Equine influenza detection kit and detection method

The invention relates to a horse influenza detecting reagent kit and a detecting method, belonging to the inspection and quarantine field. A group of nucleotide sequences for detecting H3N8 subtype horse influenza virus is the nucleotide sequences showed in sequence lists from SEQ ID No: 1 to SEQ ID No: 6. The method has the advantages of: (1) fastness: the detecting time is shortened from 21 days which the traditional detecting method to 4 hours; (2) sensitivity: the H3N8 subtype horse influenza virus which is gradient-diluted for 10 times is detected and the results indicate positive while diluted to 10<-7> times by a single approach and negative while diluted to 10<-5> by double approaches; (3) specificity: when the established H3N8 subtype horse influenza virus single-approach and double-approach fluorescent RT-PCR detecting method is used for detecting equine arteritis virus and other subtype influenza viruses, the result is negative and no cross-reaction is found; (4) stability: results ...

African horse sickness detection kit and detection method

The invention discloses a testing reagent kit of African horse sickness and a testing method thereof, in particular to a testing reagent kit and a method thereof for testing the antigen preparation and purification of virus antibodies of the African horse sickness, which pertains to the field of animal inspection and quarantine. A nucleotide acid fragement containing a plurality of linear epitopes of African horse sickness virus VP7 protein, artificially spliced, is a nucleotide sequence shown in a sequence table SEQ ID No.29. The invention has the advantages of: 1) convenience and fast speed: an assessment can be rapidly carried out to the virus antibody of the African horse sickness of equid; 2) wide range of application: 9 types of antibodies induced by the virus of the African horse sickness can be tested. The kit and the method can not only be used for testing infected animals, but also for antibody assessment; 3) specificity: no cross reaction occurs between the invention and the ...

Nucleotide sequences and kit for testing H1 and H3 subtypes of influenza viruses

The invention provides a group of nucleotide sequences and a kit for testing H1 and H3 subtypes of influenza viruses. The nucleotide sequences for testing H1 and H3 subtypes of influenza viruses are shown by the sequence table from SEQ ID NO:1 to SEQ ID NO:6, wherein the SEQ ID NO:1 and the SEQ ID NO:2 are respectively a sense primer and an antisense primer for testing the HA gene of H1 subtype of influenza viruses, the SEQ ID NO:3 is an LNA modified fluorescent probe for testing the HA gene of H1 subtype of influenza viruses, the SEQ ID NO:4 and the SEQ ID NO:5 are respectively a sense primer and an antisense primer for testing the HA gene of H3 subtype of influenza viruses, and the SEQ ID NO:6 is a fluorescent probe for testing the HA gene of H3 subtype of influenza viruses. The invention also provides a kit testing H1 and H3 subtypes of influenza viruses, which contains the primers and the probes. The kit has the advantages of quickness, high sensitivity, particularity, commonality and ...

Nucleotide sequences and kit for detecting H1N1 influenza A virus 2009 variants aiming at HA genes

The invention discloses a group of nucleotide sequences and a kit for detecting H1N1 influenza A virus 2009 variants aiming at HA genes. The nucleotide sequences of the H1N1 influenza virus 2009 variants are expressed as sequence tables SEQ ID No: 1 to SEQ ID No: 3, wherein the sequences SEQ ID No: 1 and SEQ ID No: 2 are a positive primer and a negative primer for detecting the HA genes of the H1N1 influenza virus 2009 variants respectively, and the SEQ ID No: 3 is a fluorescent probe for detecting the LNA modification of the HA genes of the H1N1 influenza virus 2009 variants. The invention further discloses the kit containing the primers and the probe for detecting the H1N1 influenza virus 2009 variants. The kit has the characteristics of quickness, sensitivity, specificity, good generality, good repeatability and difficult pollution.

Nucleotide sequences and kit for testing H1 and H3 subtypes of influenza viruses

The invention provides a group of nucleotide sequences and a kit for testing H1 and H3 subtypes of influenza viruses. The nucleotide sequences for testing H1 and H3 subtypes of influenza viruses are shown by the sequence table from SEQ ID NO:1 to SEQ ID NO:6, wherein the SEQ ID NO:1 and the SEQ ID NO:2 are respectively a sense primer and an antisense primer for testing the HA gene of H1 subtype of influenza viruses, the SEQ ID NO:3 is an LNA modified fluorescent probe for testing the HA gene of H1 subtype of influenza viruses, the SEQ ID NO:4 and the SEQ ID NO:5 are respectively a sense primer and an antisense primer for testing the HA gene of H3 subtype of influenza viruses, and the SEQ ID NO:6 is a fluorescent probe for testing the HA gene of H3 subtype of influenza viruses. The invention also provides a kit testing H1 and H3 subtypes of influenza viruses, which contains the primers and the probes. The kit has the advantages of quickness, high sensitivity, particularity, commonality and ...

Portable nucleic acid isothermal amplification instrument

The invention provides a portable nucleic acid isothermal amplification instrument. Directed at the detection characteristics of animal epidemic diseases and based on an open source Arduino hardware system, the instrument adopts a programmable isothermal amplification technology, and comprehensively covers isothermal detection methods. While realizing the detection function, hardware and software can be upgraded according to needs, existing isothermal amplification technologies can be corrected and new detection methods can be developed. The isothermal amplification instrument provided by the invention takes a universal controller Arduino uno as the main control panel, employs an independently developed full-bridge control panel to control a Peltier device in terms of heating and cooling circulation on an aluminum block, thus realizing a constant temperature. According to the control process, after thermistor and 22-bit high precision A/D conversion, then the conversion result is sent to ...

Nucleotide sequences and kit for detecting H1N1 influenza A virus 2009 variants aiming at M genes

The invention discloses a group of nucleotide sequences and a kit for detecting H1N1 influenza A virus 2009 variants aiming at M genes. The nucleotide sequences of the H1N1 influenza virus 2009 variants are expressed as sequence tables SEQ ID No: 1 to SEQ ID No: 3, wherein the sequences SEQ ID No: 1 and SEQ ID No: 2 are a positive primer and a negative primer for detecting the M genes of the H1N1 influenza virus 2009 variants respectively, and the SEQ ID No: 3 is a fluorescent probe for detecting the LNA modification of the M genes of the H1N1 influenza virus 2009 variants. The invention further discloses the kit containing the primers and the probe for detecting the H1N1 influenza virus 2009 variants. The kit has the characteristics of quickness, sensitivity, specificity, good generality, good repeatability and difficult pollution.

Nucleic acid isothermal amplification kit and method for detecting EPSPS transgenic crops

The invention provides a nucleic acid isothermal amplification kit and a method for detecting EPSPS transgenic crops, discloses the following group of nucleotide sequences for detecting the EPSPS transgenic crops: 1) 5'-GCCACCCATCTCGATCAC-3' (SEQ ID NO:1), 2) 5'-GATCGGGAATTGGATCCGG-3' (SEQ ID NO:2), 3) 5'-TCGTCCACCGTGACAGGGTTTTTTCATCGCCATGAGCTTCCTC-3' (SEQ ID NO:3), 4) 5'-AGTTCATGGACCTGATFFCCGTTTTTCATCAGGCAGCCTT CGAT-3' (SEQ ID NO:4), 5) 5'-CGACACGAGGCCCATGAC-3' (SEQ ID NO:5), and 6) 5'-CGAAGATCGAACTCTCCG-3' (SEQ ID NO:6), provides nucleic acid isothermal amplification-based nucleic acid test paper, and a detection kit for the EPSPS transgenic crops, which is capable of simply and quickly judging results, and belongs to the field of inspection and quarantine. The kit and the method are suitable for simple and quick detection of the EPSPS transgenic crops, and can be used for re-inspecting identifiers of imported and export goods in labs of testing organizations and quickly screening the ...

Phage antibody library and application thereof in avian influenza immunodetection

The invention relates to an antibody library. An immune globulin light chain variable region VL gene sequence is inserted between Xba and Sac restriction enzyme cutting sites of a Pcomb3 vector. An immune globulin heavy chain variable region VH gene sequence is inserted between Spe and Xho endo restriction enzyme cutting sites. The antibody library is characterized in that two gene fragments comprise the possible combination of antibody variable region light chain and heavy chain, and the antibody library can realize affinity enrichment with an avian influenza virus antigen, and can be applied to avian influenza immunodetection. The antibody library has the advantages that a high affinity antibody can be acquired without animal immunity; a preparation period is short; the antibody library is a phage antibody library which is constructed by taking mice natural immune globulin variable region light chain and heavy chain genes as sources, theoretically contains all possible antibodies in a ...

Method for enriching avian influenza virus in sample of antibody coupling magnetic nano granule

The invention discloses a method for the antibody coupling of avian influenza virus in a magnetic nanometer particle enriched sample and belongs to the field of inspection and quarantine. The method for the antibody coupling of avian influenza virus in the magnetic nanometer particle enriched sample comprises the following steps: (1) magnetic nanometer particles, a polyclonal antibody of avian influenza virus and a coupling agent are mixed and react for 2 hours at room temperature to obtain a magnetic nanometer particle solution coupled with the polyclonal antibody of avian influenza virus; (2) a coupling product is purified and is removed with an unreacted antibody; (3) the coupling product and a solution which is to be tested react and are enriched with magnet; and (4) an enriched product is detected. The method has the advantages that the method does not lose virus activity and has high speed, high efficiency, high sensitivity and strong specificity. The method is rapid and simple and ...

Nucleic acid constant-temperature amplification kit and method for detecting CPTI transgenic crops

The invention discloses a nucleic acid constant-temperature amplification kit and a method for detecting CPTI transgenic crops, and a group of nucleotide sequences for detecting the CPTI transgenic crops, which belong to the field of inspection and quarantine. The group of nucleotide sequences for detecting the CPTI transgenic crops comprises: 1) 5'-GCTGGTATTTTTCCTTGTAGG-3' (SEQ ID NO:1); 2) 5'-GACACGAGTTCAACCTGAT-3' (SEQ ID NO:2); 3) 5'-CGCTTGAGTCTGAATCATGATGATTTTTTACTACTGCAGCAATGGA-3' (SEQ ID NO:3); 4) 5'-ATGAACCTTCTGAGTCTTCAGAACTTTCTGTATGATGGCATTGAGG-3' (SEQ ID NO:4); 5) 5'-CCGAGGTGGTTCAAGCAA-3' (SEQ ID NO:5); and 6) 5'-TGCGATTCATGCATCTGCT-3' (SEQ ID NO:6). The nucleic acid constant-temperature amplification and nucleic acid test strip-based CPTI transgenic crop detection kit can simply and fast perform result judgment, is applied to the simple and fast detection of the CPTI transgenic crops, and can be used for the import and export commodity identifier reinspection of laboratories ...

Protein chip kit and method for detecting transgenic crops

The invention discloses a protein chip for detecting transgenic products. The protein chip is a film which is arranged on the plane of a plane type supporting carrier and coated with a modified material; and protein antibody probes for detecting transgenic agricultural products are arranged on the surface of the film in a lattice mode and comprise 1) a Bt cry1Ac/Ab monoclonal antibody, 2) a Bt cry1Ah monoclonal antibody, 3) a phytase PHY monoclonal antibody, 4) a glyphosate-tolerant G2-EPSPS polyclonal antibody and 5) a salt-tolerant IrrE polyclonal antibody. The invention further provides a chip kit for detecting transgenic crops and performing result judgment simply and rapidly based on antigen antibody reaction, which belongs to the field of inspection and quarantine. The protein chip kit has the advantages of: 1) high speed, wherein the detection time is only 1.5 to 2 hours; 2) specificity, wherein protein antigens and antibodies are specifically combined and each antibody performs ...

Nucleotide sequence and detection kit for detecting bovine enterovirus and foot-and-mouth disease virus

The invention discloses a nucleotide sequence for detecting bovine enterovirus and foot-and-mouth disease virus, and the nucleotide sequence for detecting the bovine enterovirus and the foot-and-mouth disease virus is as shown in SEQ (sequence) ID (identity) NO: 1 to SEQ ID NO: 4 in a sequence table, wherein the SEQ ID NO: 1 and the SEQ ID NO: 2 are a sense primer and an antisense primer for detecting the bovine enterovirus respectively; and the SEQ ID NO: 3 and the SEQ ID NO: 4 are the sense primer and the antisense primer for detecting the foot-and-mouth disease virus respectively. The invention further discloses a kit containing the primers for detecting the bovine enterovirus and the foot-and-mouth disease virus. The kit has the characteristics of quickness, sensitiveness, specificity, stability and good repeatability.

Equine influenza detection kit and detection method

The present invention relates to a horse influenza detecting reagent kit and a detecting method, belonging to the inspection and quarantine field. A group of nucleotide sequences for detecting H3N8 subtype horse influenza virus is the nucleotide sequences showed in sequence lists from SEQ ID No: 1 to SEQ ID No: 6. The method has the advantages of: (1) fastness: the detecting time is shortened to 4 hours; (2) sensitivity: the results indicate positive while diluted to 10<-7> times by a single approach and negative while diluted to 10<-5> by double approaches; (3) specificity: when the established H3N8 subtype horse influenza virus single-approach and double-approach fluorescent RT-PCR detecting method is used for detecting equine arteritis virus and other subtype influenza viruses, the result is negative and no cross-reaction is found; (4) stability: results of repeated experiments show that the established method has good stability; and (5) being not easy for contamination: the totally ...

Nucleic acid sequence of detecting rabies virus, detecting reagent case and detecting method

The invention discloses a nucleotide sequence for detecting rabies virus, a detection kit and a method thereof, pertaining to inspection and quarantine field. A group of nucleotide sequence for detecting rabies virus comprises the nucleotide sequences shown in sequence tables from SEQ ID No. 1 to SEQ ID No. 3, wherein, the SEQ ID No. 1 and the SEQ ID No. 2 are respectively of a sense primer and an anti-sense primer while the SEQ ID No. 3 is of a fluorescence probe. The invention has the advantages of: (1) quickness, which shortens the detection period of 2-7 days in the traditional detection method to four hours; (2) sensitivity, the detection to mice brain virus of rabies virus CVS strain which is diluted by ten-time gradient shows that positive can be detected in object diluted to eight to ten times; (3) specificity, the detection to other collected pathogen from mated animals through established rabies virus fluorescence RT-PCR detection method shows a negative result and no cross reaction ...

Nucleic acid sequence of detecting rabies virus, detecting reagent kit and detecting method

African horse sickness detection kit and detection method

The invention discloses a testing reagent kit of African horse sickness and a testing method thereof, in particular to a testing reagent kit and a method thereof for testing the antigen preparation and purification of virus antibodies of the African horse sickness, which pertains to the field of animal inspection and quarantine. A nucleotide acid fragement containing a plurality of linear epitopes of African horse sickness virus VP7 protein, artificially spliced, is a nucleotide sequence shown in a sequence table SEQ ID No.29. The invention has the advantages of: 1) convenience and fast speed: an assessment can be rapidly carried out to the virus antibody of the African horse sickness of equid; 2) wide range of application: 9 types of antibodies induced by the virus of the African horse sickness can be tested. The kit and the method can not only be used for testing infected animals, but also for antibody assessment; 3) specificity: no cross reaction occurs between the invention and the ...

Nucleic acid isothermal amplification kit and method for detecting transgenic BT crop

The invention discloses a nucleic acid isothermal amplification kit and a nucleic acid isothermal amplification method for detecting a transgenic BT crop. The invention discloses a group of following nucleotide sequence for detecting the transgenic BT crop: 1) 5'-GAAGGTTTGAGCAATCTCTAC-3'(SEQ ID No: 1), 2) 5'-CGATCAGCCTAGTAAGGTCGT-3'(SEQ ID No: 2), 3) 5'-GAATACGCATTTCCTCGCTTAGAGAGCTTCAGAGAGTGG-3'(SEQ ID No: 3), 4) 5'-CTAATCTTCACCTCAGCGTGTTCTATTGATGGTTGCAGCATC-3'(SEQ ID No: 4), 5) 5'-GAGCTGGGTTAGTAGGAT-3'(SEQ ID No:5), and 6) 5'-CTTCGAGACGTTAGCGTG-3'(SEQ ID No: 6). The invention provides nucleic acid-based isothermal amplification and nucleic acid test paper. The transgenic BT crop detection kit capable of simply and quickly judging results belongs to the field of inspection and quarantine, is suitable for simply and quickly detecting the transgenic BT crop, and can be used for identification re-inspection of detection mechanisms and laboratories on imports and exports, field quick screening ...

Nucleotide sequences and kit for detecting H1N1 influenza A virus 2009 variants aiming at M genes

The invention discloses a group of nucleotide sequences and a kit for detecting H1N1 influenza A virus 2009 variants aiming at M genes. The nucleotide sequences of the H1N1 influenza virus 2009 variants are expressed as sequence tables SEQ ID No: 1 to SEQ ID No: 3, wherein the sequences SEQ ID No: 1 and SEQ ID No: 2 are a positive primer and a negative primer for detecting the M genes of the H1N1influenza virus 2009 variants respectively, and the SEQ ID No: 3 is a fluorescent probe for detecting the LNA modification of the M genes of the H1N1 influenza virus 2009 variants. The invention further discloses the kit containing the primers and the probe for detecting the H1N1 influenza virus 2009 variants. The kit has the characteristics of quickness, sensitivity, specificity, good generality, good repeatability and difficult pollution.

Nucleotide sequence and kit for detecting type-A influenza virus

The invention discloses a nucleotide sequence and a kit for detecting type-A influenza virus. The nucleotide sequence for detecting the type-A influenza virus is shown as SEQ ID NO: 1 to SEQ ID NO: 3 in a sequence table, wherein the sequence SEQ ID NO: 1 and the sequence SEQ ID NO: 2 are respectively a positive-sense primer and an antisense primer for detecting the M gene of the type-A influenza virus; and the sequence SEQ ID NO: 3 is an LNA-modified fluorescent probe for detecting the M gene of the type-A influenza virus. The invention also discloses a primers and probe-containing kit for detecting the type-A influenza virus. The kit has the characteristics of rapidness, sensitivity, specificity, high universality and high repeatability, and is hardly polluted.

Nucleotide sequences and kit for detecting H1N1 influenza A virus 2009 variants aiming at HA genes

The invention discloses a group of nucleotide sequences and a kit for detecting H1N1 influenza A virus 2009 variants aiming at HA genes. The nucleotide sequences of the H1N1 influenza virus 2009 variants are expressed as sequence tables SEQ ID No: 1 to SEQ ID No: 3, wherein the sequences SEQ ID No: 1 and SEQ ID No: 2 are a positive primer and a negative primer for detecting the HA genes of the H1N1 influenza virus 2009 variants respectively, and the SEQ ID No: 3 is a fluorescent probe for detecting the LNA modification of the HA genes of the H1N1 influenza virus 2009 variants. The invention further discloses the kit containing the primers and the probe for detecting the H1N1 influenza virus 2009 variants. The kit has the characteristics of quickness, sensitivity, specificity, good generality, good repeatability and difficult pollution.

Brucella abortus fluorescent quantum point coupling antibody detection method

The invention discloses a method for detecting a coupling antibody of brucella abortus and luminescent quantum dots, which belongs to the field of detector and quarantine. The method comprises the following steps: (1) quantum dots, brucella abortus polyclonal antibodies and coupling agent are mixed and act for two hours in room temperature to obtain solution containing quantum dots which are coupled with brucella abortus polyclonal antibodies; (2) the coupling product is purified, and unreacted brucella abortus antibodies and quantum dots are removed; (3) the coupling product acts with a test sample coated on a slide, the luminescent detection is then carried out after the dissociative coupling product is rinsed out, and the test sample contains corresponding antigens when the luminescence exists. The invention has the advantages that the method has extremely low detection limit, high sensitivity and strong specificity, and simultaneously, a plurality of brucella abortus antigen ingredients ...

Nucleic acid constant-temperature amplification kit and method for detecting BAR transgenic crops

The invention discloses a nucleic acid constant-temperature amplification kit and a method for detecting Bar transgenic crops, and a group of nucleotide sequences for detecting the Bar transgenic crops, which belong to the field of inspection and quarantine. The group of nucleotide sequences of the Bar transgenic crops comprises: 1) 5'-CGACCTCGTCCGTCTGCG-3' (SEQ ID NO:1); 2) 5'-CTGTGCCTCCAGGGACTTC-3' (SEQ ID NO:2); 3) 5'-TTGCGTGCCTTCCAGGGGCTTGAGCGCTATCCCTGG-3' (SEQ ID NO:3); 4) 5'-ACGGCCGAGTCGACCGTGT-AGCAGGTGGGTGTAGAGC-3' (SEQ ID NO:4); 5) 5'-CCACCTCGGCGACGAG-3' (SEQ ID NO:5); and 6) 5'-CACCAGCGGACGGGACT-3' (SEQ ID NO:6). The nucleic acid constant-temperature amplification and nucleic acid test strip-based Bar transgenic crop detection kit can simply and fast perform result judgment, is applied to the simple and fast detection of the Bar transgenic crops, and can be used for the import and export commodity identifier reinspection of laboratories of detection institutions, the transgenic ...