim 1 , whereby the neutron capture agent comprises the Samarium isotope Sm or a derivative thereof.7) The method of claim 1 , whereby the neutron capture agent comprises the Gadolinium isotope Gd or a derivative thereof.8) The method of claim 1 , whereby the neutron capture agent comprises the Helium isotope He or a derivative thereof.9) The method of claim 1 , whereby the neutron capture agent comprises an isotope of Au or a derivative thereof.10) The method of claim 1 , wherein the neutron capture therapy is administered as a monotherapy.11) A method of performing neutron capture therapy in the treatment of human cancer comprising:a) loading a biodegradable periodic mesoporous organosilica ( ...

DNA-FUNCTIONALIZED SCAFFOLDS FOR DRUG CAPTURE APPLICATIONS

This disclosure is directed to structured compositions, including DNA-functionalized scaffolds, for drug capture, and methods and devices for sequestering chemotherapeutics from physiological fluids using the functionalized scaffolds. 1. A structured composition comprising DNA operatively linked to a scaffold through an organic and/or inorganic surface of the scaffold , wherein the DNA is linked to the organic or inorganic surface by attachment to an intermediary linking group.2. The structured composition of claim 1 , where the scaffold is in the form of a sheet claim 1 , tube claim 1 , microparticle claim 1 , macroparticle claim 1 , nanoparticle claim 1 , nanotube claim 1 , nanofiber claim 1 , microfiber claim 1 , fiber claim 1 , wire claim 1 , membrane claim 1 , mesh claim 1 , or web.3. The structured composition of claim 1 , wherein the linking group comprises one or more internal covalent aliphatic or aromatic amide claim 1 , amine claim 1 , ester claim 1 , ether claim 1 , thioamide claim 1 , thioester claim 1 , or thioether bonds claim 1 , or a coordinative ligand linkage to a transition metal.4. The structured composition of claim 1 , wherein the DNA is genomic DNA.5. The structured composition of claim 1 , wherein the DNA is linked to the linking group by:(a) a covalent aliphatic or aromatic amide, amine, ester, ether, thioamide, thioester, or thioether bond; or(b) intercalation or an electrostatic, pi-pi, and/or hydrogen-bonding mechanisms with a moiety on the linking group; or(c) bonding to a cis-platin-like moiety covalently attached to the linking group.6. The structured composition of claim 1 , wherein the scaffold and/or the organic or inorganic surface comprises an organic polymer.7. The structured composition of claim 6 , wherein the organic polymer contains a lithographically defined pattern.8. The structured composition of claim 6 , that comprises a three-dimensional (3D) architected polymer lattice.9. The structured composition of claim 6 , ...

Neurodegenerative Disorder Treatment Method

A method of treatment is disclosed herein. The method includes administering to a patient in need thereof a biocompatible drug by at least one of intravenously, systemically, intravitreally, through the choroid, in the cerebrospinal fluid (CSF), topically, through the conjunctival mucosa, through the nasal mucosa, through the cornea, through the retinal optic nerve, through the nasal mucosa olfactory nerve, in the brain, in the spinal cord, the biocompatible drug comprising one or more cell pathway inhibitors together with one or more complement pathway inhibitors and/or one or more TGF beta inhibitors, the patient having one or more neurodegenerative disorders. The administration of the biocompatible drug to the patient treats the one or more neurodegenerative disorders, reduces the symptoms associated with the one or more neurodegenerative disorders, and/or alleviates the one or more neurodegenerative disorders.

Scintillator nanocrystal-containing compositions and methods for their use

There are provided, inter alia, compositions including a scintillator nanocrystal linked to a chemical agent moiety through a scintillator-activated photocleavable linker, and methods of use thereof.

SIDE CHAIN MODIFIED PEPTOIDS USEFUL AS STRUCTURE-STABILIZING COATINGS FOR BIOMATERIALS

The current invention pertains compositions and methods to generate compositions providing stability to biomolecules, including providing physiologically stable and functional DNA origami-based drug/gene delivery carriers by surface coating with the oligo-ethylene glycol conjugated peptoids of Formulas (I), (II), and (III). 2. The composition according to claim 1 , wherein R claim 1 , R claim 1 , R claim 1 , R claim 1 , R claim 1 , R claim 1 , R claim 1 , and Rare independently —(CH)—Calkyne claim 1 , —((CH)—O)—CH claim 1 , —((CH)—O)—CH claim 1 , or —(CH)—NH.3. The composition according to of claim 1 , wherein at least one of R-Rcomprise a positively charged group; and R-Rdo not comprise a positively charged group.4. The composition according to claim 1 , wherein R claim 1 , R claim 1 , R claim 1 , R claim 1 , R claim 1 , R claim 1 , R claim 1 , and Rare independently selected from the group consisting of —(CH)—NH claim 1 , —(CH)—NH claim 1 , —(CH)—NH claim 1 , —(CH)—NH claim 1 , —(CH)—NH claim 1 , —(CH)—NH claim 1 , —(CH)—NH claim 1 , —(CH)—Calkyne claim 1 , —((CH)—O)—CH claim 1 , —((CH)—O)—CH claim 1 , and —(C-C)alkylene-N.8. The composition according to claim 1 , wherein the compound of Formula (I) claim 1 , is conjugated to an antibody claim 1 , imaging reagent claim 1 , biomaterial claim 1 , biomolecule claim 1 , glycan claim 1 , polymer claim 1 , or a peptoid.9. A drug delivery carrier comprising a pre-defined nucleic acid nanostructure and a compound of Formula (I) claim 1 , (II) claim 1 , or (III).10. A stabilized complex comprising:a pre-defined nucleic acid nanostructure;a compound of Formula (I), (II), or (III); anda drug molecule or protein.11. The stabilized complex according to claim 10 , wherein an antibody is conjugated to the compound of Formula (I) claim 10 , (II) claim 10 , or (III).12. A method of stabilizing a pre-defined nucleic acid nanostructure claim 10 , said method comprising:(i) complexing a pre-defined nucleic acid nanostructure with a ...

Nano-Carrier, Complex of Anticancer Drug and Nano-Carrier, Pharmaceutical Composition Thereof, Method for Manufacturing the Complex, and Method for Treating Cancer by Using the Pharmaceutical Composition

The present invention relates to a nano-carrier for an anticancer drug, which comprises: a metal nanoparticle; and a polynucleotide for connecting with an anticancer drug having a pyrimidine group or a purine group, wherein the polynucleotide is connected to a surface of the metal nanoparticle, and the anticancer drug is bound to the polynucleotide through the pyrimidine group or the purine group. In addition, the present invention also provides a complex of an anticancer drug and a nano-carrier, a pharmaceutical composition thereof, a method for manufacturing the complex, and a method for treating a cancer by using the pharmaceutical composition.

Methods and compositions for attenuating gene expression modulating anti-viral transfer vector immune responses

Provided herein are methods and related compositions for administering viral transfer vectors and antigen-presenting cell targeted immunosuppressants.

REDUCING THE PROLIFERATION OF CARCINOMA CELLS BY ADMINISTRATION OF A POLY-OXYGENATED METAL HYDROXIDE

A colloid or crystalline solution with the addition of poly-oxygenated metal hydroxide particles. The solution is configured to treat a condition of a mammal, including a human individual and an animal, including a depletion of hemoglobin and hemorrhagic shock. The solution can be intravenously administered. In some embodiments, the poly-oxygenated metal hydroxide is an aluminum poly-oxygenated hydroxide, such as O×66™. The poly-oxygenated metal hydroxide may have particles having a diameter of less than or equal to 1 um, and specifically having a diameter of less than or equal to 100 nm. 1. An oxygen enabled solution , comprising:a fluid; anda quantity of a poly-oxygenated metal hydroxide material disposed in the fluid and forming a colloid or crystalline solution.2. The oxygen enabled solution as specified in wherein the poly-oxygenated metal hydroxide material is configured to provide bioavailable oxygen molecules to a mammal when administered to the mammal.3. The oxygen enabled solution as specified in wherein the solution is a 75-90% colloid or crystalline solution with 10-25% addition of the poly-oxygenated metal hydroxide material.4. The oxygen enabled solution as specified in wherein the solution is a 75-90% colloid with 10-25% addition of the poly-oxygenated metal hydroxide material.5. The oxygen enabled solution as specified in wherein the fluid is phosphate buffered saline (PBS).6. The oxygen enabled solution as specified in wherein the fluid is a lactated Ringers solution (LRS).7. The oxygen enabled solution as specified in wherein the solution is a 75-90% crystalline solution with 10-25% addition of the poly-oxygenated metal hydroxide material.8. The oxygen enabled solution as specified in wherein the fluid is phosphate buffered saline (PBS).9. The oxygen enabled solution as specified in wherein the solution has a concentration range of 0.1 mg/l to 1000 mg/l.10. The oxygen enabled solution as specified in wherein the poly-oxygenated metal hydroxide ...

Methods and compositions for attenuating gene editing anti-viral transfer vector immune responses

Provided herein are methods and related compositions for administering viral transfer vectors and antigen-presenting cell targeted immunosuppressants.

SILICON DIOXIDE NANOPARTICLES AND THE USE THEREOF FOR VACCINATION

The invention relates to ultrasmall, monodisperse nanoparticles comprising silicon dioxide to the surface of which at least one antigen is attached. The nanoparticles can be used for the immunoprophylaxis or immunotherapy of cancer. The invention also relates to a method for the targeting of antigens at antigen-presenting cells and for the activation of the immune system, where the efficiency of targeting and/or immunoactivation are set via the particle characteristics. The invention also relates to a method for the active and passive immunisation of a mammal. 135.-. (canceled)36. A method for providing an adjuvant immune response , comprising administering nanoparticles of silicon dioxide to a patient in need thereof , wherein the nanoparticles have a size of at least 5 nm up to 150 nm.37. The method of claim 36 , wherein the nanoparticles have a size of 5 to 50 nm.38. The method of claim 36 , wherein the nanoparticles are monodisperse.39. The method of claim 38 , wherein the nanoparticles are non-porous.40. The method of claim 36 , wherein the nanoparticles are administered parenterally.41. The method of claim 36 , wherein the nanoparticles are passively targeted at antigen-presenting cells.42. The method of claim 36 , wherein the nanoparticles are targeted with a targeting efficiency that is adjusted via the size of the nanoparticles.43. The method of claim 36 , additionally comprising administering an antigen.44. The method of claim 43 , wherein the antigen is attached to a surface functionality on the nanoparticles.45. The method of claim 43 , wherein neither the surface functionality nor the antigen is a major histocompatibility (MHC) molecule.46. The method of claim 44 , wherein the surface functionality is a linker to which the antigen is covalently bonded on nanoparticles.47. The method of claim 44 , wherein the surface functionality forms a zeta-potential to which the antigen is adsorbed on the nanoparticles.48. The method of claim 36 , for generating an ...

Use of Single Dendritic Wedge Cell Penetrating Peptides to Facilitate Cellular Delivery of Nanoparticles and Nanoparticles Carrying Cargos

Nanoparticles (and optionally a cargo such as a drug) can be delivered to cells by attaching just a single dendritic peptide to the nanoparticle. The dendritic peptide includes a polyhisitidine motif and a hinge and a spacer connecting the polyhistidine to a lysine-based dendritic wedge displaying at least two copies of a cell-penetrating peptide motif. 1. A method of delivering a nanoparticle to a cell comprising:contacting a living cell with a nanoparticle bound to a single dendritic peptide thereby causing entry of the nanoparticle into the cell,wherein the dendritic peptide comprises a polyhisitidine motif and a hinge and a spacer connecting the polyhistidine to a lysine-based dendritic wedge displaying at least two copies of the peptide sequence RRRRRRRRRFG (SEQ ID No: 2).2. The method of claim 1 , wherein the nanoparticle is also bound to a cargo which is delivered to the cell with the nanoparticle.3. A method of delivering a nanoparticle to a cell comprising:contacting a living cell with a nanoparticle bound to a single dendritic peptide thereby causing entry of the nanoparticle into the cell,wherein the dendritic peptide comprises a hexahistidine motif connected to a lysine-based dendritic wedge displaying at least two copies of the peptide sequence RRRRRRRRRFG (SEQ ID No: 2) via a hinge and spacer comprising six prolines and two glycines.4. The method of claim 3 , wherein the nanoparticle is also bound to a cargo which is delivered to the cell with the nanoparticle.5. A method of delivering a nanoparticle to a cell comprising:contacting a living cell with a nanoparticle bound to a single dendritic peptide thereby causing entry of the nanoparticle into the cellwherein the dendritic peptide comprises a polyhisitidine motif and a hinge and a spacer connecting the polyhistidine to a lysine-based dendritic wedge displaying at least two copies of the peptide sequence RRRRRRRRRFG (SEQ ID No: 2); andwherein the nanoparticle is free of any other cell-penetrating ...

COMPOSITIONS AND METHODS FOR DELIVERY OF RNA

The disclosure provides nanoemulsion compositions and methods of making and using thereof to deliver a bioactive agent such as a nucleic acid to a subject. The nanoemulsion composition comprises a hydrophobic core based on inorganic nanoparticles in a lipid nanoparticle that allows imaging as well as delivering nucleic acids. Methods of using these particles for treatment and vaccination are also provided. 1. A nanoemulsion composition comprising a plurality of nanoemulsion particles , wherein the plurality of nanoemulsion particles comprise:a hydrophobic core comprising a mixture of a liquid oil and a solid inorganic nanoparticle;a cationic lipid;a hydrophilic surfactant;a hydrophobic surfactant; anda nucleic acid, wherein the nucleic acid modulates innate immune response and is complexed with the nanoemulsion particles.2. The nanoemulsion composition of claim 1 , wherein the nucleic acid is RNA.3. The nanoernuision composition of claim 2 , wherein the RNA is double-stranded RNA.4. The nanoemulsion composition of claim 1 , wherein the nucleic acid is DNA.5. The nanoemulsion composition of claim 1 , wherein the nucleic acid is a TLR agonist.6. The nanoemulsion composition of claim 5 , wherein the TLR agonist is a TLR3.7. The nanoemulsion composition of claim 1 , wherein the nucleic acid is RIG-I agonist.8. The nanoemulsion composition of claim 1 , wherein the hydrophobic surfactant is selected from the group consisting of sorbitan monostearate claim 1 , sorbitan monooleate claim 1 , and sorbitan trioleate.9. The nanoemulsion composition of claim 1 , wherein cationic lipid is selected from the group consisting of 1 claim 1 ,2-dioleoyloxy-3-(trimethylammonium)propane (DOTAP); 3b-[N—(N′ claim 1 ,N′-dimethylaminoethane)-carbamoyl]cholesterol (DC Cholesterol); dimethyldioctadecylammonium (DDA); 1 claim 1 ,2-dimyristoyl-3-trimethylammoniumpropane (DMTAP) claim 1 , dipalmitoyl(C16:0)trimethyl ammonium propane (DPTAP); distearoyltrimethylammonium propane (DSTAP); N-[1-(2 ...

A PROCESS FOR THE PREPARATION OF BIO-ORGANIC COATED GOLD AND SILVER NANOPARTICLES USING BLUE LIGHT

The present invention relates to a process which uses blue light to form bio-organic coated silver and gold nanoparticles for various applications. The present invention particularly relates to increasing the rates of reaction and widening the scope of tethering a range of biomolecules on the metal nanoparticles. The examples demonstrate that the biomolecules immobilized on the nanoparticles still retain many aspects of their structural elements which allow them to bind to their native binding partners and/or retain structural epitopes which allow them to be identified by antibodies specific to them, thus opening up scope of using such coated nanoparticles for functionalized and specific applications. 1. A process for the preparation of bio-organic coated gold and silver nanoparticles using blue light , comprising the steps of:{'sub': 3', '4, '(a) preparing a solution of AgNOor HAuClin the range of 60-300 μM, optionally in a buffer having pH of 5 to 8 or in water having 0.1 to 300 mM NaCl;'}{'sub': 3', '4, '(b) adding pure biomolecules to the solution prepared in step (a), wherein the molar ratio of AgNOto biomolecule is 50:1 and the molar ratio of HAuClto biomolecule is 300:1;'}(c) exposing the mixture of step (b) to blue light having a wattage in the range of 40 W to 200 W for 0.1 to 60 hours at a temperature of 30° C. to obtain the bio-organic coated gold and silver nanoparticles.2. The process as claimed in claim 1 , wherein the buffer is selected from HEPES claim 1 , tris claim 1 , phosphate or trisodium citrate buffer.3. The process as claimed in claim 1 , wherein the wavelength of blue light is in the range of 350 nm to 450 nm.4. The process as claimed in claim 1 , wherein the biomolecules used are selected from the group consisting of peptides claim 1 , antibodies claim 1 , proteins claim 1 , aptamers claim 1 , oligonucleotides and small organic molecules of less than 700 Da.5. The process as claimed in claim 1 , wherein the biomolecule is gelsolin.6. The ...

NANOPARTICLE DRUG CONJUGATES

Described herein are nanoparticle drug conjugates (NDCs), which, in certain embodiments, comprise a non-toxic, multi-modality, clinically proven silica-based nanoparticle platform with covalently attached drug molecules/moieties. The nanoparticle drug conjugates (NDCs) demonstrate imaging capability and targeting ligands which efficiently clear through the kidneys. Furthermore, the conjugates incorporate therapeutic agents for cancer detection, prevention, and/or treatment. 1. A nanoparticle drug conjugate (NDC) comprising:a non-mesoporous nanoparticle;an enzyme sensitive linker moiety; anda drug moiety,wherein the non-mesoporous nanoparticle comprises silica,wherein the NDC has a diameter less than 25 nm, andwherein the drug moiety and enzyme sensitive linker moiety form a cleavable linker-drug construct that facilitates enzyme catalyzed drug release.2. The NDC of claim 1 , wherein the enzyme sensitive linker moiety comprises one or more amino acids.3. The NDC of claim 1 , wherein the enzyme sensitive linker moiety comprises{'br': None, 'sub': x', 'y', 'z, '(Amino-(spacer))-peptide or (spacer)-peptide,'}wherein the spacer has from 2 to 50 atoms,wherein x is an integer from 1 to 5,wherein y is an integer from 1 to 5,wherein z is an integer from 5 to 15, andwherein the enzyme sensitive linker moiety comprises a degradable moiety between the enzyme sensitive linker moiety and the drug moiety.4. The NDC of claim 1 , wherein the enzyme sensitive linker moiety comprises a spacer between a peptide and the drug moiety.5. The NDC of claim 1 , comprising an imaging agent.6. The NDC of claim 5 , wherein the imaging agent comprises a radiolabel.7. The NDC of claim 1 , wherein the enzyme sensitive linker moiety is capable of undergoing hydrolysis at a C-terminal end upon protease binding claim 1 , thereby releasing the drug moiety from the non-mesoporous nanoparticle.8. The NDC of claim 1 , wherein the drug moiety comprises a receptor tyrosine kinase (RTK) inhibitor.9. The NDC ...

Methods of administering immunosuppressants having a specified pharmacodynamic effective life and therapeutic macromolecules for the induction of immune tolerance

This invention relates to methods that provide immunosuppressants and therapeutic macromolecules that are administered within a pharmacodynamically effective window of the immunosuppressants to induce immune tolerance to the therapeutic macromolecules. The methods allow shifting the immune response in favor of tolerogenic immune response development specific to the therapeutic macromolecule.

METHODS COMPRISING DOSING COMBINATIONS FOR REDUCING UNDESIRED HUMORAL IMMUNE RESPONSES

Disclosed are dosings of therapeutic macromolecules and immunosuppressants, in some embodiments attached to synthetic nanocarriers, in combination with dosings of therapeutic macromolecules without synthetic nanocarriers, and related methods that provide reduced humoral immune responses. 1. A method comprising: (a) therapeutic macromolecules that are not attached to any synthetic nanocarriers, and', '(b) a population of synthetic nanocarriers that are attached to immunosuppressants, and that comprise no therapeutic macromolecule antigen-presenting cell (APC) presentable antigens of the therapeutic macromolecules;, '(1) a first dosing that comprises concomitantly administering'} '(c) administering the therapeutic macromolecules that are not attached to any synthetic nanocarriers, and not administering any synthetic nanocarriers; and', '(2) a second dosing that comprises'}(3) administering the first and second dosings to a subject according to an administration schedule that reduces an undesired humoral immune response to the therapeutic macromolecules.2. The method of claim 1 , further comprising (4) determining the administration schedule for the first and second dosings that reduces an undesired humoral immune response to the therapeutic macromolecules.3. The method of claim 1 , wherein the undesired humoral immune response to the therapeutic macromolecules results from the second dosing without the first dosing.4. The method of claim 1 , wherein the first dosing comprises administering (a) and (b) to the subject one or more times.5. The method of claim 4 , wherein (a) and (b) are administered at least 1 claim 4 , 2 claim 4 , 3 claim 4 , 4 or 5 times.6. The method of claim 1 , wherein the second dosing is administered to the subject at least 1 claim 1 , 2 claim 1 , 3 claim 1 , 4 claim 1 , 5 claim 1 , 6 claim 1 , 7 or 8 weeks after the first dosing.7. The method of claim 1 , wherein the method further comprises assessing the undesired humoral immune response in the ...

CALCIUM PEROXIDES NANOPARTICLES AS ADJUVANT THERAPY

The invention provides CaOnanoparticles having a pH-responsive coating for use in a method of adjuvant therapy of hypoxic tumour cells or tissues. The nanoparticles find particular use in enhancing cancer therapies that depend on oxygen to exert their effect, such as photodynamic therapy (PDT), sonodynamic therapy (SDT), and radiotherapy. The invention also provides pharmaceutical compositions containing the coated CaOnanoparticles, together with at least one photosensitiser, sonosensitiser, or radiosensitiser and, optionally, at least one pharmaceutical carrier or excipient. 1. CaOnanoparticles having a pH-responsive coating for use in a method of adjuvant therapy of hypoxic tumour cells or tissues.2. CaOnanoparticles as claimed in for use as an adjuvant therapy to at least one of the following cancer therapies: photodynamic therapy claim 1 , sonodynamic therapy and radiotherapy.3. CaOnanoparticles for use as claimed in or having a diameter of up to about 1 μm claim 1 , preferably from 5 to 900 nm claim 1 , more preferably from 10 to 500 nm claim 1 , e.g. in the range from 10 to 300 nm.4. CaOnanoparticles for use as claimed in any one of the preceding claims which contain at least 10 wt. % claim 1 , preferably at least 25 wt. % claim 1 , e.g. at least 40 wt. % of active CaO(based on the total weight of the particles).5. CaOnanoparticles for use as claimed in any one to which consist essentially of (e.g. consist of) calcium peroxide.6. CaOnanoparticles for use as claimed in any one of the preceding claims having a pH-responsive coating which is stable at physiological pH but which degrades at a pH which is less than physiological pH claim 1 , e.g. at a pH of less than about 7.4.7. CaOnanoparticles for use as claimed in claim 6 , wherein said pH-responsive coating degrades in the range of pH 6.0 to 7.4 claim 6 , preferably 6.2 to 7.4.8. CaOnanoparticles for use as claimed in any one of the preceding claims claim 6 , wherein said pH-responsive coating comprises one or ...

Colorectal cancer drug, and method for predicting prognosis of colorectal cancer patient

The purpose of the present invention is to provide a colorectal cancer drug that uses microRNA exhibiting outstanding effectiveness in colorectal cancer patients, particularly colorectal cancer patients having a mutated KRAS gene. miR4689 and/or miR4685-3p can suppress the growth of colorectal cancer cells, particularly colorectal cancer cells having a mutated KRAS gene, and thus exhibit an effective antitumor effect.

Method and composition for hyperthermally treating cells

A method and composition for hyperthermally treating tumor cells in a patient under conditions that affect tumor stem cells and tumor cells. In one embodiment, the method is administered in combination with localized internal ionizing radiation therapy.

METHODS AND COMPOSITIONS FOR ATTENUATING GENE EXPRESSION MODULATING ANTI-VIRAL TRANSFER VECTOR IMMUNE RESPONSES

Provided herein are methods and related compositions for administering viral transfer vectors and antigen-presenting cell targeted immunosuppressants. 1. A method comprising:establishing an anti-gene expression modulating viral transfer vector attenuated response in a subject by concomitant administration of an antigen-presenting cell targeted immunosuppressant and gene expression modulating viral transfer vector to the subject,wherein the subject does not have pre-existing immunity against the gene expression modulating viral transfer vector.23-. (canceled)4. A method comprising:establishing an anti-gene expression modulating viral transfer vector attenuated response in a subject by concomitant administration of an antigen-presenting cell targeted immunosuppressant and gene expression modulating viral transfer vector to the subject, andadministering to the subject one or more repeat doses of the gene expression modulating viral transfer vector.57-. (canceled)8. The method of claim 1 , further comprising administering to the subject one or more repeat doses of the viral transfer vector subsequent to the concomitant administration of the viral transfer vector and the antigen-presenting cell targeted immunosuppressant to the subject.9. A method comprising:determining a level of pre-existing immunity to a gene expression modulating viral transfer vector in a subject prior to administration of the gene expression modulating viral transfer vector to the subject,concomitantly administering to the subject an antigen-presenting cell targeted immunosuppressant and gene expression modulating viral transfer vector, andadministering to the subject a dose of the gene expression modulating viral transfer vector.10. The method of claim 9 , wherein the determining comprises measuring a level of anti-viral transfer vector antibodies in the subject prior to administration of the viral transfer vector to the subject.1114-. (canceled)15. A method comprising:escalating transgene ...

METHODS FOR PROVIDING POLYMERIC SYNTHETIC NANOCARRIERS FOR GENERATING ANTIGEN-SPECIFIC TOLERANCE IMMUNE RESPONSES

Disclosed are synthetic nanocarrier compositions that provide controlled release of immunosuppressants as well as related methods. The synthetic nanocarrier compositions may also include antigen in some embodiments. 1. A composition , comprising:(i) synthetic nanocarriers that comprise an immunosuppressant coupled thereto, and (ii) an APC presentable antigen;wherein the synthetic nanocarriers are adapted to release the immunosuppressant according to the following relationship:wt % (1 hr) is from 0.01 to 60% and wt % (24 hr) is from 25 to 100%,wherein wt % (1 hr) is the weight of immunosuppressant released upon exposure of the synthetic nanocarriers to an in vitro aqueous environment at 37° C. at a pH for 1 hour divided by the sum of the weight of immunosuppressant released upon exposure of the synthetic nanocarriers to an in vitro aqueous environment at 37° C. at the pH for 1 hour plus a weight of immunosuppressant retained in the synthetic nanocarriers upon exposure of the synthetic nanocarriers to an in vitro aqueous environment at 37° C. at the pH for 1 hour, expressed as weight percent, and taken as an average across the synthetic nanocarriers,wherein wt % (24 hr) is the weight of immunosuppressant released upon exposure of the synthetic nanocarriers to an in vitro aqueous environment at 37° C. at the pH for 24 hours divided by the sum of the weight of immunosuppressant released upon exposure of the synthetic nanocarriers to an in vitro aqueous environment at 37° C. at the pH for 24 hours plus a weight of immunosuppressant retained in the synthetic nanocarriers upon exposure of the synthetic nanocarriers to an in vitro aqueous environment at 37° C. at the pH for 24 hours, expressed as weight percent, and taken as an average across the synthetic nanocarriers; andwherein the pH ranges from 4.5 to 6.5.2. The composition of claim 1 , wherein wt % (1 hr) is from 10 to 60%.3. The composition of claim 2 , wherein wt % (1 hr) is from 15 to 50%.4. The composition of ...