Diesel oil tank of medium-sized excavator

The utility model discloses a medium-sized excavator diesel oil tank which comprises a diesel oil tank body, an upper sealing plate is a step type upper sealing plate, the uppermost layer of the step type upper sealing plate is a top sealing plate of the diesel oil tank body, a top sealing plate installation base is arranged on the surface of the top sealing plate, and a top anti-skid plate is installed on the surface of the top sealing plate through the top sealing plate installation base. A plurality of step surfaces are formed at the step type upper sealing plate, the surface of each step surface is provided with a step anti-skid plate mounting base, and the step anti-skid plates are mounted on the upper surfaces of the step surfaces through the step anti-skid plate mounting bases. The front step type appearance design is adopted, a cantilever type getting-on pedal is omitted, a user can directly step on the steps to get on and off the whole machine, and a threaded seat is welded to ...

Major possession waste material pyrolysis professional equipment

The utility model discloses a major possession waste material pyrolysis professional equipment, including the support, with the front end articulated bracket of support, a plurality of bearing roller,crimping in furnace body, a drive arrangement and the 2nd drive arrangement on the bearing roller. The bearing roller set up in pairs in the both sides of bracket, just the length direction of bearing roller is along the front and back to the setting. A drive arrangement with at least one drive in a plurality of bearing rollers is connected for through the drive with the roller rotation that thedrive arrangement drive is connected drives the furnace body rotates, the 2nd drive arrangement is used for driving the bracket for the support rotates. The utility model discloses can adjust the timethrough the major possession rubbish of disassembling bears high temperature in the furnace body through the inclination of adjustment furnace body.

Major possession waste material pyrolysis professional equipment

The utility model discloses a major possession waste material pyrolysis professional equipment, including support, a plurality of bearing roller, furnace body, insulation band and drive arrangement. The bearing roller set up in pairs in the both sides of support, just the length direction of bearing roller is along the front and back to the setting. The furnace body crimping in set up on the bearing roller and from preceding slope up backward. Insulation band is the annular and centers on the outside of the bearing roller that sets up in pairs sets up, has to be located the furnace body with thermal -insulated portion between the crimping position of bearing roller. Drive arrangement with at least one drive in a plurality of bearing rollers is connected for through the drive with the roller rotation that the drive arrangement drive is connected drives the furnace body rotates. The utility model discloses simple structure can prevent that yin gaowen from transmitting to actuating mechanism ...

Charging and discharging control method and charging and discharging pile

The invention belongs to the technical field of new energy automobile charging, and particularly relates to a charging and discharging pile which comprises a frame body, a controller and a charging gun, the controller is fixedly connected to the frame body, a charging wire electrically connected to the charging gun is electrically connected with external mains supply, and the charging wire penetrates through a wire penetrating groove formed in the frame body to be wound on a winch. And the charging wire close to the charging gun is provided with an adapter. According to the charging pile, the conversion connector for converting connection requirements of different models is arranged on the charging gun, so that the charging gun can be connected with vehicles of different models for use, the application range of the charging pile is expanded, meanwhile, a charging wire of the charging gun is wound and stored through a winch, is directly pulled out for use during use and is wound and stored ...

Kitchen garbage dehydrator

The utility model discloses a kitchen garbage dehydrator, and relates to the technical field of kitchen garbage, the kitchen garbage dehydrator comprises a machine body, the top of the machine body is fixedly connected with a shell, the top of the shell is embedded with an exhaust fan, and the top of the machine body is fixedly connected with a gas collection chamber corresponding to the exhaust fan. An exhaust pipe is fixedly connected to the surface of the air collecting chamber, a box body is fixedly connected to the surface of the machine body, the bottom of the exhaust pipe penetrates through the box body and is fixedly connected with a circular ring, an air filter element is slidably connected to the bottom of the circular ring, and a moving plate is slidably connected to the bottom of the air filter element. By arranging the exhaust fan, the shell, the air filter element and the box body, when the air purifier is used, peculiar smell generated by the machine body is exhausted into ...

Carrier roller replacing device and continuous annealing line dryer

The utility model discloses a carrier roller replacing device and a continuous annealing line dryer, and belongs to the technical field of cold rolling continuous annealing. The carrier roller replacing device comprises a base, a driving mechanism, two connecting rods and a plurality of supporting wheels. Wherein the base is fixedly connected with the rack; the fixed end of the driving mechanism is fixedly arranged on the rack, and the action end of the driving mechanism is hinged to the ends of the two connecting rods. The first ends of the plurality of supporting wheels are rotatably arranged between the two connecting rods, and the second ends of the plurality of supporting wheels are rotatably connected with the base; and the carrier rollers are arranged on the plurality of supporting wheels. The carrier roller replacing device and the continuous annealing line dryer are convenient to operate, low in labor intensity of workers and high in production efficiency.

Method for identifying abamectin-resistant diamond back moth population

Data processing method and system, electronic equipment and storage medium

The invention provides a data processing method and system, electronic equipment and a storage medium, and the method comprises the steps: obtaining a data processing thread used for processing obtained to-be-processed data, and obtaining a task obtaining thread corresponding to the to-be-processed data according to a user unique identifier of the to-be-processed data; the obtained data processing thread is added to a data processing thread cache pool corresponding to the task obtaining thread; executing the task obtaining threads to enable the data processing threads in the corresponding data processing thread cache pools to be executed in sequence; and according to the executed data processing thread, processing the corresponding data to be processed. According to the method and the device, the data of different users can be placed in different threads to be processed, and the data of the same user can be sequentially and serially processed, so that the orderliness of user data processing ...

Kitchen waste compost processor

The utility model relates to the technical field of kitchen garbage treatment, and discloses a kitchen garbage compost treatment machine which comprises a box body, a circular groove is formed in the box body, a semicircular storage shell is arranged in the circular groove, a fixing disc is fixedly installed on the side face of the semicircular storage shell, and a handle is fixedly connected to the side face of the fixing disc. According to the kitchen waste compost processor, a semicircular storage shell on the side face of a fixed disc is driven by a handle to be pulled out of a circular groove in a box body, kitchen waste is placed in the semicircular storage shell and then inserted into the circular groove, the handle is rotated to pour out the waste in the semicircular storage shell and then pulled out, an insertion block is inserted into an insertion groove, and a hydraulic cylinder is controlled to drive an extrusion plate to conduct extrusion; water and organic matter in the kitchen ...

Intelligent charging and discharging platform based on Internet of Things

The invention belongs to the technical field of storage battery charging, and particularly relates to an intelligent charging and discharging platform based on the Internet of Things, the intelligent charging and discharging platform comprises a base, the top of the base is equidistantly provided with placing grooves for placing storage batteries, the top of the base is fixedly provided with an L-shaped plate, and the top of the L-shaped plate is fixedly provided with a first electric push rod. The device is provided with the placing groove, the L-shaped plate, the first electric push rod, the bearing plate, the second electric push rod, a sliding plate, a connecting rod, a connecting block, a bracket block, a guide rod, an insulating connecting rod, a conductive head, a storage battery charger, a positive power transmission line, a negative power transmission line, a positive conductive rod, a negative conductive rod, a first fixing block, a second fixing block, a positive charging wire ...

Ceramic-plate-like dye sensitization battery photovoltaic building component

The invention discloses a ceramic-plate-like dye sensitization battery photovoltaic building component and belongs to the technical field of photovoltaic power generation. The ceramic-plate-like dye sensitization battery photovoltaic building component mainly comprises monomer dye sensitization batteries, high-light-transmitting tempered glass, a laminated part, a fluorine-containing back plate, a junction box and an aluminum alloy frame; the monomer dye sensitization batteries form into an integrity in a series connection mode through a tin-plating copper belt, the high-light-transmitting tempered glass, a low-temperature EVA and the fluorine-containing back plate are packaged and laminated into a whole, then the alloy frame is installed at the periphery of the laminated part, the photovoltaic junction box is installed, and finally the ceramic-plate-like dye sensitization battery photovoltaic building component is formed. The ceramic-plate-like dye sensitization battery photovoltaic building ...

Air conditioner refrigerant pipeline structure for small excavator

The utility model relates to an air conditioner refrigerant pipeline structure for a small excavator. The system comprises a condenser, an air-conditioning compressor and an evaporator, characterizedin that it is characterized in that it comprises, the high-pressure refrigerant port is connected with an inlet of the condenser; the high-pressure refrigerant opening is connected with the air conditioner compressor through an air conditioner high-pressure refrigerant pipe, the air conditioner compressor is connected with the evaporator through a U-shaped air conditioner low-pressure refrigerantpipe, a low-pressure refrigerant opening is formed in the U-shaped section of the air conditioner low-pressure refrigerant pipe, and the high-pressure refrigerant opening and the low-pressure refrigerant opening are both located on the outer side of the small excavator. The device is convenient and simple to install, the residual space can be reasonably utilized, and instrument interference causedby ...

15 W portable solar energy power supply

The invention discloses a 15 W portable solar energy power supply. The 15 W portable solar energy power supply comprises a 15 W photovoltaic assembly and a storage power supply assembly. The 15 W photovoltaic assembly and the storage power supply assembly are integrated and connected to form an integral body. The storage power supply assembly comprises an installation plate and a charging controller, an energy storage battery, a first DC-DC conversion module and a second DC-DC conversion module which are installed on the installation plate, wherein the input of the charging controller is connected with the output of the 15 W photovoltaic assembly, the output of the charging controller is connected with the input of the energy storage battery, and the output of the energy storage battery is respectively connected with the first DC-DC conversion module and the second DC-DC conversion module. The 15 W portable solar energy power supply employs an integrated design, the size is small, the weight ...

Method for identifying abamectin-resistant diamond back moth population

The invention discloses a method for identifying an abamectin-resistant diamond back moth population, belonging to a molecular identification technology for vegetable pests. The method comprises the following steps of: (1) randomly catching 5-15 diamond back moths from a population to be detected and respectively preparing cDNA (complementary Deoxyribonucleic Acid) of each diamond back moth, i.e., 10 repeated samples to be detected; (2) preparing the cDNA of a diamond back moth sensitive population, i.e., a negative comparison sample; (3) undergoing a fluorescent quantitative PCR (Polymerase Chain Reaction) by taking the samples to be detected and the negative comparison sample as templates; and (4) counting and comparing whether a remarkable difference exists between the yields of fluorescent quantitative PCR products of the samples to be detected and the negative comparison sample. The method is characterized in that: a primer adopted in the fluorescent quantitative PCR is YG-S16:CGTCTACATCCGCATCTTCC ...

Composite energy structure micro-grid monitoring platform based on energy management

The invention relates to a composite energy structure micro-grid monitoring platform based on energy management and belongs to the field of photovoltaic monitoring. The composite energy structure micro-grid monitoring platform based on energy management is structurally composed of a human-machine operation interface, a local monitor, an industrial control computer, an energy management system (EMS), an isolated RS485 concentrator and a remote monitor, wherein the local monitor is internally provided with the human-machine operation interface and is connected with the industrial control computer through the isolated RS485 concentrator, the remote monitor receives data of the industrial control computer through network transmission, the industrial control computer is connected with the EMS, the EMS is provided with a main control board and an input and output port and is connected with the isolated RS485 concentrator, and the EMS collects information and loads of various distributed power ...

Air inlet duct anti-icing device and aero-engine

The invention relates to an air inlet channel anti-icing device and an aero-engine, the air inlet channel anti-icing device comprises an air inlet assembly, the air inlet assembly comprises an inner cabin, an outer cabin and a lip piece which are coaxially arranged, an air inlet channel is formed in the radial inner side of the inner cabin, and the two ends of the inner cabin and the two ends of the outer cabin are connected through a first mounting plate and a second mounting plate correspondingly; the lip piece is connected to the same end of the inner cabin and the outer cabin and located on the outer side of the first mounting plate in the axial direction, and an annular cavity is defined by the first mounting plate and the lip piece; the anti-icing assembly comprises an air guiding pipe and a spraying component, the air guiding pipe extends between the inner cabin and the outer cabin and is mounted on the first mounting plate and the second mounting plate, the spraying component is ...

Special transport vechicle of major possession rubbish

The utility model discloses a special transport vechicle of major possession rubbish, including car owner's body, railway carriage, arm and controller, the railway carriage is installed on car owner'sbody, is equipped with the feeder hopper on the railway carriage, is equipped with in the railway carriage to be used for carrying out broken garbage crushing device and installing major possession rubbish being used for the garbage compression device to the major possession rubbish compress after the breakage in the railway carriage, being equipped with first discharge gate on the railway carriage, first discharge gate lower extreme is equipped with fixing device for fixed garbage bin, arm are installed and be used for snatching major possession rubbish on car owner's bodies, and the controller is used for the control machinery arm to move on locating car owner's body. The utility model discloses add the manipulator that is used for snatching major possession rubbish through the car owner ...

Method for stabilizing fly ash of municipal incinerator, and utilization of resource

30 W portable solar energy power supply

The invention discloses a 30 W portable solar energy power supply.. The 30 W portable solar energy power supply comprises a 30 W photovoltaic assembly and a source chamber. The 30 W photovoltaic assembly and the source chamber are two mutually independent assemblies and are connected through a wire. The source chamber is internally provided with a charging controller, an energy storage battery, a first DC-DC conversion module and a second DC-DC conversion module, wherein the input of the charging controller is connected with the output of the 30 W photovoltaic assembly, the output of the charging controller is connected with the input of the energy storage battery, and the output of the energy storage battery is respectively connected with the first DC-DC conversion module and the second DC-DC conversion module. The 30 W portable solar energy power supply employs a split type design, the size is small, the weight is light, and the carrying is convenient. When power is needed, the output ...

One-driving-two correlation type grating position adjusting device

The invention provides a one-driving-two correlation type grating position adjusting device, and relates to an adjusting device, the one-driving-two correlation type grating position adjusting device comprises a base assembly, a collision ruler assembly and a graduated scale assembly, and the collision ruler assembly is arranged on the base assembly and is in sliding connection with the base assembly; the collision ruler assembly is in contact with the cylinder and serves as a mechanical zero position; the graduated scale assembly is arranged on the base assembly and is in sliding connection with the base assembly; the graduated scale assembly moves a graduated zero value and is located at the same position with the collision scale assembly, and zero marking is conducted on the mechanical zero position. According to the invention, the problems of inaccurate adjustment precision and repeated adjustment caused by oblique shooting of the switch position are solved; when the device is used, ...

Special transport vechicle of major possession rubbish

The utility model discloses a special transport vechicle of major possession rubbish, including the car owner body, railway carriage and elevating gear, the bottom is equipped with the filter in the railway carriage, and the filter is isolated for epicoele and cavity of resorption with the railway carriage inner chamber, and the department is equipped with the baffle in the middle of the cavity ofresorption, and the baffle is equipped with water tank and antiseptic solution storage tank for back cavity and ante -chamber with the cavity of resorption is isolated in the back cavity, be equippedwith first ooff valve on the position of the corresponding water tank of railway carriage lateral surface, and elevating gear installs and is used for the from bottom to top to transport major possession rubbish on the surface of railway carriage rear end so that in major possession rubbish pours the railway carriage into. The utility model discloses technical scheme is through addding the elevating ...

Fuel tank sealing performance detection device

The utility model discloses a fuel tank sealing performance detection device. The water tank is characterized by comprising a water tank body, a water outlet is formed in the bottom of the water tankbody, a water injection groove is formed in the top of the water tank body, an overflow groove is formed below the water injection groove, a stop valve is arranged on the water outlet, a supporting frame is arranged in the water tank body, a hydraulic lifting system is arranged on the supporting frame, and a fuel tank control cover for fixing a fuel tank is connected with the hydraulic lifting system. The leakage point detection device can accurately find out leakage points, is simple to operate and low in cost, and has the advantages of simple structure, high stability, simplicity and convenience in operation, practicability, improvement of efficiency, reduction of labor intensity and the like.