Connector piece for a fuel pump

In the case of a fuel pump, a plug for fixing electric contacts is manufactured from a material which is capable of swelling with fuel, and is inserted into a receptacle of a connecting piece by being fitted therein. Furthermore, the plug and the connecting piece have latching means for simplifying the pre-assembly. The connecting piece requires a particularly low number of components and can be manufactured cost-effectively.

Promoters for gene expression in caryopses of plants

The present invention provides promoters which bring about a caryopsis-specific expression of coding nucleotide sequences controlled by them, and to expression cassettes, recombinant vectors and host cells containing such promoters. Transformed transgenic plant cells and plants and methods for generating them, are also described.

Fuel pump and fuel delivery unit

A fuel pump includes: an electric motor; a pump stage drivable by the electric motor; and a fuel pump housing configured to accommodate the electric motor and the pump stage. The fuel pump housing has a first housing part configured to accommodate the electric motor and a second housing part configured to accommodate the pump stage. One or both of the first housing part and the second housing part are made of a conductive plastic adapted to dissipate static charges to a ground potential.

Systems and methods for data processing

Methods and systems are disclosed for managing bundle pricing of services. In one implementation, a system comprises a database for storing master contracts and billing customizing tables. The master contracts refer to the data of the billing customizing tables by means of result and condition attributes. This has the advantage that a modification of the billing customizing data, such as for the purpose of changing the bundle pricing scheme for the master contracts, does not require storage of the updated data in the database.

Method of producing optoelectronic semiconductor components, and optoelectronic semiconductor component

A method of producing optoelectronic semiconductor components includes providing a carrier with a carrier underside and a carrier top. The carrier has a metallic core material and at least on the carrier top a metal layer. A dielectric mirror is applied to the core material. At least two holes are formed through the carrier. A ceramic layer with a thickness of at most 150 μm at least on the carrier underside and in the holes is produced. The ceramic layer includes the core material as a component. Metallic contact layers are applied to at least subregions of the ceramic layer on the carrier underside and in the holes so that the carrier top electrically connects to the carrier underside through the holes. At least one radiation-emitting semiconductor chip is applied to the carrier top and the semiconductor chip is electronically bonded to the contact layers.

Method for producing an electronic component and electronic component

A method for producing an electronic component may include: applying an electrode growth layer on or above a layer structure by means of an atomic layer deposition method; and applying an electrode on the electrode growth layer, wherein the electrode growth layer is applied with a layer thickness in a range of approximately 1.5 nm to approximately 28 nm. 1. A method for producing an electronic component , wherein the method comprises:applying an electrode growth layer on or above a layer structure by means of an atomic layer deposition method; and 'wherein the electrode growth layer is applied with a layer thickness in a range of approximately 1.5 nm to approximately 28 nm.', 'applying an electrode on the electrode growth layer;'}2. The method as claimed in claim 1 ,wherein the electrode growth layer is applied with a layer thickness in a range of 15 nm to 10 nm.3. The method as claimed in claim 1 ,wherein applying an electrode growth layer comprises applying a plurality of partial layers forming the electrode growth layer.4. The method as claimed in claim 1 ,wherein the electrode is formed by applying a metal layer having a layer thickness of less than or equal to 30 nm.5. The method as claimed in claim 4 ,wherein the metal layer comprises at least one metal selected from the group consisting of aluminum, barium, indium, silver, copper, gold, platinum, palladium, samarium, magnesium, calcium and lithium and combinations thereof or consists of said metal or a compound composed of said metal or composed of a plurality of said metals, in particular an alloy.6. The method as claimed in claim 1 ,wherein the electronic component is formed as an organic electronic component; andwherein furthermore an additional electrode and at least one organic functional layer arranged between the electrode and the additional electrode are formed.7. The method as claimed in claim 6 ,wherein the layer structure has a substrate; and forming the additional electrode on a substrate;', ' ...

Air deflection device in the underbody region of a motor vehicle and motor vehicle comprising such an air deflection device

An air deflection device of a motor vehicle includes an air deflection element and a displacement kinematic system. The air deflection element is displaceable by the displacement kinematic system from an extended deflection position, in which the air deflection element with a deflection surface in a front region of the air deflection element in a longitudinal direction of the motor vehicle diverts an airflow hitting the air deflection element in an underbody region in a forward direction of travel of the motor vehicle, into a retracted position. The air deflection element is displaceable by the displacement kinematic system rearwards in the longitudinal direction of the motor vehicle and upwards in a vertical direction of the motor vehicle and is pushable back in a direction of the retracted position in an event of an obstacle-related force component acting on the air deflection element in the longitudinal direction of the motor vehicle.

Device and connection carrier

A device and a connection carrier are disclosed. In an embodiment a device includes a connection carrier, a frame and an encapsulation body, wherein the connection carrier, the encapsulation body and/or the frame have different thermal expansion coefficients, a semiconductor chip mechanically and electronically connected to the connection carrier and a metal layer arranged between the connection carrier and the frame, wherein the encapsulation body surrounds the semiconductor chip and is adjacent to the connection carrier and the frame, wherein the metal layer is not in electrically conductive connection, and wherein the metal layer projects beyond the frame in a lateral direction.

Electronic component and electrical contact

An electronic component (100), which comprises a substrate (1), at least one first electrode (3) arranged on the substrate (3) and a growth layer (7) on the side of the electrode (3) remote from the substrate (7), wherein the electrode (7) arranged on the growth layer (3) comprises a metal layer (9) with a thickness of less than or equal to 30 nm and the growth layer (7) has a thickness which is less than or equal to 10 nm. An electrical contact is also disclosed.

Measuring arrangement having an optical transmitter and an optical receiver

A measuring arrangement having an optical transmitter and an optical receiver are disclosed. In an embodiment a measuring arrangement includes an optical transmitter configured to transmit electromagnetic measuring radiation into a transmission space, an optical receiver configured to receive measuring radiation reflected by an object in a reception space and a covering configured to reduce reception of an interference radiation by the receiver, wherein the interference radiation is measuring radiation not reflected by the object.

Heat exchanger provided with fixing elements, in particular in a vehicle

The invention relates to a heat exchanger (1) comprising fixing elements which are provided with points of fracture, in particular in a vehicle. The aim of said invention is to provide said heat exchanger with restorable points of fracture and to make it possible to easily reassemble them after the separation thereof. For this purpose, the inventive heat exchanger (1) is characterised in that at least one fixing element is provided with a first and second area (6, 7; 12, 14) and with a quick release coupling therebetween; two areas (6, 12) form an inseparable component of the heat exchanger (1); the two areas (6, 7; 12, 14) are fixable to each other by a positive connection when the quick release coupling is closed; the coupling systems of one of the areas (6, 7; 12, 14) are provided with at least one point of fracture and in that the coupling systems provided with at least one point of fracture are arranged on the area (7, 14) which a detachable from said heat exchanger.

Piston pin with slide layer for connecting rod eye for internal combustion engines

Piston pin for a connecting rod in a reciprocating internal combustion engine, wherein the piston pin carries at least in the area of the running surface a thermal sprayed slide layer of a metallic bearing material or slide bearing material, as well as reciprocating internal combustion engine with a connecting rod with small and with large connecting rod eye, wherein at least the running surface of one of the piston pins is formed of a thermal sprayed slide layer of a metallic bearing material, which exhibits a lower hardness than the running surface of the corresponding connecting rod eye and process for manufacturing a described piston pin with the steps of a extrusion molding or machining a piston pin preform, introduction of a recess in the area which will later become the running surface, roughening the outer surface in the area of the recess, application of a coating of a bearing material by a thermal spray process.

Systems and methods for data processing

Methods and systems are disclosed for managing bundle pricing of services. In one implementation, a system comprises a database for storing master contracts and billing customizing tables. The master contracts refer to the data of the billing customizing tables by means of result and condition attributes. This has the advantage that a modification of the billing customizing data, such as for the purpose of changing the bundle pricing scheme for the master contracts, does not require storage of the updated data in the database.

Radiation-Emitting Arrangement

A radiation-emitting arrangement comprises, in particular, a carrier element (1) having an at least partly non-transparent main surface (10) and arranged on the carrier element (1), an organic radiation-emitting component (2) having an organic layer sequence (23) with an active region between an at least partly transparent first electrode (21) and an at least partly transparent second electrode (22). The active region (29) is suitable for generating electromagnetic radiation (91, 93) in a switched-on operating state. The radiation-emitting arrangement has a radiation exit area (3) for emitting the electromagnetic radiation (92, 93) on that side of the organic radiation-emitting component (2) which faces away from the carrier element. (1) The at least partly non-transparent main surface (10) of the carrier element (1) is perceptible by an external observer through the radiation exit area (3) in a switched-off operating state of the organic radiation-emitting component (2).

METHOD OF PRODUCING OPTOELECTRONIC SEMICONDUCTOR COMPONENTS, AND OPTOELECTRONIC SEMICONDUCTOR COMPONENT

A method of producing optoelectronic semiconductor components includes providing a carrier with a carrier underside and a carrier top, wherein the carrier has a metallic core material and at least on the carrier top a metal layer and following this a dielectric mirror are applied to the core material, forming at least two holes through the carrier, producing a ceramic layer with a thickness of at most 150 μm at least on the carrier underside and in the holes, wherein the ceramic layer includes the core material as a component, applying metallic contact layers to at least subregions of the ceramic layer on the carrier underside and in the holes so that the carrier top electrically connects to the carrier underside through the holes, and applying at least one radiation-emitting semiconductor chip to the carrier top and electrical bonding of the semiconductor chip to the contact layers. 115-. (canceled)16. A method of producing optoelectronic semiconductor components comprising:A) providing a carrier with a carrier underside and a carrier top, wherein the carrier has a metallic core material and at least on the carrier top a metal layer and following this a dielectric mirror are applied to the core material,B) forming at least two holes through the carrier,C) producing a ceramic layer with a thickness of at most 150 μm at least on the carrier underside and in the holes, wherein the ceramic layer comprises the core material as a component,D) applying metallic contact layers to at least subregions of the ceramic layer on the carrier underside and in the holes so that the carrier top electrically connects to the carrier underside through the holes, andE) applying at least one radiation-emitting semiconductor chip to the carrier top and electrical bonding of the semiconductor chip to the contact layers.17. The method according to claim 16 , wherein the core material is aluminum or an aluminum alloy and the ceramic layer is produced electrochemically in step D) with a ...

Thin-layer encapsulation for an optoelectronic component, method for the production thereof, and optoelectronic component

A thin-layer encapsulation (1) for an optoelectronic component. The thin-layer encapsulation (1) comprises a sequence of layers (2) that comprises the following layers: a first ALD layer (3) deposited by means of atomic layer deposition, and a second ALD layer (4) deposited by means of atomic layer deposition. A method is disclosed for producing the thin-layer encapsulation and an optoelectronic component is disclosed having such a thin-layer encapsulation.

Sensor

A sensor includes a printed circuit board; at least one semiconductor chip arranged on the printed circuit board and includes a front-side contact, wherein the semiconductor chip is a radiation-detecting semiconductor chip; an embedding layer arranged on the printed circuit board and laterally adjoining the at least one semiconductor chip; and a contact layer connected to the front-side contact of the at least one semiconductor chip.

Generic iViews

Displaying content from one or more databases includes defining a query by receiving inputs to fields, using the query to retrieve the content from the one or more databases, and integrating the content for display in one of plural generic templates. Integrating the content includes copying one of the plural generic templates and incorporating the content from the one or more databases into a copied generic template.

Optoelectronic component and method for producing an optoelectronic component

An optoelectronic component may include: at least one layer of the optoelectronic component; at least one adhesive on the layer of the optoelectronic component; and a cover on the at least one adhesive; wherein the at least one adhesive is cured only in a partial region above at least one of a substrate and the layer.

PRODUCTION OF SENSORS

A method of producing sensors includes providing a carrier plate; arranging semiconductor chips on the carrier plate, wherein the semiconductor chips include at least radiation-detecting semiconductor chips; providing radiation-transmissive optical elements on the carrier plate provided with the semiconductor chips, wherein a plurality of radiation-transmissive optical elements are provided jointly on the carrier plate provided with the semiconductor chips; and singulating the carrier plate provided with the semiconductor chips and the radiation-transmissive optical elements, thereby forming separate sensors including a section of the carrier plate, at least one radiation-detecting semiconductor chip and at least one radiation-transmissive optical element. 118-. (canceled)19. A method of producing sensors comprising:providing a carrier plate;arranging semiconductor chips on the carrier plate, wherein the semiconductor chips comprise at least radiation-detecting semiconductor chips;providing radiation-transmissive optical elements on the carrier plate provided with the semiconductor chips, wherein a plurality of radiation-transmissive optical elements are provided jointly on the carrier plate provided with the semiconductor chips; andsingulating the carrier plate provided with the semiconductor chips and the radiation-transmissive optical elements, thereby forming separate sensors comprising a section of the carrier plate, at least one radiation-detecting semiconductor chip and at least one radiation-transmissive optical element.20. The method according to claim 19 , wherein the semiconductor chips arranged on the carrier plate comprise radiation-emitting semiconductor chips claim 19 , and the sensors formed by the singulating comprise at least one radiation-emitting semiconductor chip.21. The method according to claim 19 , wherein an embedding layer is formed on the carrier plate that laterally adjoins the semiconductor chips.22. The method according to claim 21 , ...

Monocotyledon plant cells and plants which synthesise modified starch

The present invention relates to monocotyledon plant cells and plants which are genetically modified, wherein the genetic modification consists of the introduction of an extraneous nucleic acid molecule which codes for a protein with the biological activity of an R1 protein. The present invention further relates to means and methods for the production thereof. Plant cells and plants of this type synthesise a modified starch, which is characterised in that it has an increased phosphate content and/or a modified phoshorylation pattern and/or an increased final viscosity in an RVA profile and/or a reduced peak temperature in DSC analysis and/or an increased gel strength in the texture analysis compared with starch from corresponding non-genetically modified monocotyledon plants. Therefore, the present invention also relates to the starch which is synthesised from the plant cells and plants according to the invention, and to methods of producing said starch. The present invention further relates ...

Measuring Arrangement Having an Optical Transmitter and an Optical Receiver

A measuring arrangement having an optical transmitter and an optical receiver are disclosed. In an embodiment a measuring arrangement includes an optical transmitter configured to transmit electromagnetic measuring radiation into a transmission space, an optical receiver configured to receive measuring radiation reflected by an object in a reception space and a covering configured to reduce reception of an interference radiation by the receiver, wherein the interference radiation is measuring radiation not reflected by the object. 120-. (canceled)21. A measuring arrangement comprising:an optical transmitter configured to transmit electromagnetic measuring radiation into a transmission space;an optical receiver configured to receive measuring radiation reflected by an object in a reception space; anda covering configured to reduce reception of an interference radiation by the receiver,wherein the interference radiation is measuring radiation not reflected by the object.22. The arrangement according to claim 21 , wherein the covering is at least partly arranged in the transmission and reception spaces claim 21 , wherein the covering comprises a passage area claim 21 , wherein the passage area is transparent for the measuring radiation and transparent for reflected measuring radiation claim 21 , wherein the passage area at least partially limits the transmission and reception spaces claim 21 , and wherein the passage area is embodied as a continuous surface.23. The arrangement according to claim 21 , wherein the transmitter is arranged in the reception space claim 21 , wherein the reception space abuts on the receiver at a reception surface claim 21 , wherein the transmitter covers a partial surface of the reception surface against reception of reflected measuring radiation claim 21 , wherein the reception surface comprises an inactive surface area claim 21 , wherein the inactive surface area at least partly comprises a ring shape around a shadowed partial surface ...

Production of sensors

A method of producing sensors includes providing a carrier plate; arranging semiconductor chips on the carrier plate, wherein the semiconductor chips include at least radiation-detecting semiconductor chips; providing radiation-transmissive optical elements on the carrier plate provided with the semiconductor chips, wherein a plurality of radiation-transmissive optical elements are provided jointly on the carrier plate provided with the semiconductor chips; and singulating the carrier plate provided with the semiconductor chips and the radiation-transmissive optical elements, thereby forming separate sensors including a section of the carrier plate, at least one radiation-detecting semiconductor chip and at least one radiation-transmissive optical element.

Connector piece for a fuel pump

In the case of a fuel pump, a plug for fixing electric contacts is manufactured from a material which is capable of swelling with fuel, and is inserted into a receptacle of a connecting piece by being fitted therein. Furthermore, the plug and the connecting piece have latching means for simplifying the pre-assembly. The connecting piece requires a particularly low number of components and can be manufactured cost-effectively.

Modified low molecular weight glutenin gene in plants

The present invention relates to transgenic plants, such as wheat or maize, comprising plant cells having SEQ.ID.NO 1 and seeds derived from those plants. It also relates to the use of said seed for the preparation of a flour which in turn is used for the preparation of food and/or feed such as dough, batters, pastries, cookies, pasta, wafers, bread and/or confectionery. The thus obtained gliadin-free foodstuff is beneficial for feeding patients suffering from coeliac disease and/or other forms of gluten intolerance.

Fuel pump having a motor housing and pump housing against one another

A fuel pump, in which a connecting piece for a fuel line and electrical connecting lines are radially guided in a motor housing, includes an electric motor. The motor housing has a section made of plastic such that the fuel pump has reduced axial dimensions.

Method for producing a housing element of a supply pump provided with a channel housing element for a supply pump and a tool mould for producing a housing element comprising a channel

A method for manufacturing a fuel feed pump casing part in which two mould parts are brought together to form a flow channel and in which a punch is used to remove a burr that is created in the flow channel by the mould parts when forming the channel.

Sensor nodes and self-organising sensor network formed therefrom

In a self-organizing sensor network, a number of sensor nodes organize themselves and include sensor elements, distance measuring elements and communication elements for that purpose. The sensor network is able to precisely locate individual, in particular mobile, sensor nodes.

Connector

The invention relates to a connector (3) for connecting a flow pipe leading to an internal combustion engine of a motor vehicle to a feed pump. Said connector comprises an elbowed connecting sleeve (7) which can be rotationally fixed in various angular positions in a receiver (6). Said connecting sleeve (7) is positively fixed in the receiver (6) by a catch means (9). In this way, the forces acting on the flow pipe are kept at a distance from a seal pertaining to the connecting sleeve (7).

Systems and methods for data processing

Systems and methods are provided for data processing. In one implementation, a data processing system includes storage means for storing sets of account identifiers, each of the sets of account identifiers being assigned a set of control parameters. The data processing system may also include an account management system that stores account data of accounts that are identified by the account identifiers, interface means coupled to the account management system, and one or more sets of application programs that are adapted to process account data of accounts identified by at least one of the one or more sets of account identifiers using the set of control parameters assigned to the at least one of the one or more sets of account identifiers. The interface means may obtain the account data from the account management system on request of one of the application programs.

Connector

The invention relates to a connector ( 3 ) for connecting a flow pipe leading to an internal combustion engine of a motor vehicle to a feed pump. Said connector comprises an elbowed connecting sleeve ( 7 ) which can be rotationally fixed in various angular positions in a receiver ( 6 ). Said connecting sleeve ( 7 ) is positively fixed in the receiver ( 6 ) by a catch means ( 9 ). In this way, the forces acting on the flow pipe are kept at a distance from a seal pertaining to the connecting sleeve ( 7 ).

SUBSTRATE AND SEMICONDUCTOR LASER

In one embodiment, the substrate is configured for a semiconductor laser diode and comprises a plurality of substrate layers. The substrate layers include insulating layers and carrier layers, which are thicker. A plurality of electrical contact surfaces, which are configured for the semiconductor laser diode, a laser capacitor and a control chip, are located on an assembling side of a first, uppermost substrate layer, which is an insulating layer. Electrical conductor tracks, which electrically interconnect the contact surfaces, are located on the one hand between the first insulating layer and a second insulating layer, and on the other hand between the second insulating layer and a third substrate layer, which is preferably an insulating layer.

Promoters for gene expression in caryopses of plants

The present invention relates to promoters which permit a caryopsis-specific expression or suppression of genes in genetically modified plants, to methods for the tissue-specific gene expression or gene suppression in plants, expression cassettes, recombinant vectors and host cells containing such promoters, to transgenic plant cells and plants transformed with said promoters, and to methods for generating such plant cells and plants.

Consistent set of interfaces derived from a business object model

A business object model, which reflects data that used during a given business transaction, is utilized to generate interfaces This business object model facilitates commercial transactions by providing consistent interfaces that are suitable for use across industries, across businesses, and across different departments within a business during a business transaction.

Monocotyledon plant cells and plants which synthesise modified starch

The present invention relates to monocotyledon plant cells and plants which are genetically modified, wherein the genetic modification consists of the introduction of an extraneous nucleic acid molecule which codes for a protein with the biological activity of an R1 protein. The present invention further relates to means and methods for the production thereof. Plant cells and plants of this type synthesise a modified starch, which is characterised in that it has an increased phosphate content and/or a modified phoshorylation pattern and/or an increased final viscosity in an RVA profile and/or a reduced peak temperature in DSC analysis and/or an increased gel strength in the texture analysis compared with starch from corresponding non-genetically modified monocotyledon plants. Therefore, the present invention also relates to the starch which is synthesised from the plant cells and plants according to the invention, and to methods of producing said starch. The present invention further relates to wheat flours which contain said modified starches, and to food products and bakery products which contain said wheat flours and/or starch.

Consistent set of interfaces derived from a business object model

A business object model, which reflects data that used during a given business transaction, is utilized to generate interfaces This business object model facilitates commercial transactions by providing consistent interfaces that are suitable for use across industries, across businesses, and across different departments within a business during a business transaction.

Radiation-emitting arrangement

A radiation-emitting arrangement comprises, in particular, a carrier element ( 1 ) having an at least partly non-transparent main surface ( 10 ) and arranged on the carrier element ( 1 ), an organic radiation-emitting component ( 2 ) having an organic layer sequence ( 23 ) with an active region between an at least partly transparent first electrode ( 21 ) and an at least partly transparent second electrode ( 22 ). The active region ( 29 ) is suitable for generating electromagnetic radiation ( 91, 93 ) in a switched-on operating state. The radiation-emitting arrangement has a radiation exit area ( 3 ) for emitting the electromagnetic radiation ( 92, 93 ) on that side of the organic radiation-emitting component ( 2 ) which faces away from the carrier element. ( 1 ) The at least partly non-transparent main surface ( 10 ) of the carrier element ( 1 ) is perceptible by an external observer through the radiation exit area ( 3 ) in a switched-off operating state of the organic radiation-emitting component ( 2 ).

LIST ALIGNMENT META STRUCTURE AND TOOL

In an example embodiment, a persistence model is utilized that allows the storage of value lists in a referenceable and reusable manner. This allows for two lifecycle options for value lists: (i) schema-dependent and (ii) schema-independent. Thus, the lifecycle of all involved entities (e.g., schemas, values, correspondences, etc.) is managed. This enables easier upgrades, downgrades, and sidegrades. The persistence is a directed graph, which comprises nodes and directed edges. This persistence can then be used to recommend additional correspondences to a user.

Method for operating a diesel engine

The invention relates to a method for operating a diesel engine in which an air ratio (λ) of the fuel which is to be burnt and of the combustion air supplied is set by a control unit (14) according to predetermined values. When a value (15) which is predetermined as a switching criterion is recorded, the control unit (14) switches to a special operating mode for regeneration of a catalytic converter (22) and sets the fuel/air ratio according to predetermined values for this operating mode. To achieve more effective regeneration of the catalytic converter, according to the invention it is provided that at least one afterinjection, which is separated in time from a main injection, of fuel which is also to be burnt takes place in the special operating mode.

Thin-Layer Encapsulation for an Optoelectronic Component, Method for the Production Thereof, and Optoelectronic Component

A thin-layer encapsulation (1) for an optoelectronic component. The thin-layer encapsulation (1) comprises a sequence of layers (2) that comprises the following layers: a first ALD layer (3) deposited by means of atomic layer deposition, and a second ALD layer (4) deposited by means of atomic layer deposition. A method is disclosed for producing the thin-layer encapsulation and an optoelectronic component is disclosed having such a thin-layer encapsulation.

Fuel delivery assembly and fuel delivery unit

A fuel delivery assembly has a sheet-metal casing that sealingly encloses an electric motor and a pump by rolling, a suction-side inlet opening, and a pressure-side outlet opening. The electric motor has a first stator and a rotor, the first stator is provided with a plastic extrusion coating which forms a ring running in encircling fashion between the first stator and the pump. A fuel delivery unit for use in a fuel tank of a vehicle, having a fuel delivery assembly and having a surge tank in which the fuel delivery assembly is arranged in order to deliver fuel from the surge tank to an internal combustion engine.

SENSOR

A sensor includes a printed circuit board; at least one semiconductor chip arranged on the printed circuit board and includes a front-side contact, wherein the semiconductor chip is a radiation-detecting semiconductor chip; an embedding layer arranged on the printed circuit board and laterally adjoining the at least one semiconductor chip; and a contact layer connected to the front-side contact of the at least one semiconductor chip. 120-. (canceled)21. A sensor , comprising:a printed circuit board;at least one semiconductor chip arranged on the printed circuit board and comprising a front-side contact, wherein the semiconductor chip is a radiation-detecting semiconductor chip;an embedding layer arranged on the printed circuit board and laterally adjoining the at least one semiconductor chip; anda contact layer connected to the front-side contact of the at least one semiconductor chip.22. The sensor according to claim 21 , wherein the embedding layer comprises a cutout via which a contact surface of the printed circuit board is at least partly uncovered claim 21 , and the contact layer connects to the contact surface of the printed circuit board.23. The sensor according to claim 21 , further comprising an electrical connection element arranged on a contact surface of the printed circuit board claim 21 , wherein the embedding layer laterally adjoins the electrical connection element claim 21 , and the contact layer connects to the electrical connection element.24. The sensor according to claim 21 , further comprising at least one of the following:a further semiconductor chip arranged on the printed circuit board and comprising a front-side contact, wherein the embedding layer laterally adjoins the further semiconductor chip, and a further contact layer connects to the front-side contact of the further semiconductor chip; ora further semiconductor chip arranged on the printed circuit board, the further semiconductor chip being a radiation-emitting semiconductor chip ...

Organic Light-Emitting Diode, Contact Arrangement and Method for Producing an Organic Light-Emitting Diode

An organic light-emitting diode (1), comprising a layer stack (2) for emitting electromagnetic radiation (6). An electrically conductive first connection layer (4) is arranged on a first surface of the layer stack (2) and an electrically conductive second connection layer (5) at least predominantly transparent to a characteristic wavelength of the emittable electromagnetic radiation (6) is arranged on a second surface of the layer stack (2). The organic light-emitting diode is characterised by a conductive contact structure (7) arranged on the opposite side of the first connection layer (4) from the layer stack, which contact structure is connected electrically to the second connection layer (5) in the region of a plurality of openings (12) in the first connection layer (4). Also disclosed is a contact arrangement (15) for a two-dimensional, optically active element and to a method of producing organic light-emitting diodes (1).

Promoters for gene expression in caryopses of plants

The present invention relates to promoters which permit a caryopsis-specific expression or suppression of genes in genetically modified plants, to methods for the tissue-specific gene expression or gene suppression in plants, expression cassettes, recombinant vectors and host cells containing such promoters, to transgenic plant cells and plants transformed with said promoters, and to methods for generating such plant cells and plants.

Ejector pump

An ejector pump for a delivery unit provided in a fuel tank of a motor vehicle has a nozzle produced integrally with a mixing tube. The mixing tube is shaped in the form of a tubular cylinder, so that virtually the entire ejector pump may be produced from plastic in a mold allowing axial demolding. The nozzle is therefore aligned,exactly with respect to the mixing tube. The ejector pump consequently has a particularly high efficiency.

Device and Connection Carrier

A device and a connection carrier are disclosed. In an embodiment a device includes a connection carrier, a frame and an encapsulation body, wherein the connection carrier, the encapsulation body and/or the frame have different thermal expansion coefficients, a semiconductor chip mechanically and electronically connected to the connection carrier and a metal layer arranged between the connection carrier and the frame, wherein the encapsulation body surrounds the semiconductor chip and is adjacent to the connection carrier and the frame, wherein the metal layer is not in electrically conductive connection, and wherein the metal layer projects beyond the frame in a lateral direction.

Fender configuration for a vehicle, especially for a motor vehicle

A bumper for a vehicle contains a bumper cross beam extending in a transversal direction of the vehicle, a bumper cover forming the external face of the bumper, and an energy-absorbing insert disposed at least in parallel between the mounted bumper cross beam and the bumper cover. The insert has a plurality of deformation cavities and/or deformation free spaces. The insert has a first boundary layer, a medial layer, and a second boundary layer. The medial layer has a different energy absorptive capacity than the two boundary layers and is associated with the bumper cross beam. The deformation cavities and/or deformation free spaces are embodied in the medial layer such that in case of a collision, the insert is plastically deformable at least partially in the transversal and/or longitudinal direction of the vehicle along a small part of a block length to absorb energy.

Electronic Component and Electrical Contact

An electronic component (100), which comprises a substrate (1), at least one first electrode (3) arranged on the substrate (3) and a growth layer (7) on the side of the electrode (3) remote from the substrate (7), wherein the electrode (7) arranged on the growth layer (3) comprises a metal layer (9) with a thickness of less than or equal to 30 nm and the growth layer (7) has a thickness which is less than or equal to 10 nm. An electrical contact is also disclosed.

Systems and methods for data processing

Systems and methods are provided for data processing. In one implementation, a data processing system includes storage means for storing sets of account identifiers, each of the sets of account identifiers being assigned a set of control parameters. The data processing system may also include an account management system that stores account data of accounts that are identified by the account identifiers, interface means coupled to the account management system, and one or more sets of application programs that are adapted to process account data of accounts identified by at least one of the one or more sets of account identifiers using the set of control parameters assigned to the at least one of the one or more sets of account identifiers. The interface means may obtain the account data from the account management system on request of one of the application programs.

Fender configuration for a vehicle, especially for a motor vehicle

A bumper for a vehicle contains a bumper cross beam extending in a transversal direction of the vehicle, a bumper cover forming the external face of the bumper, and an energy-absorbing insert disposed at least in parallel between the mounted bumper cross beam and the bumper cover. The insert has a plurality of deformation cavities and/or deformation free spaces. The insert has a first boundary layer, a medial layer, and a second boundary layer. The medial layer has a different energy absorptive capacity than the two boundary layers and is associated with the bumper cross beam. The deformation cavities and/or deformation free spaces are embodied in the medial layer such that in case of a collision, the insert is plastically deformable at least partially in the transversal and/or longitudinal direction of the vehicle along a small part of a block length to absorb energy.

Promoters for gene expression in caryopses of plants

The present invention provides promoters which bring about a caryopsis-specific expression of coding nucleotide sequences controlled by them, and to expression cassettes, recombinant vectors and host cells containing such promoters. Transformed transgenic plant cells and plants and methods for generating them, are also described.

OPTOELECTRONIC COMPONENT AND METHOD FOR PRODUCING AN OPTOELECTRONIC COMPONENT

An optoelectronic component may include: at least one layer of the optoelectronic component; at least one adhesive on the layer of the optoelectronic component; and a cover on the at least one adhesive; wherein the at least one adhesive is cured only in a partial region above at least one of a substrate and the layer. 1. An optoelectronic component , comprising:at least one layer of the optoelectronic component;at least one adhesive on the layer of the optoelectronic component; anda cover on the at least one adhesive;wherein the at least one adhesive is cured only in a partial region above at least one of a substrate and the layer.2. The optoelectronic component as claimed in claim 1 ,wherein the partial region comprises the edge region of the at least one adhesive.3. The optoelectronic component as claimed in claim 2 ,wherein the edge region is at least one part of a circumferential structure of the at least one adhesive.4. The optoelectronic component as claimed in claim 1 ,wherein the partial region is arranged at least partly laterally outside an active region of the optoelectronic component.5. The optoelectronic component as claimed in claim 1 ,wherein the at least one adhesive comprises a plurality of adhesives of differing viscosity.6. The optoelectronic component as claimed in claim 1 ,wherein the partial region at least partly encloses a region in which a liquid non-adhesive material is provided.7. The optoelectronic component as claimed in claim 1 ,wherein particles are provided in the adhesive, said particles having a different refractive index than the adhesive.8. The optoelectronic component as claimed in claim 1 ,wherein the adhesive has a lower refractive index than the cover.9. The optoelectronic component as claimed in claim 1 ,wherein an optically refractive layer is provided on at least one surface of the cover.10. The optoelectronic component as claimed in claim 1 ,designed as a light emitting diode.11. The optoelectronic component as claimed in ...

Method for operating a diesel engine

The invention relates to a method for operating a diesel engine in which an air ratio (λ) of the fuel which is to be burnt and of the combustion air supplied is set by a control unit ( 14 ) according to predetermined values. When a value ( 15 ) which is predetermined as a switching criterion is recorded, the control unit ( 14 ) switches to a special operating mode for regeneration of a catalytic converter ( 22 ) and sets the fuel/air ratio according to predetermined values for this operating mode. To achieve more effective regeneration of the catalytic converter, according to the invention it is provided that at least one afterinjection, which is separated in time from a main injection, of fuel which is also to be burnt takes place in the special operating mode.

Air duct in the front part of a motor vehicle

The invention relates to an air control system in the front end of a motor vehicle with openings in a front wall defining the front end, through which cooling air flows into a motor compartment. Air ducts ( 6, 10, 11, 18 ) are provided which feed the cooling air into athe motor compartment, substantially against the direction of travel and which are formed by boundary walls ( 7, 19 ) running approximately parallel to the direction of the air flow. It is therefore the task of the invention that an air guidance is created in the front end of a motor vehicle while assuring a low-loss flow, in which the assembly is substantially simplified. According to the invention, the boundary walls ( 17, 19 ) are integrated into a body panel ( 1 ) which extends appromately across the direction of air flow in the motor compartment.

PISTON PIN WITH SLIDE LAYER FOR CONNECTING ROD EYE FOR INTERNAL COMBUSTION ENGINES

Piston pin for a connecting rod in a reciprocating internal combustion engine, wherein the piston pin carries at least in the area of the running surface a thermal sprayed slide layer of a metallic bearing material or slide bearing material, as well as reciprocating internal combustion engine with a connecting rod with small and with large connecting rod eye, wherein at least the running surface of one of the piston pins is formed of a thermal sprayed slide layer of a metallic bearing material, which exhibits a lower hardness than the running surface of the corresponding connecting rod eye and process for manufacturing a described piston pin with the steps of a extrusion molding or machining a piston pin preform, introduction of a recess in the area which will later become the running surface, roughening the outer surface in the area of the recess, application of a coating of a bearing material by a thermal spray process.

Encapsulation structure for an opto-electronic component

An encapsulation structure for an optoelectronic component, may include: a thin-film encapsulation for protecting the optoelectronic component against chemical impurities; an adhesive layer formed on the thin-film encapsulation; and a cover layer formed on the adhesive layer and serving for protecting the thin-film encapsulation and/or the optoelectronic component against mechanical damage, wherein the adhesive layer is formed such that particle impurities situated at the surface of the thin-film encapsulation are at least partly enclosed by the adhesive layer.

Monocotyledon plant cells and plants which synthesise modified starch

The present invention relates to monocotyledon plant cells and plants which are genetically modified, wherein the genetic modification consists of the introduction of an extraneous nucleic acid molecule which codes for a protein with the biological activity of an R1 protein. The present invention further relates to means and methods for the production thereof. Plant cells and plants of this type synthesise a modified starch, which is characterised in that it has an increased phosphate content and/or a modified phosphorylation pattern and/or an increased final viscosity in an RVA profile and/or a reduced peak temperature in DSC analysis and/or an increased gel strength in the texture analysis compared with starch from corresponding non-genetically modified monocotyledon plants. Therefore, the present invention also relates to the starch which is synthesised from the plant cells and plants according to the invention, and to methods of producing said starch. The present invention further relates ...

Monocotyledon plant cells and plants which synthesize modified starch

The present invention relates to monocotyledon plant cells and plants which are genetically modified, wherein the genetic modification consists of the introduction of an extraneous nucleic acid molecule which codes for a protein with the biological activity of an R1 protein. The present invention further relates to means and methods for the production thereof. Plant cells and plants of this type synthesise a modified starch, which is characterised in that it has an increased phosphate content and/or a modified phosphorylation pattern and/or an increased final viscosity in an RVA profile and/or a reduced peak temperature in DSC analysis and/or an increased gel strength in the texture analysis compared with starch from corresponding non-genetically modified monocotyledon plants. Therefore, the present invention also relates to the starch which is synthesised from the plant cells and plants according to the invention, and to methods of producing said starch. The present invention further relates ...

Delivery unit

The invention relates to a delivery unit for delivering fuel in a motor vehicle. The invention is characterized in that a plastic casing ( 11 ) of a rotor ( 10 ) of an electric motor ( 1 ) is configured as one piece with a bush ( 13 ). A housing part ( 5 ) of a delivery pump ( 2 ) comprises a bearing shell ( 14 ) for said bush ( 13 ). This permits the delivery unit to be produced and mounted in a particularly cost-effective manner.

Modified low molecular weight glutenin gene in plants

The present invention relates to transgenic plants, such as wheat or maize, comprising plant cells having SEQ. ID. NO. 1 and seeds derived from those plants. It also relates to the use of said seed for the preparation of a flour which in turn is used for the preparation of food and/or feed such as dough, batters, pastries, cookies, pasta, wafers, bread and/or confectionery. The thus obtained gliadin-free foodstuff is beneficial for feeding patients suffering from coeliac disease and/or other forms of gluten intolerance.

FUEL DELIVERY ASSEMBLY AND FUEL DELIVERY UNIT

A fuel delivery assembly has a sheet-metal casing that sealingly encloses an electric motor and a pump by rolling, a suction-side inlet opening, and a pressure-side outlet opening. The electric motor has a first stator and a rotor, the first stator is provided with a plastic extrusion coating which forms a ring running in encircling fashion between the first stator and the pump. A fuel delivery unit for use in a fuel tank of a vehicle, having a fuel delivery assembly and having a surge tank in which the fuel delivery assembly is arranged in order to deliver fuel from the surge tank to an internal combustion engine. 112.-. (canceled)13. A fuel delivery assembly comprising:an electric motor having a first stator and a rotor and the first stator;a pump;a sheet-metal casing that sealingly encloses the electric motor and the pump by rolling;a suction-side inlet opening;a pressure-side outlet opening; anda plastic extrusion coating which forms a ring running in encircling fashion between the first stator and the pump.14. The fuel delivery assembly as claimed in claim 13 , further comprising three support knobs acting in a pump longitudinal direction are attached to the encircling ring on the pump side.15. The fuel delivery assembly as claimed claim 13 , further comprising a second stator provided with a respective plastic extrusion coating claim 13 , which can be pushed into the first stator.16. The fuel delivery assembly as claimed in claim 15 , wherein the respective plastic extrusion coating of the second stator forms an inner lining of a bore that contributes to the centering of a pump housing in the second stator.17. The fuel delivery assembly as claimed in claim 15 , wherein the second stator has at least one stop which claim 15 , when the second stator is pushed into the first stator claim 15 , abuts against the first stator.18. The fuel delivery assembly as claimed in claim 17 , further comprising: angular securing elements that secure the first stator and/or the ...

ENCAPSULATION STRUCTURE FOR AN OPTO-ELECTRONIC COMPONENT, AND METHOD FOR ENCAPSULATING AN OPTOELECTRONIC COMPONENT

An encapsulation structure for an optoelectronic component, may include: a thin-film encapsulation for protecting the optoelectronic component against chemical impurities; an adhesive layer formed on the thin-film encapsulation; and a cover layer formed on the adhesive layer and serving for protecting the thin-film encapsulation and/or the optoelectronic component against mechanical damage, wherein the adhesive layer is formed such that particle impurities situated at the surface of the thin-film encapsulation are at least partly enclosed by the adhesive layer.

Cylinder, In Particular For A Tuned Mass Damper, Having A Sleeve-Shaped Add-On Piece

A cylinder ( 1 ), particularly for a vibration damper, includes a base ( 3 ) and a sleeve-shaped add-on part ( 5 ) which at least partially surrounds the cylinder ( 1 ) and which has at an end of the cylinder a radially inwardly directed edge profile. The edge profile ( 11 ) contacts an end face of the cylinder ( 1 ) in a noncontacting manner with respect to the base.

Piston And Cylinder Unit With An Add-On Part

A piston-cylinder unit having a cylinder with an add-on part which has a fastening portion that contacts a contact surface of the cylinder. A positive engagement connection fixing the add-on part to the cylinder is provided between the add-on part and the cylinder. The positive engagement connection is formed by a deformable rivet that extends through the fastening portion in a final assembly position and forms an undercut with the cylinder.

Fuel Pump

A fuel pump, in which a connecting piece for a fuel line and electrical connecting lines are radially guided in a motor housing, includes an electric motor. The motor housing has a section made of plastic such that the fuel pump has reduced axial dimensions.

Fuel Pump and Fuel Supply Unit

A fuel pump includes: an electric motor; a pump stage drivable by the electric motor; a fuel pump housing configured to accommodate the electric motor and the pump stage; and a bracket configured to fasten the fuel pump to a wall. The fuel pump housing includes a plastic first housing part configured to accommodate at least one selected from the group of the electric motor and the pump stage. The first housing part is configured as a single piece with the bracket, the bracket being integral with the first housing part.

Fuel Pump and Fuel Delivery Unit

A fuel pump includes: an electric motor; a pump stage drivable by the electric motor; and a fuel pump housing configured to accommodate the electric motor and the pump stage. The fuel pump housing has a first housing part configured to accommodate the electric motor and a second housing part configured to accommodate the pump stage. One or both of the first housing part and the second housing part are made of a conductive plastic adapted to dissipate static charges to a ground potential. 15-. (canceled)6. A fuel pump , comprising:{'b': '4', 'an electric motor ();'}{'b': 6', '4, 'a pump stage () drivable by the electric motor (); and'}{'b': 8', '9', '10', '4', '6, 'a fuel pump housing (, , ) configured to accommodate the electric motor () and the pump stage (),'}{'b': 8', '9', '10', '10', '4', '8', '9', '6', '10', '8', '9, 'wherein the fuel pump housing (, , ) has a first housing part () configured to accommodate the electric motor () and a second housing part (, ) configured to accommodate the pump stage (), wherein at least one selected from the group of: the first housing part () and the second housing part (, ) is made of a conductive plastic adapted to dissipate static charges to a ground potential.'}7. The fuel pump as claimed in claim 6 , wherein the conductive plastic comprises graphite powder.8. The fuel pump as claimed in claim 6 , wherein the conductive plastic comprises carbon fibers.9. The fuel pump as claimed in claim 6 , wherein the conductive plastic comprises metal fibers.10. The fuel pump as claimed in claim 6 , wherein the conductive plastic comprises graphite powder and carbon fibers.11. The fuel pump as claimed in claim 6 , wherein the conductive plastic comprises graphite powder and metal fibers.12. The fuel pump as claimed in claim 6 , wherein the conductive plastic comprises carbon fibers and metal fibers.13. The fuel pump as claimed in claim 6 , wherein the conductive plastic comprises graphite powder claim 6 , carbon fibers and metal fibers. ...

Cylinder Unit Having An Adhesive Bond

A cylinder unit includes a cylinder which is closed at one end by a base, wherein an adhesive joint is formed between the cylinder and the base, characterized in that the adhesive joining of the base is carried out in an annular space filled with adhesive, wherein the cylinder or the base is wetted with adhesive in the annular space at an inner wall and at an outer wall so that there are two gluing surfaces separated by the wall. 17-. (canceled)8. A cylinder unit comprising:{'b': '1', 'a cylinder () having an end;'}{'b': 3', '1, 'a base () for closing said cylinder () at said end;'}{'b': 1', '3, 'an adhesive joint formed between said cylinder () and said base ();'}{'b': 17', '3', '1', '1', '3, 'said adhesive joint comprising an annular space () including an adhesive for joining of said base () to said cylinder (), each of said cylinder () and said base () having a wall comprising an inner wall and an outer wall; and'}{'b': 1', '3', '17', '1', '3, 'wherein one of said cylinder () and said base () is wetted with said adhesive in said annular space () at said respective inner wall and said respective outer wall so that there are two gluing surfaces separated by said wall of one of said cylinder () and said base ().'}9357317. The cylinder unit according to claim 8 , wherein said base () comprises two-shell parts claim 8 , and wherein the two shell parts (; ) of the base () radially limit the annular space ().10571315571315. The cylinder unit according to claim 9 , wherein the two shell parts (; ) of the base comprise a bottom region (; ) and wherein the two shell parts (; ) are glued to one another along said bottom regions (; ).11272331271713. The cylinder unit according to claim 8 , additionally comprising a mounting part () on the cylinder side overlapping a gluing surface () between the base () and the cylinder () claim 8 , and wherein the mounting part () radially limits the annular space () and is connected to the cylinder () and to the base ().12273. The cylinder ...

Radiation-emitting arrangement

Eine strahlungsemittierende Anordnung umfasst insbesondere - ein Trägerelement (1) mit einer zumindest teilweise nichttransparenten Hauptoberfläche (10) und - auf dem Trägerelement (1) angeordnet ein organisches strahlungsemittierendes Bauelement (2) mit einer organischen Schichtenfolge (23) mit einem aktiven Bereich zwischen einer zumindest teilweise transparenten ersten Elektrode (21) und einer zumindest teilweise transparenten zweiten Elektrode (22), wobei - der aktive Bereich (29) geeignet ist, in einem eingeschalteten Betriebszustand elektromagnetische Strahlung (91, 93) zu erzeugen, - die strahlungsemittierende Anordnung auf der vom Trägerelement (1) abgewandten Seite des organischen strahlungsemittierenden Bauelements (2) eine Strahlungsaustrittsfläche (3) zur Abstrahlung der elektromagnetischen Strahlung (92, 93) aufweist und - die zumindest teilweise nicht-transparente Hauptoberfläche (10) des Trägerelements (1) in einem ausgeschalteten Betriebszustand des organischen strahlungsemittierenden Bauelements (2) von einem externen Beobachter durch die Strahlungsaustrittsfläche (3) hindurch wahrnehmbar ist.

Storage of a switching camshaft

Die Erfindung betrifft eine Lagerung einer antreibbaren Schaltnockenwelle (1) in stationären Lageraufnahmen (2, 3) für die Schaltnockenwelle (1) bei einer Brennkraftmaschine, wobei die Schaltnockenwelle (1) einteilig ausgebildet und axial verschieblich in den Lageraufnahmen (2, 3) gelagert ist, sowie die Schaltnockenwelle (1) eine Schaltkulisse (4) zum axialen Verschieben der Schaltnockenwelle (1) aufweist. Bei einer derartigen Lagerung ist erfindungsgemäß vorgesehen, dass ein Rastmechanismus (5) zum Rastieren der Schaltnockenwelle (1) in unterschiedlichen Verschiebestellungen vorgesehen ist, wobei der Rastmechanismus (5) innerhalb einer Lageraufnahme (2) der Lageraufnahmen (2, 3) angeordnet ist. Eine derartige Lagerung ermöglicht mit einfachen baulichen Mitteln, insbesondere einer geringen Bauteilvielfalt, eine axiale Festlegung der Schaltnockenwelle in deren Schaltstellungen. The invention relates to a bearing of a drivable camshaft (1) in stationary bearing mounts (2, 3) for the switching camshaft (1) in an internal combustion engine, wherein the switching camshaft (1) integrally formed and axially displaceable in the bearing mounts (2, 3) is mounted , And the switching camshaft (1) has a shift gate (4) for axially displacing the switching camshaft (1). In such a storage, the invention provides that a latching mechanism (5) for locking the switching camshaft (1) is provided in different displacement positions, wherein the latching mechanism (5) within a bearing receptacle (2) of the bearing mounts (2, 3) is arranged. Such storage allows with simple structural means, in particular a small variety of components, an axial definition of the switching camshaft in their switching positions.

Storage of a switch camshaft

Lagerung einer antreibbaren Schaltnockenwelle (1) in stationären Lageraufnahmen (2, 3) für die Schaltnockenwelle (1) bei einer Brennkraftmaschine, wobei die Schaltnockenwelle (1) einteilig ausgebildet und axial verschieblich in den Lageraufnahmen (2, 3) gelagert ist, sowie die Schaltnockenwelle (1) eine Schaltkulisse (4) zum axialen Verschieben der Schaltnockenwelle (1) aufweist, wobei ein Rastmechanismus (5) zum Rastieren der Schaltnockenwelle (1) in unterschiedlichen Verschiebestellungen vorgesehen ist, dadurch gekennzeichnet, dass der Rastmechanismus (5) innerhalb einer Lageraufnahme (2) der Lageraufnahmen (2, 3) angeordnet ist, wobei der Rastmechanismus (5) über ein Wälzlager (6) innerhalb der einen Lageraufnahme (2) gelagert ist, wobei der Rastmechanismus (5) lageraufnahmeseitig eine Arretierhülse (7) mit mehreren in Axialrichtung der Schaltnockenwelle (1) hintereinander angeordneten Rastvertiefungen (8) aufweist, sowie der Rastmechanismus (5) schaltnockenwellenseitig ein sich senkrecht zur Achsrichtung der Schaltnockenwelle (1) erstreckendes Sackloch (9) in der Schaltnockenwelle (1) zur Aufnahme einer Kugel (10) und einer auf diese einwirkende Feder (11) aufweist, zwecks Vorspannung der Kugel (10) gegen die Arretierhülse (7) im Bereich der Rastvertiefungen (8), wobei die Arretierhülse (7) axial festgelegt in dem Wälzlager (6) gelagert ist. Mounting of a drivable switching camshaft (1) in stationary bearing mounts (2, 3) for the switching camshaft (1) in an internal combustion engine, the switching camshaft (1) being constructed in one piece and being mounted so as to be axially displaceable in the bearing mounts (2, 3), as well as the switching camshaft (1) has a shift gate (4) for the axial displacement of the shift camshaft (1), a latching mechanism (5) for latching the shift camshaft (1) in different displacement positions being provided, characterized in that the latching mechanism (5) within a bearing receptacle ( 2) of the bearing mounts (2, 3), the ...

Method and apparatus for isolating the radioisotope molybdenum-99

A method of isolating 99Mo produced using a (n, ) reaction according to example embodiments may include vaporizing a source compound containing 98Mo and 99Mo. The vaporized source compound may be ionized to form ions containing 98Mo and 99Mo. The ions may be separated to isolate the ions containing 99Mo. The isolated ions containing 99Mo may be collected with a collector. Accordingly, the isolated 99Mo may have a relatively high specific radioactivity and, in turn, may be used to produce the diagnostic radioisotope, 99mTc, through radioactive decay.

Dos compatible dictation and voice mail system

A hardware add-on including an interface to external I/O, a voice processor, and a micro-controller along with a terminate and stay resident program allow a digital dictation and voice mail system to run transparently on a PC operating under DOS. A hardware DTMF transceiver and software template files which equate strings representing DTMF tone signals to DOS commands permits dictation through a touch-tone phone. Voice sampling and playback speed are controlled with a reference signal and a feedback loop to an oscillator controlling the sampling rate of the voice processor. Dictation, template, and message files are DOS formatted.

Method and device for lining hollow shaped parts on the interior

1. Method for lining hollow shaped parts on the interior, in particular for chimneys or suchlike with a thermal insulating layer of an insulating material, principally of expanded vermiculture and a hydraulic binding agent in which the insulating material is introduced in an annular slot (5) formed between the shaped part (3) and an inner core (4), characterised in that an insulating material with a ratio of water to solid matter of the insulating material of between 1.2 and 2 to 1 is used, that the insulating material is condensed such that it has a gross density of 150 to 400 g/l and/or a compression strength of 0.1 to 1 N/mm**2 and a coefficient of thermal conductivity of lambda = 0.18 to 0.20 W/m . K at an application temperature of 800 degrees to 1000 degrees C, and that the inner core is removed after consolidation and the shaped part is stored up to approximately 48 hours, with drying out being prevented.

sensor

Process for desulfurizing a nitrogen oxide storage catalyst in a diesel engine comprises heating the catalyst above a determined lowest desulfurization temperature, and operating the engine in a lean-rich alternating method

Process for desulfurizing a nitrogen oxide storage catalyst arranged with a particle filter in the exhaust gas purification device of a diesel engine comprises heating the catalyst above a determined lowest desulfurization temperature; and operating the engine in a lean-rich alternating method. The heating is carried out up to a time when the sulfur charge of the catalyst has exceeded a lowest value and regeneration of the filter has started. The engine is operated in a lean-rich alternating method when prescribed desulfurizing releasing conditions determined by the engine are fulfilled. Preferred Features: The lean-rich alternating method is produced using alternating lean and rich phases for 3-20 seconds. Heating of the catalyst is carried out using a lean engine operation and with a subsequent post-injection of fuel into the combustion chamber of the engine following the main injection of fuel. After desulfurization, the particle filter is regenerated when the particle charge has exceeded a predetermined threshold value.

Piston pin with sliding layers for connecting rod eyes in internal combustion engines

Kolbenbolzen für ein Pleuel in Hubkolben-Verbrennungsmaschinen dadurch gekennzeichnet, dass der Kolbenbolzen zumindest im Bereich der Lauffläche eine thermisch gespritzte durch Lichtbogendrahtspritzen, Plasmaspritzen, Flamm- oder Hochgeschwindigkeitsflammspritzen erzeugte Gleitschicht aus einem metallischen Lagerwerkstoff aus einer Cu/Sn- einer Cu/Zn-Legierung oder aus einer Al/Cu/Bi-Legierung trägt. Piston pin for a connecting rod in reciprocating internal combustion engines characterized, that the piston pin, at least in the region of the tread a thermally sprayed by wire arc spraying, plasma spraying, flame or High-speed flame spraying generated sliding layer of a metallic bearing material of a Cu / Sn- a Cu / Zn alloy or an Al / Cu / Bi alloy carries.

Packaging structure for optoelectronic component e.g. organic optoelectronic component, has an adhesive layer formed on surface of thin-layer such that the adhesive layer is partially surrounded by the particulate impurities

The packaging structure (300) has a thin-layer (301) made of glass or polyacrylic varnish to protect the optoelectronic component from chemical contaminants, an adhesive layer (302) containing thermosetting adhesive material or UV-curable thermosetting adhesive material, formed on the thin-layer, and an electrode formed on the adhesive layer to protect the outer layer of thin-layer and/or the optoelectronic component from mechanical damage. The adhesive layer is formed on top (301a) of thin-layer such that the adhesive layer is partially surrounded by the particulate impurities. An independent claim is included for a method of encapsulating an optoelectronic component.

Picture holder

The invention concerns a picture holder with a frame formed by frame sections (1) and into which a backing piece (6) is inserted from the rear side and held against a frame ledge by clamp elements (7) mounted on the frame. Each clamp element (7) is braced on the frame by a first limb (8) which lies on the frame rear side (10) and by at least one second limb (9) which is connected to the first and engages in a groove (11) in the frame, while the backing piece is held against the frame ledge by a bracing limb (13) of the clamp element (7). In order to create a picture holder which will hold picture packets (3) securely as well as being easy to handle, it is proposed that the clear distance between the first limb (8) and the ledge area of the bracing limb (13) on the backing piece (6) when the clamp element (7) is relaxed should be greater than the clear distance between the rear side (10) of the frame and the inserted backing piece (6).

Cylinder for vibration damper, has closure with tubular portion and guided in resilient manner, and closure-side form closure element engaged into cylinder-side form closure element, where tubular portion is fixed at surface of cylinder

The cylinder (1) has a closure (3) with a tubular portion (5), which is fixed at an inner peripheral surface (7) of the cylinder. The closure is fixed in the cylinder by a positive connection (11). The closure is partially radially guided in a resilient manner. A closure-side form closure element is engaged into a cylinder-side form closure element i.e. receiving window (15). The closure-side form closure element is designed as a radial resilient projection (13) that comprises an assembly bevel (21) in an insertion direction of the closure. The tubular portion comprises a support sleeve (29). The resilient projection is designed as a solid cam. The tubular portion of the closure comprises a seal for the inner peripheral surface of the cylinder.

Thin-layer encapsulation for an opto-electronic component, method for producing same and opto-electronic component

The thin-layer encapsulation (1) has an atomic layer deposition layer (3) deposited by an atomic layer deposition, and another atomic layer deposition layer (4) is deposited by the atomic layer deposition. The former atomic layer deposition layer stays in direct contact with the latter atomic layer deposition layer. Both the atomic layer deposition layers are made of materials containing aluminum oxide, zinc oxide, zirconium oxide, titanium oxide, hafnium oxide and lanthanium oxide. Independent claims are also included for the following: (1) an optoelectronic component with a substrate; and (2) a method for manufacturing the thin-layer encapsulation for an optoelectronic component.

Telecommunication-product with mediums to measure a distance by means of signal running time

vibration

Verfahren zur Herstellung eines Schwingungsdämpfer mit mindestens einem Zylinderrohr (4), einem an einer Kolbenstange (2) befestigten Dämpfungsventilkörper (3) mit mindestens einer Durchgangsöffnung, die durch entsprechende Dämpfungsventile (6) beaufschlagt wird, wobei in einem Endbereich des Zylinderrohres (4) eine Kolbenstangenführung (5) vorgesehen ist, durch die einerseits die Kolbenstange (2) abgedichtet nach außen durchtritt und die andererseits der Abdichtung gegenüber dem Zylinderrohr (4) dient, wobei das Zylinderrohr (4) mittels eines Formschlusses mit der Kolbenstangenführung (5) verbunden ist mit folgenden Verfahrensschritten: – die einzelnen Bauteile innerhalb des Zylinderrohres (4) werden vor Aufbringung einer Magnetkraft axial vorgespannt; – zur Verbindung wird auf das Zylinderrohr (4) im Bereich der zylindrischen Außenfläche (7) der Kolbenstangenführung (5) eine radial wirkende Magnetkraft ausgeübt, die eine Deformation des Zylinderrohres (4) bewirkt, wobei der Endbereich des Zylinderrohres (4) in Form eines Überstandes am Endbereich der Kolbenstangenführung (5) durch die Magnetkraft radial umgebördelt wird.

Connector

The invention relates to a connector (3) for connecting a flow pipe leading to an internal combustion engine of a motor vehicle to a feed pump. Said connector comprises an elbowed connecting sleeve (7) which can be rotationally fixed in various angular positions in a receiver (6). Said connecting sleeve (7) is positively fixed in the receiver (6) by a catch means (9). In this way, the forces acting on the flow pipe are kept at a distance from a seal pertaining to the connecting sleeve (7).

Method and apparatus for isolating a radioisotope

A method of isolating a radioisotope according to example embodiments may include vaporizing a source compound containing a first isotope and a second isotope of an element, wherein the second isotope may have at least one of therapeutic and diagnostic properties when used as a radiopharmaceutical. The vaporized source compound may be ionized to form charged particles of the first and second isotopes. The charged particles may be separated to isolate the particles of the second isotope. The isolated charged particles of the second isotope may be collected with an oppositely-charged collector. Accordingly, the isolated second isotope may be used to produce therapeutic and/or diagnostic radiopharmaceuticals having higher specific activity.

Pad for a lighting device

The invention relates to a pad (17) that is provided for a substrate (12) of a lighting device (11) and has at least one opening (18) for at least one semiconductor light source (14) of the lighting device (11), wherein the pad (17) has at least one peripheral wall (19a-g), which surrounds at least one opening (18). The lighting device (11) has a substrate (12) on which at least one semiconductor light source (14) is mounted, wherein the substrate (12) is provided with a pad (17) according to one of the preceding claims, such that the at least one semiconductor light source (14) is located within an opening (18) of the pad (17), and wherein at least one box (20a-g) formed by at least one peripheral wall (19a-g) is filled with at least one filling mass (23, 24a-c, 25).

PROCESS FOR DESULFURIZING A NITROGEN OXIDE ACCUMULATOR CATALYST

L'invention concerne un procédé de désulfuration d'un catalyseur accumulateur d'oxydes d'azote (3), disposé dans l'installation d'épuration des gaz d'échappement d'un moteur à combustion interne (1), en particulier d'un moteur diesel utilisé dans des véhicules automobiles, conjointement avec un filtre à particules (4).Selon l'invention, la désulfuration s'effectue en ce que le catalyseur accumulateur d'oxydes d'azote (3) est placé à une température supérieure à une température minimale prédéterminée de désulfuration et une alternance, répétée plusieurs fois, entre une composition oxydante et une composition réductrice des gaz d'échappement, étant effectuée, la désulfuration étant effectuée subséquemment à une régénération du filtre à particules (4). The invention relates to a process for the desulphurization of a nitrogen oxide accumulator catalyst (3) located in the exhaust gas purification plant of an internal combustion engine (1), in particular of 'a diesel engine used in motor vehicles, together with a particulate filter (4). According to the invention, the desulphurization takes place in that the nitrogen oxide accumulator catalyst (3) is placed at a temperature above a predetermined minimum desulfurization temperature and an alternation, repeated several times, between an oxidizing composition and a reducing composition of the exhaust gases, being carried out, the desulfurization being carried out subsequent to a regeneration of the particulate filter (4).

Screen and roller shutter with such a screen

A data processing system and method

The data processing system has a database for storing master contracts and billing customizing tables. The master contracts refer to the billing customizing data by means of result and condition attributes. This has the advantage that a modification of the billing customizing data, such as for the purpose of changing the bundle pricing scheme for the master contracts, does not require storage of the updated data in the database.

Method for producing optoelectronic semiconductor components, and optoelectronic semiconductor component

In at least one embodiment, the method is set up to produce optoelectronic semiconductor components (1) and comprises the steps of: A) providing a carrier (2), wherein the carrier (2) has a metal core material (24), and a metal layer (25) and subsequently a dielectric mirror (26) are applied to the core material (24) at least on a carrier top side (22), B) forming at least two holes (3) through the carrier (2), C) producing a ceramic layer (4) having a thickness of at most 100 μm at least on a carrier underside (21) and in the holes (3), wherein the ceramic layer (4) comprises the core material (24) as a component, D) applying metal contact layers (91, 92) to at least sections of the ceramic layer (4) on the carrier underside (21) and in the holes (3), with the result that the carrier top side (22) is electrically connected to the carrier underside (21) through the holes (3), and E) applying at least one radiation-emitting semiconductor chip (5) to the carrier top side (22) and electrically connecting the semiconductor chip (5) to the contact layers (91, 92).

Cylinder with an attachment and method of making a cylinder with an attachment

Zylinder, insbesondere für einen Schwingungsdämpfer, an dem Anbauteil mittels eines Schweißverfahrens befestigt ist, wobei das Anbauteil über eine Kontaktfläche am Zylinder fixiert ist dadurch gekennzeichnet, dass der Zylinder mindestens einen radialen Schweißbolzen aufweist, der mit dem Anbauteil verschmolzen ist. Cylinder, in particular for a vibration damper, is attached to the attachment by means of a welding process, wherein the attachment is fixed via a contact surface on the cylinder, characterized in that the cylinder has at least one radial welding bolt, which is fused with the attachment.

Illuminated picture holder

A transparent adhesion layer is located between the picture (6) and the back of the front plate (2). The layer enables the picture to be changed over and held against the front plate, and has a refractive index which is greater than that of air. An illuminated picture holder for showing pictures, comprises a transparent front plate through which the picture is seen, and a light source on a side face of the front plate, whose light passes through the sides into the front plate. A transparent adhesion layer is located between the picture (6) and the back of the front plate (2). The layer enables the picture to be changed over and held against the front plate, and has a refractive index which is greater than that of air. The light from the light source (4) is directed from the front plate, through the adhesion layer, onto the picture surface.

Cylinder assembly with a bottom and apparatus for establishing a positive connection between the bottom and a cylinder

Zylinderanordnung, umfassend einen Zylinder und einen damit verbundenen Boden, wobei zwischen dem Boden und dem Zylinder eine in Axial- und in Umfangsrichtung wirksame Formschlussverbindung vorliegt, wobei der Boden eine umlaufende Ringnut aufweist, die sich über den gesamten Umfang erstreckt, wobei der Zylinder mindestens eine radiale in die Ringnut des Bodens eingreifende Eindrückung aufweist, deren Breite größer ist als die Breite der Ringnut.

Cylinder, in particular for a vibration damper, with a sleeve-shaped attachment

Zylinder, insbesondere für einen Schwingungsdämpfer, umfassend einen Boden und ein hülsenförmiges den Zylinder wenigsten teilweise umschließendes Anbauteil, das an einem Ende des Zylinders ein nach radial innen gerichtetes Randprofil aufweist, wobei das Randprofil kontaktlos zum Boden an einer Stirnfläche des Zylinders anliegt. Cylinder, in particular for a vibration damper, comprising a bottom and a sleeve-shaped part at least partially enclosing the attachment, which has at one end of the cylinder a radially inwardly directed edge profile, wherein the edge profile contacts the bottom contactlessly against an end face of the cylinder.

Fluid pump, water delivery unit, water injection system, internal combustion engine and vehicle

Es wird eine Fluidpumpe 2 zur Förderung eines flüssigen Fluids vorgeschlagen, umfassend:- einen Elektromotor 4 und- eine durch den Elektromotor 4 angetriebene, ein Pumpenlaufrad 12 aufweisende Pumpenstufe 6.Dabei wird vorgeschlagen, ein erstes, als Ausgleichselement fungierendes elastisches Röhrchen 14 in einem Einlass E der Fluidpumpe 2und/oderein zweites, als Ausgleichselement fungierendes elastisches Röhrchen 16 in einem Auslass A der Fluidpumpe 2 anzuordnen.Das jeweilige Röhrchen 14, 16 kleidet dabei den Einlass E oder den Auslass A aus und nimmt eine sich im Einlass E oder Auslass A einstellende, vereisungsbedingte Ausdehnung des Fluids elastisch auf.Des Weiteren werden eine Wasserfördereinheit mit einer solchen Fluidpumpe, ein Wassereinspritzsystem mit einer solchen Wasserfördereinheit, ein Verbrennungsmotor mit einem solchen Wassereinspritzsystem sowie ein Fahrzeug mit einem solchen Verbrennungsmotor vorgeschlagen. A fluid pump 2 for conveying a liquid fluid is proposed, comprising: an electric motor 4 and a pump stage 6 driven by the electric motor 4 and having a pump impeller 12. It is proposed that a first elastic tube 14 acting as a compensating element in an inlet E of the fluid pump 2 and / or a second elastic tube 16, which acts as a compensating element, to be arranged in an outlet A of the fluid pump 2. The respective tube 14, 16 lines the inlet E or the outlet A and takes up a position in the inlet E or outlet A. expansion of the fluid due to icing. Furthermore, a water delivery unit with such a fluid pump, a water injection system with such a water delivery unit, an internal combustion engine with such a water injection system and a vehicle with such an internal combustion engine are proposed.

Piston-cylinder device e.g. double tube vibration damper, for vehicle, has carrier disk, where bending point in region of opening of disk generates smaller axial displacement of segments for higher damping force in pressure direction

The device (1) has a damping disk comprising two axially movable segments connected with each other at outer ends. A carrier disk and the damping disk are arranged parallely adjacent to each other. A bending point in a region of an inner wall of a working cylinder (3) with a larger lever arm generates a larger axial displacement of the segments for smaller damping force during pressurization in a traction direction. A bending point in a region of an opening of the carrier disk generates a smaller axial displacement of the segments for higher damping force in a pressure direction.

SUBSTRATE AND SEMICONDUCTOR LASER

In einer Ausführungsform ist das Substrat (1) für eine Halbleiterlaserdiode (61) eingerichtet und umfasst eine Vielzahl von Substratlagen (4). Die Substratlagen (4) umfassen Isolierlagen (41..43) und Trägerlagen (44..50), die dicker sind. Mehrere elektrische Kontaktflächen (33), die für die Halbleiterlaserdiode (61), einen Laserkondensator (62) und einen Ansteuerchip (63) eingerichtet sind, befinden sich an einer Bestückungsseite (3) einer ersten, obersten Substratlage (4), die eine Isolierlage (41) ist. Elektrische Leiterbahnen (51), die die Kontaktflächen (33) elektrisch miteinander verschalten, befinden sich einerseits zwischen der ersten Isolierlage (41) und einer zweiten Isolierlage (42), und andererseits zwischen der zweiten Isolierlage (42) und einer dritten Substratlage (4), die bevorzugt eine Isolierlage (43) ist. In one embodiment, the substrate (1) is set up for a semiconductor laser diode (61) and comprises a multiplicity of substrate layers (4). The substrate layers (4) comprise insulating layers (41..43) and carrier layers (44..50), which are thicker. Several electrical contact surfaces (33), which are set up for the semiconductor laser diode (61), a laser capacitor (62) and a control chip (63), are located on a component side (3) of a first, top substrate layer (4), which has an insulating layer ( 41) is. Electrical conductor tracks (51), which electrically interconnect the contact surfaces (33), are located on the one hand between the first insulating layer (41) and a second insulating layer (42), and on the other hand between the second insulating layer (42) and a third substrate layer (4) , which is preferably an insulating layer (43).

Promoters of gene expression in plant caryopses

The invention relates to promoters which permit a caryopsis specific expression or suppression of genes in genetically modified plants, a method for the tissue specific genetic expression or genetic suppression in plants, expression cassettes, recombinant vectors and host cells, containing said promoters, transgenic plant cells and plants transformed by means of said promoters and a method for production of said plant cells and plants.

Screen and roller shutter with such a screen

New nucleic acid that functions as caryposis-specific promoter, useful for tissue-selective gene expression or suppression in plants, also related transgenic plants

Nucleic acid molecule (I) that functions as caryopsis-specific promoter, is new. (I) comprises: (1) a 3785 bp sequence (1) or the sequence deposited in DSM 13398 (plasmid p11/1), or their functional fragments; (2) contains one or more of sequences (II) (2)-(8): (a) CACGCAAAGGCGCGTCGGCCAGCCACGAC (2); (b) AGAAACAAACAAACAAACAAA (3); (c) CCTTTCAGGACGATGCTTCGGTGCCTTAAGACACCTACCTTTGTGTCTATGACATGTGAGCCCAACAGAT GGCT (4); (d) CCCGTCTAGGCGTTCGGTGTCCGGCC (5); (e) CAGGGAGCCTTCGA (6); (f) TCAGCCAGTTCCACCCCGTGCACG (7); and (g) TACTCTGGTCATGTTAA (8); and (3) a molecule which hybridizes to (I) and/or (II) or is at least 60-99, preferably 95-99,% identical with (I). Independent claims are also included for the following: (1) expression cassette (EC) containing (I); (2) vector containing (I) or EC; (3) host cell modified by (I), EC or the vector of (c); (4) plants (or their replicative materials or harvested products) containing plant cells of (c); and (5) method for preparing transgenic plant cells, or complete plants, by transforming cells with (I), EC, the vector of (2) or host cells of (4), and optionally regenerating.

Bumper device for a vehicle, in particular for a motor vehicle

The invention relates to a bumper device (1) for a vehicle, in particular a motor vehicle comprising at least one bumper cross beam (3, 28) extending in a transversal direction of the vehicle on the front-end area thereof, a bumper cover (5, 29) forming the external face of said bumper device (1), at least one energy-absorbing insert (4, 18, 31) which is arranged at least in parallel between the mounted bumper cross beam (3, 28) and the bumper cover (5, 29). Said insert (4, 18, 31) is provided with a plurality of deformation cavities (27) and/or deformation free spaces (26, 36). The inventive insert consists of three layers, i.e. a first boundary layer (17, 19, 32), a medial layer (8, 20, 33) and a second boundary layer (9, 21, 34). The medial layer (8, 20, 33) has energy absorptive capacity different with respect to the energy absorptive capacity of two boundary layers (7, 9, 19, 21, 32, 34) and is associated to the bumper cross beam (3, 28) in the mounted state thereof. The deformation cavities (27) and/or deformation free spaces (26, 36) are embodied in the medial layer (8, 20, 33) in such a way that in the case of the collision which applies a force to the bumper cover (5, 29), the insert (4, 18, 31) is plastically deformable at least partially in the transversal and/or longitudinal direction of the vehicle along a small part of a block length in order to absorb energy with the aid of said deformation cavities (27) and/or deformation free spaces (26, 36).

Promoters of gene expression in plant caryopses

The invention relates to promoters which permit a caryopsis specific expression or suppression of genes in genetically modified plants, a method for the tissue specific genetic expression or genetic suppression in plants, expression cassettes, recombinant vectors and host cells, containing said promoters, transgenic plant cells and plants transformed by means of said promoters and a method for production of said plant cells and plants.

Optoelectronic assembly, electronic assembly, method of forming an optoelectronic assembly, and method of forming an electronic assembly

In verschiedenen Ausführungsbeispielen wird bereitgestellt eine optoelektronische Baugruppe (20), mit einem Gehäuse (22), mit mindestens einem optoelektronischen Bauelement (26), das einen ersten Kontakt (42) und einen zweiten Kontakt (44) zum elektrischen Kontaktieren des optoelektronischen Bauelements (26) aufweist und das zumindest teilweise von dem Gehäuse (22) umgeben ist, und mit einem Leiterrahmen (24). Der Leiterrahmen (24) ist aus Metall gebildet, ist zumindest teilweise in das Gehäuse (22) eingebettet, weist einen Bauelementbereich (40) auf, auf dem das optoelektronische Bauelement (26) angeordnet ist und mit dem der erste Kontakt (42) des optoelektronischen Bauelements (26) elektrisch verbunden ist, weist ein erstes Presspassung-Steckelement (34) auf, das mit dem Bauelementbereich (40) einstückig ausgebildet ist, und weist mindestens ein zweites Presspassung-Steckelement (38) auf, das von dem ersten Presspassung-Steckelement (34) elektrisch isoliert ist und das mit dem zweiten Kontakt (44) des optoelektronischen Bauelements (26) elektrisch verbunden ist. Die Presspassung-Steckelemente (34, 38) sind ausgebildet zum Ausbilden von je einer Presspassung-Verbindung mit zwei entsprechenden Presspassung-Aufnahmen (53, 54) eines Trägers (52) und zum Ausbilden von je einer elektrischen Verbindung zwischen den Kontakten (42, 44) des optoelektronischen Bauelements (26) und zwei entsprechenden Leitern (55, 56) des Trägers (52). In various exemplary embodiments, an optoelectronic assembly (20) is provided with a housing (22), with at least one optoelectronic component (26) having a first contact (42) and a second contact (44) for electrically contacting the optoelectronic component (26 ) and which is at least partially surrounded by the housing (22), and with a lead frame (24). The lead frame (24) is formed of metal, is at least partially embedded in the housing (22), has a component region (40) on which the optoelectronic component (26) is arranged and with which the ...

Optoelectronic device

The invention relates to an optoelectronic device comprising - a transmitter (1) designed to emit electromagnetic radiation (2) and to be operated with an input voltage (UI), and - a receiver (3) designed to receive the electromagnetic radiation (2) and to provide an output voltage (UO), - the transmitter (1) comprising at least one surface emitter (10), and - the receiver (3) comprising at least one photodiode (30).

Electric pump with a radial slot formed between the motor and pump to discharge leaking fluid

The invention relates to a fluid pump (2) for delivering a liquid fluid, comprising: - an electric motor (4) and - a pump stage (6) driven by the electric motor (4) and comprising a pump impeller (12). The electric motor (4) is designed to run dry. The pump stage (6) is sealed against the electric motor (4) by means of a seal in a region of a pump-side shaft end (5) of a rotor in the electric motor (4) extending into the pump stage (6) and through the pump impeller (12). According to the invention, a water discharge (16) is provided on the pump stage (6) adjacent to the electric motor (4) with at least one slot (18) for discharging fluid escaping through the seal to counteract leakage from the seal. The invention further relates to a water delivery unit comprising a fluid pump of this kind, a water injection system with a water delivery unit of this kind, an internal combustion engine with a water injection system of this kind and a vehicle with an internal combustion engine of this kind.

Monocotyledon plant cells and plants which synthesise modified starch

The present invention relates to monocotyledon plant ells and plants which are genetically modified, wherein the genetic modification consists of the introduction of an extraneous nucleic acid molecule which codes for a protein with the biological activity of an R1 protein. The present invention further relates to means and methods for the production thereof. Plant cells and plants of this type synthesise a modified starch, which is characterised in that is has an increased phosphate content and/or a modified phosphorylation pattern and/or an increased final viscosity in an RVA profile and/or a reduced peak temperature in DSC analysis and/or an increased gel strength in the texture analysis compared with starch from corresponding non-genetically modified monocotyledon plants. Therefore, the present invention also relates to the starch which is synthesised from the plant cells and plants according to the invention, and to methods of producing said starch. The present invention further relates to wheat flours which contain said modified starches, and to food products and bakery products which contain said wheat flours and/or starch.

Load receptacle e.g. for transporting bicycles or skis on rear of motor vehicle, has beams releasably received in towing bracket receptacles on each side of bumper mounting bracket

The load receptacle comprises at least one beam (1,2) which can be attached so as to project from the rear of a vehicle, to receive a load. The beams are releasably received in a towing bracket receptacle (4) on the vehicle via a connecting portion (3). Each beam is preferably received in respective towing bracket receptacles on each side of the vehicle, arranged in a bumper mounting bracket.

Thin-film encapsulation for an optoelectronic component, method for its production and optoelectronic component

Es wird eine Dünnschichtverkapselung (1) für ein optoelektronisches Bauelement offenbart. Die Dünnschichtverkapselung (1) weist eine Schichtenfolge (2) auf, die folgende Schichten umfasst: - eine erste mittels Atomlagenabscheidung abgeschiedene ALD-Schicht (3), und - eine zweite mittels Atomlagenabscheidung abgeschiedene ALD-Schicht (4). Weiterhin wird ein Verfahren zur Herstellung der Dünnschichtverkapselung und ein optoelektronisches Bauelement mit einer solchen Dünnschichtverkapselung beschrieben. A thin-film encapsulation (1) for an optoelectronic component is disclosed. The thin-layer encapsulation (1) has a layer sequence (2) comprising the following layers: a first ALD layer (3) deposited by atomic layer deposition, and a second ALD layer (4) deposited by atomic layer deposition. Furthermore, a method for producing the thin-layer encapsulation and an optoelectronic component with such a thin-layer encapsulation will be described.

Fuel Pump

A fuel pump includes an electric motor, a pump stage and a motor housing with a plastic section that holds a stator of the electric motor. The plastic section has a rim on the side facing the pump housing, when seen from the stator. A sheet metal sheath engages behind a rim of the motor housing and a rim of the pump housing by rolled portions so as to permit the fuel pump to be produced cost-effectively.

Method for operating a diesel engine

Air Deflection Device in the Underbody Region of a Motor Vehicle and Motor Vehicle Comprising Such an Air Deflection Device

An air deflection device of a motor vehicle includes an air deflection element and a displacement kinematic system. The air deflection element is displaceable by the displacement kinematic system from an extended deflection position, in which the air deflection element with a deflection surface in a front region of the air deflection element in a longitudinal direction of the motor vehicle diverts an airflow hitting the air deflection element in an underbody region in a forward direction of travel of the motor vehicle, into a retracted position. The air deflection element is displaceable by the displacement kinematic system rearwards in the longitudinal direction of the motor vehicle and upwards in a vertical direction of the motor vehicle and is pushable back in a direction of the retracted position in an event of an obstacle-related force component acting on the air deflection element in the longitudinal direction of the motor vehicle.

Method and apparatus for producing a closure for a piston and cylinder unit

The invention relates to a method and apparatus for producing a cup-shaped closure (1), in particular for a piston and cylinder unit, comprising a bottom (5) having a circumferential annular wall (9), the closure (1) having at least one annular groove (11, 13). The at least one annular groove (11, 13) is formed in the annular wall (9) by means of at least one rolling tool (17), the volume of material of the closure (1) displaced by the rolling tool (17) being kept away from the interior of the cup-shaped closure (1) by means of a counter tool (19).

Process for the production of optoelectronic semiconductor components and optoelectronic semiconductor component

In mindestens einer Ausführungsform ist das Verfahren zur Herstellung von optoelektronischen Halbleiterbauteilen (1) eingerichtet und umfasst die Schritte: A) Bereitstellen eines Trägers (2), wobei der Träger (2) ein metallisches Kernmaterial (24) aufweist und zumindest an einer Trägeroberseite (22) auf das Kernmaterial (24) eine Metallschicht (25) und darauffolgend ein dielektrischer Spiegel (26) aufgebracht sind, B) Ausbilden von mindestens zwei Löchern (3) durch den Träger (2) hindurch, C) Erzeugen einer Keramikschicht (4) mit einer Dicke von höchstens 100 µm zumindest an einer Trägerunterseite (21) und in den Löchern (3), wobei die Keramikschicht (4) als Komponente das Kernmaterial (24) umfasst, D) Aufbringen von metallischen Kontaktschichten (91, 92) auf zumindest Teilbereiche der Keramikschicht (4) an der Trägerunterseite (21) und in den Löchern (3), sodass durch die Löcher (3) die Trägeroberseite (22) elektrisch mit der Trägerunterseite (21) verbunden wird, und E) Aufbringen zumindest eines Strahlung emittierenden Halbleiterchips (5) auf die Trägeroberseite (22) und elektrisches Verbinden des Halbleiterchips (5) mit den Kontaktschichten (91, 92). In at least one embodiment, the method for producing optoelectronic semiconductor components (1) is set up and comprises the steps: A) providing a carrier (2), wherein the carrier (2) has a metallic core material (24) and at least on a carrier top side (22 ) on the core material (24) a metal layer (25) and subsequently a dielectric mirror (26) are applied, B) forming at least two holes (3) through the support (2), C) producing a ceramic layer (4) a thickness of at most 100 μm at least on a carrier underside (21) and in the holes (3), the ceramic layer (4) comprising the core material (24) as component, D) applying metallic contact layers (91, 92) to at least partial areas the ceramic layer (4) on the carrier underside (21) and in the holes (3), so that through the holes (3) the carrier upper side (22) is electrically ...

Verfahren zum herstellen eines schwenkaggregats

Optoelectronic device

An optoelectronic device is specified comprising - an emitter (1) arranged to emit electromagnetic radiation (2) and configured to be operated with an input voltage (UI), - a receiver (3) arranged to receive the electromagnetic radiation (2) and configured to provide at least part of an output voltage (UO), wherein - the emitter (1) and the receiver (3) are grown laterally adjacent to each other

Verwendung einer elektrisch angetriebenen Strömungspumpenstufe, einer Wasserfördereinheit, eines Wassereinspritzsystems, eines Verbrennungsmotors sowie eines Fahrzeugs

Verwendung einer elektrisch angetriebenen Strömungspumpenstufe (6) in einer Wasserfördereinheit eines Wassereinspritzsystems zur Einspritzung von Wasser in einen Verbrennungsmotor, dadurch gekennzeichnet, dass die Strömungspumpenstufe (6) ein Pumpenlaufrad (12) in Gestalt eines Seitenkanalpumpenlaufrades umfasst.

Halbleiterleuchte

In mindestens einer Ausführungsform der Halbleiterleuchte (1) umfasst diese mindestens ein Trägersubstrat (4) mit einer Montageseite (40). Eine Mehrzahl von Leuchtdiodenchips (2) ist an der Montageseite (40) angebracht. Die Halbleiterleuchte (1) beinhaltet elektrische Kontakteinrichtungen (3), die sich mindestens mittelbar auf dem Trägersubstrat (4) befinden und über die Leuchtdiodenchips (2) elektrisch kontaktiert sind. Das Trägersubstrat (4) ist durchlässig für eine von den Leuchtdiodenchips (2) im Betrieb erzeugte Strahlung.

Fluidpumpe, Wasserfördereinheit, Wassereinspritzsystem, Verbrennungsmotor und Fahrzeug

Fluidpumpe (2) zur Förderung eines flüssigen Fluids, umfassend:einen Elektromotor (4) und eine durch den Elektromotor (4) angetriebene, ein Pumpenlaufrad (12) aufweisende Pumpenstufe (6),dadurch gekennzeichnet, dass an der Pumpenstufe (6) mindestens ein als Ausgleichselement fungierendes, elastisches Verbindungselement (14) zur Aufnahme einer sich zumindest in der Pumpenstufe (6) einstellenden, vereisungsbedingten Bewegung der Pumpenstufenteile vorgesehen ist.

Optoelektronisches bauelement und verfahren zum herstellen eines optoelektronischen bauelements

Die Erfindung betrifft ein optoelektronisches Bauelement mit einem Träger, einem Gehäuse, einem optoelektronischen Halbleiterchip sowie einer Linse. Der Träger weist zumindest einen ersten elektrisch leitfähigen Bereich und einen zweiten elektrisch leitfähigen Bereich sowie einen elektrisch isolierenden Bereich auf. Der optoelektronische Halbleiterchip ist derart auf dem Träger angeordnet, dass ein erster Kontakt des optoelektronischen Halbleiterchips mit dem ersten elektrisch leitfähigen Bereich elektrisch leitfähig verbunden ist und ein zweiter Kontakt des optoelektronischen Halbleiterchips mit dem zweiten elektrisch leitfähigen Bereich elektrisch leitfähig verbunden ist. Das Gehäuse ist zumindest teilweise oberhalb des Trägers angeordnet. Das Gehäuse weist eine Oberseite und eine von der Oberseite ausgehende und bis zum Träger geführte Ausnehmung auf. Der optoelektronische Halbleiterchip ist in der Ausnehmung angeordnet. Ferner ist die Linse zumindest teilweise in der Ausnehmung angeordnet.

Bauteil und Anschlussträger

Entfernungssensor mit mehreren detektoren oder lichtemittereinheiten zum detektieren eines objekts und entsprechendes verfahren

Die Erfindung betrifft einen Entfernungssensor zum Detektieren eines Objekts in einem Erfassungsbereich des Entfernungssensors. Dieser umfasst ein Sensorgehäuse mit einer Vielzahl von Anschlussbereichen, eine Lichtemittereinheit zur Erzeugung von Licht wenigstens einer ersten Wellenlänge, wenigstens einen ersten Detektor zum Empfangen einer Lichtstärke, der von dem Emitter in einem ersten Abstand angeordnet ist, und wenigstens einen zweiten Detektor zum Empfangen einer Lichtstärke, der von dem Emitter in einem zweiten Abstand angeordnet ist. Zudem ist eine Auswerteschaltung vorgesehen, die mit dem ersten und zweiten Detektor verbunden und ausgebildet ist, aus Signalen korrespondierend zu den erfassten Lichtstärken und dem ersten sowie zweiten Abstand eine Entfernung zu einem im Erfassungsbereich des Entfernungssensors positioniertem Objekt zu ermitteln.

Consistent set of interfaces derived from a business object model

A business object model (108), which reflects data that used during a given business transaction, is utilized to generate interfaces. This business object model ( I08)facilitates commercial transactions by providing consistent interfaces that are suitable for use across industries, across businesses, and across different department within a business during a business transaction.

Optoelektronisches bauelement und verfahren zum herstellen eines optoelektronischen bauelements

Die Erfindung betrifft ein optoelektronisches Bauelement mit einem ersten Leiterrahmenabschnitt, einem zweiten Leiterrahmenabschnitt und einem optoelektronischen Halbleiterchip. Der erste Leiterrahmenabschnitt weist eine erste Oberseite und eine erste Unterseite sowie eine von der ersten Oberseite ausgehende erste Ausnehmung auf, die zumindest an einen Rand des ersten Leiterrahmenabschnitts und bis zu einer ersten Montageebene geführt. Der zweite Leiterrahmenabschnitt weist eine zweite Oberseite und eine zweite Unterseite sowie eine von der zweiten Oberseite ausgehende zweite Ausnehmung auf, die zumindest an einen Rand des zweiten Leiterrahmenabschnitts und bis zu einer zweiten Montageebene geführt ist. Die erste Ausnehmung und die zweite Ausnehmung sind einander zugewandt angeordnet. Der optoelektronische Halbleiterchip ist auf der ersten Montageebene angeordnet und mit der zweiten Montageebene elektrisch leitend verbunden. Die erste Ausnehmung und die zweite Ausnehmung sind mit einem in einem vorgegebenen Wellenlängenbereich transparenten Material verfüllt, wobei das transparente Material den optoelektronischen Halbleiterchip bedeckt.

Modified low molecular weight glutenin with reduced risk to patients with celiak disease

Optisches Gerät und dessen Verwendung

Optisches Gerät (8) mit einem optischen Element (1), zum Betrachten eines Gegenstands (7) mit Hilfe eines Strahlengangs (6), und mit mindestens zwei transparenten organischen Leuchtdioden (2),wobei zumindest ein Teil des Strahlengangs (6) durch zumindest eine transparente organische Leuchtdiode (2) läuft und die transparente organische Leuchtdiode (2) im eingeschalteten Zustand den Gegenstand (7) beleuchtet, wobeidas optische Element (1) eine Eintrittsseite und eine Ausfallseite aufweist, undauf der Eintrittsseite und der Ausfallseite des optischen Elements (1) jeweils eine organische Leuchtdiode (2) aufgebracht ist.

Abschluss und rolltor mit einem derartigen abschluss

Luftleiteinrichtung im unterbodenbereich eines kraftwagens und kraftwagen mit einer solchen luftleiteinrichtung

Die Erfindung betrifft eine Luftleiteinrichtung (28) für den Unterbodenbereich eines Kraftwagens, mit wenigstens einem Luftleitelement (30), welches als in Fahrzeuglängsrichtung vor einem zugeordneten Rad des Kraftwagens angeordneter Radspoiler ausgebildet ist und aus einer ausgefahrenen Leitstellung, in welcher das Luftleitelement (30) mit einer in Fahrzeuglängsrichtung in einem vorderen Bereich des Luftleitelements (30) vorgesehenen Leitfläche (32) eine in Vorwärtsfahrtrichtung (12) des Kraftwagens im Unterbodenbereich auf das Luftleitelement (30) treffende Luftströmung umleitet, in eine zumindest teilweise eingefahrene Stellung mittels einer Verlagerungskinematik (38) verlagerbar ist. Die Luftleiteinrichtung zeichnet sich dadurch aus, dass das Luftleitelement (30) mittels der Verlagerungskinematik (38) in einer überlagerten Verlagerungsbewegung in Fahrzeuglängsrichtung nach hinten und in Fahrzeughochrichtung nach oben verlagerbar ist, dass die Leitfläche (32) zumindest in einem Teilbereich als Rampe ausgebildet ist, und dass bei einer in Fahrzeuglängsrichtung auf das Luftleitelement (30) wirkenden hindernisbedingten Kraftkomponente (FH) in Richtung der eingefahrenen Stellung zurückdrängbar ist.

Luftleiteinrichtung im unterbodenbereich eines kraftwagens und kraftwagen mit einer solchen luftleiteinrichtung

Die Erfindung betrifft eine Luftleiteinrichtung (28) für den Unterbodenbereich eines Kraftwagens, mit wenigstens einem Luftleitelement (30), welches als in Fahrzeuglängsrichtung vor einem zugeordneten Rad des Kraftwagens angeordneter Radspoiler ausgebildet ist und aus einer ausgefahrenen Leitstellung, in welcher das Luftleitelement (30) mit einer in Fahrzeuglängsrichtung in einem vorderen Bereich des Luftleitelements (30) vorgesehenen Leitfläche (32) eine in Vorwärtsfahrtrichtung (12) des Kraftwagens im Unterbodenbereich auf das Luftleitelement (30) treffende Luftströmung umleitet, in eine zumindest teilweise eingefahrene Stellung mittels einer Verlagerungskinematik (38) verlagerbar ist. Die Luftleiteinrichtung zeichnet sich dadurch aus, dass das Luftleitelement (30) mittels der Verlagerungskinematik (38) in einer überlagerten Verlagerungsbewegung in Fahrzeuglängsrichtung nach hinten und in Fahrzeughochrichtung nach oben verlagerbar ist, dass die Leitfläche (32) zumindest in einem Teilbereich als Rampe ausgebildet ist, und dass bei einer in Fahrzeuglängsrichtung auf das Luftleitelement (30) wirkenden hindernisbedingten Kraftkomponente (FH) in Richtung der eingefahrenen Stellung zurückdrängbar ist.

Promoters for gene expression in caryopses of plants

The present invention provides promoters which bring about a caryopsis-specific expression of coding nucleotide sequences controlled by them, and to expression cassettes, recombinant vectors and host cells containing such promoters. Transformed transgenic plant cells and plants and methods for generating them, are also described.

Promotoren zur genexpression in karyopsen von pflanzen

Kraftstoffpumpe

Eine Kraftstoffpumpe (5) mit einem Elektromotor (10) und mit einer Pumpenstufe (11) hat ein Motorgehäuse (14) mit einem einen Stator (21) des Elektromotors (10) halternden Abschnitt (24) aus Kunststoff. Der aus Kunststoff gefertigte Abschnitt (24) hat von dem Stator (21) aus gesehen auf der dem Pumpengehäuse (16) zugewandten Seite einen Rand (15). Der Rand (15) des Motorgehäuses (14) und ein Rand (17) des Pumpengehäuses (16) werden von einem Blechmantel (18) von Verrollungen (19, 20) hintergriffen. Hierdurch lässt sich die Kraftstoffpumpe (5) besonders kostengünstig fertigen.

Kraftstoffpumpe

Eine Kraftstoffpumpe (5) mit einem Elektromotor (10) und mit einer Pumpenstufe (11) hat ein Motorgehäuse (14) mit einem einen Stator (21) des Elektromotors (10) halternden Abschnitt (24) aus Kunststoff. Der aus Kunststoff gefertigte Abschnitt (24) hat von dem Stator (21) aus gesehen auf der dem Pumpengehäuse (16) zugewandten Seite einen Rand (15). Der Rand (15) des Motorgehäuses (14) und ein Rand (17) des Pumpengehäuses (16) werden von einem Blechmantel (18) von Verrollungen (19, 20) hintergriffen. Hierdurch lässt sich die Kraftstoffpumpe (5) besonders kostengünstig fertigen.

Verfahren zum betrieb eines dieselmotors

Die Erfindung betrifft ein Verfahren zum Betrieb eines Dieselmotors, bei dem ein Luftverhältnis ( lambda ) des zu verbrennenden Kraftstoffes und der zugeführten Verbrennungsluft von einer Steuereinheit (14) nach vorgegebenen Werten eingestellt wird. Bei Feststellung eines als Umschaltkriterium vorgegebenen Wertes (15) schaltet die Steuereinheit (14) auf eine Sonderbetriebsart zur Regeneration eines Katalysators (22) um und stellt das Kraftstoff/Luft-Ver hältnis nach Vorgabewerten für diese Betriebsart ein. Um eine wirkungsvollere Regeneration des Katalysators zu erreichen, ist erfindungsgemäss vorgesehen, dass in der Sonderbetriebsart mindestens eine zeitlich von einer Haupteinspritzung abgesetzte Nacheinspritzung von mitverbrennendem Kraftstoff erfolgt.

Verfahren und Vorrichtung zur Herstellung eines Gewindes an einem dünnwandigen Rohr

Verfahren zur Herstellung eines Rohres mit einem Gewinde, wobei ein Gewindedorn mit einer Mantelfläche des Rohres axial in Überdeckung gebracht wird, wodurch das Rohr eine Durchmesseränderung erfährt und das Rohr im mittels einer Matrize einer zweiten entgegengesetzten Durchmesseränderung unterzogen wird, bei der Volumenanteile des Rohres in Richtung eines Gewindeprofils des Gewindedorn verdrängt werden.

Verfahren zur herstellung von polyethercarbonatpolyolen

Die vorliegende Erfindung betrifft ein Computer-implementiertes Verfahren zur Steuerung eines Prozesses zur kontinuierlichen Herstellung von Polyethercarbonatpolyolen durch Anlagerung von Alkylenoxid (AO) und Kohlendioxid an H-funktioneller Startsubstanz, umfassend die Schritte (I) Festsetzung von Sollwerten für Prozessparameter X i , enthaltend p, T, c cat , τ, Massenströme von Alkylenoxid, Massenströme von Kohlendioxid und Massenströme von H-funktioneller Startersubstanz, (II) Experimentelle oder rechnerische Bestimmung der Konzentration an freiem Alkylenoxid cAO 0 bei den in Schritt (I) definierten Sollwerten, (III) Bestimmung der Größtfehlerberechnung für die maximale Schwankungsbreite der Parameter X i und des Einflusses der bestimmten Größtfehlerberechnung der Prozessparameter X i auf die freie Alkylenoxidkonzentration ΔcAO i , (IV) Überprüfung der Vorgabe cAO i + cAO 0 < cAO safety,max , wobei cAO i für die Summe von ΔcAO i für jede maximale Parameterschwankung steht, cAO 0 für den Wert der freien AO-Konzentration bei den in (I) definierten Sollwerten steht, cAO safety,max für den Maximalwert der freie AO-Konzentration steht, bei der eine sichere Prozessführung möglich ist, wobei bei cAO i + cAO 0 ≥ cAO safety,max die Schritte (I) bis (IV) wiederholt werden und mindestens einer der in Prozessparameter Xi enthaltenden Sollwerte in Schritt (I) variiert wird.

Schwingungsdämpfer mit eingerolltem verschluss

Schwingungsdämpfer (1) mit einem Zylinder (3), der an mindestens einem Ende einen Verschluss (5) aufweist, der auf von einer zumindest partiellen nach radial innen weisenden Sicke (27) im Zylinder (3) abgestützt ist, wobei ein zum Verschluss (5) überstehender Rand (23) auf eine äußere Deckfläche (19) des Verschlusses (5) verformt ist, wobei die nach radial innenweisende Sicke (27) im Zylinder (3) mit einer äußeren Mantelfläche (15) des Verschlusses (5) eine Formschlussverbindung (29) bildet. Die Erfindung betrifft zudem ein Verfahren zur Herstellung eines solchen Schwinungsdämpfers.

Verfahren zum herstellen eines elektronischen bauteils

Ein Verfahren zum Herstellen eines elektronischen Bauteils weist folgende Verfahrensschritte auf: Ein erstes Bauelement wird mittels eines Werkzeugs aufgenommen. Das Werkzeug wird an eine Montagefläche eines Trägers angenähert, bis ein Anschlagsbereich des Werkzeugs mit einer Referenzfläche in Kontakt kommt. Das erste Bauelement wird vom Werkzeug abgelöst.

Client-side mass data selection system

Systems and methods include presentation of a subset of a result set of items received from a remote system, reception of a command to perform an operation on all items of the result set while presenting the subset, and determination, in response to the command, of whether a total number of items in the result set exceeds a threshold value. If it is determined that the total number of items in the result set exceeds the threshold value, a first request is transmitted to the remote system to perform the operation on all items of the result set, where the first request includes filter values associated with the result set. If it is determined that the total number of items in the result set does not exceed the threshold value, a second request is transmitted to the remote system to perform the operation on all items of the result set, where the second request includes an identifier of each item of the result set.

Wärmetauscher mit befestigungselementen in insbesondere einem kraftfahrzeug

Ein Wärmetauscher (1) mit Sollbruchstellen umfassenden Befestigungselementen, in insbesondere einem Fahrzeug, soll mit wiederherstellbaren Sollbruchstellen ausgerüstet sein und nach erfolgter Ruftrennung der Sollbruchstellen einfach remontierbar sein. Zu diesem Zweck zeichnet sich ein solcher Wärmetauscher (1) durch folgende Merkmale aus, - mindestens eines der Befestigungselemente umfässt einen ersten und zweiten Bereich (6, 7; 12, 14) mit einer Schnellverschlussverbindung zwischen diesen beiden Bereichen (6, 7; 12, 14), - jeweils einer der beiden Bereiche (6; 12) ist untrennbarer Bestandteil des Wärmetauschers (1), - bei geschlossener Schnellverschlussverbindung greifen die jeweils beiden Bereiche (6, 7; 12, 14) formschlüssig fixierwirkend ineinander, - die Verschlussmittel eines der beiden Bereich (6, 7; 12, 14) sind mit mindestens einer Sollbruchstelle versehen, - das mit der mindestens einen Sollbruchstelle versehenen Verschlussmittel befindet sich an dem von dem Wärmetauscher (1) trennbaren Bereich (7, 14).

Wärmetauscher mit Befestigungselementen in insbesondere einem Kraftfahrzeug

Ein Wärmetauscher (1) mit Sollbruchstellen umfassenden Befestigungselementen, in insbesondere einem Fahrzeug, soll mit wiederherstellbaren Sollbruchstellen ausgerüstet sein und nach erfolgter Auftrennung der Sollbruchstellen einfach remontierbar sein. DOLLAR A Zu diesem Zweck zeichnet sich ein solcher Wärmetauscher (1) durch folgende Merkmale aus: DOLLAR A - Mindestens eines der Befestigungselemente umfasst einen ersten und zweiten Bereich (6, 7; 12, 14) mit einer Schnellverschlussverbindung zwischen diesen beiden Bereichen (6, 7; 12, 14), DOLLAR A - jeweils einer der beiden Bereiche (6; 12) ist untrennbarer Bestandteil des Wärmetauschers (1), DOLLAR A - bei geschlossener Schnellverschlussverbindung greifen die jeweils beiden Bereiche (6, 7; 12, 14) formschlüssig fixierwirkend ineinander, DOLLAR A - die Verschlussmittel eines der beiden Bereiche (6, 7; 12, 14) sind mit mindestens einer Sollbruchstelle versehen, DOLLAR A - das mit der mindestens einen Sollbruchstelle versehene Verschlussmittel befindet sich an dem von dem Wärmetauscher (1) trennbaren Bereich (7, 14).

Wärmetauscher mit befestigungselementen in insbesondere einem kraftfahrzeug

Ein Wärmetauscher (1) mit Sollbruchstellen umfassenden Befestigungselementen, in insbesondere einem Fahrzeug, soll mit wiederherstellbaren Sollbruchstellen ausgerüstet sein und nach erfolgter Ruftrennung der Sollbruchstellen einfach remontierbar sein. Zu diesem Zweck zeichnet sich ein solcher Wärmetauscher (1) durch folgende Merkmale aus, - mindestens eines der Befestigungselemente umfässt einen ersten und zweiten Bereich (6, 7; 12, 14) mit einer Schnellverschlussverbindung zwischen diesen beiden Bereichen (6, 7; 12, 14), - jeweils einer der beiden Bereiche (6; 12) ist untrennbarer Bestandteil des Wärmetauschers (1), - bei geschlossener Schnellverschlussverbindung greifen die jeweils beiden Bereiche (6, 7; 12, 14) formschlüssig fixierwirkend ineinander, - die Verschlussmittel eines der beiden Bereich (6, 7; 12, 14) sind mit mindestens einer Sollbruchstelle versehen, - das mit der mindestens einen Sollbruchstelle versehenen Verschlussmittel befindet sich an dem von dem Wärmetauscher (1) trennbaren Bereich (7, 14).