Поиск патентов

Настройки

Глубина выборки

Укажите год

Небесная энциклопедия

Космические корабли и станции, автоматические КА и методы их проектирования, бортовые комплексы управления, системы и средства жизнеобеспечения, особенности технологии производства ракетно-космических систем

Подробнее

Мониторинг СМИ

Мониторинг СМИ и социальных сетей. Сканирование интернета, новостных сайтов, специализированных контентных площадок на базе мессенджеров. Гибкие настройки фильтров и первоначальных источников.

Подробнее

Форма поиска

Ключевые слова. Может быть несколько по одной на строку

Поддерживает ввод нескольких поисковых фраз (по одной на строку). При поиске обеспечивает поддержку морфологии русского и английского языка

Автор

Ведите корректный номера.

Владелец

Ведите корректный номера.

Классы IPC

Ведите корректный номера.

Классы CPC

Ведите корректный номера.

Начиная с года

Укажите год

Заканчивая годом

Укажите год

Применить Всего найдено 7801. Отображено 100.

16-02-2012 дата публикации

Multipotent Lymphohematopoietic Progenitor Cells

Номер: US20120040362A1

Автор: Igor I. Slukvin, James A. Thomson, Maksym A. Vodyanyk

Принадлежит: Individual

This invention relates to hematopoietic precursors derived from human embryonic stem cells. In the culture of differentiated cells from human ES cells, the fully committed hematopoietic precursors are CD34+ and CD43+ but not CD45+. If the cells are cultured until they express CD45, then the cells lose the ability to produce differentiated cells of the lymphoid lineages.

Подробнее

Номер записи: 1

01-03-2012 дата публикации

Differentiation of Pluripotent Stem Cells

Номер: US20120052576A1

Автор: Alireza Rezania

Принадлежит: Janssen Biotech Inc

The present invention provides methods to promote the differentiation of pluripotent stem cells into insulin producing cells. In particular, the present invention provides a method utilizing an agent that degrades retinoic acid to produce a population of pancreatic endocrine precursor cells.

Подробнее

Номер записи: 2

05-04-2012 дата публикации

In Vitro Generation of Myeloid Derived Suppressor Cells

Номер: US20120082688A1

Автор: Ping-Ying Pan, Shu-Hsia Chen, Zuping Zhou

Принадлежит: Mount Sinai School of Medicine

The invention relates to methods of isolating, culturing, and differentiating myeloid derived suppressor cells (MD-SCs) from embryonic stem (ES) cells and hematopoietic stem cells (HSCs). In certain embodiments, the invention relates to methods and compositions for producing MDSCs from ES cells and HSCs using a combination of factors including macrophage colony-stimulating factor (M-CSF).

Подробнее

Номер записи: 3

19-04-2012 дата публикации

Methods of neural conversion of human embryonic stem cells

Номер: US20120094381A1

Автор: Lorenz Studer, Stuart Chambers

Принадлежит: Memorial Sloan Kettering Cancer Center

The present invention relates generally to the field of cell biology of stem cells, more specifically the directed differentiation of pluripotent or multipotent stem cells, including human embryonic stem cells (hESC), somatic stem cells, and induced human pluripotent stem cells (hiPSC) using novel culture conditions. Specifically, methods are provided for obtaining neural tissue, floor plate cells, and placode including induction of neural plate development in hESCs for obtaining midbrain dopamine (DA) neurons, motorneurons, and sensory neurons. Further, neural plate tissue obtained using methods of the present inventions are contemplated for use in co-cultures with other tissues as inducers for shifting differentiation pathways, i.e. patterning.

Подробнее

Номер записи: 4

26-04-2012 дата публикации

Regionalised endoderm cells and uses thereof

Номер: US20120100115A1

Автор: Gillian Mary Morrison, Ifigenia Oikonomopoulou, Joshua Mark Brickman

Принадлежит: University of Edinburgh

The present invention relates to the generation of anterior definitive endoderm (ADE) cells from embryonic stem cells and the differentiation of such cells to, for example, pancreatic or liver cells. The invention also relates to cell lines, cell culture methods, cells markers and the like and their potential uses in a variety of applications.

Подробнее

Номер записи: 5

24-05-2012 дата публикации

Method of preparing pluripotent stem cells

Номер: US20120129256A1

Автор: Mariya A. Lagar'kova, Mariya V. Shutova, Sergey L. Kiselev

Принадлежит: OBSCHESTVO S OGRANICHENNOI OTVETSTVENNOSTYU "LABORATORIA KLETOCHNYKH TEKHNOLOGIY\

The invention relates to biotechnology, and particularly to the preparation of pluripotent stem cells. The method involves introduction into umbilical cord and placental stem cells of RNA with at least one sequence which ensures the transition of cells to the pluripotent state. The method enables to effectively prepare pluripotent stem cells from the cells of mammalian placenta and umbilical cord which have not yet acquired somatic mutations, which reduces the risk of oncogenesis and other adverse effects of reprogramming.

Подробнее

Номер записи: 6

24-05-2012 дата публикации

Transcriptome Transfer Produces Cellular Phenotype Conversion

Номер: US20120129261A1

Автор: Jai-Yoon Sul, James Eberwine, Tai Kyung Kim, Vickas Patel

Принадлежит: University of Pennsylvania Penn

The present invention includes methods for effecting phenotype conversion in a cell by transfecting the cell with phenotype-converting nucleic acid. Expression of the nucleic acids results in a phenotype conversion in the transfected cell. Preferably the phenotype-converting nucleic acid is a transcriptome, and more preferably an mRNA transcriptome.

Подробнее

Номер записи: 7

19-07-2012 дата публикации

Methods and Compositions For Reprogramming Cells

Номер: US20120184035A1

Автор: Katerine L. Holton, Robert Lanza, Sadhana Agarwal

Принадлежит: Individual

Methods and compositions are provided for reprogramming cells. In an exemplary embodiment, fibroblasts are reprogrammed to adopt a skeletal, cardiac, or smooth muscle cell fate. Cell and tissue therapies using said methods and compositions are also disclosed.

Подробнее

Номер записи: 8

26-07-2012 дата публикации

Induced pluripotent stem cells and methods of use

Номер: US20120189595A1

Автор: Angel Raya, Juan Carlos Izpisua Belmonte, Trond Aasen

Принадлежит: SALK INSTITUTE FOR BIOLOGICAL STUDIES

The invention relates to the field of stem cells and, specially, to the reprogramming of adult somatic cells; to obtain pluripotent cells by the transfection of specific genes. Thus, the invention provides induced pluripotent stem cells (iPS) and methods of obtaining and using them.

Подробнее

Номер записи: 9

26-07-2012 дата публикации

Methods for obtaining hepatocytes, hepatic endoderm cells and hepatic progenitor cells by induced differentiation

Номер: US20120190059A1

Автор: Dongxin Zhao, Hongkui Deng, Mingxiao Ding, SONG Chen, Zhihua Song

Принадлежит: Beijing Huayuanbochuang Technology Co Ltd

The present invention discloses a method for inducing the differentiation of embryonic stem cells (ESC) or induced pluripotent stem cells (iPS cells) into hepatocytes, a method for inducing the differentiation of embryonic stem cells or induced pluripotent stem cells into hepatic endoderm cells, and a method for inducing the differentiation of embryonic stem cells (ESC) or induced pluripotent stem cells into hepatic progenitor cells. The present invention also provides the hepatocytes, hepatic endoderm cells and hepatic progenitor cells obtained by above methods, and the uses of these cells.

Подробнее

Номер записи: 10

26-07-2012 дата публикации

Differentiation of Pluripotent Stem Cells

Номер: US20120190111A1

Автор: Christine Parmenter, Janet Davis, Jiajian Liu, Pascal Ghislain André Bonnet

Принадлежит: Janssen Biotech Inc

The present invention is directed to methods to differentiate pluripotent stem cells. In particular, the present invention is directed to methods and compositions to differentiate pluripotent stem cells into cells expressing markers characteristic of the definitive endoderm lineage comprising culturing the pluripotent stem cells in medium comprising a sufficient amount of GDF-8 to cause the differentiation of the pluripotent stem cells into cells expressing markers characteristic of the definitive endoderm lineage.

Подробнее

Номер записи: 11

20-09-2012 дата публикации

Generation of Functional Basal Forebrain Cholinergic Neurons From Stem Cells

Номер: US20120237484A1

Автор: Christopher Bissonnette, John Kessler

Принадлежит: Northwestern University

The present invention provides method, compositions, and systems for generating basal forebrain cholinergic neurons (BFCNs) using FGF8, SHH, LXH8, GBX1, or vectors encoding these ligands, as well as using such BFCNs to treat neurological disorders such as Alzheimer's disease.

Подробнее

Номер записи: 12

20-09-2012 дата публикации

Megakaryocyte and Platelet Production from Stem Cells

Номер: US20120238020A1

Автор: Mauro P. Avanzi, W. Beau Mitchell

Принадлежит: New York Blood Center Inc

Methods for obtaining purified populations of megakaryocytes and platelets by ex vivo culture of stem cells are provided herein.

Подробнее

Номер записи: 13

20-09-2012 дата публикации

Novel Method for Producing Differentiated Cells

Номер: US20120238023A1

Автор: Hiromitsu Nakauchi, Koji Eto, Naoya Takayama, Sou Nakamura

Принадлежит: Individual

The present invention has an object of providing a method for producing specific cells by amplifying cells in a desired differentiation stage. The present invention provides a method for producing specific cells by inducing differentiation of cells, wherein an oncogene is forcibly expressed in cells in a desired differentiation stage to amplify the cells in the desired differentiation stage. The present invention also provides a method for producing specific cells, wherein oncogene-induced senescence (OIS) which is induced by the oncogene expressed in the cells in the desired differentiation stage is suppressed.

Подробнее

Номер записи: 14

04-10-2012 дата публикации

Methods of generating a tendon tissue

Номер: US20120253463A1

Автор: Joseph Itskovitz-Eldor, Shahar Cohen

Принадлежит: Technion Research and Development Foundation Ltd

Methods of generating and expanding proliferative, multipotent connective tissue progenitor cells from adult stem cells are provided. Also provided are methods of generating functional tendon grafts in vitro and bone, cartilage and connective tissues in vivo using the isolated cell preparation of connective tissue progenitor cells.

Подробнее

Номер записи: 15

18-10-2012 дата публикации

Induction of pluripotent cells

Номер: US20120264218A1

Автор: Sheng Ding, Tongxiang Lin

Принадлежит: Scripps Research Institute

The slow kinetics and low efficiency of reprogramming methods to generate human induced pluripotent stem cells (iPSCs) impose major limitations on their utility in biomedical applications. Here we describe a chemical approach that dramatically improves (>200 fold) the efficiency of iPSC generation from human fibroblasts, within seven days of treatment. This will provide a basis for developing safer, more efficient, non-viral methods for reprogramming human somatic cells.

Подробнее

Номер записи: 16

25-10-2012 дата публикации

Productions of artificial tissues by means of tissue engineering using agarose-fibrin biomaterials

Номер: US20120269776A1

Автор: Antonio CAMPOS MUÑOZ, Ingrid Johanna Garzón Bello, José Ignacio Muñoz Ávila, Miguel Alaminos Mingorance, Miguel GONZÁLEZ ANDRADES

Принадлежит: SERVICIO ANDALUZ DE SALUD, Universidad de Granada

The present invention is encompassed in the field of biomedicine and more specifically tissue engineering. It relates specifically to an in vitro method for preparing an artificial tissue, to the artificial tissue obtainable by said method and to the use of this artificial tissue to partially or completely increase, restore or replace the functional activity of a damaged tissue or organ.

Подробнее

Номер записи: 17

08-11-2012 дата публикации

Non-viral delivery of transcription factors that reprogram human somatic cells into a stem cell-like state

Номер: US20120282229A1

Автор: Christian Kannemeier, Joel Sae Won Marh, John Sundsmo, Kyle Howerton

Принадлежит: Individual

Disclosed herein are cellular compositions, stable continuous cell cultures, reporter cell lines, pharmaceutical preparations, cell penetrable pluripotent stem cells transcription factors and methods related thereto, related to reprogrammed somatic cells.

Подробнее

Номер записи: 18

29-11-2012 дата публикации

Technologies, Methods, and Products of Small Molecule Directed Tissue and Organ Regeneration from Human Pluripotent Stem Cells

Номер: US20120301437A1

Автор: Xuejun Huang Parsons

Принадлежит: SAN DIEGO REGENERATIVE MEDICINE INST

Pluripotent human embryonic stem cells (hESCs) hold great potential for restoring tissue and organ function, which has been hindered by inefficiency and instability of generating desired cell types through multi-lineage differentiation. This instant invention is based on the discovery that pluripotent hESCs maintained under defined culture conditions can be uniformly converted into a specific lineage by small molecule induction. Retinoic acid induces specification of neuroectoderm direct from the pluripotent state of hESCs and triggers progression to neuronal progenitors and neurons efficiently. Similarly, nicotinamide induces specification of cardiomesoderm direct from the pluripotent state of hESCs and triggers progression to cardiac precursors and cardiomyocytes efficiently. This technology provides a large supply of clinically-suitable human neuronal or cardiac therapeutic products for CNS or myocardium repair. This invention enables well-controlled efficient induction of pluripotent hESCs exclusively to a specific clinically-relevant lineage for tissue and organ engineering and regeneration, cell-based therapy, and drug discovery.

Подробнее

Номер записи: 19

13-12-2012 дата публикации

Large scale generation of functional megakaryocytes and platelets from human embryonic stem cells under stromal-free conditions

Номер: US20120315338A1

Автор: Feng Li, Shi-Jiang Lu

Принадлежит: Stem Cell and Regenerative Medicine International Inc

The present invention provides a method of generating megakaryocytes and platelets. In various embodiments, method involves the use of human embryonic stem cell derived hemangioblasts for differentiation into megakaryocytes and platelets under serum and stromal-free condition. In this system, hESCs are directed towards megakaryocytes through embryoid body formation and hemangioblast differentiation. Further provided is a method of treating a subject in need of platelet transfusion.

Подробнее

Номер записи: 20

31-01-2013 дата публикации

Method for hepatic differentiation of definitive endoderm cells

Номер: US20130031645A1

Автор: Anne Weber-Benarous, Ludovic Vallier, Thomas Touboul

Принадлежит: CAMBRIDGE ENTERPRISE LTD, Institut National de la Sante et de la Recherche Medicale INSERM

The present invention relates to a method for obtaining a population of hepatic progenitor cells, said method comprising a step of culturing definitive endoderm cells with a culture medium stimulating hepatic specification. In a particular embodiment, such culture medium stimulating hepatic specification comprises a retinoic acid receptor (RAR) agonist, an FGF family growth factor and an inhibitor of the activin signaling pathway.

Подробнее

Номер записи: 21

14-02-2013 дата публикации

Isolation and cultivation of stem/progenitor cells from the amniotic membrane of umbilical cord and uses of cells differentiated therefrom

Номер: US20130039893A1

Автор: Toan-Thang Phan

Принадлежит: CellResearch Corp Pte Ltd

The present invention relates to the generation of a mucin-producing cell using stem/progenitor cells obtained from the amniotic membrane of umbilical cord and therapeutic uses of such mucin-producing cells.

Подробнее

Номер записи: 22

28-02-2013 дата публикации

Method for preparing induced paraxial mesoderm progenitor (ipam) cells and their use

Номер: US20130052729A1

Автор: Jerome Chal, Olivier Pourquie

Принадлежит: Individual

An ex vivo method for preparing a population of induced paraxial mesoderm progenitor (iPAM) cells includes culturing pluripotent cells in an appropriate culture medium that includes an effective amount of an activator of the Wnt signalling pathway.

Подробнее

Номер записи: 23

21-03-2013 дата публикации

Neuregulin isoforms,neuregulin polypeptides and uses thereof

Номер: US20130072437A1

Автор: André SCHRATTENHOLZ, Daniel Bach, Thierry Baussant

Принадлежит: Mind NRG SA

The present invention relates to new therapeutic and diagnostic uses of soluble neuregulin-1 isoforms and polypeptides, particularly neurological disorders.

Подробнее

Номер записи: 24

25-04-2013 дата публикации

Cytoplasmic transfer to de-differentiate recipient cells

Номер: US20130104253A1

Автор: Karen B. Chapman

Принадлежит: Individual

Methods for de-differentiating or altering the life-span of desired “recipient” cells, e.g., human somatic cells, by the introduction of cytoplasm from a more primitive, less differentiated cell type, e.g., oocyte or blastomere are provided. These methods can be used to produce embryonic stem cells and to increase the efficiency of gene therapy by allowing for desired cells to be subjected to multiple genetic modifications without becoming senescent. Such cytoplasm may be fractionated and/or subjected to subtractive hybridization and the active materials (sufficient for de-differentiation) identified and produced by recombinant methods.

Подробнее

Номер записи: 25

23-05-2013 дата публикации

Human Stem Cell Materials and Methods

Номер: US20130129696A1

Автор: Eliezer Huberman, Yong Zhao

Принадлежит: Individual

Monocyte derived adult stem cells (MDSCs) isolated from peripheral blood of mammals is provided, along with pharmaceutical compositions containing an MDSC, kits containing a pharmaceutical composition, and methods of preparing, propagating and using MDSCs or differentiated derivatives thereof The uses of these biological materials include methods of treating disorders or diseases, as well as methods of ameliorating a symptom associated with any such disorder or disease.

Подробнее

Номер записи: 26

23-05-2013 дата публикации

Use of fibroblast growth factor for lineage priming and differentiation of pluripotent stem cells

Номер: US20130130375A1

Автор: Diane Elizabeth Rudy-Reil

Принадлежит: CMR Technologies LLC

The present invention provides a method of inducing mesoderm derived cells from pluirpotent stem cells. In contrast to methods known in the art that are often designed to replicate in vivo events of mesoderm induction, the present invention provides a unique, yet simple, method whereby pluripotent stem cells are mesodermally primed in the presence of factors that concomitantly inhibit the spontaneous differentiation of endoderm and ectoderm during expansion and suspension steps. Exposure and/or adherence of primed aggregates to a extracellular matrix that promotes the commitment and survival of induced mesoderm progenitors, followed by exposure to various mesoderm associated factors, allows for the subsequent induction of such cells into terminally differentiated lineages, such as cardiomyocytes. End products of this induction system will ultimately provide an unlimited source of mesoderm-derived cell types for therapeutic and pharmacological purposes.

Подробнее

Номер записи: 27

13-06-2013 дата публикации

Methods of producing human rpe cells and pharmaceutical preparations of human rpe cells

Номер: US20130149284A1

Автор: Christopher Malcuit, Linda Lemieux, Lucy Vilner, Pedro Huertas, William Holmes

Принадлежит: Advanced Cell Technology Inc

The present invention provides improved methods for producing retinal pigmented epithelial (RPE) cells from human embryonic stem cells, human induced pluripotent stem (iPS), human adult stem cells, human hematopoietic stem cells, human fetal stem cells, human mesenchymal stem cells, human postpartum stem cells, human multipotent stem cells, or human embryonic germ cells. The RPE cells derived from embryonic stem cells are molecularly distinct from adult and fetal-derived RPE cells, and are also distinct from embryonic stem cells. The RPE cells described herein are useful for treating retinal degenerative conditions including retinal detachment and macular degeneration.

Подробнее

Номер записи: 28

27-06-2013 дата публикации

Cell compositions derived from dedifferentiated reprogrammed cells

Номер: US20130164787A1

Автор: Alan D. Agulnick, Allan Robins, Olivia Kelly, Thomas Schultz, Yuki Ohi

Принадлежит: Viacyte Inc

Disclosed herein are cell culture compositions, for example, pancreatic cell culture compositions, derived from dedifferentiated human reprogrammed pluripotent stem cells, such as induced pluripotent stem (iPS) cells, and methods for producing and using such cell culture compositions.

Подробнее

Номер записи: 29

04-07-2013 дата публикации

Compositions comprising acidic extracts of mastic gum

Номер: US20130172416A1

Автор: Andre C. B. Lucassen, Zadik Hazan

Принадлежит: Regenera Pharma Ltd

The invention relates to compositions and formulations comprising isolated acidic fraction of mastic gum and uses thereof for treating impaired neurological functions as well as wound and tissue repair.

Подробнее

Номер записи: 30

11-07-2013 дата публикации

Wnt inhibitors for human stem cell differentiation

Номер: US20130177535A1

Автор: Dennis Schade, Erik Willems, John Cashman, Marion Lanier, Mark Mercola

Принадлежит: Individual

Methods and small molecule compounds for stem cell differentiation and treatment of animals with diseases are provided. One example of a class of compounds that may be used is represented by the compound of Formula I and II: or a pharmaceutically acceptable salt or solvate thereof, wherein A, X, Q, R 1 , R 2 , R 3 , R 4 are as described herein.

Подробнее

Номер записи: 31

15-08-2013 дата публикации

Method of producing pancreatic hormone-producing cells

Номер: US20130210060A1

Автор: Masaki Hosoya, Masanobu Shoji

Принадлежит: Takeda Pharmaceutical Co Ltd

Disclosed is a production method of pancreatic hormone-producing cells in a form that mimics the pancreatogenesis, the method comprising subjecting stem cells to the following steps: (1) cultivating stem cells in a medium containing a Rho kinase inhibitor, (2) cultivating the cells obtained in (1) in a medium containing a GSK3 inhibitor, (3) cultivating the cells obtained in (2) in a medium containing GSK3 inhibitor and an activator of activin receptor-like kinase-4,7, (4) forming a cell mass from the cells obtained in (3), and cultivating the cell mass in a suspension state in a medium, (5) cultivating the cells obtained in (4) in a medium containing a retinoic acid receptor agonist, an inhibitor of AMP-activated protein kinase and/or activin receptor-like kinase-2,3,6, an inhibitor of activin receptor-like kinase-4,5,7 and a cell growth factor, and (6) cultivating the cells obtained in (5).

Подробнее

Номер записи: 32

15-08-2013 дата публикации

Differentiation of pluripotent cells

Номер: US20130210141A1

Автор: Deepika Rajesh, Rachel Lewis

Принадлежит: Fujifilm Cellular Dynamics Inc

Provided herein are methods for the in vitro maintenance, expansion, culture, and/or differentiation of pluripotent cells, such as human embryonic stem cells (hESC) or induced pluripotent cells (iPSC), into hematopoietic precursor cells or endothelial cells. The pluripotent cells may be maintained and differentiated under defined conditions; thus, the use of mouse feeder cells or serum is not required in certain embodiments for the differentiation of the pluripotent cells into hematopoietic precursor cells or endothelial cells. The resulting hematopoietic precursor cells may be further differentiated into various myeloid or lymphoid lineages.

Подробнее

Номер записи: 33

17-10-2013 дата публикации

Insulin producing cells derived from pluripotent stem cells

Номер: US20130273013A1

Автор: Alon Levy, Arik Hasson, Guy Slutsky, Judith Chebath, Michal Izrael, Michel Revel, MOLAKANDOV Kfir, Rosalia Kaufman

Принадлежит: KADIMASTEM Ltd

A method of generating islet cells from pluripotent stem cells is disclosed. The method comprises: (a) culturing the pluripotent stem cells in a differentiation medium so as to differentiate the pluripotent stem cells into endoderm cells; and (b) culturing the endoderm cells in a medium comprising at least one growth factor, a cAMP inducer and retinoic acid (RA), said at least one growth factor being selected from the group consisting of FGF10, bFGF and FGF7 so as to generate further differentiated cells; and (c) culturing the further differentiated cells in a medium comprising a maturation factor selected from the group consisting of nicotinamide, GLP-1 and exendin 4, thereby generating islet cells from pluripotent stem cells. Further methods of generating islet cells are also disclosed, isolated cell populations comprising same and uses thereof.

Подробнее

Номер записи: 34

24-10-2013 дата публикации

Methods of obtaining cell populations enriched with desired cells

Номер: US20130280218A1

Автор: Benjamin Reubinoff, Sharona Cohen Evenram

Принадлежит: Hadasit Medical Research Services and Development Co

Provided is a method including providing a population of cells including a target type of differentiated cells having a pre-identified cytoskeletal profile and at least one cell selected from undifferentiated cells, differentiating cells and differentiated cells being different from the target type of differentiated cells; and incubating the population of cells with a cytotoxic agent, in an amount and for a time period effective to form a modified population of cells including predominantly or consisting essentially of the target type of differentiated cells. The pre-identified cytoskeletal profile can include the presence of class III β-tubulin on neuronal cells and the population of cells includes neural cells and neuronal cells.

Подробнее

Номер записи: 35

24-10-2013 дата публикации

Method of deriving progenitor cell line

Номер: US20130280719A1

Автор: Elias Lye, Sai Kiang Lim

Принадлежит: Agency for Science Technology and Research Singapore

We disclose a method comprising: (a) providing an embryonic stem (ES) cell; and (b) establishing a progenitor cell line from the embryonic stem cell; in which the progenitor cell line is selected based on its ability to self-renew. Preferably, the method selects against somatic cells based on their inability to self-renew. Preferably, the progenitor cell line is derived or established in the absence of co-culture, preferably in the absence of feeder cells, which preferably selects against embryonic stem cells. Optionally, the method comprises (d) deriving a differentiated cell from the progenitor cell line.

Подробнее

Номер записи: 36

24-10-2013 дата публикации

Differentiation of human pluripotent stem cells to multipotent neural crest cells

Номер: US20130280804A1

Автор: Laura M. MENENDEZ, Stephen Dalton

Принадлежит: Individual

The present invention relates to the differentiation of human pluripotent cells, including human pluripotent stems cells to produce a self-renewing multipotent neural crest cell population in a single step method without the requirement of isolation of intermediate cells and without appreciable contamination (in certain preferred instances, virtually none) with Pax6+ neural progenitor cells in the population of p75+ Hnk1+ Ap2+ multipotent neural crest-like cells. The multipotent neural crest cell population obtained can be clonally amplified and maintained for >25 passages (>100 days) while retaining the capacity to differentiate into peripheral neurons, smooth muscle cells and mesenchymal precursor cells.

Подробнее

Номер записи: 37

24-10-2013 дата публикации

Reprogramming of cells to a new fate

Номер: US20130280809A1

Автор: Janghwan Kim, Jem A. Efe, Saiyong Zhu, Sheng Ding, Simon Hilcove

Принадлежит: Scripps Research Institute

Methods and compositions for transdifferentiation of an animal cell from (i) a first pluripotent cell fate to a second nonpluripotent cell fate or (ii) from a non-pluripotent mesodermal, endodermal, or ectodermal cell fate to a different non-pluripotent mesodermal, endodermal, or ectodermal cell fate.

Подробнее

Номер записи: 38

14-11-2013 дата публикации

Modalities for the treatment of degenerative diseases of the retina

Номер: US20130302426A1

Автор: Irina V. Klimanskaya, Robert Lanza

Принадлежит: Advanced Cell Technology Inc

This invention relates to methods for improved cell-based therapies for retinal degeneration and for differentiating human embryonic stem cells and human embryo-derived into retinal pigment epithelium (RPE) cells and other retinal progenitor cells.

Подробнее

Номер записи: 39

28-11-2013 дата публикации

Method for stem cell differentiation in vivo by delivery of morphogenes with mesoporous silica and corresponding pharmceutical active ingredients

Номер: US20130315962A1

Автор: Alfonso E. Garcia-Bennett, Elena Nickolaevna Kozlova

Принадлежит: Nanologica AB

A pharmaceutical active ingredient for cell differentiation to alleviate cell and cell-related deficiencies in mammals comprising porous silica containing a releasable agent capable of contributing to a cell environment conducive for stem cell differentiation in co-implanted stem cells and/or in endogenous stem cells.

Подробнее

Номер записи: 40

19-12-2013 дата публикации

Differentiation and Enrichment of Islet-Like Cells from Human Pluripotent Stem Cells

Номер: US20130337561A1

Автор: Anish SEN MAJUMDAR, JianJie Jiang, Melinda Au

Принадлежит: Geron Corp

Methods for differentiating human pluripotent stem cells into islet-like cells are provided. In certain embodiments, the methods utilize sequential culturing of the human pluripotent stem cells with certain factors to produce islet-like cells. In certain embodiments, the population of cells produced by the methods is further enriched for islet-like cells.

Подробнее

Номер записи: 41

13-02-2014 дата публикации

Robust and efficient differentiation of human pluripotent stem cells to multipotent vascular progenitors

Номер: US20140045265A1

Автор: Emmanuel Nivet, Ignacio SANCHO-MARTINEZ, Juan Carlos Izpisua Belmonte, Leo Kurian

Принадлежит: SALK INSTITUTE FOR BIOLOGICAL STUDIES

Provided herein are methods and compositions for generating vascular progenitor cells that can in turn be differentiated into endothelial, smooth muscle, and hematopoietic cells. The present methods provide a faster, safer, and more efficient in vitro differentiation program than existing methodologies. The differentiated cells can be used for research and therapeutic applications, such as cell transplantation.

Подробнее

Номер записи: 42

27-02-2014 дата публикации

Method of producing retinal pigment epithelial cell sheet

Номер: US20140057281A1

Автор: Hiroyuki Kamao, Masayo Takahashi, Satoshi Okamoto

Принадлежит: RIKEN Institute of Physical and Chemical Research

The present invention provides a method of producing a cell sheet including the following steps (1) seeding and culturing retinal pigment epithelial cells on a collagen gel to form a cell sheet composed of the retinal pigment epithelial cells, and (2) degrading the collagen gel with collagenase to detach the cell sheet composed of the retinal pigment epithelial cells, and the like.

Подробнее

Номер записи: 43

13-03-2014 дата публикации

Mesenchymal stromal cells and uses related thereto

Номер: US20140072537A1

Автор: Erin Anne Kimbrel, Jianlin Chu, Nicholas Arthur Kouris, Robert Lanza

Принадлежит: Advanced Cell Technology Inc

The present invention generally relates to novel preparations of mesenchymal stromal cells (MSCs) derived from hemangioblasts, methods for obtaining such MSCs, and methods of treating a pathology using such MSCs. The methods of the present invention produce substantial numbers of MSCs having a potency-retaining youthful phenotype, which are useful in the treatment of pathologies.

Подробнее

Номер записи: 44

27-03-2014 дата публикации

Induction of human embryonic stem cell derived cardiac pacemaker or chamber-type cardiomyocytes by manipulation of neuregulin signaling

Номер: US20140087460A1

Автор: Michael A. LAFLAMME, Wei-Zhong ZHU

Принадлежит: UNIVERSITY OF WASHINGTON

The present invention is directed to methods of producing cardiomyocytes having a nodal/pacemaker phenotype and cardiomyocytes having an atrial/ventricular phenotype. Isolated populations of nodal/pacemaker and atrial/ventricular cardiomyocytes are also disclosed. Methods of treating a subject having cardiac arrhythmia and a subject in need of cardiac tissue repair using the isolated populations of nodal/pacemaker cardiomyocytes and atrial/ventricular cardiomyocytes, receptively, are also disclosed.

Подробнее

Номер записи: 45

04-01-2018 дата публикации

METHODS FOR TREATING DEGENERATIVE DISEASES/INJURIES

Номер: US20180000785A1

Автор: Erickson-Miller Connie L., Jenkins Julian

Принадлежит:

Invented is a method of treating degenerative diseases/injuries, in a mammal, including a human, in need thereof which comprises the administration of a therapeutically effective amount of a non-peptide TPO receptor agonist to such mammal. 1. An in vitro or ex vivo method of enhancing the differentation of blood components in human fetal cord blood into functional cells which method comprises the addition of an effective amount of a non-peptide TPO receptor agonist selected from:3′-{N′-[1-(3,4-Dimethylphenyl)-3-methyl-5-oxo-1,5-dihydropyrazol-4-ylidene]hydrazino}-2′-hydroxybiphenyl-3-carboxylic acid,or a pharmaceutically acceptable salt thereof, and3-{N′-[1-(3,4-dimethylphenyl)-3-methyl-5-oxo-1,5-dihydropyrazol-4-ylidene]hydrazino}-2-hydroxy-3′-tetrazol-5-ylbiphenyl,or a pharmaceutically acceptable salt thereof;to a culture medium containing human fetal cord blood;followed by optional isolation of the functional cells.2. The method of wherein progenitor cells are enhanced.3. A method of transfusing human fetal cord blood which method comprises the addition of an effective amount of a non-peptide TPO receptor agonist selected from:3′-{N′-[1-(3,4-Dimethylphenyl)-3-methyl-5-oxo-1,5-dihydropyrazol-4-ylidene]hydrazino}-2′-hydroxybiphenyl-3-carboxylic acid,or a pharmaceutically acceptable salt thereof, and3-{N′-[1-(3,4-dimethylphenyl)-3-methyl-5-oxo-1,5-dihydropyrazol-4-ylidene]hydrazino}-2-hydroxy-3′-tetrazol-5-ylbiphenyl,or a pharmaceutically acceptable salt thereof;to a patient receiving human fetal cord blood. This invention relates to non-peptide tbrombopoietin (TPO) receptor agonists and their use in the treatment of degenerative diseases/injuries.Thrombopoietin (TPO) has been shown to be the main humoral regulator in situations involving thrombocytopenia. See, e.g., Metcalf Nature 389:519-520 (1994). TPO has been shown in several studies to increase platelet counts, increase platelet size, and increase isotope incorporation into platelets of recipient animals. ...

Подробнее

Номер записи: 46

07-01-2021 дата публикации

METHOD FOR PRODUCING A CELL POPULATION INCLUDING NK CELLS

Номер: US20210000871A1

Автор: Harada Yui, Yonemitsu Yoshikazu

Принадлежит: GAIA BioMedicine Inc.

An object of the present invention is to provide an effective method for producing a population of NK cells for cell therapy. Another object of the present invention is to improve in vitro amplification efficiency of NK cells. A still another object of the present invention is to flexibly increase signals required for licensing of NK cells. There is provided a method for producing a cell population including NK cells, which comprises preparing a cell population of mononuclear cells originating in a plurality of donors and including NK cells, and incubating the prepared population of mononuclear cells under conditions effective for treating and proliferating NK cells to proliferate NK cells. 1. A method for producing a cell population including NK cells , which comprises:preparing a cell population of mononuclear cells originating in a plurality of donors and including NK cellsincubating the prepared population of mononuclear cells under conditions effective for treating NK cells.2. The production method according to claim 1 , wherein the step of preparing a population of mononuclear cells comprises the step of removing CD3-positive cells.3. The production method according to claim 1 , wherein the step of preparing a population of mononuclear cells comprises the step of removing CD34-positive cells.4. The production method according to claim 1 , wherein the step of preparing a population of mononuclear cells comprises the step of obtaining a population of mononuclear cells from peripheral blood collected from a plurality of donors.5. The production method according to claim 1 , wherein the step of preparing a population of mononuclear cells comprises the step of obtaining a population of mononuclear cells from apheresis blood collected from a plurality of donors.6. The production method according to claim 1 , wherein the step of preparing a population of mononuclear cells consists of preparing a population of mononuclear cells derived from any one selected from the ...

Подробнее

Номер записи: 47

05-01-2017 дата публикации

Modulation of Stem Cell and Progenitor Cell Differentiation, Assays, And Uses Thereof

Номер: US20170000779A1

Автор: David Stirling, Kyle W.H. Chan, Laure A. Moutouh-De Parseval, Robert J. Hariri

Принадлежит: Anthrogenesis Corp, Celgene Corp, Signal Pharmaceuticals LLC

The present invention relates to methods of modulating mammalian stem cell and progenitor cell differentiation. The methods of the invention can be employed to regulate and control the differentiation and maturation of mammalian, particularly human stem cells along specific cell and tissue lineages. The methods of the invention relate to the use of certain small organic molecules to modulate the differentiation of stem or progenitor cell populations along specific cell and tissue lineages, and in particular, to the differentiation of embryonic-like stem cells originating from a postpartum placenta or for the differentiation of early progenitor cells to a granulocytic lineage. Finally, the invention relates to the use of such differentiated stem or progenitor cells in transplantation and other medical treatments.

Подробнее

Номер записи: 48

04-01-2018 дата публикации

ISOLATION, CULTIVATION AND USES OF STEM/PROGENITOR CELLS

Номер: US20180000866A1

Автор: LIM Ivor Jiun, PHAN Toan-Thang

Принадлежит: CELLRESEARCH CORPORATION PTE LTD

The present invention relates to a method of cultivating an epithelial stem/progenitor cell population of the amniotic membrane of umbilical cord, the epithelial stem/progenitor cell population having the capacity to differentiate in multiple cell types. 1. A method of cultivating an epithelial stem/progenitor cell population of the amniotic membrane of umbilical cord , the epithelial stem/progenitor cell population having the capacity to differentiate in multiple cell types , the method comprising:Obtaining a tissue explant from the amniotic membrane of umbilical cord,Cultivating the tissue explant in suitable cultivation media and cultivation conditions allowing cell proliferation of epithelial stem/progenitor cells without differentiation of the epithelial stem/progenitor cells over a suitable period of time,isolating the stem/progenitor cells of the amniotic membrane, wherein the stem/progenitor cells have a polyhedral shape, express the following genes: POU5f1, Bmi-1, leukemia inhibitory factor (LIF), and wherein the stem/progenitor cells secrete Activin A and Follistatin.2. The method of claim 1 , further comprising preserving the isolated epithelial stem/progenitor cells.3. The method of claim 2 , wherein preserving is carried out by using cryo-preservation.4. The method of claim 1 , wherein the tissue explant is obtained by separating the amniotic membrane from the other components of the umbilical cord in vitro. This application is a continuation application of U.S. patent application Ser. No. 14/715,441, filed May 18, 2015, which is a divisional of U.S. patent application Ser. No. 11/205,248 filed Aug. 15, 2005, which claims the benefit of U.S. Provisional Application No. 60/602,208, filed Aug. 16, 2004, and to U.S. Provisional Application No. 60/632,209, filed Dec. 1, 2004, the contents of each being hereby incorporated by reference it its entirety for all purposes.The present invention relates to a method for isolating stem/progenitor cells from the ...

Подробнее

Номер записи: 49

04-01-2018 дата публикации

Induced Hepatocytes and Uses Thereof

Номер: US20180000868A1

Автор: LEE Jau-Nan, LEE Tony Tung-Yin, LEE Yuta, TSAI Eing-Mei

Принадлежит:

Disclosed herein are induced hepatocytes from a trophoblast stem cell, methods for inducing the cells, and compositions thereof. Also disclosed herein are methods of treating a disease or disorder (e.g., liver-associated) by utilizing an induced hepatocyte disclosed herein. 189-. (canceled)90. An isolated human hepatocyte , wherein the isolated human hepatocyte expresses human leukocyte antigen G (HLA-G) and human cytoplasmic marker stem 121 (stem 121).91. The isolated human hepatocyte of claim 90 , wherein the isolated human hepatocyte is a human hepatic progenitor cell.92. The isolated human hepatocyte of claim 90 , wherein the isolated human hepatocyte further expresses one or more biomarkers selected from the group consisting of CXCR4 claim 90 , FOXA2 claim 90 , SOX17 claim 90 , HHEX claim 90 , TTR claim 90 , ALB claim 90 , TAT claim 90 , CYP7A1 claim 90 , BSEP claim 90 , SERPINA1 claim 90 , G6PC claim 90 , ABCC2 claim 90 , C/EBPβ claim 90 , HNF1α claim 90 , HNF4α claim 90 , and any combination thereof.93. The isolated human hepatocyte of claim 90 , wherein the isolated human hepatocyte further expresses TGFβ1 claim 90 , fibronectin claim 90 , or collagen IV in extracellular matrix (ECM).94. The isolated human hepatocyte of claim 90 , wherein the isolated human hepatocyte recruits CD4Foxp3 Treg cells.95. The isolated human hepatocyte of claim 90 , wherein the isolated human hepatocytes form tissue of a 3-dimensional structure.96. The isolated human hepatocyte of claim 90 , wherein the isolated human hepatocytes cluster or aggregate.97. The isolated human hepatocyte of claim 90 , wherein the isolated human hepatocytes form a crescent cell mass.98. The isolated human hepatocyte of claim 90 , wherein the isolated human hepatocyte further expresses one or more markers selected from the group consisting of TGFβ1 claim 90 , C-kit claim 90 , CK19 claim 90 , CK18 claim 90 , ALB claim 90 , α-AFP claim 90 , betatrophin claim 90 , ADH1 claim 90 , APOF claim 90 , CPS1 claim ...

Подробнее

Номер записи: 50

06-01-2022 дата публикации

Cell lines expressing inserted secretable reporter genes at multiple stages of differentiation

Номер: US20220002822A1

Автор: James M. Stafford, Michael R. Rountree

Принадлежит: Nzumbe Inc

A composition of matter comprises one or more cell lines configured to inducibly differentiate to at least a first stage of differentiation and a second, subsequent stage of differentiation. Each of the one or more cell lines are genetically edited to express one or more first stage inserted secretable reporter genes placed under control of promoters for genes canonically expressed during the first stage of differentiation. The cell lines are further genetically edited to express one or more second stage inserted secretable reporter genes placed under control of promoters for genes canonically expressed during the second stage of differentiation, but not during the first stage of differentiation, wherein the one or more second stage inserted secretable reporter genes are different than the one or more first stage inserted secretable reporter genes.

Подробнее

Номер записи: 51

05-01-2017 дата публикации

COMPOSITIONS AND METHODS OF OBTAINING AND USING ENDODERM AND HEPATOCYTE CELLS

Номер: US20170002313A1

Автор: Doudement Estelle, UPPAL Hirdesh

Принадлежит:

The invention provides for efficient methods for generating populations of endoderm cells and/or differentiated cells derived from endoderm cells (e.g., hepatic cells, pancreatic precursor cells, pancreatic cells, intestinal progenitor cells, intestinal cells, lung progenitor cells, lung cells, etc.). Also provided are compositions of endoderm cells and differentiated cells derived from endoderm cells (e.g., hepatic cells, pancreatic precursor cells, pancreatic cells, intestinal progenitor cells, intestinal cells, lung progenitor cells, lung cells, etc.) and methods of using such cells. 1. An isolated population of endoderm cells wherein at least 83% of the cells express SOX17 , at least 77% of the cells express FoxA2 , or at least 76% of the cells express CXCR4.2. The isolated population of endoderm cells of claim 1 , wherein at least 83% of the cells express SOX17 and at least 77% of the cells express FoxA2.3. The isolated population of endoderm cells of claim 1 , wherein at least 77% of the cells express FoxA2 and at least 76% of the cells express CXCR4.4. The isolated population of endoderm cells of claim 1 , wherein at least 83% of the cells express SOX17 and at least 76% of the cells express CXCR4.5. The isolated population of endoderm cells of claim 1 , wherein at least 83% of the cells express SOX17 claim 1 , at least 77% of the cells express FoxA2 claim 1 , and at least 76% of the cells express CXCR4.6. The isolated population of endoderm cells of claim 1 , wherein the endoderm cells have the capability to become hepatocytes claim 1 , pancreatic cells claim 1 , pancreatic progenitor cells claim 1 , liver cells claim 1 , lung cells claim 1 , airway progenitor cells claim 1 , or lung epithelial cells.7. A bank of stable endoderm cells comprising one or more populations of endoderm cells wherein at least 83% of the cells express SOX17 claim 1 , at least 77% of the cells express FoxA2 claim 1 , and/or at least 76% of the cells express CXCR4 claim 1 , wherein ...

Подробнее

Номер записи: 52

05-01-2017 дата публикации

TRANS-DIFFERENTIATION OF DIFFERENTIATION CELLS

Номер: US20170002316A1

Автор: Gascón Jiménez Sergio, Götz Magdalena

Принадлежит: Helmholtz Zentrum München-Deutsches Forschungszent Forschungszentrum Für Gesundheit Und Umwelt (GMBH

The present invention comprises methods and compositions related to trans-differentiating differentiated cells, the methods comprising bringing said cells into contact with a polypeptide or a nucleic acid encoding said polypeptide. 1. A method of trans-differentiating differentiated cells , the method comprising bringing said cells into contact with at least one component (i) and at least one component (ii) , whereinsaid component (i) is selected from(a) a polypeptide comprising at least one domain selected from a BH1, a BH2, a BH3 and a BH4 domain;(b) a polypeptide comprising or consisting of the amino acid sequence of a wild-type form of a member of the Bcl-2 family or a fragment thereof;(c) a polypeptide comprising or consisting of the amino acid sequence of a wild-type form of a member of the Bcl-2 family or a fragment thereof, wherein said polypeptide comprises one or more point mutations as compared to said wild-type form or fragment thereof;{'sub': 'L', '(d) a polypeptide comprising or consisting of an amino acid sequence which sequence exhibits at least 30% sequence identity with a wild-type form of a member of the Bcl-2 family, said wild-type form of a member of the Bcl-2 family preferably being selected from human Bcl-2 (SEQ ID NO: 1 or 5), human Bcl-X(SEQ ID NO: 6), human Bcl-w (SEQ ID NO: 7), human Mcl1 (SEQ ID NO: 8), human BfI1 (SEQ ID NO: 9 or 10), human Nrh (SEQ ID NO: 11), human Bcl2L1 (SEQ ID NO: 12), human DIVA (SEQ ID NO: 13), human myeloid cell leukemia sequence 1 isoform 1 (SEQ ID NO: 14), and human Bcl-x beta (SEQ ID NO: 15);'}wherein said wild-type form has anti-apoptotic activity;a nucleic acid encoding said polypeptide; andmeans for enhancing the amount and/or activity of said polypeptide in said cells;wherein said component (i) enhances the yield of trans-differentiated cells by at least 30% as compared to the absence of said component (i);andwherein said component (ii) is selected from a transcription factor capable of trans- ...

Подробнее

Номер записи: 53

05-01-2017 дата публикации

Master Transcription Factors Identification and Use Thereof

Номер: US20170002319A1

Автор: "DAlessio Ana C.", Fan Zi Peng, Lee Tang Ihn, Young Richard A.

Принадлежит:

Provided herein are methods for identifying master transcription factors (TFs) in a cell type of interest and for transdifferentiation of a somatic cell, e.g., a fibroblast to the cell type of interest. Also provided herein are induced retinal pigment epithelium (iRPE) cell, master TFs therefor, methods for making iRPE cell, and methods and compositions for treating an ocular disease such as age-related macular degeneration. 1. A method of identifying master transcription factors of a query cell type , comprising:providing gene expression data of a plurality of transcription factors for a query cell type;relatively quantifying expression level and expression specificity of each transcription factor in the query cell type against a background gene expression profile assembled from a collection of cell types by using an entropy-based measure of Jensen-Shannon divergence (JSD), thereby generating a cell-type-specificity score for each transcription factor; andranking the plurality of transcription factors based on their corresponding cell-type-specificity scores, wherein top ranked transcription factors are identified as master transcription factors of the query cell type.2. The method of claim 1 , wherein in the providing step claim 1 , the gene expression data is selected from one or more of: gene expression profiling by microarray or sequencing claim 1 , non-coding RNA profiling by microarray or sequencing claim 1 , chromatin immunoprecipitation profiling by microarray or sequencing claim 1 , genome methylation profiling by microarray or sequencing claim 1 , genome variation profiling by array claim 1 , single nucleotide polymorphism array claim 1 , serial analysis of gene expression claim 1 , and/or protein array.3. The method of claim 1 , wherein in the providing step claim 1 , a plurality of disparate sets of gene expression data are provided.4. The method of claim 3 , further comprising comparing the plurality of disparate sets of gene expression data by pair- ...

Подробнее

Номер записи: 54

05-01-2017 дата публикации

Purification of Cell Mixtures Using Molecular Beacons Targeting Cell Specific RNA

Номер: US20170002326A1

Автор: Ban Kiwon, BAO Gang, Wile Brin, YOON Young Sup

Принадлежит:

This disclosure is in the area of research and therapeutics. In certain embodiments, it provides methods to assist in the purification of cell mixtures, e.g., cardiomyocytes, using molecular beacons targeting cell-type specific RNA, e.g. mRNA. 1. A kit comprising a molecular beacon comprising a loop sequence having SEQ ID NO: 4.2. The kit of further comprising instructions for purifying cardiomyocytes.3. The kit of further comprising bone morphogenetic protein 4.4. The kit of further comprising activin A.5. The kit of further comprising basic fibroblast growth factor.6. The kit of further comprising isoproterenol.7. The kit of claim 1 , wherein the molecular beacon is enclosed in a container.8. The kit of claim 7 , wherein the container is a vial or ampoule.9. A method for purifying cardiomyocytes comprising claim 7 ,a) introducing a molecular beacon comprising a loop sequence having SEQ ID NO: 2 into a mixture of cardiomyocytes and pluripotent stem cells under conditions such that the molecular beacon hybridizes to mRNA in the cardiomyocytes providing molecular beacon bound fluorescent cardiomyocytes; andb) purifying the molecular beacon bound fluorescent cardiomyocytes by fluorescence activated cell sorting providing a purified composition of cardiomyocytes.10. The method of claim 9 , wherein the mixture of cardiomyocytes and pluripotent stem cells have been differentiated by a method comprising:a) culturing undifferentiated stem cells under conditions such that a monolayer of the undifferentiated stem cells is formed,b) applying bone morphogenetic protein 4 (BMP4), Activin A, and fibroblast growth factor 2 (FGF2) to the undifferentiated stem cells under conditions such that cardiac lineage cells are formed, and,c) treating the cardiac lineage cells with isoproterenol to generate spontaneous beating cardiomyocytes.11. The method of claim 9 , wherein pluripotent stem cells are mammalian stem cells.12. A kit comprising a molecular beacon comprising a loop sequence ...

Подробнее

Номер записи: 55

04-01-2018 дата публикации

EFFICIENT INDUCTION OF DEFINITIVE ENDODERM FROM PLURIPOTENT STEM CELLS

Номер: US20180002668A1

Автор: Ekberg Jenny, Funa Nina, Hess Katja, Semb Henrik

Принадлежит:

The present invention relates to a method to differentiate pluripotent stem cells to a primitive streak cell population, in a stepwise manner for further maturation to definitive endoderm. 1. A method for differentiation of stem cells into definitive endoderm comprising the steps of:incubating stem cells in a medium comprising at least 2 μM CHIR, wherein activin A is not present; andsubsequently incubating stem cells in a medium comprising activin A.2. The method according to claim 1 , wherein said medium is RPMI-1640.3. The method according to claims 1 , wherein said stem cells are embryonic stem cells or induced pluripotent stem cells.4. The method according to claim 1 , wherein the concentration of CHIR is at least about 2.5 μM.5. The method according to claim 1 , wherein the concentration of CHIR is at least about 3.1 μM.6. The method according to claim 1 , wherein the concentration of CHIR is in a range selected from the group consisting of about 2.5-15 uM claim 1 , about 3.1-15 μM claim 1 , about 3.1-7 μM claim 1 , 3.5-7 μM claim 1 , about 3.5-6 μM claim 1 , and about 3.5-5 μM.7. The method according to claim 1 , wherein the concentration of CHIR is at least about 3.5 μM.8. The method according to claim 1 , wherein said incubation with CHIR is at least 24 hours.9. The method according to claim 1 , wherein said incubation with activin A is at least 24 hours.10. The method according to claim 1 , wherein said incubation with activin A is 48 to 72 hours.11. The method according to claim 1 , wherein endodermal cells are obtained from said definitive endoderm cells.12. The method according to claim 11 , wherein said endoderm cells are pancreatic endoderm cells.13. Pancreatic endoderm cells obtainable by the method of .14. The method according to claim 1 , wherein the concentration of CHIR in the culture medium is at least 3 μM.15. The method according to claim 1 , wherein the concentration of CHIR in the culture medium is in a range selected from the group ...

Подробнее

Номер записи: 56

04-01-2018 дата публикации

CHEMICAL APPROACHES FOR GENERATION OF INDUCED PLURIPOTENT STEM CELLS

Номер: US20180002671A1

Автор: Desponts Caroline, Ding Sheng, Li Wenlin, Lin Tongxiang, Shi Yan, Zhu Saiyong

Принадлежит:

The present invention provides for identification and use of small molecules to induce pluripotency in mammalian cells as well as other methods of inducing pluripotency. 120-. (canceled)21. A therapeutic composition comprising (i) an induced pluripotent stem cell reprogrammed from a mammalian non-pluripotent cell , and (ii) a small molecule composition comprising a GSK-3 inhibitor.22. The therapeutic composition of claim 21 , wherein the small molecule composition further comprises a MEK inhibitor claim 21 , an Erk inhibitor claim 21 , or a TGFβ receptor/ALK5 inhibitor.23. The therapeutic composition of claim 22 , wherein the TGFβ receptor/ALK5 inhibitor is selected from the group consisting of A-83-01 and SB431542.24. The therapeutic composition of claim 22 , wherein the MEK inhibitor is PD0325901.25. The therapeutic composition of claim 21 , wherein the GSK-3 inhibitor is selected from the group consisting of CHIR99021 claim 21 , CHIR98014 claim 21 , and 6-bromoindirubin-3′-oxime (BIO).26. The therapeutic composition of claim 21 , wherein the induced pluripotent stem cell is reprogrammed by introducing into the mammalian non-pluripotent cell exogenous polynucleotides comprising an Oct4 encoding polynucleotide and a Klf encoding polynucleotide to initiate reprogramming.27. The therapeutic composition of claim 21 , further comprising a pharmaceutically acceptable carrier.28. A composition comprising differentiated cells of a desired cell type derived from induced pluripotent stem (iPS) cells claim 21 , wherein the iPS cells are comprised in a composition comprising a small molecule composition comprising a GSK-3 inhibitor.29. The composition of claim 28 , wherein the GSK-3 inhibitor is selected from the group consisting of CHIR99021 claim 28 , CHIR98014 claim 28 , and 6-bromoindirubin-3′-oxime (BIO).30. The composition of claim 28 , wherein the iPS cells are reprogrammed by introducing into mammalian non-pluripotent cells exogenous polynucleotides comprising an Oct4 ...

Подробнее

Номер записи: 57

02-01-2020 дата публикации

METHOD FOR INDUCING TRANS-DIFFERENTIATION OF CARDIOMYOCYTES BASED ON EXOSOME

Номер: US20200002677A1

Автор: KIM Hyosuk, KIM Sun Hwa, KWON Ick Chan, YANG Yoosoo

Принадлежит: KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY

The present invention relates to a method for inducing trans-differentiation of cardiomyocytes based on exosome, and more particularly, to a method for inducing trans-differentiation of a fibroblast into a cardiomyocyte, comprising the steps of: isolating exosomes in a culture medium during a process of differentiating a stem cell into the cardiomyocyte; culturing a fibroblast in a cardiomyocyte reprogramming medium containing the isolated exosomes; and culturing the fibroblast cultured in a cardiomyocyte differentiation medium containing the isolated exosomes. 1. A method of inducing trans-differentiation a fibroblast to a cardiomyocyte , the method comprising:isolating exosomes in a culture medium during a process of differentiating a stem cell into the cardiomyocyte;culturing a fibroblast in a cardiomyocyte reprogramming medium containing the isolated exosomes; andculturing the fibroblast cultured in a cardiomyocyte differentiation medium containing the isolated exosomes.2. The method according to claim 1 , wherein the exosomes are prepared by mixing a first exosome isolated during a mesoderm induction process and a second exosome isolated during a cardiac specification and maturation process.3. The method according to claim 2 , wherein mixing ratio of the first exosome and the second exosome is from 1:19 to 19:1.4. The method according to claim 1 , wherein the cardiomyocyte reprogramming medium comprises 2 to 7 wt % of KnockOut Serum Replacement claim 1 , 10 to 17 wt % of embryonic stem cell fetal calf serum (ES-FBS) claim 1 , 0.1 to 2 wt % of N2 claim 1 , 1 to 3 wt % of B-27 claim 1 , 0.5 to 2 wt % of Glutamax claim 1 , 0.5 to 2 wt % of nonessential amino acid (NEAA) claim 1 , 0.05 to 0.2 mM of β-mercaptoethanol claim 1 , and 20 to 70 μg/ml of ascorbic acid.5. The method according to claim 1 , the cardiomyocyte differentiation medium comprises 12 to 20 wt % of fetal bovine serum claim 1 , 20 to 70 μg/ml of ascorbic acid claim 1 , 0.5 to 2 μg/ml of insulin claim ...

Подробнее

Номер записи: 58

07-01-2021 дата публикации

METHODS AND COMPOSITIONS FOR PREPARING CARDIOMYOCYTES FROM STEM CELLS AND USE THEREOF

Номер: US20210002614A1

Автор: Ma Yue

Принадлежит: Institute of Biophysics, Chinese Academy of Sciences

The present invention discloses novel compositions and methods for enhancing cardiac differentiation efficiency of stem cells or promoting ventricular and atrial cardiomyocytes formation from stem cells. The present invention also discloses the atrial and ventricular cardiomyocytes formed from the stem cells, and the uses of the cardiomyocytes for repairing cardiac injuries and screening for new medicaments for treating cardiac injuries. 177-. (canceled)78. A pharmaceutical composition for treating a cardiac injury or disorder , which pharmaceutical composition comprises an effective amount of a ventricular cardiomyocyte differentiated , in vitro , from a mesodermal cell in which the retinoic acid signaling pathway is inhibited by an exogenous agent to promote ventricular cardiomyocyte formation from the mesodermal cell.79. The pharmaceutical composition of claim 78 , wherein the mesodermal cell is differentiated from a pluripotent stem cell claim 78 , a totipotent stem cell claim 78 , a multipotent stem cell claim 78 , an oligopotent stem cell claim 78 , a unipotent stem cell claim 78 , an embryonic stem cell claim 78 , an induced pluripotent stem cell claim 78 , a fetal stem cell claim 78 , or an adult stem cell.80. The pharmaceutical composition of claim 78 , wherein the mesodermal cell is differentiated from a mammalian stem cell.81. The pharmaceutical composition of claim 78 , wherein the mesodermal cell is differentiated from a human stem cell claim 78 , a human embryonic stem cell claim 78 , or a human induced pluripotent stem cell.82. The pharmaceutical composition of claim 78 , wherein the mesodermal cell is generated by contacting a stem cell with basic fibroblast growth factor (bFGF) claim 78 , BMP 4 and/or activin A.83. The pharmaceutical composition of claim 78 , wherein the mesodermal cell is generated by contacting a stem cell with Wnt-3a claim 78 , Bio claim 78 , or CHIR99021.84. The pharmaceutical composition of claim 78 , wherein the mesodermal ...

Подробнее

Номер записи: 59

07-01-2021 дата публикации

DEVELOPMENT OF SUPERIOR CHIMERISM BY hiPSC ENGINEERING AND EMBRYO AGGREGATION

Номер: US20210002616A1

Автор: Gafni Ohad, Garry Daniel J., Garry Mary G., Maeng Geunho

Принадлежит:

Provided herein are method to increase the efficiency of interspecies chimera generation. 1. A method to increase the efficiency of human:non-human animal chimera generation comprising introducing one or more human stem cells into a non-human embryo , wherein multiple embryos are dissociated and the dissociated aggregate is layered with one or more human cells and cultured prior to transfer into a synchronized gilt , wherein the aggregated embryo and cells results in increased efficiency of chimera generation , further comprising knocking down or out the expression of TP53 and/or overexpression BCL-2 in the one or more human cells.2. The method of claim 1 , wherein BCL-2 is overexpressed.3. The method of claim 1 , wherein TP53 expression is reduced/knocked down.4. The method of claim 1 , wherein BCL-2 is overexpressed and TP53 expression is reduced/knocked down.5. The method of claim 1 , wherein the cells are induced human pluripotent stem cells (hiPSCs).6colicoli. The method of claim 1 , wherein one or both alleles of ETV2 claim 1 , NKX2-5 claim 1 , HandII claim 1 , TBX5 claim 1 , MYF5 claim 1 , MYOD claim 1 , MRF4 claim 1 , IL2Rgy/− claim 1 , RAG2−/− claim 1 , IL2Rg−/−; RAG2−/− claim 1 , IL2Rgy/− claim 1 , RAG2−/− claim 1 , IL2Rg+/− claim 1 , RAG2+/− claim 1 , IL2Rgy/+; RAG2+/− claim 1 , IL2Rg+/−; RAG2+/− claim 1 , DGAT (diglyceride acyltransferase) claim 1 , ABCG2 (ATP-binding cassette sub-family G member 2) claim 1 , ACAN (aggrecan) claim 1 , AMELY (amelogenin claim 1 , y-linked) claim 1 , BLG (progestagen-associated endometrial protein) claim 1 , BMP 1B (FecB) (bone morphogenetic protein receptor claim 1 , type 1B) claim 1 , DAZL (deleted in azoospermia like) claim 1 , Eif4GI (eukaryotic translation initiation factor 4 gamma claim 1 , 1) claim 1 , GDF8 (growth/differentiation factor 8) claim 1 , Horn-poll locus claim 1 , IGF2 (insulin-like growth factor 2) claim 1 , CWC15 (CWC15 spliceosome associated protein) claim 1 , KissR/GRP54 (kisspeptin) claim 1 , OFD1Y ...

Подробнее

Номер записи: 60

03-01-2019 дата публикации

Method for Inducing Targeted Differentiation of Human Stem Cells Toward Hepatic Cells

Номер: US20190002825A1

Автор: CHEN Li-Xin, ZHANG Pei-Lin

Принадлежит:

The present invention relates to a novel method for multi-target-directed inducing direct differentiation of human stem cells, such as human embryonic stem cells (ES cells) or induced pluripotent stem cells (iPS cells), into hepatocytes using combinations of small molecules. The present invention discloses a medium and a culturing method for inducing directed differentiation of human stem cells into hepatocytes directly. In the method of the present invention, no exogenous genes are need to be introduced into stem cells, no stepwise induction is needed, various cell growth factors are not needed, and directed differentiation of human stem cells into hepatocytes directly can be achieved using only small chemical molecules. The differentiated human hepatocytes obtained have the typical characteristics of human hepatocytes, the differentiated liver precursor cells can be passaged for a long period of time, and the differentiated liver mature cells can be passaged for a limited number of times. Moreover, the method uses a conventional culturing procedure with simple operation, low cost, safety and stability. 1. A medium for inducing directed differentiation of human stem cells into hepatocytes comprising a cell differentiation minimal medium; anda GSK3β inhibitor with a final concentration of 0.5-8 uM;a TGFβ inhibitor with a final concentration of 0.1-10 uM; anda retinoid with a final concentration of 0.001-10 uM;wherein the medium can induce directed differentiation of human stem cells into hepatocytes directly, thereby obtaining human liver precursor cells or liver mature cells.2. The medium according to claim 1 , wherein claim 1 ,the GSK3β inhibitor is present at a final concentration of 0.5-5 uM;the TGFβ inhibitor is present at a final concentration of 0.5-8 uM; andthe retinoid is present at a final concentration of 0.01-5 uM.3. The medium according to claim 1 , wherein the GSK3β inhibitor is selected from GSK3β signaling pathway inhibitors or compounds of the same ...

Подробнее

Номер записи: 61

03-01-2019 дата публикации

METHODS FOR PRODUCING ENUCLEATED ERYTHROID CELLS DERIVED FROM PLURIPOTENT STEM CELLS

Номер: US20190002828A1

Автор: LANZA Robert, Lu Shi-Jiang

Принадлежит: Astellas Institute for Regenerative Medicine

Methods for generating enucleated erythroid cells using pluripotent stem cells are provided. The methods permit the production of large numbers of cells. The cells obtained by the methods disclosed may be used for a variety of research, clinical, and therapeutic applications. Methods for generating megakaryocyte and platelets are also provided. 1. A method of producing a pluripotent stem cell-derived enucleated erythroid cell , comprising: providing a pluripotent stem cell; and differentiating said pluripotent stem cell into an enucleated erythroid cell by culturing said pluripotent stem cell with OP9 mouse stromal cells or human mesenchymal stem cells (MSCs).231-. (canceled)32. A method of producing a pluripotent stem cell-derived erythroid cell , comprising: providing a human pluripotent stem cell; and differentiating said pluripotent stem cell into an erythroid cell by culturing said pluripotent stem cell in a medium comprising EPO.33. The method of claim 32 , wherein said pluripotent stem cell is selected from the group consisting of an embryonic stem cell claim 32 , induced pluripotent stem cell claim 32 , or embryo-derived cell.3435-. (canceled)36. The method of claim 32 , wherein said pluripotent stem cell is genetically manipulated prior to differentiation.37. The method of claim 32 , wherein differentiating said pluripotent stem cell into an erythroid cell comprises differentiating said pluripotent stem cell into a hemangioblast claim 32 , non-engrafting hemangio cell claim 32 , or blast cell.38. The method of claim 37 , wherein said hemangioblast claim 37 , non-engrafting hemangio cell claim 37 , or blast cell is expanded prior being differentiated into said erythroid cell.39. The method of claim 38 , wherein said hemangioblasts claim 38 , non-engrafting hemangio cells claim 38 , or blast cells are expanded in the presence of Epo claim 38 , IL-3 claim 38 , and SCF.40. The method of claim 32 , further comprising:(a) culturing a cell culture comprising said ...

Подробнее

Номер записи: 62

03-01-2019 дата публикации

LARGE SCALE GENERATION OF FUNCTIONAL MEGAKARYOCYTES AND PLATELETS FROM HUMAN EMBRYONIC STEM CELLS UNDER STROMAL-FREE CONDITIONS

Номер: US20190002829A1

Автор: Li Feng, Lu Shi-Jiang

Принадлежит: Stem Cell & Regenerative Medicine International

The present invention provides a method of generating megakaryocytes and platelets. In various embodiments, method involves the use of human embryonic stem cell derived hemangioblasts for differentiation into megakaryocytes and platelets under serum and stromal-free condition. In this system, hESCs are directed towards megakaryocytes through embryoid body formation and hemangioblast differentiation. Further provided is a method of treating a subject in need of platelet transfusion. 1. A method of generating megakaryocytes , comprising:providing hemangioblasts; andculturing the hemangioblasts to differentiate into megakaryocytes (MKs).219-. (canceled)20. A quantity of megakaryocytes generated from the method of .21. A method of generating platelets claim 1 , comprising:culturing human pluripotent stem cells to produce hemangioblasts:differentiating the hemangioblasts to obtain megakaryocytes (MKs); andculturing the MKs to differentiate into platelets.2227-. (canceled)28. The method of claim 21 , wherein the pluripotent stem cells are human embryonic stem cells (hESCs) or induced pluripotent stem cells (iPSCs).29. (canceled)30. The method of claim 21 , wherein the pluripotent stem cells are cultured to form embryoid bodies (EBs) and the EBs are further cultured to produce hemangioblasts.3132-. (canceled)33. The method of claim 30 , wherein the formed EBs are chemically and/or mechanically dissociated and cultured in the presence of at least one growth factor selected from the group consisting of BMP-4 claim 30 , VEGF claim 30 , bFGF claim 30 , TPO claim 30 , Flt3 ligand claim 30 , and SCF to generate the hemangioblasts.3440-. (canceled)41. The method of claim 21 , wherein the MKs are cultured for at least 4 days in medium comprising at least one growth factor selected from the group consisting of TPO claim 21 , SCF claim 21 , sodium heparin claim 21 , and IL1 to differentiate into the platelets.42. The method of claim 41 , wherein the concentration of TPO is 100 ng/ml ...

Подробнее

Номер записи: 63

13-01-2022 дата публикации

Aminoquinoline Derivatives and Uses Thereof

Номер: US20220008418A1

Автор: Kandi Shamseer Kulangara, Kim Chun-Hyung, KIM Kwang-Soo, Kumar Deepak, Manohar Sunny, Rajesh Ummadisetty Chinna, Rawat Diwan S., Reddy Panyala Linga, Thakur Anuj, Tripathi Mohit, Vardhineni Satyapavan

Принадлежит:

Described herein are aminoquinoline and aminoacridine based hybrids, pharmaceutical compositions and medicaments that include such aminoquinoline and aminoacridine based hybrids, and methods of using such compounds for diagnosing and/or treating infections, neurodegerative diseases or disorders, inflammation, inflammation associated diseases and disorders, and/or diseases or disorders that are treatable with dopamine agonists such as the restless leg syndrome. 2. (canceled)49-. (canceled)11. (canceled)13. The method of claim 1 , comprising co-administering to the subject a composition comprising stem cells claim 1 , wherein an amount of the compound is sufficient to induce differentiation of the stem cells.14. The method of claim 13 , wherein the stem cells are human embryonic stem cells. This application is a continuation of U.S. patent application Ser. No. 15/404,964, filed Jan. 12, 2017, which is a divisional application of U.S. patent application Ser. No. 14/382,727, filed on Sep. 3, 2014, now U.S. Pat. No. 9,567,316, which is a 35 U.S.C. § 371 National Stage Entry Application of International Application No. PCT/US2013/028329, filed Feb. 28, 2013, which designates the U.S., and which claims benefit under one or more of 35 U.S.C. § 119(a)-119(d) of Indian Patent Application No. 661/DEL/2012, filed Mar. 7, 2012, the contents of each of which are incorporated herein by reference in their entirety.This invention was made with government support under grant no. MH048866 awarded by the National Institutes of Health. The government has certain rights in the invention.The sequence listing of the present application has been submitted electronically via EFS-Web as an ASCII formatted sequence listing with the file name: “Sequence Listing”, creation date of Apr. 26, 2021 and a size of 8,539 bytes. The sequence listing submitted via EFS-Web is part of the specification and is herein incorporated by reference in its entirety.The present disclosure relates generally to ...

Подробнее

Номер записи: 64

02-01-2020 дата публикации

ISOLATION OF HUMAN LUNG PROGENITORS DERIVED FROM PLURIPOTENT STEM CELLS

Номер: US20200003776A1

Автор: Hawkins Finn, KOTTON Darrell N.

Принадлежит: TRUSTEES OF BOSTON UNIVERSITY

Provided herein are methods and compositions relating, in part, to the generation and isolation of human lung progenitor cells from pluripotent stem cells. 1. A composition comprising: a population of CD47/CD26lung progenitor cells and a pharmaceutically acceptable carrier.2. The composition of claim 1 , wherein the composition further comprises a scaffold.3. The composition of claim 1 , wherein the population of CD47/CD26lung progenitor cells is at least 90% pure.4. The composition of claim 1 , where the CD47/CD26lung progenitor cell also expresses NKX2-1.5. The composition of claim 1 , wherein the CD47/CD26lung progenitor cell further expresses SFTA3 claim 1 , CPM claim 1 , NFIB claim 1 , NKX2-1 claim 1 , CRH claim 1 , JUN claim 1 , MECOM claim 1 , SOX2 claim 1 , HES1 claim 1 , HOXA1 claim 1 , FOXA2 claim 1 , FOXA1 claim 1 , GATA6 claim 1 , GRHL2 claim 1 , IRX1 claim 1 , IRX2 claim 1 , ELF3 claim 1 , ELF5 claim 1 , HNFIB claim 1 , FOXP2 claim 1 , HOXA4 claim 1 , HOXC4 claim 1 , SHH claim 1 , EPCAM claim 1 , CD166 claim 1 , CD227 claim 1 , SOX2 claim 1 , SOX9 claim 1 , and/or LAMA2.6. The composition of claim 1 , wherein the CD47/CD26lung progenitor cell comprises expression of NKX2-1 claim 1 , SFTA3 claim 1 , CPM claim 1 , and LAMA3.7. The composition of claim 1 , wherein the CD47/CD26lung progenitor cell does not express SCGB3A2 claim 1 , SFTPB claim 1 , TP63 claim 1 , ICAM1 claim 1 , IL8 claim 1 , ASCL1 claim 1 , FOXJ1 claim 1 , SCGB1A1 claim 1 , ITGB6 claim 1 , SIX3 claim 1 , SIX6 claim 1 , OTX1 or PAX8.8. The composition of claim 1 , wherein the CD47/CD26lung progenitor cell or the lung primordial progenitor cell is engineered to comprise at least one genomic modification.9. The composition of claim 1 , wherein the CD47/CD26lung progenitor cells are isolated by a method comprising:(a) contacting a population of cells comprising lung primordial progenitor cells with an antibody that recognizes CD47 and a second antibody that recognizes CD26 to determine the ...

Подробнее

Номер записи: 65

13-01-2022 дата публикации

OVARIAN FOLLICLE CELLS AND CONSTRUCTS FOR FERTILITY TREATMENT AND HORMONE REPLACEMENT THERAPY

Номер: US20220010270A1

Автор: Atala Anthony, Jackson John D., Sequeira Russel C., Sivanandane Sittadjody, Yoo James J.

Принадлежит:

A method of providing a culture of oogonia stem cells comprising oogonia stem cells is provided. The method may further include culturing the oogonia stem cells with granulosa and theca cells to differentiate the oogonia stem cells into oocytes. In some embodiments, the culturing comprises including the oogonia stem cells in an in vitro follicle construct or a microcapsule comprising said granulosa and theca cells. Further described herein is a method of forming a bioengineered follicle construct capable of releasing a mature oocyte. An in vitro fertilization method using the mature oocyte is also provided. 2. The method of claim 1 , wherein the ovary tissue is adult human ovary tissue.3. The method of claim 1 , wherein the separating is carried out with fluorescent-activated cell sorting (FASC) claim 1 , immunomagnetic bead sorting claim 1 , or magnetic activated cell sorting (MASC).4. The method of claim 1 , wherein said providing step comprises: isolating ovarian cells from the ovary tissue; and culture expanding the ovarian cells in a germ-line stem cell media.5. The method of claim 1 , further comprising a step of collecting ovarian cells that are not positive for either DDX4 or IFITM3 claim 1 , to provide a second population comprising cells that can differentiate into granulosa and theca cells.6. The method of claim 5 , wherein the method further comprises differentiating the cells of the second population into granulosa and/or theca cells.7. The method of claim 1 , further comprising culturing the oogonia stem cells with granulosa and theca cells claim 1 , to differentiate the oogonia stem cells into oocytes.8. The method of claim 7 , wherein the culturing comprises contacting the oogonia stem cells with a combination of retinoic acid claim 7 , follicle-stimulating hormone claim 7 , and estradiol.10. The in vitro follicle construct of claim 9 , wherein one claim 9 , two claim 9 , or all three of the live mammalian ovarian granulosa cells claim 9 , live ...

Подробнее

Номер записи: 66

07-01-2021 дата публикации

Methods and devices for live cell imaging analysis

Номер: US20210004563A1

Автор: Chieko NAKADA, Kathleen L. Pfaff, Keiichi Niikura, Lee L. Rubin, Yasujiro Kiyota

Принадлежит: Harvard College, Nikon Corp

Provided herein are methods for analysis of target cells on a population or individual basis, including before and after contact with a stimulus in order to determine the effect of such stimulus on the target cells. Also provided are devices for performing such methods. The analysis methods involve identifying and measuring or tracking morphological changes that occur in target cells over a period of time. Tracking is accomplished using imaging systems capable of imaging target cells individually over a period of time either continuously or at discrete intervals of time.

Подробнее

Номер записи: 67

14-01-2021 дата публикации

METHODS OF TREATING HEMATOLOGICAL DISORDERS, SOLID TUMORS, OR INFECTIOUS DISEASES USING NATURAL KILLER CELLS

Номер: US20210008109A1

Автор: HARRIS Jeffrey, JANKOVIC Vladimir, KANG Lin, ZHANG Xiaokui

Принадлежит: Celgene Corporation

Provided herein are methods of treating a hematological disorder, a solid tumor, or an infectious disease in a subject in need thereof using natural killer cells in combination with a second agent, or using natural killer cells with genetic modifications for target specificity and/or homing specificity. 182.-. (canceled)83. A method of treating a viral infection in a subject in need thereof , comprising administering to said subject an isolated population of NK cells or a pharmaceutical composition thereof , wherein the NK cells comprise a chimeric antigen receptor (CAR) , wherein said CAR comprises an extracellular domain that binds to an antigen on an infected cell , a transmembrane domain , and an intracellular stimulatory domain that comprises a co-stimulatory domain comprising the intracellular domain of NKp46 , NKp44 , NKp30 , DAP10 or DAP12.84. (canceled)85. The method of claim 83 , wherein the NK cells comprising the CAR are derived from CD34+ hematopoietic stem cells (HSCs) that are engineered to express the CAR.86. The method of claim 83 , wherein the extracellular domain that binds to an antigen on an infected cell is a viral antigen binding domain.87. The method of claim 83 , wherein the extracellular domain that binds to an antigen on an infected cell is an scFv domain.88. The method of claim 83 , wherein the intracellular stimulatory domain is a CD3 zeta signaling domain.89. (canceled)90. The method of claim 83 , wherein the NK cells further comprise a homing receptor.91. The method of claim 90 , wherein the NK cells comprising the homing receptor are derived from CD34+ hematopoietic stem cells (HSCs) that are engineered to express the homing receptor.92. The method of claim 90 , wherein the homing receptor is CXCR4 claim 90 , VEGFR2 claim 90 , or CCR7.93103.-. (canceled)104. The method of claim 83 , wherein the step of administering to said subject an isolated population of NK cells or a pharmaceutical composition thereof is by injection claim 83 , ...

Подробнее

Номер записи: 68

08-01-2015 дата публикации

MIDBRAIN DOPAMINE (DA) NEURONS FOR ENGRAFTMENT

Номер: US20150010514A1

Автор: Kriks Sonja, Shim Jae-Won, Studer Lorenz

Принадлежит:

The present invention relates to the field of stem cell biology, in particular the lineage specific differentiation of pluripotent or multipotent stem cells, which can include, but is not limited to, human embryonic stem cells (hESC) in addition to nonembryonic human induced pluripotent stem cells (hiPSC), somatic stem cells, stem cells from patients with a disease, or any other cell capable of lineage specific differentiation. Specifically described are methods to direct the lineage specific differentiation of hESC and/or hiPSC into floor plate midbrain progenitor cells and then further into large populations of midbrain fate FOXA2+LMX1A+TH+ dopamine (DA) neurons using novel culture conditions. The midbrain fate FOXA2+LMX1A+TH+ dopamine (DA) neurons made using the methods of the present invention are further contemplated for various uses including, but not limited to, use in in vitro drug discovery assays, neurology research, and as a therapeutic to reverse disease of, or damage to, a lack of dopamine neurons in a patient. Further, compositions and methods are provided for differentiating midbrain fate FOXA2+LMX1A+TH+ dopamine (DA) neurons from human pluripotent stem cells for use in disease modeling, in particular Parkinson's disease. Additionally, authentic DA neurons are enriched for markers, such as CD142, and A9 type neuronal cells. 1. A composition , comprising , a cell population in contact with LDN-193189 and CHIR99021 , wherein greater than 40% of said cell population is positive for forkhead box protein A2 (FOXA2) , and wherein said cell population was previously contacted by LDN-193189 , SB431542 , an activator of Sonic hedgehog (SHH) signaling and CHIR99021 , wherein said activator of Sonic hedgehog (SHH) signaling is selected from the group consisting of Sonic hedgehog (SHH) C25II and purmorphamine.2. The composition of claim 1 , wherein greater than 10% of said cell population is selected from the group consisting of double positive for forkhead box ...

Подробнее

Номер записи: 69

12-01-2017 дата публикации

Method Of Differentiation From Stem Cells To Hepatocytes

Номер: US20170009203A1

Автор: Hiroyuki Mizuguchi, Kenji Kawabata, Miho Furue, Mitsuru Inamura

Принадлежит: JAPAN HEALTH SCIENCES FOUNDATION

Disclosed are: a gene transduction method for use in the induction of the differentiation of stem cells such as ES cells or iPS cells into hepatocytes effectively; stem cells into each of which a gene useful for the induction of the differentiation into hepatocytes is introduced; and hepatocytes produced from stem cells each having the gene introduced therein. A specific gene can be introduced into stem cells such as ES cells or iPS cells using an adenovirus vector. The effective induction of the differentiation into hepatocytes can be achieved by introducing the gene. Specifically, the effective induction of the differentiation of stem cells such as ES cells or iPS cells into hepatocytes can be achieved by introducing at least one gene selected from HEX gene, HNF4A gene, HNF6 gene and SOX17 gene into the stem cells.

Подробнее

Номер записи: 70

12-01-2017 дата публикации

LOW OXYGEN TENSION ENHANCES ENDOTHELIAL FATE OF HUMAN PLURIPOTENT STEM CELLS

Номер: US20170009204A1

Автор: Gerecht Sharon, Kusuma Sravanti

Принадлежит:

Low oxygen tension is a critical regulator of the developing or regenerating vasculature. The present invention is based on the determination that low oxygen tension during early stages of early vascular cell (EVC) derivation induces endothelial commitment and maturation of pluripotent stem cells. Inhibition of reactive oxygen species generation during the early stages of differentiation abrogates the endothelial inductive effects of the low oxygen environments. Methods of generating various types of cells from pluripotent stem cells (PSCs) are described, as well as compositions and methods of use thereof. In particular, generation of EVCs, bicellular vascular populations, early endothelial cells (ECs) and pericytes via culture in a low oxygen environment is described. 1. A method of generating early vascular cells (EVCs) comprising culturing pluripotent stem cells (PSCs) under hypoxic conditions on a culture substrate in a growth medium suitable to induce differentiation of the PSCs , thereby generating EVCs.2. The method of claim 1 , further comprising harvesting the EVCs.3. The method of claim 1 , wherein hypoxic conditions are from about 1-5% oxygen.4. The method of claim 3 , wherein hypoxic conditions are about 5% oxygen.5. The method of claim 1 , wherein the PSCs are cultured for about 6 to 12 days.6. The method of claim 1 , wherein the culture substrate is two-dimensional.7. The method of claim 6 , wherein the culture substrate is selected from the group consisting of type I collagen claim 6 , type IV collagen and fibronectin.8. The method of claim 1 , wherein the growth medium comprises serum.9. The method of claim 1 , wherein the PSCs are cultured as a monolayer.10. The method of claim 1 , further comprising addition of vascular endothelial growth factor (VEGF) to the growth medium.11. The method of claim 1 , further comprising addition of a transforming growth factor-β (TGF-β) inhibitor to the growth medium.12. The method of claim 1 , wherein the cultured ...

Подробнее

Номер записи: 71

12-01-2017 дата публикации

GUIDED DIFFERENTIATION OF INDUCED PLURIPOTENT STEM CELLS

Номер: US20170009210A1

Автор: El Khatib Moustafa M.A., IKEDA Yasuhiro

Принадлежит: Mayo Foundation for Medical Education and Research

This document provides methods and materials related to making and using differentiated induced pluripotent stem cells. For example, methods and materials for making differentiated induced pluripotent stem cells (e.g., insulin-producing cells) that do not form cancer cells within a mammal (e.g., a human), cells that underwent guided differentiation from induced pluripotent stem cells, compositions containing cells that underwent guided differentiation from induced pluripotent stem cells, and methods for using cells that underwent guided differentiation from induced pluripotent stem cells (e.g., methods for using such cells to treat diabetes or to repair cardiovascular tissue) are provided. 1. A population of differentiated cells obtained from induced pluripotent stem cells , wherein the cells of said population lack integrated viral nucleic acid encoding a stemness factor , wherein implantation of said population of differentiated cells into a mammal does not result in cancer cell formation , and wherein said cells were obtained using a culture comprising an enzyme.2. The population of differentiated cells of claim 1 , wherein said cells are human cells.3. The population of differentiated cells of claim 1 , wherein said cells lack exogenous nucleic acid.4. The population of differentiated cells of claim 1 , wherein said enzyme is trypsin.5. A method for obtaining a population of differentiated cells obtained from induced pluripotent stem cells claim 1 , wherein said method comprises:(a) exposing somatic cells to one or more non-integrating viral vectors that direct the expression of one or more stemness factors to produce induced pluripotent stem cells from said somatic cells, and(b) exposing said induced pluripotent stem cells to one or more differentiation factors in the presence of an enzyme to produce a population of cells more specialized than said induced pluripotent stem cells.6. The method of claim 5 , wherein said somatic cells are keratinocytes.7. The ...

Подробнее

Номер записи: 72

12-01-2017 дата публикации

DIFFERENTIATION OF HUMAN EMBRYONIC STEM CELLS

Номер: US20170009212A1

Автор: Fryer Benjamin

Принадлежит: JANSSEN BIOTECH, INC.

The present invention provides methods to promote the differentiation of pluripotent stem cells into insulin producing cells. In particular, the present invention provides a method to produce a population of cells, wherein greater than 80% of the cells in the population express markers characteristic of the definitive endoderm lineage. 1. A method for generating a population of cells wherein greater than 80% of the cells in the population express markers characteristic of the definitive endoderm lineage , comprising the steps of:a. Culturing a population of pluripotent stem cells,b. Differentiating the population of pluripotent stem cells to a population of cells wherein greater than 80% of the cells in the population express markers characteristic of the definitive endoderm lineage in medium supplemented with GDF-8, 14-Prop-2-en-1-yl-3,5,7,14,17,23,27-heptaazatetracyclo[19.3.1.1˜2,6˜.1˜8,12˜]heptacosa-1(25),2(27),3,5,8(26),9,11,21,23-nonaen-16-one and glucose at a concentration that does not exceed 10.5 mM.2. The method of claim 2 , wherein the concentration of glucose does not exceed 5.5 mM.3. The method of claim 1 , wherein the cells express CXCR4 and CD99.4. The method of claim 1 , wherein the cells expressing markers characteristic of the definitive endoderm lineage are definitive endoderm cells.5. The method of claim 1 , wherein the pluripotent stem cells are human pluripotent stem cells.6. The method of claim 1 , wherein the pluripotent stem cells are human embryonic stem cells.7. The method of claim 1 , wherein the medium has a pH of 7.6 or higher.8. The method of claim 1 , wherein the medium comprises about 100 ng/ml of GDF-8.9. The method of claim 1 , wherein the medium is serum free.10. The method of claim 1 , wherein the step of differentiation comprisesculturing the pluripotent stem cells for about one day in serum-free medium supplemented with about 100 ng/ml GDF-8, about 2.5 μM 2.5 μM of 14-Prop-2-en-1-yl-3,5,7,14,17,23,27-heptaazatetracyclo[19.3.1.1˜ ...

Подробнее

Номер записи: 73

09-01-2020 дата публикации

PERINATAL TISSUE DERIVED MESENCHYMAL STEM CELLS: METHOD OF PREPARATION AND USES THEREOF

Номер: US20200009193A1

Автор: HAN Zhibo, HAN ZhongChao, WANG TAO

Принадлежит:

The present invention discloses the preparation of placenta tissue derived CD106CD151+Nestin+ mesenchymal stem cells (MSCs). In a first aspect, the invention relates to a particular method to prepare these cells at industrial scale and the cell population generated thereby. In a second aspect, the invention relates to a cell culture obtained by said particular method, containing placental CD106CD151+Nestin+ MSCs expressing the vascular cell adhesion molecule 1 (VCAM-1) marker. The present application shows that said placental CD106CD151+Nestin+ MSCs are capable of inducing angiogenesis in vitro and in vivo. The herein presented results also show that administering said placental CD106CD151+Nestin+ MSCs to individuals suffering from an ischemic disease or from a disorder of the circulatory system results in a detectable improvement of one or more symptoms of said disease or disorder. Therefore, in a third aspect, the invention relates to placental CD 106CD151+Nestin+ MSCs for use as a medicament for treating subjects suffering from an ischemic disease, a disorder of the circulatory system, an immune disease, an organ injury or an organ function failure. 136-. (canceled)37. A method to prepare CD106CD151+Nestin+ mesenchymal stem cells (MSCs) , said method comprising culturing a population of undifferentiated MSCs in a culture medium comprising at least two pro-inflammatory growth factors.38. The method of claim 37 , wherein said pro-inflammatory growth factors are IL1β and IL4.39. The method of claim 37 , wherein said undifferentiated MSCs are obtained by cell isolation from an explant of umbilical cord fragment or by cell isolation from a placenta tissue fragment.40. The method of claim 37 , wherein said culture medium contains between 1 and 100 ng/ml of Interleukine 1β.41. The method of claim 37 , wherein said culture medium contains between 1 and 100 ng/ml of Interleukine 4.42. A method to enhance the CD106 expression level of undifferenciated MSCs claim 37 , said ...

Подробнее

Номер записи: 74

27-01-2022 дата публикации

In vitro method of differentiating a human pluripotent stem cell population into a cardiomyocyte cell population

Номер: US20220025333A1

Автор: Ana Catarina Martins GRANDELA, Stefan Robbert BRAAM

Принадлежит: Ncardia Bv

The current invention relates to a method of differentiation of human pluripotent stem cells into a human stem-cell derived population of cardiomyocytes. The method comprises the use of specific combination of steps and compounds to induce and/or promote differentiation. The method also comprises steps directed to further maturation of the cardiomyocytes obtained with the method of the invention. Also provided are kits for use in a method of differentiation as well as cell populations obtainable with the method disclosed.

Подробнее

Номер записи: 75

14-01-2016 дата публикации

METHOD OF INDUCING DIFFERENTIATION FROM PLURIPOTENT STEM CELLS TO GERM CELLS

Номер: US20160010056A1

Автор: NAKAKI Fumio, Saitou Mitinori

Принадлежит:

This invention provides a method of producing a primordial germ cell-like cell (PGCLC) from an epiblast isolated from an embryo or an epiblast-like cell (EpiLC) induced from a pluripotent stem cell (PSC), which comprises allowing the epiblast or EpiLC to express exogenous transcription factor(s) selected from the group consisting of: (i) Blimp1, Prdm14 and Tfap2c; (ii) Blimp1 and Prdm14; (iii) Blimp1 and Tfap2c; (iv) Prdm14 and Tfap2c; and (v) Prdm14; thereby inducing the epiblast or EpiLC into a PGC state without acquiring transient mesodermal program. 2. The method according to claim 1 , wherein the exogenous transcription factor(s) or nucleic acid(s) encoding the same is/are introduced into the epiblast or EpiLC.3. The method according to claim 1 , wherein the nucleic acid(s) encoding the exogenous transcription factor(s) has/have been introduced into the epiblast or EpiLC claim 1 , in a form capable of being conditionally expressed claim 1 , prior to the induction of the epiblast or EpiLC.4. The method according to claim 3 , wherein the epiblast or EpiLC is cultured under conditions which the nucleic acid(s) encoding the exogenous transcription factor(s) is/are expressed for 1 to 5 days.5. The method according to claim 1 , wherein the EpiLC is obtained by culturing a pluripotent stem cell (PSC) in the presence of activin A (ActA) claim 1 , optionally in the presence of further basic fibroblast growth factor (bFGF) and/or Knockout™ Serum Replacement (KSR).6. The method according to claim 5 , wherein the PSC is an embryonic stem cell (ESC) or induced pluripotent stem cell (iPSC).7. The method according to claim 1 , wherein the nucleic acid(s) encoding the exogenous transcription factor(s) is in a form capable of disappearing from the PGCLC.8. The method according to claim 7 , wherein the nucleic acid(s) is/are carried on vector(s) selected from the group consisting of plasmid claim 7 , episomal vector claim 7 , transposon claim 7 , adenoviral vector and Sendai ...

Подробнее

Номер записи: 76

08-01-2015 дата публикации

MICRORNAS FOR CARDIAC REGENERATION THROUGH INDUCTION OF CARDIAC MYOCYTE PROLIFERATION

Номер: US20150011609A1

Автор: BREGIEIRO EULALIO Ana Sofia, CUNHA MANO Miguel Luis, GIACCA Mauro, Zacchigna Serena

Принадлежит:

The present invention discloses a set of human microRNAs, or a primary transcript for such microRNAs, or a precursor of such microRNAs, or a mimic of such microRNAs or a combination thereof, and their use as medicaments for inducing proliferation of cardiomyocytes for the prevention and treatment of heart diseases associated with a loss of cardiomyocytes. The invention also relates to a method for screening microRNAs and biological and therapeutically active compounds for their ability to increase proliferation of cardiomyocytes. 2. A method for the treatment of a cardiac pathology associated with loss of cardiac myocytes claim 1 , comprising administering a microRNA according to .3. The method according to wherein said pathology is selected from the group consisting of consequences of myocardial infarction claim 2 , ischemic cardiomyopathy claim 2 , non-ischemic cardiomyopathy claim 2 , myocarditis claim 2 , and heart failure.4. The method according to wherein the administration is gene therapy.5. The microRNA according to wherein the microRNA is selected from the group consisting of ACAGUAGUCUGCACAUUGGUUA (SEQ ID NO: 14) and UAAUUUUAUGUAUAAGCUAGU (SEQ ID NO: 29).6. A vector for use as a medicament for stimulating heart regeneration through cardiac myocyte proliferation claim 1 , said vector comprising at least a microRNA according to and/or a DNA coding for at least said microRNA and/or a DNA coding for at least a primary transcript or a precursor for said microRNA claim 1 , or a combination thereof.7. The vector according to claim 6 , which is an adeno-associated vector (AAV) of any capsid serotype claim 6 , either natural or artificial.8. A pharmaceutical composition comprising at least a microRNA according to and/or a primary transcript of said microRNA claim 1 , and/or a precursor of said microRNA claim 1 , and/or a DNA coding for at least said microRNA claim 1 , primary transcript or precursor claim 1 , and/or a mimic or at least said microRNA claim 1 , or a ...

Подробнее

Номер записи: 77

11-01-2018 дата публикации

DIFFERENTIATION OF MACROPHAGES FROM PLURIPOTENT STEM CELLS

Номер: US20180010096A1

Автор: GINHOUX Florent, HUBER Tara, LIM Hwei-In Shawn

Принадлежит:

The present invention relates to a method of culturing primitive-like macrophages from stem cells, a kit when used in the method thereof and uses of the primitive like macrophage for in-vitro disease models and for screening compounds for therapy. One embodied culture method comprises contacting and incubating embryonic stem cells or induced pluripotent stem cells with a serum-free culture media comprising a GSK3 inhibitor to differentiate stem cells into cells of the mesoderm lineage, followed by incubation with a culture media comprising Dickkopf-related protein 1 (DKK1) to differentiate the mesoderm into cells of hematopoietic lineage, maturing hematopoietic cells and incubating these cells with a culture media comprising M-CSF to drive differentiation into primitive-like macrophages. Another embodiment comprises incubating the stem cells with serum-free culture media comprising FGF2 and BMP4 to induce differentiation into cells of the mesoderm lineage, followed by incubating the cells with a culture media comprising FGF2, BMP4, Activin A and VEGF to differentiate the cells of the mesoderm lineage into cells of the hematopoietic cell lineage, maturing the cells of the hematopoietic cell lineage and lastly, incubating the matured hematopoietic cells with culture media comprising M-CSF to drive the differentiation of hematopoietic cells into primitive-like macrophages. 1. A method for culturing primitive-like macrophages from stem cells wherein the method comprises:(a) contacting and incubating said stem cells with a serum-free culture media comprising a GSK3 inhibitor to induce differentiation of said stem cells into cells of the mesoderm lineage;(b) contacting and incubating said cells of the mesoderm lineage with a culture media comprising DKK1 to differentiate the cells of the mesoderm lineage into cells of the hematopoietic cell lineage;(c) maturing said cells of the hematopoietic cell lineage;(d) contacting and incubating said mature cells of the ...

Подробнее

Номер записи: 78

11-01-2018 дата публикации

MESENCHYMAL-LIKE STEM CELLS DERIVED FROM HUMAN EMBRYONIC STEM CELLS, METHODS AND USES THEREOF

Номер: US20180010098A1

Автор: WANG Xiaofang, Xu Ren-He

Принадлежит:

The present invention relates to methods of generating and expanding hitman embryonic stem cell derived mesenchymal-like stem/stromal cells. These hES-MSCs are characterized at least in part by the low level of expression of IL-6. These cells are useful for the prevention and treatment of T cell related autoimmune disease, especially multiple sclerosis, as well as for delivering agents across the blood-brain barrier and the blood-spinal cord barrier. Also provided is a method of selecting clinical grade hES-MSC and a method of modifying MSC to produced a MSC with specific biomarker profile. The modified MSC are useful for treatment of various diseases. 192-. (canceled)93. A method for preventing or treating an inflammatory disease in a subject , the method comprising administering to a subject an effective dose of hES-MSC prepared by the method comprising the steps of:(a). culturing human embryonic stem cells in a serum free medium comprising at least one GSK3 inhibitor at a concentration ranging from 0.05 μM to 0.2 μM, wherein the human embryonic stem cells are cultured in the absence of feeder cells;(b). culturing the cells from step a) in a serum-free medium comprising vascular endothelial growth factor (VEGF) and bone morphogenic protein 4 (BMP4) in an amount sufficient to induce formation of embryoid bodies comprising human hemangio-colony forming cells;(c). adding at least one growth factor to the culture resulting from step b), wherein the growth factor is in an amount sufficient to expand human hemangio-colony forming cells;(d). disaggregating the hemangio-colony forming cells resulting from step c) into single cells; and(e). culturing the single hemangio-colony forming cells resulting from step d) in mesenchymal stem cell medium containing serum, knockout serum replacement (KOSR), or in a serum-free medium to induce differentiation of the single cells into human mesenchymal stem cells, wherein at least 90% of the hES-MSCs express CD73, and said hES-MSCs: (i ...

Подробнее

Номер записи: 79

11-01-2018 дата публикации

Induction of Hemogenic Endothelium from Pluripotent Stem Cells by Forced Expression of Transcription Factors

Номер: US20180010124A1

Автор: Elcheva Irina, SLUKVIN IGOR

Принадлежит:

Described herein are methods and related compositions for inducing differentiation of human pluripotent stem cells (hPSCs) into hemogenic endothelium with pan-myeloid potential or restricted potential, by forced expression in the hPSCs of a combination of transcription factors as described herein. 113-. (canceled)14. A recombinant human pluripotent stem cell comprising: '(a) an ETV2 or ERG protein, and a GATA1 protein, or functional homologs thereof; (b) an ETV2 or ERG protein, and a GATA2 protein, or functional homologs thereof; or (c) an ETV2 or ERG protein, and a GFI1 protein', '(i) one or more exogenous nucleic acids suitable for expression of'}(ii) exogenous polypeptides comprising the amino acid sequences of any of (a), (b), or (c).15. The recombinant human pluripotent stem cell of claim 14 , wherein the exogenous polypeptides comprise the amino acid sequence of a protein transduction domain.16. The recombinant human pluripotent stem cell of claim 14 , wherein the recombinant human pluripotent stem cell is integration-free.17. The recombinant human pluripotent stem cell of claim 16 , wherein the one or more exogenous nucleic acids are episomal plasmid expression vectors.18. The recombinant human pluripotent stem cell of claim 16 , wherein the one or more exogenous nucleic acids are modified mRNAs (mmRNAs).19. A cell culture composition for generating human hemogenic endothelial cells with pan-myeloid potential claim 14 , comprising the recombinant human pluripotent stem cell of and a cell culture medium suitable for expansion of hematopoietic cells.20. The cell culture composition of claim 19 , wherein the cell culture medium comprises FGF2 claim 19 , SCF claim 19 , and thrombopoietin.2122-. (canceled) This patent application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application Ser. No. 61/716875 filed Oct. 22, 2012, which is incorporated by reference herein in its entirety.This invention was made with government support under ...

Подробнее

Номер записи: 80

14-01-2021 дата публикации

METHOD FOR ISOLATING STEM CELLS FROM HUMAN UMBILICAL CORD

Номер: US20210009944A1

Автор: JO Hyun Chul, LEE Ah-Young

Принадлежит: ACESOSTEM BIOSTRATEGIES INC.

The present invention relates to a method for isolating umbilical cord-derived stem cells, and more specifically to a method for isolating a significantly large number of mesenchymal stem cells from the umbilical cord having a specified size. The method of the present invention has a great advantage in that since stem cells can be isolated from an umbilical cord tissue without enzymatic treatment, stress applied to the cells can be significantly suppressed. In addition, stem cells obtained by the method of the present invention have superior proliferative capacity compared to stem cells obtained by conventional isolation methods. 1. A method for isolating umbilical cord-derived stem cells comprising (a) grinding an isolated umbilical cord tissue into explants having a width of 2 to 4 mm and a length of 2 to 4 mm and (b) culturing the explants in a culture medium.2. The method according to claim 1 , wherein step (a) comprises introducing an umbilical cord tissue into a culture medium and chopping the umbilical cord tissue into explants having a width of 2 to 4 mm and a length of 2 to 4 mm.3. The method according to claim 2 , wherein the culture medium is added in an amount of 0.5 to 3.0 ml per gram of the umbilical cord tissue.4. The method according to claim 1 , wherein the culture medium is selected from the group consisting of Dulbecco's minimum essential medium (DMEM) claim 1 , RPMI claim 1 , Ham's F-10 claim 1 , Ham's F-12 claim 1 , α-minimal essential medium (α-MEM) claim 1 , Glasgow's minimal essential medium (GMEM) claim 1 , Iscove's modified Dulbecco's medium (IMDM) claim 1 , and combinations thereof.5. The method according to claim 1 , wherein the explants are cultured to reach 0.0007 to 0.0068 g per unit area (cm).6. The method according to claim 1 , wherein step (b) is carried out for 60 to 120 minutes. The present invention relates to a method for isolating umbilical cord-derived stem cells, and more specifically to a method for isolating a significantly ...

Подробнее

Номер записи: 81

14-01-2021 дата публикации

METHOD FOR GENERATING MULTIPLE CELLULAR PRODUCTS FROM SINGLE PLURIPOTENT CELL SOURCE

Номер: US20210009945A1

Автор: Rao Mahendra, Zeng Xianmin

Принадлежит:

Methods are provided for generating multiple cellular products via differentiation of cells from single clinically compliant pluripotent cells into multiple cellular products selected from retinal epithelium, retinal progenitors, neural stem cells, dopaminergic neurons, astrocytes, hepatocytes, endothelial cells and mesenchymal cells using standard differentiation protocols for the multiple cellular products. 1. A method for generating multiple cellular products , said method comprising differentiating cells from a single clinically compliant pluripotent cell source into multiple cellular products selected from retinal epithelium , retinal progenitors , neural stem cells , dopaminergic neurons , astrocytes , hepatocytes , endothelial cells and mesenchymal cells via standard differentiation protocols for the multiple cellular products.2. The method of wherein the generated multiple cellular products can be cells from the same germ layer or three different germ layers.3. The method of wherein neural stem cells claim 1 , retinal epithelium and retinal progenitors are produced from the same single clinically compliant iPSC cell line using clinically compliant material.4. The method of wherein endothelial cells and mesenchymal cells are produced from the same single clinically compliant iPSC line.5. The method of wherein the generated cellular products can be stored at intermediate stages in a cryopreservation media.6. The method of wherein transplantable cells are generated.7. The method of further comprising using markers to select and distinguish between the multiple cellular products in their intermediate stages.8. The method of wherein cell surface and/or PCR based techniques are used for selective isolation for stage specific process development.9. The method of a wherein the single clinically compliant iPSC cell line comprises a stock at at least passage 20 or greater prepared from a cGMP-compliant working cell bank. This patent application claims the benefit of ...

Подробнее

Номер записи: 82

14-01-2021 дата публикации

CARDIOMYOCYTE PREPARATION AND PREPARATION METHOD THEREFOR AND USE THEREOF

Номер: US20210009957A1

Автор: TSUI Yat Ping, Wang Jiaxian, WANG Qian, XU Xiao

Принадлежит:

Provided are a cardiomyocyte preparation, a preparation method therefor and the use of the preparation in treating heart failure. The cardiomyocyte preparation comprises cardiomyocytes and fibroblasts, differentiated from pluripotent stem cells, wherein the concentration of the cardiomyocytes in the cardiomyocyte preparation is 0.75×10-1.0×10cells/mL, and the content of the cardiomyocytes is higher than 80% while the content of the fibroblasts is not higher than 20%. The cardiomyocyte preparation can improve cardiac ejection fraction and left ventricular fractional shortening, and increase the thickness of the left ventricular inner wall. 1. A cardiomyocyte formulation comprising cardiomyocytes and fibroblasts differentiated from pluripotent stem cells , wherein the concentration of the cardiomyocytes in the cardiomyocyte formulation is 0.75×10to 1.0×10cells/mL , and the content of the cardiomyocytes is higher than 80% and the content of the fibroblasts is not higher than 20%.2. The cardiomyocyte formulation of claim 1 , wherein the concentration of the cardiomyocytes is 0.5×10to 1.2×10cells/mL.3. The cardiomyocyte formulation of claim 1 , wherein residual amount of the pluripotent stem cells in the cardiomyocyte formulation is not more than 1%.4. The cardiomyocyte formulation of claim 3 , wherein residual amount of the pluripotent stem cells in the cardiomyocyte formulation is not higher than 0.3%.5. A method for preparing the cardiomyocyte formulation of claim 1 , wherein the cardiomyocytes are prepared from pluripotent stem cells by steps of:{'sup': 5', '5', '2, 'sub': '2', '1) pretreating the pluripotent stem cells: seeding the pluripotent stem cells into a pluripotent stem cell culture medium at a density of 0.9×10to 3.0×10cells/cm, culturing the cells at 37° C. with 5% COuntil cell density exceeds 40%;'}2) differentiating to cardiomyocytes: removing the pluripotent stem cell culture medium by suction, adding cardiomyocyte differentiation medium containing 0.01 ...

Подробнее

Номер записи: 83

14-01-2021 дата публикации

NOVEL MUSCULOSKELETAL STEM CELL

Номер: US20210009958A1

Автор: HAN Myung-Kwan

Принадлежит:

The present disclosure relates to a novel musculoskeletal stem cell (MSSC) differentiated from an ESC (embryonic stem cell) or an iPSC (induced pluripotent stem cell). The musculoskeletal stem cell of the present disclosure can be easily induced from a human embryonic stem cell or a human-derived pluripotent stem cell and can be effectively differentiated not only into bone but also into cartilage, tendon and muscle. Accordingly, it can be usefully used for prevention or treatment of various musculoskeletal diseases. 1. A medium composition for inducing differentiation into a musculoskeletal stem cell (MSSC) , comprising noggin , LIF (leukemia inhibitory factor) , bFGF (basic fibroblast growth factor) , CHIR99021 (9-bromo-7 ,12-dihydro-pyrido[3′ ,2′:2 ,3]azepino[4 ,5-b]indol-6(5H)-one) as Wnt signaling activator , PD0325901 (N-[(2R)-2 ,3-dihydroxypropoxy]-3 ,4-difluoro-2-[(2-fluoro-4-iodophenyl)amino]-benzamide) as ERK (extracellular signal-regulated kinase) signaling inhibitor and SB431542 (4-[4-(1 ,3-benzodioxol-5-yl)-5-(2-pyridinyl)-1H-imidazol-2-yl]benzamide) as TGF-β/activin/nodal signaling inhibitor ,wherein the musculoskeletal stem cell can be differentiated into bone, cartilage, tendon, ligament, muscle and fat.24-. (canceled)5. A method for preparing a musculoskeletal stem cell claim 1 , comprising a step of culturing an ESC (embryonic stem cell) or an iPS (induced pluripotent stem cell) in the medium composition for inducing differentiation into a musculoskeletal stem cell according to .6. The method for preparing a musculoskeletal stem cell according to claim 5 , wherein the culturing is performed for 5 passages or longer without change in the composition of the medium.7. A musculoskeletal stem cell prepared using the medium composition for inducing differentiation into a musculoskeletal stem cell according to .8. A musculoskeletal stem cell (MSSC) differentiated from an ESC (embryonic stem cell) or an iPSC (induced pluripotent stem cell) claim 1 , ...

Подробнее

Номер записи: 84

14-01-2021 дата публикации

METHOD FOR INDUCING URETERIC BUD-LIKE TISSUE

Номер: US20210009960A1

Автор: MAE Shinichi, Osafune Kenji, RYOUSAKA Makoto

Принадлежит:

An object of the present application is to provide a method for inducing the differentiation from pluripotent stem cells, particularly iPS cells and ES cells, into ureteric bud cells. Another object of the present application is to provide a system for producing ureteric bud-like tissue from pluripotent stem cells through each stage of differentiations, i.e. anterior primitive streak cells, anterior intermediate mesoderm cells and Wolffian duct cells. Yet another object of the present application is to provide a method for maintaining ureteric bud-like organoids. Another object of the present application is to provide a method for expansion-culturing ureteric bud-like tip tissue. 1. A method for inducing an early Wolffian duct cell , comprising the following steps:(1) culturing an anterior primitive streak cell in the presence of a fibroblast growth factor, a retinoic acid receptor agonist, a TGFβ inhibitor and a BMP inhibitor under a two-dimensional culture condition to obtain an anterior intermediate mesoderm cell culture, and(2) culturing the anterior intermediate mesoderm cell culture in the presence of a GSK3β inhibitor, a BMP inhibitor, a fibroblast growth factor and a glial cell line-derived neurotrophic factor under a two-dimensional culture condition.2. The method according to claim 1 , wherein in step (1) claim 1 , the fibroblast growth factor is FGF8 claim 1 , the retinoic acid receptor agonist is TTNPB claim 1 , the TGFβ inhibitor is A83-01 claim 1 , and the BMP inhibitor is LDN193189.3. The method according to claim 1 , wherein in step (2) claim 1 , the GSK3β inhibitor is CHIR99021 claim 1 , the BMP inhibitor is LDN193189 claim 1 , and the fibroblast growth factor is FGF8.4. The method according to claim 1 , wherein a retinoic acid receptor agonist is further present in step (2).5. The method according to claim 4 , wherein in step (2) claim 4 , the retinoic acid receptor agonist is TTNPB.6. The method according to claim 1 , further comprising the step ...

Подробнее

Номер записи: 85

14-01-2021 дата публикации

Methods and Materials for Producing Hybrid Cell Lines

Номер: US20210009961A1

Автор: Collins Daniel Patrick, Steer Clifford J.

Принадлежит:

Methods and materials are described for producing immortalized hybrid cells composed of a fusion of immortalized multi-lineage progenitor cells (MLPC) and primary hepatocytes. The hybrid cells express the biological activity of the primary hepatocytes and the immortality and expansion capacities of the immortalized MLPC. The methods of culture and expansion of the resultant hybrid cells and the methods to confirm the characteristics of the hybrid cells are described. 1. A cell population comprising a plurality of hybrid cells , wherein each hybrid cell is composed of an immortalized multi-lineage progenitor cell (MLPC) and a primary somatic cell.2. The cell population of claim 1 , wherein said hybrid cell is created by the fusion of said immortalized MLPC and said primary somatic cell.3. The cell population of claim 1 , wherein said immortalized MLPC comprises a nucleic acid encoding a telomerase reverse transcriptase.4. The cell population of claim 1 , wherein said primary somatic cell is a hepatocyte.5. The cell population of claim 1 , wherein said hybrid cell has the biological activity associated with the primary somatic cell.6. The cell population of claim 1 , wherein the hybrid cell is immortalized and has the expandability of said immortalized MLPC.7. The cell population of claim 1 , wherein the hybrid cells can be expanded continuously in an expansion medium claim 1 , said expansion medium comprising hydrocortisone claim 1 , bovine serum albumin claim 1 , insulin claim 1 , transferrin claim 1 , selenium claim 1 , epithelial growth factor claim 1 , basic fibroblast growth factor claim 1 , fibroblast growth factor 4 claim 1 , hepatocyte growth factor claim 1 , stem cell factor claim 1 , oncostatin M claim 1 , bone morphogenic protein 4 claim 1 , and interleukin 1 beta.8. The cell population of claim 7 , the expansion medium further comprising an antibiotic.9. The cell population of claim 4 , wherein said fusion cells are positive for alkaline phosphatase claim ...

Подробнее

Номер записи: 86

10-01-2019 дата публикации

DIFFERENTIATION INDUCTION FROM HUMAN PLURIPOTENT STEM CELLS INTO HYPOTHALAMIC NEURONS

Номер: US20190010452A1

Автор: ARIMA Hiroshi, Kasai Takatoshi, Ogawa Koichiro, Suga Hidetaka

Принадлежит:

There is provided a method for efficient differentiation induction from human pluripotent stem cells into hypothalamic neurons. Also, provided is a method for constructing, from human pluripotent stem cells, a cellular structure in which hypothalamic tissue and pituitary tissue are integrated. A cellular structure including hypothalamic tissue is obtained by a method including the steps of: culturing an aggregate of human pluripotent stem cells in suspension in a medium containing a low concentration of a bone morphogenetic protein signal transduction pathway activating substance and a low concentration of a substance acting on the Shh signaling pathway; and further culturing the cell aggregate obtained in the step in suspension in a medium containing a low concentration of a substance acting on the Shh signaling pathway. 1. A method for producing a cellular structure comprising hypothalamic tissue , the method comprising the steps of:(1) culturing an aggregate of human pluripotent stem cells in suspension in a medium containing a low concentration of a bone morphogenetic protein signal transduction pathway activating substance and a low concentration of a substance acting on the Shh signaling pathway, and(2) further culturing the cell aggregate obtained in the step (1) in a medium containing a low concentration of a substance acting on the Shh signaling pathway, but not containing a bone morphogenetic protein signal transduction pathway activating substance.2. The producing method according to claim 1 , wherein the step (2) is carried out under a high oxygen partial pressure condition.3. The producing method according to claim 1 , further comprising the step of:(3) recovering the cell aggregate obtained in the step (2) and subjecting the cells constituting the cell aggregate to dissociation culture.4. The producing method according to claim 3 , wherein the step (3) is carried out under a high oxygen partial pressure condition.5. The producing method according to ...

Подробнее

Номер записи: 87

10-01-2019 дата публикации

Isolation And Use Of Pluripotent Stem Cell Population From Adult Neural Crest-Derived Tissues

Номер: US20190010455A1

Автор: Cheung Herman S., Huang C-Y Charles, Pelaez Daniel

Принадлежит:

The present invention relates to methods of isolating a substantially homogenous population of pluripotent stem cells from adult neural crest tissue (e.g., periodontal ligament) as well as pharmaceutical compositions comprising such isolated pluripotent stem cells. Methods of inducing the isolated pluripotent stem cells into specific cell lineages, such as neurogenic and retinogenic lineages, are also described. The isolated pluripotent stem cells find use in various regenerative medicine applications and the treatment of degenerative diseases. 126.-. (canceled)27. A method of differentiating pluripotent stem cells isolated from adult periodontal ligament to neural progenitor cells or neural cells comprising:incubating said pluripotent stem cells in a culture media comprising epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF) for a period of time, wherein a plurality of said pluripotent stem cells are differentiated into neural progenitor cells or neural cells at the end of the period of time.28. The method of claim 27 , wherein EGF is present in the media at a concentration of about 25 ng/ml to about 150 ng/ml.29. The method of claim 28 , wherein EGF is present in the media at a concentration of about 50 ng/ml.30. The method of claim 27 , wherein bFGF is present in the media at a concentration of about 25 ng/ml to about 150 ng/ml.31. The method of claim 30 , wherein bFGF is present in the media at a concentration of about 50 ng/ml.32. The method of claim 27 , wherein the period of time is about 4 to about 12 days.33. The method of claim 32 , wherein the period of time is about 8 days.34. The method of claim 27 , wherein a plurality of the neural progenitor cells or neural cells express one or more markers selected from nestin claim 27 , tubulin (TUBB3) claim 27 , neurofilament medium (NEFM) claim 27 , SOX1 claim 27 , synaptophysin claim 27 , and glial fibrillary acidic protein (GFAP).35. The method of claim 27 , wherein a plurality of the ...

Подробнее

Номер записи: 88

10-01-2019 дата публикации

METHOD TO DIRECT DIFFERENTIATION OF PLURIPOTENT STEM CELLS INTO FUNCTIONAL HEART MUSCLE

Номер: US20190010460A1

Автор: HUDSON James, TIBURCY Malte, Zimmermann Wolfram-Hubertus

Принадлежит: GEORG-AUGUST-UNIVERSITÄT GÖTTINGEN STIFTUNG ÖFFENTLICHEN RECHTS, UNIVERSITÄTSMEDIZIN

The present invention is directed to a method for producing bioengineered heart muscle (BHM) from pluripotent stem cells, generally comprising the steps of inducing mesoderm differentiation, cardiac differentiation, and cardiac maturation by directed tissue formation. The method is a robust, serum-free and reproducible way to produce BHM for multiple applications, and closed herein, as well as to uses of said BHM in pharmacologic and toxicity screenings, and its use in medicine. 115.-. (canceled)16. A bioengineered heart muscle (BHM) produced by a method comprising the steps of(i) cultivating pluripotent stem cells in a basal medium comprising an effective amount of (a) BMP4, Activin A, FGF2, a GSK3-inhibitor, and (b) a serum-free supplement resulting in a final concentration of 0.5-50 mg/ml albumin, 1-100 μg/ml transferrin, 0.1-10 μg/ml ethanol amine, 0.003-0.3 μg/ml sodium selenite, 0.4-40 μg/ml L-Carnitine HCl, 0.1-10 μg/ml Hydrocortisone, 0.05-5 μl/ml Fatty acid supplement, and 0.0001-0.1 μg/ml triodo-L-thyronine (T3), thereby inducing mesoderm differentiation of said pluripotent stem cells;(ii) cultivating the cells obtained in step (i) in a basal medium comprising an effective amount of an inhibitor of the Wnt-signaling pathway and a serum-free supplement as in (i), thereby inducing cardiac differentiation of the cells; and(iii) cultivating the cells obtained in step (ii) in a basal medium comprising an effective amount of a serum-free supplement as in (i), under mechanical stimulation, thereby promoting cardiac maturation.17. The BHM of claim 16 , wherein the BHMa) is capable of being paced at multiple frequencies up to at least 3 Hz; orb) exhibits an increased twitch tension in response to increased resting length and resting tension; or{'sub': '50', 'c) exhibits a calcium EChigher than 0.2 mM; or'}d) exhibits a twitch tension of more than 200 μN; ore) exhibits an inotropic response to 1 μM isoprenaline of more than 40 μN under paced conditions at 0.6 mM ...

Подробнее

Номер записи: 89

10-01-2019 дата публикации

HUMAN PLURIPOTENT STEM CELL-BASED SCREENING FOR SMOOTH MUSCLE CELL DIFFERENTIATION AND DISEASE

Номер: US20190010461A1

Автор: Thomson James A., Zhang Jue

Принадлежит:

Methods of using a small molecule MYH11 agonist to inhibit intimal hyperplasia and to maintain a contractile phenotype in vitro and in vivo are described. Also described herein are methods for generating human contractile smooth muscle cells from human pluripotent stem cells under defined conditions in the presence of the small molecule MYH11 agonist. 1. A method of obtaining contractile smooth muscle cells , the method comprising:culturing SMC progenitor cells in a culture medium that comprises an MYH11 agonist, whereby a cell population comprising contractile smooth muscle cells is obtained.2. The method of claim 1 , where in the SMC progenitor cells are obtained by a method comprising:(i) culturing mesoderm cells under conditions and for a time sufficient to obtain a population of cells expressing MEOX1;(ii) culturing the population of cells expressing MEOX1 under conditions and for a time sufficient to suppress MEOX1 expression; and(iii) culturing the population of cells from step (ii) under conditions and for a time sufficient to obtain a population of SMC progenitor cells.3. The method of claim 2 , wherein the mesoderm cells are obtained by a method comprising:culturing human pluripotent stem cells for a period of about two days in a chemically-defined cell culture medium comprising a Bone Morphogenetic Protein (BMP), Activin A, and an activator of Wnt/β-catenin signaling to obtain a cell population comprising mesodermal cells.4. The method of claim 1 , wherein the cell population comprises at least 80% contractile smooth muscle cells.5. The method of claim 1 , wherein the contractile smooth muscle cells express one or more markers selected from the group consisting of MYH11 claim 1 , SMA claim 1 , SM22α claim 1 , ACTA2 claim 1 , SMTN claim 1 , CNN1 claim 1 , and ELN.6. The method of claim 2 , wherein in step (i) the mesoderm cells are cultured in chemically defined medium comprising TGFβ1 in an amount sufficient to obtain a population of cells expressing ...

Подробнее

Номер записи: 90

10-01-2019 дата публикации

DIFFERENTIATION OF HUMAN EMBRYONIC STEM CELLS INTO PANCREATIC ENDOCRINE CELLS

Номер: US20190010465A1

Автор: Rezania Alireza

Принадлежит: JANSSEN BIOTECH, INC.

The present invention provides methods to promote differentiation of pancreatic endoderm cells to pancreatic endocrine rich clusters and to enhance insulin expression in hormone-expressing cells. 1. A method of enhancing expression of NKX6.1 by treating pancreatic endoderm cells in medium comprising semaphorin 3a or Epigen.2. The method of claim 1 , wherein the population of pancreatic endoderm cells treated with medium comprising semaphorin 3a or Epigen expresses an enhanced amount of NKX6.1 as compared to pancreatic endoderm cells non-treated with medium comprising semaphorin 3a or Epigen.3. The method of claim 1 , wherein the level of expression of insulin claim 1 , glucagon claim 1 , and ghrelin is not affected in pancreatic endoderm cells treated with medium comprising semaphorin 3a or Epigen as compared to pancreatic endoderm cells not treated with medium comprising semaphorin 3a or Epigen.4. The method of claim 1 , wherein the pancreatic endoderm cells are obtained by a stepwise differentiation of pluripotent cells.5. The method of claim 4 , wherein the pluripotent cells wherein the pancreatic endoderm cells are derived from are human pluripotent stem cells.6. The method of claim 5 , wherein the human pluripotent stem cells are human embryonic pluripotent cells.7. The method of claim 1 , wherein the method further comprises:differentiating pluripotent stem cells into definitive endoderm cells;differentiating the definitive endoderm cells into primitive gut tube cells;differentiating the primitive gut tube cells into foregut cells;differentiating the foregut cells into pancreatic foregut precursor cells; anddifferentiating the foregut precursor cells into the pancreatic endoderm cells.8. The method of claim 1 , wherein the method comprises treating pancreatic endoderm cells in medium comprising semaphorin 3a.9. The method of claim 1 , wherein the method comprises treating pancreatic endoderm cells in medium comprising Epigen.10. The method of claim 1 , wherein ...

Подробнее

Номер записи: 91

10-01-2019 дата публикации

DIFFERENTIATION OF HUMAN EMBRYONIC STEM CELLS INTO PANCREATIC ENDOCRINE CELLS

Номер: US20190010466A1

Автор: Rezania Alireza

Принадлежит: JANSSEN BIOTECH, INC.

The present invention provides methods to promote differentiation of pancreatic endoderm cells to pancreatic endocrine rich clusters and to enhance insulin expression in hormone-expressing cells. 1. A method for inducing formation of endocrine clusters , comprising culturing pancreatic endocrine cells with a sphingosine-1 receptor agonist.2. The method of claim 1 , wherein the sphingosine-1 receptor agonist is sphingosine-1-phosphate (S1P).3. The method of claim 1 , wherein the pancreatic endocrine cells are obtained by a stepwise differentiation of pluripotent stem cells.4. The method of claim 3 , wherein the pluripotent stem cells are human embryonic pluripotent stem cells.5. The method of claim 3 , wherein the pluripotent stem cells are human pluripotent stem cells.6. The method of claim 1 , wherein the method further comprises:differentiating pluripotent stem cells into definitive endoderm cells;differentiating the definitive endoderm cells into primitive gut tube cells;differentiating the primitive gut tube cells into foregut cells;differentiating the foregut cells into pancreatic foregut precursor cells;differentiating the foregut precursor cells into the pancreatic endoderm; anddifferentiating the pancreatic endoderm cells into pancreatic endocrine cells.7. The method of claim 1 , wherein the pancreatic endocrine cells are human pancreatic endocrine cells. The present application is a divisional of U.S. Ser. No. 13/911,829, filed Jun. 6, 2013 (now allowed), which claims the benefit of U.S. Provisional Patent Application Ser. No. 61/657,160, filed Jun. 8, 2012, both of which are incorporated herein by reference in their entirety.The present invention is in the field of cell differentiation. More specifically, the invention discloses use of Ephrin ligands and sphingosine-1-phosphate as regulators of differentiation of pluripotent stem cells to endocrine cells.Advances in cell-replacement therapy for Type I diabetes mellitus and a shortage of transplantable ...

Подробнее

Номер записи: 92

11-01-2018 дата публикации

ASSESSING RETINAL PIGMENT EPITHELIAL CELL POPULATIONS

Номер: US20180011092A1

Автор: Bohana-Kashtan Osnat, Rosenberg Belmaker Lior Ann, Wiser Ofer

Принадлежит:

A method of qualifying whether a cell population is a suitable therapeutic for treating an eye condition is disclosed. The method comprises analyzing co-expression of premelanosome protein (PMEL17) and at least one polypeptide selected from the group consisting of cellular retinaldehyde binding protein (CRALBP), lecithin retinol acyltransferase (LRAT) and sex determining region Y-box 9 (SOX 9) in the population of cells. 1. A method of qualifying whether a cell population is a suitable therapeutic for treating an eye condition , comprising analyzing co-expression of premelanosome protein (PMEL17) and at least one polypeptide selected from the group consisting of cellular retinaldehyde binding protein (CRALBP) , lecithin retinol acyltransferase (LRAT) and sex determining region Y-box 9 (SOX 9) in said population of cells , wherein when the number of cells that co-express said PMEL17 and said at least one polypeptide is above a predetermined level , the cell population is qualified as being a suitable therapeutic for treating an eye condition.2. The method of claim 1 , wherein said at least one polypeptide is CRALBP.34-. (canceled)5. The method of claim 1 , wherein said cell population is generated by ex vivo differentiating pluripotent stem cells into retinal pigment epithelium (RPE) cells.6. (canceled)7. The method of claim 5 , wherein said pluripotent stem cells comprise embryonic stem cells claim 5 , and said embryonic stem cells are propagated in a medium comprising bFGF and TOPβ prior to said differentiating.8. The method of claim 7 , wherein said embryonic stem cells are cultured on human cord fibroblasts prior to said differentiating.9. The method of claim 7 , wherein said ex vivo differentiating is effected by:(a) culturing embryonic stem cells in a medium comprising a differentiating agent so as to generate differentiating cells; and(b) culturing said differentiating cells in a medium comprising a member of the transforming growth factor β (TGF β) ...

Подробнее

Номер записи: 93

09-01-2020 дата публикации

ORGANOID ARRAYS

Номер: US20200010797A1

Автор: BRANDENBERG Nathalie, HOEHNEL Sylke, Lutolf Matthias

Принадлежит:

The invention provides methods for producing arrays of organoids, the arrays thereof and uses of such arrays. 1. A method for making an array of organoids , comprising:i. seeding stem cells on a surface,ii. culturing the stem cells of step i) in situ to allow their aggregation into multicellular stem cell containing aggregates,iii. culturing the multicellular stem cell containing aggregates of ii) in situ in conditions suitable for organoid development,wherein the array of organoids is within a single focal plane and the surface may be overlaid with a regular tessellation, such that the organoids are uniquely positioned within adjacent tiles of the tessellation; and wherein the surface comprises a biofunctional hydrogel.2. The method of claim 1 , wherein non-stem cells are seeded in combination with the stem cells seeded in step i claim 1 , and/or additionally comprising overlaying the multicellular stem cell containing aggregates with an overlay claim 1 , wherein the overlay comprises a gel or viscous solution claim 1 ,preferably wherein the overlay comprises a cell compatible material that supports organoid development and maintenance,more preferably wherein the cell compatible material is a hydrogel, preferably wherein the viscous solution is a dilute hydrogel,most preferably wherein the surface comprises a hydrogel that has a stiffness between 150 Pa and 50 kPa.3. The method of claim 2 , wherein the surface hydrogel and/or overlay hydrogel comprises naturally derived biomaterials claim 2 , i. polysaccharides, gelatinous proteins, ECM components comprising: agarose; alginate; chitosan; dextran; gelatin; lam inins; collagens; hyaluronan; fibrin, functional variants thereof, and mixtures thereof; or', 'ii. a gel derived from natural ECM, preferably Matrigel, Myogel or Cartigel., 'preferably wherein the naturally derived biomaterials are selected from the group comprising4. The method of claim 2 , wherein the surface hydrogel and/or overlay hydrogel is a crosslinked ...

Подробнее

Номер записи: 94

09-01-2020 дата публикации

METHOD FOR PRODUCING RETINAL PIGMENT EPITHELIAL CELLS

Номер: US20200010801A1

Автор: KURODA Takao

Принадлежит:

The present invention provides a production method of a retinal pigment epithelial cell containing the following steps: 1. A production method of a retinal pigment epithelial cell comprising the following steps:(1) a first step for culturing a pluripotent stem cell in a medium comprising at least one kind selected from the group consisting of an FGF receptor inhibitor and an MEK inhibitor for a period of not more than 30 days, and(2) a second step for culturing the cell obtained in the first step in a medium containing at least one kind selected from the group consisting of a Rho signal transduction pathway inhibitor and an apoptosis inhibitor to form a retinal pigment epithelial cell.2. The method according to claim 1 , wherein the first step is performed in serum-free conditions.3. The method according to claim 1 , wherein the first step is performed in the absence of feeder cells.4. The production method according to claim 1 , wherein the medium in the first step further comprises a factor for maintaining undifferentiated state.5. The production method according to claim 4 , wherein the factor for maintaining undifferentiated state is an FGF signal transduction pathway agonist.6. The method according to claim 5 , wherein the FGF signal transduction pathway agonist is bFGF.7. The method according to claim 1 , wherein the FGF receptor inhibitor is at least one kind selected from the group consisting of PD173074 and SU5402.8. The method according to claim 1 , wherein the MEK inhibitor is at least one kind selected from the group consisting of PD0325901 claim 1 , PD184352 claim 1 , U0126 claim 1 , TAK-733 and AZD-8330.9. The method according to claim 1 , wherein the medium in the second step does not contain either an exogenous Nodal signal transduction pathway inhibitor or an exogenous Wnt signal transduction pathway inhibitor.10. The method according to claim 1 , wherein the medium in the second step does not contain an exogenous substance that influences ...

Подробнее

Номер записи: 95

03-02-2022 дата публикации

MACS-BASED PURIFICATION OF STEM CELL-DERIVED RETINAL PIGMENT EPITHELIUM

Номер: US20220033770A1

Автор: Chase Lucas, Meyer Nathan, STANKEWICZ Casey

Принадлежит: FUJIFILM Cellular Dynamics, Inc.

Provided herein are methods of enriching a retinal pigment epithelium (RPE) cell population derived from stem cells. Such a method may comprise removing contaminating cells through the depletion of CD24 positive cells, CD56 positive cells, and/or CD90 positive cells from a starting population of RPE cells. 1. A method for providing an enriched population of retinal pigment epithelial (RPE) cells comprising:a) obtaining a starting cell population comprising RPE cells; andb) enriching said starting cell population for RPE cells by removing therefrom cells that are positive for CD24, cells that are positive for CD56 and/or cells that are positive for CD90, thereby providing a RPE-enriched cell population that is enriched for RPE cells as compared to the starting cell population.2. The method of claim 1 , further comprising determining a level of enrichment of the RPE cells in said RPE-enriched population.3. The method of claim 2 , wherein the level of enrichment is determined through the use of a retinal epithelial-specific marker selected from the group consisting of BEST1 claim 2 , CRALBP claim 2 , TYRP1 claim 2 , PMEL17 claim 2 , and MITF.4. The method of claim 1 , wherein the RPE-enriched cell population is enriched for RPE cells as compared to the starting cell population as determined by BEST1 sorting.5. The method of claim 1 , wherein the RPE-enriched population is at least 95% RPE cells.6. The method of claim 5 , wherein the RPE-enriched population is at least 99% RPE cells.7. The method of claim 6 , wherein the RPE-enriched population is essentially pure RPE cells.8. The method of claim 1 , wherein the RPE cells are human RPE cells.9. The method of claim 1 , wherein the starting cell population is prepared from pluripotent stem cells.10. The method of claim 9 , wherein the pluripotent stem cells are induced pluripotent stem cells.11. The method of claim 1 , wherein the cells that are positive for CD24 claim 1 , cells that are positive for CD56 and/or cells ...

Подробнее

Номер записи: 96

03-02-2022 дата публикации

DERIVATION OF HUMAN MICROGLIA FROM PLURIPOTENT STEM CELLS

Номер: US20220033773A1

Автор: Hou Zhonggang, Murphy William L., Propson Nicholas E., Schwartz Michael P., Slukvin Igor I, Thomson James A., Uenishi Gene I., Zhang Jue

Принадлежит:

The present invention relates to methods for deriving human hematopoietic progenitors, primitive macrophages, and microglial cells from human pluripotent stem cells. In particular, provided herein are highly efficient and reproducible methods of obtaining human primitive macrophages and microglia from human pluripotent stem cells, where the primitive macrophages and microglia can be suitable for clinically relevant therapeutic applications. 1. A method of obtaining human hematopoietic precursor cells , comprising culturing human pluripotent stem cells under normoxic conditions for about 24 hours , wherein the pluripotent stem cells are cultured on a substrate that promotes cell adhesion and in a culture medium consisting essentially of L-ascorbic acid-2-phosphate magnesium , sodium selenium , transferrin , insulin , NaHCO , fibroblast growth factor 2 (FGF2) , transforming growth factor beta 1 (TGFβ1) , and a Rho kinase (ROCK) inhibitor , whereby the cultured pluripotent stem cells differentiate into hematopoietic precursor cells (HPCs).2. The method of claim 1 , wherein the substrate that promotes cell adhesion comprises Tenascin-C.3. The method of claim 2 , wherein the Tenascin-C is recombinant human Tenascin-C.4. The method of claim 1 , wherein the ROCK inhibitor is selected from the group consisting of Y-27632 and Blebbistatin.5. A method of obtaining human myeloid progenitors claim 1 , comprising culturing human HPCs obtained according to the method of for about 3 to about 5 days in a culture medium comprising FGF2 claim 1 , a vascular endothelium growth factor (VEGF) claim 1 , thrombopoietin (TPO) claim 1 , stem cell factor (SCF) claim 1 , interleukin-6 (TL-6) claim 1 , and interleukin-3 (IL-3) claim 1 , wherein the hematopoietic progenitor cells differentiate into myeloid progenitors.6. A method of obtaining human primitive macrophages claim 3 , comprising culturing human myeloid progenitors obtained according to the method of in the presence of a culture ...

Подробнее

Номер записи: 97

15-01-2015 дата публикации

HAIR FOLLICLES MADE EX VIVO THAT CAN BE INSERTED INTO A RECIPIENT FOR HAIR RESTORATION

Номер: US20150017131A1

Автор: Fabrikant Jordan

Принадлежит:

The present invention recognizes that there exists a long felt need for reliable hair growth methods and compositions that do not suffer from side effects and limitations of current technologies, such as surgery using a subject's own hair and pharmaceutical compositions. A first aspect of the present invention is a method of making at least one three dimensional collection of cells capable of forming a functional hair follicle. A second aspect of the present invention is a product produced by the method of making at least one three dimensional collection of cells capable of forming a functional hair follicle of the present invention. A third aspect of the present invention is a method of making at least one functional hair follicle. A fourth aspect of the present invention is a product produced by the method of making at least one functional hair follicle of the present invention. A fifth aspect of the present invention is a method of hair growth in a subject using at least one three dimensional collection of cells capable of forming a functional hair follicle of the present invention. A sixth aspect of the present invention is a method of hair growth in a subject using at least one functional hair follicle of the present invention. 1. A method of making at least one three dimensional collection of cells capable of forming a functional hair follicle , comprising:a. providing at least one three dimensional printable formulation comprising cells capable of forming a functional hair follicle;b. three dimensional printing with said at least one three dimensional printable formulation at least one three dimensional collection of cells capable of forming at least one functional hair follicle.2. The method of claim 1 ,wherein said at least one functional hair follicle is capable of viable transplantation into a subject.3. The method of claim 1 ,wherein said method is performed ex vivo.4. The method of claim 1 ,wherein said three dimensional collection of cells comprise an ...

Подробнее

Номер записи: 98

15-01-2015 дата публикации

EMT-INDUCING TRANSCRIPTION FACTORS COOPERATE WITH SOX9

Номер: US20150017134A1

Автор: GUO Wenjun, Keckesova Zuzana, Weinberg Robert A.

Принадлежит:

In some aspects, compositions and methods useful for generating stem cells from epithelial cells are disclosed. 1. A method of generating stem cells from epithelial cells comprising steps of: (a) providing a population of epithelial cells; and (b) inducing epithelial-mesenchymal transition (EMT) and increasing the amount or activity of at least one EMT-cooperating protein in the population of epithelial cells , thereby generating stem cells in the population.2. The method of claim 1 , wherein the EMT-cooperating protein is a transcription factor (TF).3. The method of claim 1 , wherein the EMT-cooperating protein is a Sox protein.4. The method of claim 1 , wherein the EMT-cooperating protein is Sox 9 or Sox10.5. The method of claim 1 , wherein said inducing comprises exposing the population of epithelial cells to an EMT-inducing agent.6. The method of claim 1 , wherein said inducing comprises exposing the population of epithelial cells to an agent that comprises claim 1 , encodes claim 1 , or increases expression or activity of a polypeptide comprising an EMT-TF.7. The method of claim 1 , wherein said inducing comprises exposing the population of epithelial cells to an agent that comprises claim 1 , encodes claim 1 , or increases expression or activity of a polypeptide comprising an EMT-TF selected from Slug claim 1 , Snail claim 1 , Twist1 claim 1 , Twist2 claim 1 , Zeb1 claim 1 , Zeb2 claim 1 , Goosecoid claim 1 , FoxC2 claim 1 , Tcf3 claim 1 , Klf8 claim 1 , FoxC1 claim 1 , FoxQ1 claim 1 , Six1 claim 1 , Lbx1 claim 1 , Yap1 claim 1 , HIF1 claim 1 , or a functional variant of any of these or exposing the population of epithelial cells to an agent that comprises claim 1 , encodes claim 1 , or increases expression or activity of a polypeptide comprising Taz or a functional variant thereof.8. The method of claim 1 , wherein the method comprises exposing the population of epithelial cells to an agent that stimulates TGF-beta claim 1 , Wnt claim 1 , Notch claim 1 , ...

Подробнее

Номер записи: 99

18-01-2018 дата публикации

GENERATION OF UNIFORM HEPATOCYTES FROM HUMAN EMBRYONIC STEM CELLS BY INHIBITING TGF-BETA and METHODS OF MAINTAINING HEPATIC CULTURES

Номер: US20180015126A1

Автор: James A. Thomson, Srikumar Sengupta

Принадлежит: WISCONSIN ALUMNI RESEARCH FOUNDATION

This disclosure relates generally to new methods of maintaining the expression of hepatic genes in human hepatocytes and method for maintaining the functional hepatic enzyme activity of primary hepatocytes in culture. The disclosure also encompasses new methods of deriving a population of pure hepatocytes without selecting or sorting the cells from the cultured pluripotent cells.

Подробнее

Номер записи: 100