Настройки

Укажите год
-

Небесная энциклопедия

Космические корабли и станции, автоматические КА и методы их проектирования, бортовые комплексы управления, системы и средства жизнеобеспечения, особенности технологии производства ракетно-космических систем

Подробнее
-

Мониторинг СМИ

Мониторинг СМИ и социальных сетей. Сканирование интернета, новостных сайтов, специализированных контентных площадок на базе мессенджеров. Гибкие настройки фильтров и первоначальных источников.

Подробнее

Форма поиска

Поддерживает ввод нескольких поисковых фраз (по одной на строку). При поиске обеспечивает поддержку морфологии русского и английского языка
Ведите корректный номера.
Ведите корректный номера.
Ведите корректный номера.
Ведите корректный номера.
Укажите год
Укажите год

Применить Всего найдено 8. Отображено 8.
23-06-2023 дата публикации

Control method and device applied to methanol preparation, electronic equipment and readable medium

Номер: CN116283487A
Принадлежит:

The embodiment of the invention discloses a control method and device applied to methanol preparation, electronic equipment and a readable medium. A specific embodiment of the method comprises the following steps: controlling an input rate of a raw material corresponding to raw material information and a preparation state of an intermediate product; determining a real-time methanol prediction preparation amount; generating intermediate product preparation optimization information according to the target methanol preparation amount, the real-time predicted methanol preparation amount and the real-time raw material input ratio; in response to determining that the real-time intermediate product generation amount corresponding to the real-time intermediate product information is smaller than the intermediate product theoretical amount corresponding to the theoretical intermediate product information, performing configuration information updating on the initial intermediate product configuration ...

Подробнее
27-08-2014 дата публикации

Fluorescent quantitative PCR detection kit of Shigella, and detection method thereof

Номер: CN104004827A
Принадлежит:

The invention relates to a fluorescent quantitative PCR detection kit of Shigella, and a detection method thereof. The kit comprises a DNA extract liquid, a PCR reaction solution, a Taq enzyme and UNG enzyme mixed solution, Shigella positive control and negative control; and specific primer sequences comprise F Sequence(5'-3'):GTTCCTTGACCGCCTTTCCGAT and R Sequence(5'-3'):AAGCTCCGCAGAGGCACTGAGT, and the sequence of a probe is CTGCACGCAATACCTCCGGATTCC Modification:5'6-FAM,3'BHQl. The kit has the advantages of high sensitivity, good stability, convenience and fastness when the kit is used to detect Shigella in a tested sample.

Подробнее
06-06-2023 дата публикации

High slope protection structure and use method thereof

Номер: CN116220071A
Принадлежит:

The high slope protection structure comprises a protection plate, a supporting plate and a fixing column, the supporting plate is installed at the top of the protection plate in a penetrating mode, the fixing column is installed at the bottom of the protection plate in a penetrating mode, a threaded sleeve is installed at one end of the fixing column in a penetrating mode, and a threaded rod is installed on the inner wall of the threaded sleeve in a penetrating mode. By installing the threaded sleeve, the connecting rod and the pulley, the effect of firmer connection between the structure and soil is achieved, the fixing column is inserted into the high slope soil, the threaded rod is rotated to drive the bearing to rotate, the bearing rotates to enable the threaded rod to drive the first supporting rod to move through the threaded sleeve, and the first supporting rod moves to drive the pulley to move; the pulley moves to enable the first supporting rod to drive the connecting rod to move ...

Подробнее
29-08-2023 дата публикации

Drilling machine for stone blasting and using method

Номер: CN116658084A
Принадлежит:

The drilling machine comprises a main body, collecting plates and a lubricating box, the two sets of collecting plates are installed on the inner bottom wall of the main body, a moving rod is installed on the outer walls of the collecting plates in a penetrating mode, a cleaning plate is installed at one end of the moving rod, and a through hole is formed in the outer wall of the moving rod; a collecting plate is installed on the inner wall of the main body, a plurality of guide wheels are installed on the outer wall of the collecting plate, a first motor is installed on the inner bottom wall of the main body, a take-up shaft is installed at the output end of the first motor, a lubricating box is installed on the inner wall of the main body, and a fixing plate is installed on the inner wall of the main body. The cleaning function can be achieved by installing a collecting plate, when the drill rod is taken back, a first motor drives a take-up shaft to rotate, so that a cable is shrunk, ...

Подробнее
05-02-2014 дата публикации

Manufacturing method of collagen coffee

Номер: CN103549091A
Принадлежит:

The invention relates to a manufacturing method of collagen coffee. The collagen coffee takes hydrolyzed fish collagen powder and coffee powder as main raw materials and is additionally provided with white granulated sugar (or not), non-dairy creamer and malto dextrin. The manufacturing method comprises the main processes of burdening, evenly mixing and packaging. The collagen coffee has the advantages of being reasonable in proportion, good in taste, convenient to eat, free of toxic and side effects, simple in process and easy to produce, has great market development potential, and fills up the market vacancy.

Подробнее
05-02-2014 дата публикации

Health-care wine for tonifying kidney and strengthening yang

Номер: CN103555535A
Принадлежит:

The invention relates to health-care wine for tonifying kidney and strengthening yang. The health-care wine is refined from a new resource food, namely Maca, and medicinal and edible raw materials, namely longan aril, semen ziziphi spinosae, medlar, poria cocos, Chinese date, orange peel, cortex cinnamomi and high wine through the traditional soaking process. The health-care wine disclosed by the invention has obvious health-care effects of tonifying kidney and strengthening yang through test and observation.

Подробнее
25-03-2015 дата публикации

Gene-specific molecular marker Pi2SSR for blast resistance genes Pi2 as well as preparation method and applications of gene-specific molecular marker Pi2SSR

Номер: CN104450932A
Принадлежит:

The invention discloses a gene-specific molecular marker Pi2SSR for blast resistance genes Pi2. The molecular marker Pi2SSR is a nucleotide sequence amplified from a rice genome DNA through primer pairs SEQIDNO.1 and SEQIDNO.2, and achieves a specific banding pattern with blast resistance genes Pi2. The molecular marker disclosed by the invention is the first Pi2 gene-specific SSR marker developed for inner sequences of Pi2 genes, and has the advantages of high specificity, low cost and high flux, and therefore, the marker can be widely applied to colonies with different genetic backgrounds.

Подробнее
09-07-2014 дата публикации

Health care medicinal liquor for decreasing high blood pressure, high blood glucose, and high blood lipid

Номер: CN103908599A
Принадлежит:

The invention relates to health care medicinal liquor for decreasing 'three highs', which is refined by a traditional soaking process from raw materials with homology of medicine and food, wherein the raw materials comprise allium macrostemon, haws, lotus leaves, coix seeds, chrysanthemum, kudzu roots, stir-fried radish seeds, chicken's gizzard membrane, and high-degree liquor. Tests and observation show that the health care medicinal liquor has obvious health care effect on decreasing high blood pressure, high blood glucose, and high blood lipid.

Подробнее