Ribbed woven winding carbon fiber composite transmission shaft

The invention relates to a ribbed woven winding carbon fiber composite transmission shaft, which comprises a transmission shaft body (1) and metal flanges (2) connected with two ends of the transmission shaft body, wherein the transmission shaft body (1) is tubular and is formed by winding a carbon fiber composite, and the metal flanges (2) are arranged on two ends of the transmission shaft body. According to the carbon fiber composite transmission shaft, the contact area between the metal flanges and carbon fibers can be increased through ribs on the metal flanges, the strength of the carbon fibers can be fully utilized by utilizing weaving and winding methods, and the interlaminar shear strength and connection strength at the connection position of the transmission shaft body and the metal flanges is improved, so that torque can be stably transmitted. The connection reliability of the carbon fiber composite transmission shaft can be enhanced. The application fields of the carbon fiber ...

Chinese rose tissue culture and rapid propagation method combining ex vitro rooting technology

The invention discloses a Chinese rose tissue culture and rapid propagation method combining the ex vitro rooting technology. The method includes: using a Chinese rose half-lignification stem as an explant, inoculating the stem into induction culture media containing MS culture media, 6-BA, NAA, cane sugar and agar for culturing, performing subculture for two to three times, and cutting new buds and moving into culture media containing MS culture media, 6-BA, CPPU, NAA, cane sugar and agar for continuous multiplication culturing; soaking regenerated seedlings with rooting liquid, and cutting the regenerated seedlings to compound substrates to achieve ex vitro rooting. The method has the advantages that in a tissue culture vitro stage, first-generation induction and subculture multiplication, 6-BA is used as the plant growth regulator, 6-BA can promote cell division, promote cell growth, and the like, high multiplication coefficient and robust plants are achieved, and ex vitro rooting can ...

Ecological interception and blocking system for controlling non-point source pollution of rice field

The invention discloses an ecological interception and blocking system for controlling non-point source pollution of a rice field. The ecological interception and blocking system is characterized by comprising an ecological ditch and a rice field wet land, wherein the ecological ditch consists of ditch side walls and a ditch bottom, the cross section in the width direction of the ditch is a trapezoid with a longer upper side and a shorter bottom side, the ditch walls and the ditch bottom are formed by splicing regularly hexagonal brick holes, ditch body green plants are distributed on the ditch walls, and an emergent aquatic plant is distributed at the ditch bottom; the rice field wet land is constructed at the tail end of a rice field drainage, the soil surface of the rice field wet land is lower than the surface of a normal rice field, rice seedling is planted in the rice field wet land, water flowing through the rice field and the ecological ditch from upstream is used as irrigation ...

Magnetic suspension method and device

Medical tool for odontology

Single-phase power factor correction simplified direct division controller

The invention relates to a single-phase power factor correction simplified direct division controller. The controller comprises a power circuit which receives single-phase alternating current input voltage and a control signal of a control circuit to carry out power factor correction, and outputs the voltage to load, wherein the control circuit comprises a detection part, a numerical control partand a drive part, wherein the detection part is used for detecting output direct current voltage and shunt resistance voltage in the power circuit; the numerical control part is used for carrying outanalog-digital conversion on partial output signal, calculating amplitude of inductive current, calculating duty factor according to duty factor function, and generating a PWM pulse signal by a pulsegenerator; and the drive part is used for controlling the on/off of a power switch in the power circuit according to the PWM pulse signal output by the numerical control part. The controller can determine ...

Rural sewage treatment pond

The utility model discloses a rural sewage treatment pond aims at providing the rural sewage treatment pond of the mud of can discharging fast, and its technical scheme main points are including anaerobism pond, a plurality of filtering ponds, sealed lid is installed to anaerobism pond top surface, and naughty clearly mouthful has been seted up to sealed covering, the clear mouth of drawing is equipped with the top cap, anaerobism pond and filtering ponds all be equipped with water inlet and outlet, the outlet height in anaerobism pond is less than the height of water inlet, the outlet is linked together with the water inlet of adjacent filtering ponds, and the water inlet and the outlet of two adjacent filtering ponds communicate each other and form the limbers, the limbers is crisscross to be set up, the anaerobism pond is equipped with the desilt string bag below the water inlet, the top cap is equipped with the hoist mechanism who is used for the pull -up desilt string bag.

Combined septic tank

The invention discloses a combined septic tank which is convenient for assembly. The combined septic tank comprises a bottom plate, two side plates and a plurality of partitions, wherein the two side plates are arranged on the top surface of the bottom plate and arranged in opposite; the partitions are arranged between the two side plates; one side of each side plate faced with the other side plate and the position of each partition are respectively provided with a groove; the top surface of the bottom plate is also provided with grooves in the position of each partition; the side part of each partition is clamped in each groove of the side plate; and the bottom end of each partition is clamped in the groove of the top surface of the bottom plate in the corresponding partition position.

Water conduction electrocoagulation hemostatic cutter

The invention discloses a water conduction electrocoagulation hemostatic cutter, comprising a shell and an electrocoagulation hemostatic cutter core arranged in the shell. The electrocoagulation hemostatic cutter core is electrically connected with the output end corresponding to an external radio-frequency generator respectively through an electrocoagulation switch and an electricity cutting switch; the head of the electrocoagulation hemostatic cutter core extends out from the lower port of the shell; the shell is internally provided with a water conducting device used for seeping water fromthe lower port of the shell; the water inlet on the water conducting device extends out from the shell and is communicated with a water delivery device which supplies water fluid to the external partand controls the water fluid flow. In the water conduction electrocoagulation hemostatic cutter of the invention, as the water conducting device which can seep water is increased on the basis of the common ...

Double-layer type disposable snare

The utility model discloses a double-layer type disposable snare which comprises an upper snare ring, a lower snare ring, a hard-end absorbable wire, a fixing section, a handheld push rod, a tailstock, a push plate and a threading hole. The beneficial effects of the utility model are that the length of the hard-end absorbable line is 5mm, and the distance between the threading holes arranged on the push plate is 5mm, so that the two loop rings form a double-layer tightening structure with an interval of 5mm after the absorbable line is tensioned, thereby ensuring that the distance between the two loop rings is moderate, and improving the tightness of the two loop rings. The situation that the second snare ring is ineffectively pricked in the same place due to the fact that the distance between the two snare rings is too narrow is prevented, and meanwhile the situation that a cavity may be formed due to the fact that the distance between the two snare rings is too wide and too many tissue ...

Washing tank

The invention discloses a washing tank, which aims to provide a washing tank which can prevent waste liquid which is washed from a washboard from flowing around. The washing tank comprises a tank body, wherein a U-shaped tank is arranged in the tank body, a water outlet is arranged on one side of the U-type tank, a filter screen is arranged on the water outlet, and fixed feet which are used to place are arranged on the bottom portion of the tank body.

Drink

Owing to the ingredients comprising refined kelp powder, citric acid, licorice and iodic salt, the drink contains certain amount of iodine. It is one drink with excellent preventing and curing effecton iodine lacking diseases.

Hydraulic cylinder of carbon fiber composite material

The invention discloses a hydraulic cylinder of a carbon fiber composite material. A cylinder body (2) is made of a high-strength carbon fiber precursor of which the strength is greater than or equal to 3500MPa as a reinforcing material and thermosetting resin as a substrate by adopting a technology of winding and molding carbon fiber into a carbon fiber composite material layer; a cylinder bottom (1), a piston (6) and a cylinder cover (10) are made of a high-strength aluminum alloy of which the strength is greater than or equal to 500MPa; a piston rod (9) is made of hard chromium-plated steel. Compared with a common hydraulic cylinder made of metal, the hydraulic cylinder has the significant advantage of weight reduction, and the weight-carrying capacity is obviously superior to that of an existing common hydraulic cylinder made of metal. Therefore, the hydraulic cylinder has a good application prospect in hydraulic drive and hydraulic control equipment in which water is used as a fluid ...

Fault monitoring method, device and equipment for coal mill pull rod and storage medium

The invention relates to a coal mill pull rod fault monitoring method and device, equipment and a storage medium. The method comprises the steps that a coal mill simulation model is established according to an actual coal mill, the coal mill simulation model is operated, and the installation position of a strain sensor is determined according to simulation data; actual pull rod strain data of the coal mill are collected in real time through the strain sensor, and the pull rod strain data are preprocessed; and when the pre-processed pull rod strain data reaches a preset alarm threshold value within a first preset time, sending out a pull rod fault early warning signal. According to the fault monitoring method, device and equipment for the pull rod of the coal mill and the storage medium, the position where the pull rod is prone to fracture is determined by establishing the coal mill simulation model, the strain data of the pull rod at the position are collected, preprocessing and fault monitoring ...

Rural sewage treatment pool

The invention discloses a rural sewage treatment pool and aims at providing a rural sewage treatment pool capable of rapidly discharging sludge. According to key points of the technical scheme, the rural sewage treatment pool comprises an anaerobic tank and multiple filtering basins, wherein a sealing cover is arranged on the top surface of the anaerobic tank; a cleaning port is formed in the sealing cover; a top cover is arranged at the cleaning port; water inlets and water outlets are formed in the anaerobic tank and the filtering basins; the heights of the water outlets of the anaerobic tank are lower than the heights of the water inlets; the water outlets and the water inlets of the adjacent filtering basins are communicated with one another; the water inlets of two adjacent filtering basins are communicated with the water outlets so as to form water through holes; the water through holes are formed in a staggered mode; a silt removal net bag is arranged on the anaerobic tank below ...

Porta hepatis blocking device

The invention provides a porta hepatis blocking device. The porta hepatis blocking device consists of a clamping tongue, a double-cylinder shell, a clamping tongue cylinder, a shaft, a belt-penetrating cylinder, a clamping tongue tip, a clamping tongue press key, a spring sheet and a blocking belt, wherein the clamping tongue cylinder and the belt-penetrating cylinder form the double-cylinder shell; the clamping tongue has a 'Z' shape and is positioned in the clamping tongue cylinder; the shaft is connected with the clamping tongue and the clamping tongue cylinder; the spring sheet has an arcuate shape and is positioned in the clamping tongue cylinder; one end of the spring sheet is fixed with the clamping tongue cylinder; the bow back of the spring sheet is propped against the clamping tongue, so that the clamping tongue press key extends out of the clamping tongue cylinder; the tail end of the blocking belt is fixed with the clamping tongue cylinder; and the blocking belt is provided ...

Coal feeder fault risk judgment method based on coal pulverizing system operation parameters

The invention discloses a coal feeder fault risk judgment method based on coal pulverizing system operation parameters, and the method comprises the steps: obtaining a plurality of measurement operation parameters of a to-be-measured coal pulverizing system corresponding to a to-be-measured coal feeder in real time, the reference coal pulverizing system and the coal pulverizing system to be tested are in the same operation condition and the working state is normal; according to a corresponding relationship between the plurality of measured operation parameters and the reference operation parameters, determining a multi-dimensional coal interruption risk grade of the to-be-measured coal feeder; and determining the coal interruption fault risk of the to-be-tested coal feeder according to the multi-dimensional coal interruption risk levels of the to-be-tested coal feeder. According to the method, the real-time data acquired by field operation of the coal pulverizing system is acquired, whether ...

Porta hepatis blocking device

The invention provides a porta hepatis blocking device. The porta hepatis blocking device consists of a clamping tongue, a double-cylinder shell, a clamping tongue cylinder, a shaft, a belt-penetrating cylinder, a clamping tongue tip, a clamping tongue press key, a spring sheet and a blocking belt, wherein the clamping tongue cylinder and the belt-penetrating cylinder form the double-cylinder shell; the clamping tongue has a 'Z' shape and is positioned in the clamping tongue cylinder; the shaft is connected with the clamping tongue and the clamping tongue cylinder; the spring sheet has an arcuate shape and is positioned in the clamping tongue cylinder; one end of the spring sheet is fixed with the clamping tongue cylinder; the bow back of the spring sheet is propped against the clamping tongue, so that the clamping tongue press key extends out of the clamping tongue cylinder; the tail end of the blocking belt is fixed with the clamping tongue cylinder; and the blocking belt is provided ...

Integral type no. 3 manure pit of formatting

The utility model discloses an integral type no. 3 manure pit of formatting aims at providing one kind and not only makes things convenient for the transportation but also can prevent the too big integral type no. 3 manure pit of formatting of marsh gas pressure, and its technical scheme main points are the three cavities that enclose including chi gai, by pool wall and baffle, chi gai lid closes formats on the manure pit three, is equipped with into dirty mouthful on the first cavity, is equipped with the outlet on the third cavity, advance dirty mouthful with the outlet on connecting to advance dirty pipe and drain pipe respectively, be equipped with between first cavity and second cavity and on the baffle of second cavity and third cavity and feed through bicavitary through -hole, connecting the pipe on the through -hole, the three cavity formula structure as an organic whole of enclosing by pool wall and baffle, it is the staggered arrangement distribution to advance dirty pipe, pipe ...

Combination type digestion tank

The utility model discloses a be convenient for the equipment combination type digestion tank, including bottom plate, two curb plates and a plurality of baffle, two curb plate settings set up at bottom plate top surface, two curb plates relatively, the baffle sets up between two curb plates, in one side of another curb plate of orientation and all be equipped with the recess with every baffle position department on every curb plate, the top surface of bottom plate also all is equipped with the recess in every baffle position department, the lateral part card of baffle is in the recess of curb plate, and the bottom card of baffle is at the bottom plate top surface to should the baffle position in the recess of department.

Pipeline handling device

The utility model provides a pipeline handling device, place case, manipulator, turn to base and running gear including base, balance control platform, platform, pipeline, the base both sides are equipped with two running gear respectively, the base upper end is equipped with the balance control platform, balance control platform upper end is equipped with the platform, the platform upper end is equipped with the pipeline and places the case, the platform upper end is equipped with and turns to the base, it locates the pipeline and places case side to turn to the base, it is equipped with themanipulator on the base to turn to. The utility model discloses the intention is novel, and compact structure is equipped with balance control platform and track, can be used to scramble stair and complicated topography, is equipped with the manipulator and turns to the base, but make its auto -control handling pipeline, and convenient and fast has avoided the workman be injured because of the transport ...

Coal mill fault early warning method based on PCA and LSTM fusion algorithm

The invention discloses a coal mill fault early warning method based on a PCA and LSTM fusion algorithm, and the method comprises the steps: obtaining a plurality of historical operation state parameters of a normal operation condition time period of a coal mill, carrying out the principal component analysis of the parameters, and obtaining a state representation parameter data set of the coal mill; constructing a coal mill fault early warning model based on a long short-term memory network, and performing iterative training on the coal mill fault early warning model by using the coal mill state characterization parameter data set to obtain a completely trained coal mill fault early warning model; acquiring a plurality of real-time operation state parameters of the coal mill, and performing principal component analysis on the plurality of real-time operation state parameters to obtain real-time state characterization parameters of the coal mill; and inputting the real-time state characterization ...

Portable collapsible transfusion stand using hinge principle

Water conduction electrocoagulation hemostatic cutter

The invention discloses a water conduction electrocoagulation hemostatic cutter, comprising a shell and an electrocoagulation hemostatic cutter core arranged in the shell. The electrocoagulation hemostatic cutter core is electrically connected with the output end corresponding to an external radio-frequency generator respectively through an electrocoagulation switch and an electricity cutting switch; the head of the electrocoagulation hemostatic cutter core extends out from the lower port of the shell; the shell is internally provided with a water conducting device used for seeping water from the lower port of the shell; the water inlet on the water conducting device extends out from the shell and is communicated with a water delivery device which supplies water fluid to the external part and controls the water fluid flow. In the water conduction electrocoagulation hemostatic cutter of the invention, as the water conducting device which can seep water is increased on the basis of the common ...

Laundry groove

The utility model discloses a laundry groove aims at providing one kind and can prevent the waste liquid of washboard under washing by rubbing with the hands the laundry groove of sinuous flow everywhere, and its technical scheme main points are including the cell body, the inboard U type groove that is of cell body, U type groove one side is equipped with the outlet, the outlet is equipped with the filter screen, cell body bottom is equipped with and is used for the fixed foot put.

Ecological purifying device for waste water

The invention relates to the technical filed of domestic sewage treatment, which discloses an ecological sewage purification device. The ecological sewage purification device comprises a hollow cylinder buried in the ground, and two ends of the cylinder are provided with a sewage inlet and a purification water outlet respectively, and a cavity in the middle is divided into a plurality of sequentially-communicated (sewage storage) fermentation chambers and filtering chambers through opened partitions, wherein the top of each (sewage storage) fermentation chamber is provided with a flexible cover plate for regular cleaning, and the inside of each filtering chamber is paved with filtering materials by layers. The cylinder is connected with the partitions into a whole and is water-sealed at the periphery. Openings on various partitions are different in height. The device is quite simple in structure and low in production cost, the producing materials are environment-friendly, the installation ...

Production line for polypropylene spunbonded needle-punched geotechnical cloth and manufacturing method

The invention discloses a production line for polypropylene spunbonded needle-punched geotechnical cloth and a manufacturing method. The production line comprises a silo, a screw extruder, a melt filter, a spinning box, a lateral blowing device, a drafting device, a sway machine, a lapping machine, a preliminary needle-punching machine, a stretching device, a main needle-punching machine, a winding machine and a cloth storage device, wherein the melt filter is connected with the spinning box through a pipeline. The production line is relatively simple, and the specific gravity of polypropylene is lighter than that of polyester; the geotechnical cloth produced by using the polypropylene as raw materials is large in fiber quantity under the condition of the same weight, and water filtration and planar water drainage are facilitated; in addition, the production line has better acid resistance and alkali resistance properties and is quite suitable for a refuse landfill used for an environmental ...

Method for preparing soluble human recombinant MICA protein

The invention discloses a method for preparing a soluble human recombinant MICA protein, which comprises the following steps of: a step 1 of sampling 30ml of in-vitro peripheral venous blood donated by a healthy adult volunteer, diluting the in-vitro peripheral venous blood by physiological saline and separating out an offwhite lymphocyte layer by a lymphocytes separation medium; a step 2 of extracting an RNA (Ribose Nucleic Acid) of processed offwhite lymphocytes by a TRIZOL, carrying out sequence screening on the RNA, planting the RNA into a rhabdovirus genome, carrying out recombination, collection, dialysis and centrifugation to obtain an MICA protein and filtering the MICA protein by a CENTRICON ultrafilter; a step 3 of purifying a target protein; and a step 4 of identifying the MICA target protein. The soluble human recombinant MICA protein prepared by the preparation method is the MICA protein of which a molecular structure domain is closer to the natural state and has the advantages ...

Magnetic bearing electromagnetic force sensing device based on optical fiber grating and on-line measurement system

The invention relates to an optical fiber grating magnetic force bearing electromagnetic force sensing device and an online measuring system, belonging to the optical fiber grating magnetic force sensing technical field, wherein the device comprises an L-shaped magnetic elastic unit 1 and an optical fiber grating 2 enclosed in the elastic unit groove, a magnetic force bearing stator 4, a magnetic force bearing rotor 5. The convex part of the L-shaped magnetic elastic unit is spliced in the groove at the bottom of the magnetic force bearing stator 4, and the other part is suspended in the air gap to form the cantilever structure. When in measurement, the wideband light source transmits the light with certain bandwidth and the conversion part into the optical fiber grating magnetic force sensing device through the light transmission, wherein the optical fiber grating 2 in the device generates the wavelength excursion due to the strain, according to the wavelength selection of the optical ...

A sewer line for desilting

The utility model provides a sewer line for desilting, be provided with symmetry in the round opening of the horizontal central plane of pipeline body on the pipeline body, the apron compresses tightly on round opening, round opening's below is provided with ring type seal, ring type seal sets up in the junction of pipeline body with the apron, the last fastening double -screw that is provided with of ring type seal, the top of apron is provided with and is used for the handle that lifts by crane, fastening double -screw passes the apron and lifts by crane handle and fastening double -screw and locks on lifting by crane the handle through the fastener, be provided with the many places turn on apron and round opening's the contact surface, the end of turn is provided with the sealed chamberof T type, the sealed intracavity of T type is provided with T type sealing strip, the intermediate position of apron is provided with the filter screen. This sewer line can realize purifying in advance ...

Glass fiber reinforced plastic vacuum pump

The glass fiber reinforced plastic vacuum pump comprises a centrifugal cylinder and a servo motor arranged at the bottom of the centrifugal cylinder, a power output end rope at the top of the servo motor is fixedly provided with a rotating disc located in the centrifugal cylinder, and the circle center of the rotating disc does not coincide with the circle center of the centrifugal cylinder; a center cylinder and a centrifugal plate surrounding the center cylinder are fixed to the top of the rotating disc, a connecting flange is integrally arranged at the top of the centrifugal cylinder, a sealing plate is detachably arranged on the connecting flange, and a separation cylinder is arranged on the sealing plate. The filling plate moves up and down in the centrifugal cylinder, the inner wall of the centrifugal cylinder is filled with the filling plate, the interior of the centrifugal cylinder can be adjusted, the mass of water contained in the centrifugal cylinder is not changed, the inner ...

Method, device and equipment for evaluating health state of coal mill and storage medium

The invention relates to a coal mill health state assessment method and device, equipment and a storage medium. The method comprises the steps that an initial dynamic model of a coal mill is established; based on a preset method, parameters of the initial dynamic model of the coal mill are determined according to historical operation data of the coal mill, and a target dynamic model of the coal mill is obtained; inputting a coal mill operation data sequence into the coal mill target dynamic model, and determining a coal mill health index initial value according to an output result; and optimizing the initial value of the health index of the coal mill according to the running data of the main measuring point of the coal mill to obtain a final value of the health index. According to the coal mill health state assessment method, device and equipment and the storage medium, the coal mill operation data sequence is input into the coal mill target dynamic model, the coal mill health index final ...

Sheet type giant magnetostrictive magnetic field sensor based on fiber Bragg grating

The invention relates to a sheet type giant magnetostrictive magnetic field sensor based on a fiber Bragg grating. The sensor includes a giant magnetostrictive sheet (1) and the fiber Bragg grating (2), wherein the fiber Bragg grating (2) is adhered to one side surface of the giant magnetostrictive sheet (1) and is perpendicular to the magnetostriction direction. The sensor provided by the invention has the advantages of high anti-jamming capability, high reliability, passivity, high convenience in establishing a sensor network, etc.

Cylindrical flexible circuit board conducting loop used for electric bearing

The invention discloses a cylindrical flexible circuit board conducting loop used for an electric bearing. The conducting loop comprises a core shaft (1) and a long rectangular flexible circuit board, wherein the flexible circuit board (5) is wound layer by layer and pasted on the core shaft (1) to form a cylindrical conducting loop (2); two wide wires (3) which penetrate through overall length are respectively printed on the edges of two long ends of the flexible circuit board (5); multiple parallel thin wires (4) which are equidistant are printed between the two wide wires (3) along the vertical direction; the thin wires (4) are communicated with the two wide wires (3). The cylindrical flexible circuit board conducting loop disclosed by the invention is used in the electric bearing and can guide vortex along the direction in which restoring force is generated with an ultrafine wire diameter, the vortex loss is reduced; the cylindrical flexible circuit board is in continuous distribution ...

Environmental-friendly halogen-free low-smoke flame retardant material for coaxial cable and preparation method thereof

The invention relates to an environmental-friendly halogen-free low-smoke flame retardant material for a coaxial cable and a preparation method thereof. The environmental-friendly halogen-free low-smoke flame retardant material comprises the following materials with the content by weight percent: 15 to 30 percent of ethane-vinyl acetate copolymer, 8 to 15 percent of linear low-density polythene, 25 to 60 percent of fire retardant aluminium hydroxide, 10 to 20 percent of fire retardant magnesium hydroxide, 5 to 10 percent of compatilizer ethane-vinyl acetate copolymer graft maleic anhydride copolymer or ethane graft maleic anhydride copolymer, 0.2 to 0.8 percent of antioxygen triphenyl phosphate, 0.4 to 1 percent of surface active agent ethenyl (beta-methoxyl ethyoxyl) trisilane and 0.5 to 1.2 percent of lubricant zinc stearate. The preparation method of the environmental-friendly halogen-free low-smoke flame retardant material comprises the following steps: firstly, mixing the fire retardant ...

Maglev galloping train device

The invention provides a maglev galloping train device. In the invention, the train body of a galloping train is suspended on an overhead track by using the maglev technology, the galloping train is driven to run along the track by air flow generated by a propeller-powered thruster on the galloping train, and the galloping train is composed of a maglev system and the propeller-powered thruster. Because the galloping train is suspended in the air and has no friction with the track, the power loss caused by friction can be avoided, thereby making the high-speed running of the galloping train possible. The maglev galloping train device provided by the invention can become a transportation facility with a totally new concept and a new carrying mode and has the advantages of novel principle, simple structure and the like.

Portable medicine cabinet arranging infusion devices by specification

Tumor marker in human cholangiocarcinoma serum and detection method and application thereof

The present invention discloses a tumor marker in human cholangiocarcinoma serum and a detection method and application thereof, and mainly relates to a tiny RNA sequence in human cholangiocarcinoma serum exosome and a detection method thereof. The miRNA sequence of the tumor marker is miR-CCA sequence of 3 'UGAUCGACUGUGCCUCUGGAU5'. The detection method mainly comprises the following steps: 1, extracting peripheral blood serum, removing most of the free miRNA by ultrafiltration centrifugation to keep the exosome; 2, extracting the miRNA in the exosome; and 3, detecting the expression level of the miR-CCA in serum exosome by RT-PCR (reverse transcription-polymerase chain reaction). The method can fast, conveniently and accurately detect the expression level of the miR-CCA in serum exosome, and helps to diagnosis and differential diagnosis of human cholangiocarcinoma.

Rural area sewage treatment device

The invention discloses a rural area sewage treatment device and aims to provide the rural area sewage treatment device. The rural area sewage treatment device comprises a bucket body, wherein a vertically arranged filter plate is arranged in the bucket body, the bucket body is divided into a sewage zone and a purified water zone; a water inlet communicated with the sewage zone and a water outlet communicated with the purified water zone are separately formed in the side wall of the bucket body.

Washer for automobile head light

The washer for automobile head light consists of a nozzle assembly, a piston, a spring, a base, a water inlet, and a cylinder mainly. The base with ring groove and the cylinder with inlet and outlet constitute one flow channel, the piston with guide hole to the inner cavity is provided with sealing ring and end cap to the tail, the nozzle assembly consists of a spray head, a guide cone and a nozzle and is communicated with the piston cavity, and all the said parts constitute one passage for the cleaning liquid. The present invention has excellent cleaning effect, simple structure, low cost and other advantages.

Structure for connecting carbon fiber composite shaft and metal shaft

The invention discloses a structure for connecting a carbon fiber composite shaft and a metal shaft. The structure is structurally characterized by consisting of polygonal metal ends (1) and a carbon fiber composite shaft (2), wherein two ends of the carbon fiber composite shaft are respectively formed in the shape of a polygon consistent with the end shape of the polygonal metal end in a way of twining and the like; two ends of the carbon fiber composite shaft are respectively connected with the end parts of the polygonal metal ends in a bonding way; alternately, the structure consists of the polygonal metal ends (1), a metal internal layer (3) and a carbon fiber pipe (4); the end parts of the polygonal metal ends are respectively connected with polygonal holes in the interior of the metal internal layer in a sheathing way; the carbon fiber pipe is twined on the external surface of the metal internal layer, and fixed in a resin connection way. According to the structure, the defect of ...

Integrated three-squared septic tank

The invention discloses an integrated three-squared septic tank, and aims to provide an integrated three-squared septic tank which is convenient to transport and capable of preventing excessive methane pressure. The integrated three-squared septic tank is characterized by comprising three cavities, namely a first cavity, a second cavity and a third cavity, defined by a tank cover, tank walls and partitions; the tank cover covers the three-squared septic tank; a dirt inlet opening is formed in the first cavity; a water drainage outlet is formed in the third cavity; a dirt inlet pipe and a water drainage pipe are correspondingly communicated with the dirt inlet opening and the water drainage outlet; through holes are formed in the partitions between the first cavity and the second cavity as well as between the second cavity and the third cavity, used for communicating the adjacent two cavities, and communicated with guide pipes; the three cavities defined by the tank walls and the partitions ...

Integrated magnetic suspension rotor dynamic displacement measuring device

Tilting cart

The invention provides a tilting cart which comprises a cart frame and a cart hopper arranged on the cart frame. The two ends of the cart hopper are hinged to the cart frame through rotating shafts. The cart frame is provided with an idler wheel group and at least one fixed pulley. The idler wheel group comprises a support fixed on the cart frame, a center shaft supported on the support and an idler wheel. The idler wheel is arranged on the center shaft in a penetrating mode and is in transmission connection with the center shaft. A rope is arranged on the idler wheel in a winding mode. One end of the rope is fixed on the idler wheel. The other end of the rope is wound through the fixed pulley and is hung at the position, far away from the rotating shafts, of the cart hopper. The idler wheel or the center shaft is driven to rotate in the forward direction through a power end, so that the rope is wound on the idler wheel, the rope is tightened, so that the cart hopper and the rope hanging ...

Rural sewage treatment plant

The utility model discloses a rural sewage treatment plant aims at providing a rural sewage treatment plant, and its technical scheme main points are including the staving, be equipped with the filter that vertical direction set up in the staving, the staving is separated into sewage district and water purification district by the filter, the staving lateral wall is seted up respectively and is distinguished the water inlet of intercommunication and distinguish the delivery port that communicates with the water purification with sewage.

Two-pass print method for tensible material

A method for printing on extensible material by twice features that when the second printing is performed, the advance speed of the said extensible material is corrected to prevent the dislocation deviation between two printing stamps, which is caused by the extensible material, resulting in correct chromatography.

Anti-squeezing drainage tube and method for manufacturing same

The invention discloses an anti-squeezing drainage tube and a method for machining the same. The anti-squeezing drainage tube comprises a drainage tube body. Spiral reinforcing ribs are arranged on the inner wall of the drainage tube body, and a plurality of side holes are formed in the front end of the drainage tube body, are formed in spiral gaps of the spiral reinforcing ribs and are arrayed around the drainage tube body to form spiral shapes. The method for machining the anti-squeezing drainage tube includes penetrating a rod into the spiral reinforcing ribs; fixing the front ends of the spiral reinforcing ribs to the front end of the rod; fixing the rear ends of the spiral reinforcing ribs; driving the rod to rotate; penetrating the rod wound with the spiral reinforcing ribs into the drainage tube body; releasing the front ends and the rear ends of the spiral reinforcing ribs; withdrawing the rod. The drainage tube body and the spiral reinforcing ribs also can be of integrated structures ...

Magnetic bearing electromagnetic force sensing device based on optical fiber grating and on-line measurement system

The invention relates to an optical fiber grating magnetic force bearing electromagnetic force sensing device and an online measuring system, belonging to the optical fiber grating magnetic force sensing technical field, wherein the device comprises an L-shaped magnetic elastic unit 1 and an optical fiber grating 2 enclosed in the elastic unit groove, a magnetic force bearing stator 4, a magneticforce bearing rotor 5. The convex part of the L-shaped magnetic elastic unit is spliced in the groove at the bottom of the magnetic force bearing stator 4, and the other part is suspended in the air gap to form the cantilever structure. When in measurement, the wideband light source transmits the light with certain bandwidth and the conversion part into the optical fiber grating magnetic force sensing device through the light transmission, wherein the optical fiber grating 2 in the device generates the wavelength excursion due to the strain, according to the wavelength selection of the optical fiber ...

Sewer line that durability is good

The utility model provides a sewer line that durability is good, the intermediate junction of pipeline body has one section scrubbing pipe, the scrubbing pipe sets up in the protection casing, the protection casing is provided with shield cavity, shield cavity's lateral wall is the shut, shield cavity's lower extreme is linked together through the throttle pipeline with the pipeline body of scrubbing pipe delivery port end, be provided with the carrier on the inside wall of shield cavity lower extreme, it supports to be provided with the pipeline on the inside wall at shield cavity middle part, one side of protection casing is provided with placing chamber, placing chamber is provided with the track that supplies the carrier to pass through with the junction of protection casing, arrangedin the placing chamber and acted as go -between, be provided with thin filter screen on the scrubbing pipeline, be provided with the escape orifice on the pipeline wall of the below of thin filter screen ...

Artificial paddy wetland system and method for controlling the non-point source pollution of paddy field

The invention belongs to the technical field of non-point source pollution control, and discloses a method for controlling the non-point source pollution of paddy field, artificial paddy wetland system, and a paddy field wetland system for improving the P and N utilization rate of paddy field. The system structure uses the paddy field as the upper stream, and a paddy field wetland is constructed in the drainage downstream of the paddy field along the river. The surface of the paddy field wetland soil is 25-32cm lower than surface of the paddy field soil, and the area of the paddy field wetland is 3%-5% of the paddy field; the paddy filed wetland and paddy field are separated by the isolation ridge; paddy field ridges are around the paddy field, and paddy field wetland ridges are around the paddy field wetland; an irrigation ditch is arranged along one side of the paddy field and the paddy field wetland, and a drainage ditch is arranged on the other side. The method uses the paddy field ...