ЗАМЕЩЕННЫЕ ПРОИЗВОДНЫЕ НОРБОРНИЛАМИНА, СПОСОБ ИХ ПОЛУЧЕНИЯ И ЛЕКАРСТВЕННОЕ СРЕДСТВО

Изобретение относится к новым замещенным производным норборниламина с экзоконфигурацией азота и эндоаннелированными пяти-шестичленными циклами формулы (I) и с экэо-конфигурацией азота и экзоаннелированными пяти-шестичленными циклами формулы (Ia), а также их фармацевтически приемлемым солям или трифторацетатам, которые могут быть использованы для получения лекарственных средств, пригодных для лечения или профилактики нарушений дыхательного импульса, в частности обусловленных сном нарушений дыхания, таких как временная остановка дыхания во время сна, храпа, для лечения или профилактики острых и хронических почечных заболеваний, в частности острой почечной недостаточности и хронической почечной недостаточности, нарушений функции кишечника, желчного пузыря, ишемических состояний периферической и центральной нервной системы и острых приступов и др. Соединения изобретения являются ингибиторами натрийпротонного обмена, влияют на сывороточный липопротеин и поэтому могут быть использованы для профилактики ...

ЛИГАНДЫ TLR3, КОТОРЫЕ АКТИВИРУЮТ КАК ЭПИТЕЛИАЛЬНЫЕ, ТАК И МИЕЛОИДНЫЕ КЛЕТКИ

Изобретение относится к биотехнологии и медицине, в частности к композиции, содержащей двухцепочечную РНК (дцРНК), имеющую две комплементарные цепи, включающие по меньшей мере один блок поли(А) и комплементарный блок поли(U), причем каждая цепь имеет длину от 50 до 200 оснований, предпочтительно от 55 до 200 оснований, а также фармацевтически приемлемый растворитель, носитель или вспомогательное вещество для использования в способе лечения рака, экспрессирующего рецептор TLR3. Изобретение предлагает дцРНК, способные как активировать миелоидные клетки, так и запускать гибель эпителиальных раковых клеток. 3 н. и 16 з.п. ф-лы, 20 ил., 5 табл., 20 пр.

Способ изменения функционального состояния мРНК, обеспечивающий ее избирательное и специфическое распознавание

Предложенная группа изобретений относится к области медицины. Предложена конструкция для связывания последовательностей-мишеней нуклеиновой кислоты, содержащая две комплементарные последовательности олигонуклеотидов длиной до 20 нуклеотидов, отдаленных друг от друга посредством полимерного связующего фрагмента, конечная длина которого составляет от 10 до 100 ангстрем на основе расстояния между нуклеотидами в линейной, полностью удлиненной нуклеиновой кислоте. Предложен раствор для нацеливания на опухолевые клетки, содержащий указанную конструкцию. Предложен способ связывания конструкции с последовательностью-мишенью нуклеиновой кислоты, обеспечивающий избирательное распознавание нуклеиновой кислоты-мишени, включающий контактирование нуклеиновой кислоты-мишени с конструкцией для формирования гетеродуплекса. Предложен способ лечения пациента, страдающего от рака и способ диагностики рака. Предложенная группа изобретений обеспечивает образование стабильного гетеродуплекса и избирательное распознавание ...

ПОЛИНУКЛЕОТИД С УКОРОЧЕННОЙ ЦЕПЬЮ И СПОСОБ ЕГО ПОЛУЧЕНИЯ

В настоящем изобретении предлагается полинуклеотид со средней длиной цепи от 0,1 до 1 тыс. оснований, в котором доля 2’-5’ фосфодиэфирных связей составляет от 0,1 до 3% от общего числа фосфодиэфирных связей, или его соль. Полинуклеотид представляет собой полиинозиновую кислоту (поли(I)), полицитидиловую кислоту (поли(С)), полиадениловую кислоту (поли(А)) или полиуридиловую кислоту (поли(U)). Способ получения полинуклеотида включает гидролиз в растворе при pH от 7 до 10 и температуре от 20 до 110°С или обработку фосфодиэстеразой при pH от 4 до 9 и температуре от 20 до 60°С. Также изобретение относится к фармацевтической композиции, представляющей собой интерферон-индуцирующий агент, иммуноактивирующий агент и др., включающей указанный полинуклеотид. 5 с. и 3 з.п. ф-лы, 8 табл.

СРЕДСТВО ДЛЯ ЛЕЧЕНИЯ ФИБРОЗА ПОЧЕК

Настоящее изобретение относится к носителю для доставки вещества в продуцирующие внеклеточный матрикс клетки в почке, причем носитель содержит ретиноид в качестве нацеливающего агента. Настоящее изобретение также относится к средству для лечения фиброза почек вследствие диабетического нефрита и уменьшения фиброза в мезангиальной области и окружающей среде тубулярных клеток, в котором применяется указанный носитель. Кроме того, настоящее изобретение относится к способам получения носителя и средства, наборам для получения и способу и тому подобному для лечения фиброза почек с применением средства для лечения фиброза почек. 4 н. и 6 з.п. ф-лы, 3 ил., 3 пр.

МОДУЛЯЦИЯ ЭКСПРЕССИИ HSP47

Изобретение относится к области биохимии, в частности к молекулам нуклеиновой кислоты для модуляции экспрессии генов-мишеней. Заявлена двухцепочечная молекула нуклеиновой кислоты для ингибирования экспрессии гена белка теплового шока 47 (hsp47). Также представлены композиция, включающая указанную молекулу нуклеиновой кислоты, и способ лечения пациента, страдающего от заболевания, связанного с hsp47. Изобретение может быть использовано для лечения ассоциированных с hsp47 состояний и нарушений, таких как фиброз печени, фиброз легких, фиброз брюшины и фиброз почек. 3 н. и 22 з.п. ф-лы, 27 ил., 31 табл., 10 пр.

БИОКОМПОЗИТ ДЛЯ ОБЕСПЕЧЕНИЯ ВОССТАНОВИТЕЛЬНЫХ ПРОЦЕССОВ ПОСЛЕ ПОВРЕЖДЕНИЯ У МЛЕКОПИТАЮЩЕГО, СПОСОБ ЕГО ПОЛУЧЕНИЯ (ВАРИАНТЫ) И ПРИМЕНЕНИЯ

Предложенная группа изобретений относится к области медицины и ветеринарии. Предложен биокомпозит для обеспечения восстановительных процессов после повреждения у млекопитающего, содержащий носитель, по меньшей мере одну нуклеиновую кислоту, содержащую гены, кодирующие VEGF и/или SDF-1, и клетки, обеспечивающие репаративную регенерацию. Предложены способы получения вышеуказанного биокомпозита и набор для его приготовления. Предложены также способ обеспечения заживления повреждения у млекопитающего и способ доставки нуклеиновой кислоты. Предложенная группа изобретений обеспечивает эффективную регенерацию тканей после повреждения у млекопитающего за счет использования трехкомпонентного биокомпозита, состоящего из носителя, по меньшей мере одной нуклеиновой кислоты и клеток, обеспечивающих репаративную регенерацию. 7 н. и 9 з.п. ф-лы, 4 ил., 4 пр.

КОМПОЗИЦИИ И СПОСОБЫ МОДУЛЯЦИИ SMN2 СПЛАЙСИНГА У СУБЪЕКТА

Изобретение относится к области медицины и предназначено для лечения спинальной мышечной атрофии (СМА). Способ включает введение посредством болюсной инъекции в интратекальное пространство субъекта, являющегося человеком, антисмыслового соединения, содержащего антисмысловой олигонуклеотид, состоящий из 18 связанных нуклеозидов, где каждая межнуклеозидная связь олигонуклеотида представляет собой фосфоротиоатную связь, где каждый нуклеозид олигонуклеотида представляет собой 2'-МОЭ нуклеозид и где введение антисмыслового соединения усиливает включение экзона 7 в SMN2 мРНК транскриптах у субъекта, являющегося человеком. Изобретение обеспечивает эффективное лечение СМА типов I, II и III. 11 з.п. ф-лы, 13 ил., 14 табл., 14 пр.

ИНЪЕКЦИОННАЯ КОМПОЗИЦИЯ ПОЛИДЕЗОКСИРИБОНУКЛЕОТИДОВ ДЛЯ ЛЕЧЕНИЯ КОСТНО-СУСТАВНЫХ ЗАБОЛЕВАНИЙ

Описана фармацевтическая композиция на основе полидезоксирибонуклеотидов, экстрагированных из естественных источников. Композиция содержит фракцию полидезоксирибонуклеотидов, экстрагированных из спермы рыб, где указанные полидезоксирибонуклеотиды обладают полимерными цепями с различными молекулярными массами от 70 килодальтонов до 240 килодальтонов. Композиция пригодна для применения в качестве терапевтического средства при лечении костно-суставных патологий, особенно остеоартрита, путем внутрисуставной инъекции, обеспечивая необходимую вязкость синовиальной жидкости. 2 н. и 6 з.п. ф-лы, 13 ил.

Изготовление и хранение липосомальных РНК-составов, подходящих для терапии

Настоящее раскрытие относится к медицине, в частности к способу получения РНК-липоплексных частиц для доставки РНК в ткани-мишени после парентерального введения и композиции, содержащей такие частицы. Для осуществления указанного способа смешивают раствор, содержащий РНК и имеющий ионную силу, соответствующую хлориду натрия в концентрации от около 50 мМ до около 300 мМ, и раствор, содержащий катионные липосомы в контролируемых условиях смешивания. При этом объединенный поток первого раствора и второго раствора характеризуется числом Рейнольдса более 300. В результате получают РНК-липоплексные частицы, имеющие средний диаметр, который находится в диапазоне от около 300 нм до около 500 нм, и имеющие индекс полидисперсности менее чем 0,2. Настоящее изобретение позволяет повысить эффективность трансляции РНК в пептид или белок, который она кодирует при доставке РНК в клетку-мишень, а также повысить стабильность композиций при хранении без существенной потери качества продукта, в частности, ...

Реагенты для лечения окулофарингеальной мышечной дистрофии (OPMD) и их применение

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая конструкцию для ДНК-направленной РНК-интерференции (ddRNAi), вектор экспрессии, содержащий вышеуказанную конструкцию, композицию для ингибирования экспрессии белка PABPN1, который является причиной окулофарингеальной мышечной дистрофии (OPMD), способ подавления экспрессии белка PABPN1, способ лечения окулофарингеальной мышечной дистрофии (варианты) и набор для лечения окулофарингеальной мышечной дистрофии. В одном из вариантов реализации изобретения конструкция ddRNAi содержит в себе последовательность ДНК, кодирующую шпилечную РНК, содержащую эффекторную последовательность из по меньшей мере 17 смежных нуклеотидов, которая по существу комплементарна области транскрипта РНК, соответствующей белку PABPN1, где область транскрипта РНК приведена под любым из SEQ ID NO: 1-3. Изобретение расширяет арсенал средств для ДНК-направленной РНК-интерференции. 7 н. и 26 з.п. ф-лы, 8 ил., 5 табл., 4 пр.

СПОСОБ РЕГИОНАРНОЙ ЛИМФОТРОПНОЙ ТЕРАПИИ ПРИ ПАРАПРОКТИТЕ

Изобретение относится к области медицины, а именно к проктологии, может быть использовано для регионарной лимфотропной терапии парапроктита. Для этого осуществляют вскрытие, дренирование, санацию гнойного очага. После чего в послеоперационном периоде лекарственные препараты вводят подкожно, на границе средней и нижней трети голени по следующей схеме. Сначала вводят 32 ЕД лидазы, разведенной в 2 мл 0,25% новокаина. Затем через 5-10 минут вводят 1000 мг цефалоспорина третьего поколения, разведенного в 5 мл 0,25% новокаина 1 раз в сутки в течение 5 дней. После чего вводят раствор дерината 5 мл 1 раз в двое суток в количестве 4 инъекций. Изобретение обеспечивает санацию лимфатического русла и восстановление его функции и позволяет уменьшить число рецидивов заболевания и послеоперационных осложнений у пациентов с паропроктитом. 1 пр.

СПОСОБ ЛЕЧЕНИЯ АБСЦЕССОВ ПЕЧЕНИ У ДЕТЕЙ

Изобретение относится к медицине, а именно к абдоминальной хирургии, гепатологии и методам детоксикации, и может быть использовано для лечения абсцессов печени различной этиологии. Для этого после санации гнойного очага полость абсцесса печени обрабатывают 0,25% раствором дерината, затем проводят забор крови в количестве 150-200 мл крови, после центрифугирования которой эритроциты возвращают больному, а лейкоциты экстракорпорально обрабатывают 0,5% раствором глутоксима в дозе 1 мл и разводят в 50-100 мл 0,9% раствора NaCl с последующим внутривенным капельным их введением, и со следующих суток вводят в полость 0,25% раствор дерината в дозе 1,5 мл один раз в день в течение 5 дней. Способ позволяет сократить продолжительность лечения и снизить количество осложнений за счет улучшения показателей активности клеточного звена, связанного с повышением количественных показателей Т-хелперов и Т-супрессоров на фоне увеличения фагоцитарной активности нейтрофилов, а также купированием процессов эритродиереза ...

КОМПОЗИЦИЯ ДЛЯ ПРЕДУПРЕЖДЕНИЯ ИЛИ ЛЕЧЕНИЯ ЗАБОЛЕВАНИЯ, СВЯЗАННОГО С ОЖИРЕНИЕМ, СОДЕРЖАЩАЯ АМФИРЕГУЛИН-СПЕЦИФИЧЕСКУЮ ДВУХЦЕПОЧЕЧНУЮ ОЛИГОНУКЛЕОТИДНУЮ СТРУКТУРУ

Изобретение относится к композиции для лечения или предупреждения ожирения. Предложено применение фармацевтической композиции, содержащей амфирегулин-специфический двухцепочечный олигонуклеотид, двухцепочечную олиго-РНК, которая содержит гидрофильные и гидрофобные соединения, соединенные с амфирегулин-специфическим двухцепочечным олигонуклеотидом, или наночастицы, содержащие двухцепочечную олиго-РНК. Амфирегулин-специфический двухцепочечный олигонуклеотид содержит последовательность, выбранную из SEQ ID NO: 10, 11 и 12, и антисмысловую цепь, комплементарную последовательности смысловой цепи. Изобретение обеспечивает потерю веса, снижение коэффициента пищевой эффективности, уменьшение подкожного жира, уменьшение висцерального жира, уменьшение площади адипоцитов и ингибирование адипогенеза печени. 23 з.п. ф-лы, 28 ил., 10 табл., 10 пр.

СПОСОБЫ И ФАРМАЦЕВТИЧЕСКИЕ КОМПОЗИЦИИ ДЛЯ ЛЕЧЕНИЯ ЗАБОЛЕВАНИЙ, СВЯЗАННЫХ С ТУБУЛИН КАРБОКСИПЕПТИДАЗАМИ (TCP)

Группа изобретений касается лечения заболеваний, связанных с тубулин карбоксипептидазой (TCP), и скрининга соединений, пригодных для лечения таких заболеваний. Предлагается применение ингибитора экспрессии или активности комплекса вазогибин/SVBP (малый вазогибин-связывающий белок) для лечения заболевания, связанного с циклом детирозинирования/тирозинирования тубулина тубулин карбоксипептидазой, у субъекта, который в этом нуждается. Предлагается также применение фармацевтической композиции, содержащей ингибитор экспрессии или активности комплекса вазогибин/SVBP для лечения указанного выше заболевания. Заболевание, связанное с TCP, представляет собой неврологическое нарушение (в частности, рассеянный склероз, инсульт, боковой амиотрофический склероз, болезнь Паркинсона, болезнь Хантингтона и болезнь Альцгеймера) или сердечно-сосудистое заболевание (в частности, инфаркт миокарда, инфаркт миокарда, индуцирующий сердечно-сосудистую дисфункцию, сердечную недостаточность, кардиомиопатию и дистрофинопатию ...

СПОСОБ ЛЕЧЕНИЯ ПОСТРАДАВШИХ С ТЯЖЕЛОЙ СОЧЕТАННОЙ ТРАВМОЙ

Способ относится к медицине, а именно к травматологии, и может быть использовано для уменьшения количества осложнений у пострадавших с тяжелой сочетанной травмой. Для этого пациенту с тяжелой сочетанной травмой в послеоперационном периоде дополнительно к лечению вводят ежесуточно внутримышечно 75 мг дерината в течение 10 суток, начиная со следующих суток после травмы. 1 табл., 1 пр.

Способ иммунотерапии гнойного риносинусита с сопутствующим сахарным диабетом 2 типа

Изобретение относится к медицине, в частности к оториноларингологии и может быть использовано для лечения больных с гнойными риносинуситами с сопутствующим сахарным диабетом 2 типа. Способ включает дополнительное назначение больным риносинуситом с сахарным диабетом 2 типа терапии дезоксирибонуклеатом натрия (деринат) в дозе 6 мг внутримышечно по схеме: 5 инъекций через день, далее 5 инъекций в режиме 2 раза в неделю. Использование изобретения позволяет достичь уменьшения длительности лечения, более стойкой и длительной ремиссии, снижения уровня сахара крови и риска развития осложнений заболевания. 1 табл., 3 пр.

ОЛИГОНУКЛЕОТИДЫ, ФАРМАЦЕВТИЧЕСКАЯ КОМПОЗИЦИЯ

Изобретение относится к олигонуклеотидам и их производным для подавления экспрессии изопренилпротеинтрансфераз, фармацевтическим композициям, содержащим такие соединения, и к использованию таких композиций олигонуклеотидов для лечения или терапии заболеваний человека или животных, вызванных ненормальной и/или нерегулируемой пролиферацией. Олигонуклеотиды имеют формулу (I): P - O-R (I), где Р либо отсутствует, либо представляет собой последовательность из одного или более оснований, выбранных из А (аденин), Т/(тимин), С (цитозин) или G (гуанин); О является последовательностью, выбранной из: SEQIDN1: AGAAGCCATG AT; SEQIDN2: GGACGTGACT GT; SEQIDN3: AAGGAGTAGC AG; SEQIDN4: CAGGCAGTAG CA; SEQIDN5: CCCGTCGTCC AT; SEQIDN6: CTGTCCCTGT AC; SEQIDN7: ACTTCTCTCT CC; SEQIDN8: ACTTGGTCCT AA; SEQIDN9: GCCATCATTC TG; SEQIDN10: GATCTGGACC AC; SEQIDN11: CTCAATAGCA TC; SEQIDN12: GTTTTTGGGG TG; SEQIDN13: TCTCACATCC TC; SEQIDN14: TTGTAAGAAC TG; SEQIDN15: GAAGTGCTTC TC; SEQIDN16: GCCTCTTTC AG; SEQIDN17: GGCATCTGTC ...

НУКЛЕИНОВЫЕ КИСЛОТЫ ДЛЯ ИНГИБИРОВАНИЯ ЭКСПРЕССИИ LPA В КЛЕТКЕ

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая нуклеиновую кислоту для ингибирования экспрессии LPA в клетке, конъюгат для ингибирования экспрессии LPA в клетке (варианты), композицию для предотвращения, или лечения, или уменьшения риска развития сердечно-сосудистого заболевания и применение нуклеиновой кислоты, или конюгата, или композиции для предотвращения, или лечения, или уменьшения риска развития сердечно-сосудистого заболевания. В одном варианте реализации нуклеиновая кислота содержит по меньшей мере одну дуплексную область, которая содержит по меньшей мере часть первой цепи и по меньшей мере часть второй цепи, которая по меньшей мере частично комплементарна указанной первой цепи, причем указанная первая цепь по меньшей мере частично комплементарна по меньшей мере части РНК, транскрибированной с гена LPA. Изобретение расширяет арсенал средств для ингибирования экспрессии LPA в клетке. 5 н. и 21 з.п. ф-лы, 40 ил., 15 табл., 15 пр.

ПРОИЗВОДНЫЕ ПОРФИРИНПЛАТИНЫ, ТЕРАПЕВТИЧЕСКИЕ АКТИВНОЕ СОЕДИНЕНИЕ ДЛЯ ПОЛУЧЕНИЯ СРЕДСТВА ДЛЯ ЛЕЧЕНИЯ ОПУХОЛЕЙ, ЛЕКАРСТВЕННОЕ СРЕДСТВО И СПОСОБ ПОЛУЧЕНИЯ УКАЗАННОГО СРЕДСТВА

... 1. Производные порфиринплатины, представляющие собой производные тетраарилпорфиринплатины общей формулы I где Х выбран из группы, содержащей О, S, NH, N-алкил; R2 и R3 выбраны из группы, содержащей Н, алкил, арил, аралкил, гетарил, гетарилалкил, циклоалкил; R4 выбран из группы, содержащей Н, алкил, арил, аралкил, гетарил, гетарилалкил, циклоалкил; R5 выбран из группы, содержащей Н, алкил, О-алкил, S-алкил, галоген, нитро, циано, амино, замещенную аминогруппу; R6 выбран из группы, содержащей Н, алкил, О-алкил, S-алкил, галоген, нитро, циано, амино, замещенную аминогруппу; или общей формулы II где X выбран из группы, = содержащей О, S, NH, N-алкил; R1, R2, R3 и R4 выбраны из группы, содержащей Н, алкил, арил, аралкил, гетарил, гетарилалкил, циклоалкил и R2-Z-R3, где Z означает (СН2)n, n равно 0-6; R1 и R4 могут означать -(CH2)n-COOR8, где n равно 0-6; R5 выбран из группы, содержащей Н, алкил, арил, аралкил, гетарил, гетарилалкил, циклоалкил; R6 выбран из группы, содержащей Н, алкил, O-алкил ...

ИНГИБИРОВАНИЕ STAT-1

Применение двунитевых ДНК-олигонуклеотидов, однонитевых антисмысловых олигонуклеотидов, антисмысловых векторов экспрессии или двунитевых олигонуклеотидов РНК-интерференции, пригодных для ингибирования активности STAT-1, для изготовления лекарства для предотвращения или терапии сердечно-сосудистых осложнений, таких, например, как рестеноз после чрезкожной ангиопластики или стеноз венозного шунта, реакции трансплантат против хозяина, ишемических/реперфузионных повреждений при хирургических операциях и трансплантации органов, соответственно, иммунологических реакций гиперчувствительности, в частности аллергического ринита, лекарственных и пищевых аллергий, в частности крапивницы и глютеновой болезни (спру), контактной экземы и комплексных иммунных заболеваний, в частности альвеолита, артрита, гломерулонефрита и аллергического васкулита, воспалительных хондро- и остеопатий, в частности артроза, подагры, остита и остеомиелита, полиневрита, как острого, так и подострого соответственно, инфекционного ...

НУКЛЕИНОВАЯ КИСЛОТА, КОМПОЗИЦИЯ И КОНЪЮГАТ, СОДЕРЖАЩИЕ ЕЕ, А ТАКЖЕ СПОСОБ ЕЕ ПОЛУЧЕНИЯ И ПРИМЕНЕНИЕ

ГИДРОГЕЛЕВАЯ КОМПОЗИЦИЯ ДЛЯ ЛЕЧЕНИЯ ОЖОГОВ

Изобретение относится к области медицины, в частности к дерматологии, и представляет собой гидрогелевую композицию для лечения ожогов, содержащую иммобилизированные активный и вспомогательные ингредиенты и гелеобразующий компонент, отличающуюся тем, что в качестве активного ингредиента содержит лекарственную субстанцию 2-аллилоксиэтанола в количестве от 0,1 до 10,0 мас.%, в качестве вспомогательных ингредиентов содержит лекарственную субстанцию лидокаина в количестве от 0,1 до 5,0 мас.% или лекарственные субстанции лидокаина в количестве от 0,1 до 5,0 мас.% и дезоксината в количестве от 0,1 до 5,0 мас.%, в качестве гелеобразующего компонента содержит гидроксипропилцеллюлозу в количестве от 0,1 до 5,0 мас.%. Изобретение обеспечивает расширение эксплуатационных возможностей для оказания первой помощи при локальных ожогах различной этиологии, в том числе радиационных, на всех этапах оказания медицинской помощи, также применение в экстренной медицине в качестве универсального средства при лечении ...

СПОСОБЫ И КОМПОЗИЦИИ ДЛЯ ЛЕЧЕНИЯ ЯВЛЕНИЯ КРОВОТЕЧЕНИЯ У БОЛЬНОГО ГЕМОФИЛИЕЙ

МОДУЛЯЦИЯ ЭКСПРЕССИИ TIMP1 И TIMP2

... 1. Молекула нуклеиновой кислоты, причем:(а) указанная молекула нуклеиновой кислоты содержит смысловую и антисмысловую нити;(б) каждая нить молекулы нуклеиновой кислоты независимо содержит от 15 до 49 нуклеотидов в длину;(в) последовательность антисмысловой нити, содержащая в длину от 15 до 49 нуклеотидов, комплементарна последовательности мРНК, кодирующей TIMP1 (SEQ ID NO:1) или TIMP2 (SEQ ID NO:2); и(г) последовательность смысловой нити, содержащая в длину от 15 до 49 нуклеотидов, комплементарна последовательности антисмысловой нити, образуя таким образом участок дуплекса, и содержит состоящую из 15-49 нуклеотидов последовательность мРНК, кодирующую TIMP1 (SEQ ID NO:1) или TIMP2 (SEQ ID NO:2).2. Молекула нуклеиновой кислоты по п.1, отличающаяся тем, что последовательность антисмысловой нити комплементарна последовательности мРНК, кодирующей TIMP1 человека (SEQ ID NO:1), и при этом антисмысловая нить и смысловая нить включают пары последовательностей, выбранных из группы, состоящей из: ...

МОДУЛЯЦИЯ ЭКСПРЕССИИ STAT-1-ЗАВИСИМЫХ ГЕНОВ

... 1. Олигонуклеотид-ловушка, содержащий нить нуклеиновой кислоты, имеющей последовательность в соответствии с SEQ ID NO:1-32 или 34-40. 2. Олигонуклеотид-ловушка по п.1, имеющий модифицированные межнуклеотидные связи. 3. Молекула нуклеиновой кислоты, имеющая последовательность в соответствии с SEQ ID NO:41-43. 4. Молекула нуклеиновой кислоты по п.3, имеющая модифицированные межнуклеотидные связи. 5. Олигонуклеотид-ловушка по п.1 или 2 и молекула нуклеиновой кислоты по п.3 или 4 в качестве лекарственного средства. 6. Применение олигонуклеотида-ловушки по п.1 или 2 и молекулы нуклеиновой кислоты по п.3 или 4 в качестве лекарственного средства для предотвращения и/или лечения сердечно-сосудистых осложнений, в частности рестеноза после чрескожной ангиопластики и стеноза венозных шунтов, отторжения трансплантата, болезни "трансплантат против хозяина" (GHVD), ишемических/реперфузионных повреждений при хирургических операциях, иммунологических реакций гиперчувствительности (типа I-V), аутоиммунных ...

Способ лечения больных с опухолями

GEN BETEILIGT AN V(D)J REKOMBINATION UND/ODER DNA REPARATUR

SCHUTZ GEGEN SCHOCK INFOLGE EINER SCHÄDIGUNG DURCH DOPPELSTRÄNGIGE RNA'S

HEMMUNG DER EXPRESSION VON GENEN MITTELS DSRNA

REGULATION EINER NF-AT INTERAGIERENDEN PROTEINVARIANTE NIP 45

FLT4 (VEGFR-3) ALS EIN ZIEL FÜR KREBSDARSTELLUNG UND ANTI-KREBS-BEHANDLUNG

THERAPEUTISCHE VERWENDUNG DES WACHSTUMSFAKTORS NSG33

Use of marker sequences for the diagnosis of rheumatoid arthritis, where the marker sequences of a complementary DNA (cDNA) from the specific sequence is determined in a patient

Use of marker sequences for the diagnosis of rheumatoid arthritis, is claimed, where at least a marker sequence of a complementary DNA (cDNA) from the SEQ ID NO. 1-488 (not defined) or a protein obtained from the sequence, a partial sequence or a fragment of the sequence, is determined in a patient. Independent claims are included for: (1) diagnosing rheumatoid arthritis comprising introducing the marker sequences on a solid carrier and contacting with body fluids or tissue extracts of a patient and determining the interaction of the body fluids or tissue extracts with the marker sequences; (2) a procedure for the stratification, preferably for risk stratification or for the therapy control of a patient with rheumatoid arthritis, comprising determining the marker sequences in a patient; (3) an arrangement of marker sequences; (4) an assay, protein biochip consisting of the arrangement, where the marker sequences are applied on a solid carrier; (5) a diagnostic agent for the diagnosis of ...

Use of marker sequences for the diagnosis of rheumatoid arthritis, where the marker sequences of a complementary DNA (cDNA) from the specific sequence is determined in a patient

Use of marker sequences for the diagnosis of rheumatoid arthritis, is claimed, where at least a marker sequence of a complementary DNA (cDNA) from the SEQ ID NO. 1-488 (not defined) or a protein obtained from the sequence, a partial sequence or a fragment of the sequence, is determined in a patient. Independent claims are included for: (1) diagnosing rheumatoid arthritis comprising introducing the marker sequences on a solid carrier and contacting with body fluids or tissue extracts of a patient and determining the interaction of the body fluids or tissue extracts with the marker sequences; (2) a procedure for the stratification, preferably for risk stratification or for the therapy control of a patient with rheumatoid arthritis, comprising determining the marker sequences in a patient; (3) an arrangement of marker sequences; (4) an assay, protein biochip consisting of the arrangement, where the marker sequences are applied on a solid carrier; (5) a diagnostic agent for the diagnosis of ...

CHEMICAL COMPOUNDS

Oligonucleotides which inhibit expression of isoprenyl protein transferases

The invention relates to oligonucleotides and their derivatives to inhibit the expression of isoprenyl protein transferases, therapeutic compositions containing such compounds and the use of such compositions of oligonucleotides for the treatment or therapy of diseases of the human or animal body induced by an abnormal and/or uncontrolled cellular proliferation.

RNA interference (RNAi) of huntingtin (htt) gene

The present invention concerns compounds, compositions, and methods for the study, diagnosis, and treatment of diseases and conditions associated with polyglutamine repeat (polyQ) allelic variants that respond to the modulation of gene expression and/or activity. The present invention also concerns compounds, compositions, and methods relating to diseases and conditions associated with polyglutamine repeat (polyQ) allelic variants that respond to the modulation of expression and/or activity of genes involved in polyQ repeat gene expression pathways or other cellular processes that mediate the maintenance or development of polyQ repeat diseases and conditions such as Huntington disease and related conditions such as progressive chorea, rigidity, dementia, and seizures, spinocerebellar ataxia, spinal and bulbar muscular dystrophy (SBMA), dentatorubropallidoluysian atrophy (DRPLA), and any other diseases or conditions that are related to or will respond to the levels of a repeat expansion ...

Use of rnai inhibiting parp activity for the manufacture of a medicament for the treatment of cancer

Inhibin as targetable regulators of angiogenesis

A method for inhibiting SMAD 1/5 signalling in endothelial cells, the method comprising, in an in vitro environment, contacting endothelial cells with a composition comprising an agent configured to inhibit the presence or activity of inhibin; and examining the endothelial cells following the contact. The agent may be configured to inhibit the presence of activity of the alpha subunit of inhibin, and may selected from an antibody, an interfering RNA, a small molecule inhibitor, wherein the agent may specifically bind the inhibin. The in vitro environment may also include a cell that express the alpha subunit of inhibin, particularly an ovarian cancer cell. The method may affect a MAPK pathway in the endothelial cells, such as the ERK 1/2 pathway. The method may further include contacting the endothelial cells with an agent configured to inhibit the presence or activity of activin receptor-like kinase 1 or endoglin. The endothelial cells may comprise human microvascular endothelial cells ...

Compositions and methods for organ specific delivery of nucleic acids

Compositions and methods for organ specific delivery of nucleic acids

TMPRSS6 IRNA COMPOSITIONS AND METHODS OF USE THEREOF

Ghrelin binding nucleic acids

Crystalline oxathiolane derivatives.

... (-)cis-4-amino-1-(2-hydroxymethyl-1,3-oxathiolan-5-yl)-(hl)-pyrimidine-2-one in crystalline form, in particular as needle-shaped or bypyramidyl crystals, pharmaceutical formulations thereof, methods for their preparation and their use in medicine.

Compositions for targeted delivery of SIRNA

CRYSTALLINE OXATHIOLANE DERIVATIVES

Ghrelin binding nucleic acids

Compositions and methods for inhibiting expressionof a gene from the ebola

TMPRSS6 IRNA COMPOSITIONS AND METHODS OF USE THEREOF

Compositions for targeted delivery of SIRNA

Complexes of the acid polyadenylic with the acid polyuridylic

Viral Treatment off human infections by dsRNA combined with viral inhibitors.

Oligonucleotides to inhibit the role of isoprenyl protein transferases

Crystalline oxathiolane derivatives.

Compositions for targeted delivery of SIRNA

CRYSTALLINE OXATHIOLANE DERIVATIVES

Ghrelin binding nucleic acids

Compositions for targeted delivery of SIRNA

TMPRSS6 IRNA COMPOSITIONS AND METHODS OF USE THEREOF

LIGAND OF THE CELLENTRANCE-OBTAINING PROTEIN OF HERPES SIMPLEX AND METHODS TO ITS USES

SIRNA KNOCKOUT TESTING METHODS AND KONSTRUKTE

ANTI-SCYTHE THERAPY FOR HORMONE-ADJUSTED TUMORS

ANTI-SCYTHE INHIBIERUNG THE PTP1B EXPRESSION.

GENES DIFFERENTIAL EXPERIMIERT IN BRUDTKREBS

NEW OLIGORIBONUCLEOTID DERIVATIVES FOR THE PURPOSEFUL INHIBITION OF THE GENEXPRESSION

USE OF BACTERIAL PARD KIS/PARD KID TOXIN ANTITOXIN SYSTEM FOR THE KILLING OF EUKARYOTI CELLS

THERAPEUTIC USE OF THE GROWTH FACTOR NSG33

NUCLEIC ACID LIGAND WITH HIGH AFFINITY FOR THE C1Q PROTEIN OF THE COMPLEMENT SYSTEM

PHARMACEUTICAL COMPOSITION FOR THE TREATMENT OF REPEATS OCCURRENCE SPONTANEOUS TOILET AND PROCEDURE FOR IT

COMPOSITIONS AND PROCEDURES FOR THE INCREASE OF THE BONE MINERALIZING

NEW POLYPEPTID WITH SUITABILITY TO THE DIAGNOSIS AND TREATMENT OF CANCER

MODULATION THAT TRPV EXPRESSIONSMENGEN

REDUCTION OF ARTHRITIS AND LAMELY WITH PERSONS UNDER SUPLLEMENT FROM GROWTH HORMONE SETTING FREE HORMONE (GHRH)

GALACTOSEDERIVAT, DRUG CARRIERS AND MEDICAL COMPOSITION

PROCEDURE AND COMPOSITIONS IN CONNECTION WITH GENE SILENCING

AGAINST IAP DIRECTION ANTISENSE NUKLEOBASEN AND THEIR USES

ANTI- BAMBI ANTIBODIES OR RNA TO THE DIAGNOSIS AND THERAPY WITH LARGE INTESTINE OR LIVER CANCER

USE OF MOLECULAR-BIOLOGICALLY MANUFACTURE, NOT VIRALEN ACTIVE SUBSTANCES FOR THE TREATMENT OF ACNE

NUCLEIC ACIDS FOR RELEASING THE TUMOR CELL NUMBER OF DEATHS

DOPPELSTRÄNGIGE OLIGONUKLEOTIDE

ANTIVIRAL ANTI-SCYTHE CONNECTIONS AND PROCEDURES FOR THE TREATMENT OF FILOVIRUS INFECTIONS

CLIP-WELL-BEHAVED OLIGONUKLEOTID AND THIS CONTAINING MEDICINE MATERIAL

NEW POLYPEPTID WITH SUITABILITY TO THE DIAGNOSIS AND TREATMENT OF CANCER

USE FROM SIRNA TO THE ABOLISHMENT OF THE EXPRESSION OF EIF-5A1 IN THE TREATMENT OF GLAUKOMA

SENSITIZATION OF CANCER CELLS FOR a THERAPY USING SINA ZIELGENEN FROM the CHROMOSOME REGIONS 1P AND 19Q

SEQUENCES THE GENOTYPE OF THE HEPATITIS C VIRUS AS WELL AS YOUR USE AS DRUGS AND DIAGNOSTIKA

CHLAMYDIA ANTIGENS AND THEIR CORRESPONDING DNA OF FRAGMENTS AND USES OF IT

MULTIPLE PROMOTER EXPRESS ION CARTRIDGES ZURGLEICHZEITIGEN SUPPLY OF RNAI AGENTIEN

PROCEDURE FOR THE LOWERING OF THE BLOOD PRESSURE

PROTECTION AGAINST SHOCK DUE TO A DAMAGE BY DOPPELSTRÄNGIGE RNA'S

COMPOSITION AND METHOD FOR INDUCING OF APOPTOSIS IN PROSTATAKREBSZELLEN MEANS M-DNA AND MCC

CRYSTALLINE OXATHIOLANDERIVATE

RECEPTOR AND BUT CODING NUCLEIC ACID MOLECULE

POLYNUKLEOTIDE WITH SHORTENED CHAIN AND PROCEDURE FOR YOUR PRODUCTION

New sequences of hepatitis c virus genotypes and their use as therapeutic and diagnostic agents

MiRNA and its diagnostic therapeutic uses in diseases or conditions associated with melanoma, or in diseases or conditions associated with activated BRAF pathway

Abstract The invention relates to the diagnostic and therapeutic uses of a miRNA molecule, an equivalent or a source thereof in a disease and condition associated with melanoma or a 5 disease or a condition associated with activated BRAF pathway. 10549404_1 (GHMatters) P92336.AU.2 ...

Synthetic Lethality And Treatment Of Cancer

Described herein are compounds, compositions and methods for treatment of cancer. Also described are methods and uses for identifying subject with cancer that are suitable for treatment with the compounds, composition and methods are described herein. In one aspect 5 of the present invention, there is provided a method of treating a subject having a cancer deficient in NMT2, comprising: administering to said subject an NMT inhibitor.

Compositions and methods for the treatment of hemoglobinopathies

The present invention is directed to genome editing systems, reagents and methods for the treatment of hemoglobinopathies.

Nucleic acid capable of inhibiting expression of MASP2

The present invention provides: a nucleic acid having an activity to inhibit the expression of MASP2; a pharmaceutical composition containing the nucleic acid; and a prophylactic or therapeutic agent for autoimmune diseases including APS and SLE and thrombosis occuring during hemodialysis, which contains the nucleic acid.

Sensitizing agents for cancer therapy, methods of use and methods for the identification thereof

There is provided herein methods, compounds and methods for identifying compounds, for sensitizing a subject with cancer to a cancer therapy by inhibiting or down-regulating UROD.

METHODS AND COMPOSITIONS FOR REDUCING TARGET GENE EXPRESSION USING COCKTAILS OF siRNAS OR CONSTRUCTS EXPRESSING siRNAS

The present invention concerns methods and compositions involving the production or generation of siRNA mixtures or pools capable of triggering RNA-mediated interference (RNAi) in a cell. Compositions of the invention include kits that include reagents for producing or generating siRNA pools. The present invention further concerns methods using polypeptides with RNase III activity for generating siRNA mixtures or pools that effect RNAi, including the generation of a number of RNA molecules to the same target gene.

Transcriptome Transfer Produces Cellular Phenotype Conversion

The present invention includes methods for effecting phenotype conversion in a cell by transfecting the cell with phenotype-converting nucleic acid. Expression of the nucleic acids results in a phenotype conversion in the transfected cell. Preferably the phenotype-converting nucleic acid is a transcriptome, and more preferably an mRNA transcriptome.

Use of pkc isozymes for diagnosis and treatment of neuroblastoma

The present invention pertains to the use of PKC-epsilon (PKC-ε), PKC-delta (PKC-δ), PKC-eta, and/or PKC-theta as biomarker(s) for prediction and/or detection of neuroblastoma, as well as therapeutic targets for treatment of neuroblastoma.

Modified L-Nucleic Acid

A modified L-nucleic acid, containing an L-nucleic acid part conjugated to a non-L-nucleic acid part is described. The conjugate has extended retention time in and demonstrates a delayed elimination from an organism.

Mitochondrial enhancement of cells

Certain embodiments disclosed herein include, but are not limited to, at least one of compositions, methods, devices, systems, kits, or products regarding rejuvenation or preservation of stem cells. Certain embodiments disclosed herein include, but are not limited to, methods of modifying stem cells, or methods of administering modified stem cells to at least one biological tissue.

CATIONIC LIPIDS

The invention provides a cationic lipid comprising: 2. The cationic lipid of wherein the at least one amino acid is an α-amino acid.3. The cationic lipid of wherein the side chain of the at least one amino acid is an optionally substituted alkylene chain.4. The cationic lipid of wherein the cationic moiety or cationic precursor of the at least one amino acid is or comprises an amine claim 1 , amidine or guanidine group claim 1 , or a protonated amine claim 1 , amidine or guanidine group.5. The cationic lipid of wherein the at least one amino acid is a basic amino acid.6. The cationic lipid of wherein the basic amino acid is arginine claim 5 , lysine claim 5 , histidine or ornithine.7. The cationic lipid of wherein the basic amino acid is arginine.81. The cationic lipid of wherein the head group comprises two or more amino acids.9. The cationic lipid of wherein the head group comprises from two to four amino acids.10. The cationic lipid of wherein each of the amino acids in the headgroup is the same.11. The cationic lipid of wherein the head group is represented by formula (1):{'br': None, 'sup': 2', '1, 'sub': n', '2, '—[(N(H)—C(H)(R)—C(═O)]—N(R)\u2003\u2003(1)'} [{'sup': '1', 'sub': '1-5', 'each Ris independently hydrogen or a Calkyl;'}, 'n is from 1 to 10; and', {'sup': '2', 'each Ris independently the side chain of an α-amino acid.'}], 'wherein12. The cationic lipid of wherein the two lipophilic moieties are independently of formula (8):{'br': None, 'sup': '6', 'R—C(O)\u2003\u2003(8),'} {'sup': '6', 'Rrepresents a saturated or unsaturated fatty alkyl chain, optionally comprising fused cyclic regions whereby to form a polycyclic hydrocarbyl moiety.'}, 'wherein14. The cationic lipid of claim 12 , wherein R—C(O)— is represented as CH(CH)C(═O)— wherein q is from 5 to 100 claim 12 , more usually 10 to 30 claim 12 , for example 12 to 24 claim 12 , optionally wherein one or more non-adjacent pairs of methylene groups (i.e. CHCHunits) are each replaced with CH═CH units ...

RETINOID-LIPOSOMES FOR TREATING FIBROSIS

What is described are pharmaceutical compositions comprising a double-stranded nucleic acid molecule comprising a sense strand and an antisense strand wherein the sense and antisense strands are selected from the oligonucleotides described as SERPINH1_2 (SEQ ID NOS: 60 and 127), SERPINH1_45a (SEQ ID NOS: 98 and 165), and SERPINH1_51 (SEQ ID NOS: 101 and 168), and drug carrier comprising a mixture of a retinoid and a lipid vesicle, and methods of using these pharmaceutical compositions to treat a disease associated with hsp47 expression, including fibrosis. 1. A pharmaceutical composition comprising a drug carrier and a double-stranded nucleic acid molecule , wherein the drug carrier comprises a liposome and a stellate cell-specific amount of a retinoid , wherein the liposome comprises a bilayer of lipid molecules , and wherein the double-stranded nucleic acid molecule comprises the structure:{'br': None, 'sub': 'x', '5′ (N)—Z 3′ (antisense strand)'}{'br': None, 'sub': 'y', '3′ Z′—(N′)-z″ 5′ (sense strand)'}wherein each of N and N′ is a nucleotide which may be unmodified or modified, or an unconventional moiety;{'sub': x', 'y, 'wherein each of (N)and (N′)is an oligonucleotide in which each consecutive N or N′ is joined to the next N or N′ by a covalent bond;'}wherein each of Z and Z′ is independently present or absent, but if present independently includes 1-5 consecutive nucleotides or non-nucleotide moieties or a combination thereof covalently attached at the 3′-terminus of the strand in which it is present;{'sub': 'y', 'wherein z″ may be present or absent, but if present is a capping moiety covalently attached at the 5′-terminus of (N′);'}wherein each of x and y is independently an integer between 18 and 40;{'sub': y', 'x, 'wherein the sequence of (N′)has complementary to the sequence of (N); and'}{'sub': 'x', 'wherein (N)includes an antisense sequence to the mRNA coding sequence for human hsp47 exemplified by SEQ ID NO:1; wherein the composition prevents or ...

Cancer-specific genetic rearrangements

The present invention relates to the field of cancer. More specifically, the present invention provides compositions and methods useful for treating cancer characterized by the expression of mutant FAM190A proteins. In a specific embodiment, a method for treating a patient having a cancer characterized by a FAM190A intragenic rearrangement comprises the step of administering to the patient an agent that inhibits a biological function or reduces the level or expression of the FAM190A protein.

USP47 Inhibtors and Methods to Induce Apoptosis

The present invention relates to USP47 (ubiquitin specific protease 47) inhibitors and methods for inducing apoptosis or cell death in a target cell. In certain embodiments, the invention relates to methods and kits to screen for related agents that induce apoptosis. Additionally, the invention relates to assays for screening compounds capable of acting as USP47 inhibitors. 1. A method of inducing apoptosis or cell death comprising contacting a target cell with an effective amount of an inhibitor of ubiquitin specific protease 47 (USP47).2. The method of claim 1 , wherein the target cell is a diseased or abnormal cell from tissue or a cell that exhibits a disease or abnormal condition selected from the group consisting of cancer claim 1 , infection claim 1 , immune disorder claim 1 , cardiovascular disease claim 1 , and inflammatory disorders.3. The method of claim 1 , further comprising contacting the cell with a second agent for sensitizing the cell to DNA damage or apoptosis.4. A method of killing a target cell comprising contacting the cell with an effective amount of an inhibitor of ubiquitin specific protease 47 (USP47).5. The method of claim 4 , further comprising contacting the cell with a second agent for sensitizing the cell to DNA damage.6. The method of claim 4 , wherein the target cell is a diseased or abnormal cell from tissue or a cell that exhibits a disease or abnormal condition selected from the group consisting of cancer claim 4 , infection claim 4 , immune disorder claim 4 , cardiovascular disease claim 4 , and inflammatory disorders.711-. (canceled)12. A method of treating cancer comprising administering an effective amount of a ubiquitin specific protease 47 (USP47) inhibitor to a subject suffering from cancer.13. The method of claim 12 , wherein the USP47 inhibitor induces apoptosis.14. The method of claim 12 , wherein the USP47 inhibitor results in loss of beta-transducin repeat containing protein (β-TrCP) activity.15. A kit for screening for ...

TREATING CANCER BY MODULATING MAMMALIAN STERILE 20-LIKE KINASE 3

The present invention relates to a method for modulating miRNA, said method being characterized in that a modulator of XRN1 is used. Also provided are uses of said method for therapeutical purposes, reagents therefore, as well as screening methods. 1. A method for modulating miRNA in a sample , said method being characterized in that the sample is contacted with a modulator of XRN1.2. (canceled)3. The method of claim 16 , wherein the method is performed to treat a disease and wherein a therapeutically effective amount of said modulator of XRN1 is administered to said subject.4. The method of claim 3 , wherein the disease is a cancer claim 3 , a metabolic disease claim 3 , a developmental disorder claim 3 , a cardiac disease or a viral infection.5. The method of claim 16 , wherein the modulator of XRN1 is a small molecule claim 16 , for instancc a RNasc inhibitor.6. The method of claim 16 , wherein the modulator of XRN1 is an antibody.7. The method of claim 16 , wherein the modulator of XRN1 is an agonist.8. The method of claim 16 , wherein the modulator of XRN1 is an inhibitor of XRN1.9. The method of wherein said inhibitor of XRN1 decreases or silences the expression of XRN1.10. The method of wherein the inhibitor is a siRNA.11. The method of claim 16 , wherein the subject is a mammal.12. (canceled)13. (canceled)14. A method for the identification of a substance that modulates the expression of XRN1 and/or its biological activity claim 16 , which method comprises the steps of:(i) contacting a XRN1 polypeptide or a fragment thereof having the biological activity of XRN1, a polynucleotide encoding such a polypeptide or polypeptide fragment, an expression vector comprising such a polynucleotide or a cell comprising such an expression vector, and a test substance under conditions that in the absence of the test substance would permit XRN1 expression and/or biological activity; and(ii) determining the amount of expression and/or biological activity of XRN1, e.g. the ...

MicroRNA-130a,b as a Tumor Suppressor and Sensitizing Agent for Chemotherapy

The present invention provides a method of improving a therapeutic response to a cancer treatment, in a subject, the method comprising administering an effective amount of an agent that enhances the expression of microRNA-130 or an agent that mimics the effects of microRNA-130. Further provided is a method of treating a cancer in a subject in need of such treatment comprising the step of administering an effective amount of a microRNA-130 or an agent that enhances the expression of microRNA-130. 1. A method of providing a prognosis for ovarian cancer in a subject , comprising the steps of:obtaining a biological sample from said subject; andtesting said biological sample to determine whether or not microRNA-130 is under-expressed in said sample, relative to the expression of microRNA-130 in a control sample, whereby the under-expression of microRNA-130 in said biological sample indicates that a tumor in said subject is resistant to a chemotherapy.2. A method of improving a therapeutic response to a cancer treatment , in a subject , the method comprising administering an effective amount of an agent that enhances the expression of microRNA-130 or an agent that mimics the effects of microRNA-130.3. The method of claim 2 , whereby said agent is microRNA-130a or microRNA-130b.4. The method of claim 2 , whereby said agent is a double-stranded miRNA mimic.5. The method of claim 2 , whereby said agent is an oligonucleotide based pre-microRNA-130 drug.6. The method of claim 2 , whereby said cancer is selected from the group consisting of lung cancer claim 2 , pancreatic cancer claim 2 , skin cancer claim 2 , hematological neoplasms claim 2 , breast cancer claim 2 , brain cancer claim 2 , colon cancer claim 2 , follicular lymphoma claim 2 , bladder cancer claim 2 , cervical cancer claim 2 , endometrial cancer claim 2 , esophageal cancer claim 2 , gastric cancer claim 2 , head and neck cancer claim 2 , multiple myeloma claim 2 , liver cancer claim 2 , lymphomas claim 2 , oral ...

APOPTOSIS INDUCER FOR CANCER CELL

The present invention revealed that by suppressing the expression of the WRN gene, the BLM gene, or the RecQ1 gene, which belong to the RecQ helicase family, apoptosis is induced in various cancer cells and their proliferation is suppressed. Compounds that suppress the expression of RecQ helicase family genes or the functions of RecQ helicase proteins are thought to have the activity of inducing apoptosis. 1. A method for inducing apoptosis of cancer cells comprising a step of administering a compound that suppresses the expression of a WRN gene into a subject , wherein the compound induces apoptosis in cancer cells but does not induce apoptosis in normal cells.2. The method according to claim 1 , wherein the compound that suppresses the expression of the WRN gene is a double-stranded RNA having RNAi activity towards the WRN gene.3. The method according to claim 2 , wherein the double-stranded RNA comprises a sense RNA comprising a sequence homologous to an arbitrary 20 to 30 consecutive nucleotides from the mRNA of the WRN gene claim 2 , and an antisense RNA claim 2 , comprising the sequence complementary to the sense RNA.4. The method according to claim 2 , wherein either strand of the double-strand RNA with RNAi activity comprises the nucleotide sequence of any one of SEQ ID NOs: 2 claim 2 , 35 claim 2 , 36 claim 2 , and 53-62. The Sequence Listing associated with this application is provided in text format in lieu of a paper copy, and is hereby incorporated by reference into the specification. The name of the text file containing the Sequence Listing 390081401D1_SEQUENCE_LISTING.txt. The text file is 163 KB, was created on Sep. 27, 2012, and is being submitted electronically via EFS-Web.The present invention relates to apoptosis inducers for cancer cells, which comprise as an active ingredient a compound that suppresses the expression of a gene belonging to the RecQ DNA helicase family, or a compound that suppresses the function of the protein encoded by that ...

Hyaluronic Acid Decomposition-Promoting Factor and Inhibitor Thereof

The present invention is directed to KIAA1199, which is a novel factor involved in decomposition of hyaluronic acid, and to use thereof. More specifically, the invention is directed to a hyaluronic acid decomposition-promoting agent containing the KIAA1199 gene and a protein encoded by the gene; to a hyaluronic acid decomposition-inhibiting agent characterized by inhibiting the activity or expression thereof (including an siRNA or a monoclonal antibody); and to a method for screening a novel hyaluronic acid decomposition-controlling agent, in which the method contains employing the expression of KIAA1199 as an index. 1. A method for screening a hyaluronic acid decomposition-controlling agent , wherein the method comprises assessing a hyaluronic acid decomposition controlling effect of a test substance by use of cells in which a KIAA1199 gene is highly expressed transiently or stably.2. The method according to claim 1 , wherein the hyaluronic acid decomposition controlling effect of the test substance is assessed on the basis of the expression level of the KIAA1199 gene or a protein encoded by the KIAA1199 gene as an index.3. The method according to claim 1 , which comprises the following steps:1) culturing cells in the presence or absence of the test substance;2) determining the expression level of the KIAA1199 gene or a protein encoded by the KIAA1199 gene in the cells; and3) assessing the hyaluronic acid decomposition controlling effect of the test substance on the basis of the difference between the expression level of the KIAA1199 gene or the protein encoded by the KIAA1199 gene in the cells determined in the presence of the test substance and that determined in the absence of the test substance.4. The method according to claim 1 , which comprises the following steps:1) culturing cells in coexistence with a labeled hyaluronic acid in the presence or absence of the test substance;2) recovering a culture supernatant after culturing, and determining a molecular ...

THERAPEUTIC USES OF INHIBITORS OF RTP801

The present invention provides novel molecules, compositions, methods and uses for treating microvascular disorders, eye diseases and respiratory conditions based upon inhibition of the RTP801 gene and/or protein. 128-. (canceled)29. A double-stranded compound comprising a sense strand and an antisense strand wherein the sense strand comprises ribonucleotides , the sequence of which is set forth in SEQ ID NO:16 and the antisense strand comprises ribonucleotides , the sequence of which is set forth in SEQ ID NO:66;wherein each ribonucleotide in the sense strand and in the antisense strand is independently unmodified or modified; andwherein each ribonucleotide is bound to each adjacent ribonucleotide by a covalent bond.31. The compound of claim 30 , wherein at least one A claim 30 , C claim 30 , G claim 30 , or U is a sugar-modified ribonucleotide.32. The compound of claim 31 , wherein in the sugar-modified ribonucleotide a 2′ OH group is replaced by —H claim 31 , —OCH claim 31 , —OCHCH claim 31 , —OCHCHCHor —NH.33. The compound of claim 32 , wherein the 2′OH group is replaced by —OCH).34. The compound of claim 30 , wherein at least one A claim 30 , C claim 30 , G or U is a ribonucleotide modified in its base.35. The compound of claim 29 , wherein at least one covalent bond comprises a phosphorothioate bond.36. A method of treating a patient suffering from a disorder associated with elevated expression of RTP801 which comprises administering to the patient the compound of in an amount effective to reduce the expression of RTP801 so as to thereby treat the patient.37. The method of claim 36 , wherein the disorder is a respiratory disorder claim 36 , an eye disease claim 36 , a microvascular disorder claim 36 , or a spinal cord injury.39. The compound of claim 38 , wherein x=y=19.40. The compound of claim 38 , wherein at least one A claim 38 , C claim 38 , G claim 38 , or U comprises a sugar-modified ribonucleotide.41. The compound of claim 40 , wherein in the sugar- ...

Compositions and Methods for Reduced Scarring and for Treatment of Fibrosis

Methods of treating, reducing or preventing fibrosis or scarring including administering a therapeutic molecular agent selected from the group consisting of an agent that inhibits chaperonin containing Tcomplex polypeptide subunit eta polypeptide (“CCT-eta”), an agent that inhibits a-Smooth Muscle Actin (“a-SMA”), or a combination thereof, are presented. The fibrosis may include Dupuytren's contracture, Peyronie's disease, pulmonary fibrosis, cirrhosis, interstitial lung disease or scarring alopecia. 1. A method of reducing scarring comprising administering a therapeutic molecular agent selected from an agent that inhibits chaperonin containing T-complex polypeptide subunit eta , an agent that inhibits α-Smooth Muscle Actin , or a combination thereof.2. The method of claim 1 , wherein scarring comprises fibrosis.3. The method of claim 1 , wherein the agent that inhibits CCT-eta is selected from an agent that inhibits expression of CCT-eta mRNA claim 1 , an agent that inhibits CCT-eta protein claim 1 , or a combination thereof.4. The method of claim 3 , wherein the agent that inhibits CCT-eta mRNA comprises an siRNA comprising a sense strand comprising SEQ ID No. 1 or a variant thereof and an antisense strand comprising SEQ ID No. 2 or a variant thereof.5. The method of claim 3 , wherein the agent that inhibits CCT-eta mRNA comprises an siRNA that inhibits a target mRNA selected from SEQ ID No. 7 claim 3 , 11 claim 3 , 12 claim 3 , 13 claim 3 , 14 claim 3 , a variant thereof or a combination thereof.6. The method of claim 3 , wherein the agent that inhibits CCT-eta protein is an antibody.7. The method of claim 6 , wherein the antibody inhibits the CCT-eta protein comprising SEQ ID No. 9 claim 6 , 15 claim 6 , 16 claim 6 , 17 claim 6 , 18 or a combination thereof.8. The method of claim 1 , wherein the agent that inhibits α-SMA is selected from an agent that inhibits expression of α-SMA mRNA claim 1 , an agent that inhibits α-SMA protein claim 1 , or a combination ...

METHODS OF USING SCD1 ANTAGONISTS

Provided herein are therapies for the treatment of pathological conditions, such as cancer, and method of using SCD1 antagonists. 1) A method of treating a cancer cell in an individual comprising administering to the individual an effective amount of an SCD1 antagonist.2) The method of claim 1 , wherein the cancer cell is an endometrial cancer cell claim 1 , a head and neck cancer cell claim 1 , a kidney cancer cell claim 1 , an ovarian cancer cell claim 1 , a colon cancer claim 1 , a pancreatic cancer cell claim 1 , an urinary cancer cell claim 1 , or a bladder cancer cell.3) The method of claim 2 , wherein the cancer cell is a kidney cancer cell claim 2 , pancreatic cancer cell claim 2 , or bladder cancer cell.4) The method of claim 3 , wherein the cancer cell expresses elevated levels of one or more biomarkers compared to a reference sample claim 3 , reference cell claim 3 , reference tissue claim 3 , control sample claim 3 , control cell claim 3 , control tissue claim 3 , or internal control (e.g. claim 3 , housekeeping gene).5) A method of treating cancer in an individual comprising administering to the individual an effective amount of an SCD1 antagonist.6) The method of claim 5 , wherein the cancer in the individual expresses elevated levels of one or more biomarkers compared to a reference sample claim 5 , reference cell claim 5 , reference tissue claim 5 , control sample claim 5 , control cell claim 5 , control tissue claim 5 , or internal control (e.g. claim 5 , housekeeping gene)7) A method of treating cancer in an individual comprising administering to the individual an effective amount of an SCD1 antagonist claim 5 , wherein treatment is based upon the individual having cancer expressing elevated levels of one or more biomarkers compared to a reference sample claim 5 , reference cell claim 5 , reference tissue claim 5 , control sample claim 5 , control cell claim 5 , control tissue claim 5 , or internal control (e.g. claim 5 , housekeeping gene).8) The ...

Tiki1 and Tiki2, Wnt Inhibitors

This invention relates to Tiki1 and Tiki2 proteins and nucleic acids, cells expressing the same, and methods for identifying compounds that modulate Tiki1/2 activity for use in the treatment of osteoporosis or cellular proliferative disorders.

METHODS OF LIMITING MICROVASCULAR DAMAGE FOLLOWING ACUTE MYOCARDIAL ISCHEMIA

This disclosure has identified a new ligand-receptor system, proNGF and p75NTR/SorCS2, which is found to be involved in the microvascular functions of the heart. This disclosure provides methods for limiting microvascular damage following acute myocardial ischemia based on administration of an antagonist of this newly identified system, thereby promoting myocardial recovery. 1. A method of limiting microvascular damage following acute myocardial ischemia in a subject , comprising administering to the subject a proNGF antagonist.2. The method of claim 1 , wherein said proNGF antagonist is an antibody specific for proNGF which inhibits the binding of proNGF to p75and/or SorCS2.3. The method of claim 2 , wherein said antibody is an antibody directed to the pro-domain of proNGF.4. The method of claim 1 , wherein said proNGF antagonist is a nucleic acid or peptide aptamer which specifically binds to proNGF and inhibits the binding of proNGF to p75and/or SorCS2.5. The method of claim 1 , wherein said proNGF antagonist is an oligopeptide or small molecule which inhibits the binding of proNGF to p75and/or SorCS2.6. The method of claim 6 , wherein said nucleic acid molecule is an anti-sense molecule or siRNA which reduces the level or activity of proNGF mRNA.7. The method of claim 1 , wherein said proNGF antagonist is administered to the subject within 48 hours of acute myocardial ischemia.8. The method of claim 1 , wherein the proNGF antagonist is administered to the subject via ingestion claim 1 , injection claim 1 , catheter delivery during percutaneous intervention claim 1 , or directly to the heart during open heart surgery.9. A method of limiting microvascular damage following acute myocardial ischemia in a subject claim 1 , comprising administering to the subject a SorCS2 antagonist.10. The method of claim 9 , wherein said SorCS2 antagonist is an antibody directed to SorCS2 which blocks the binding of proNGF to SorCS2.11. The method of claim 10 , wherein said antibody ...

PHARMACEUTICAL COMPOSITION FOR THE TREATMENT OF CHLAMYDIAL INFECTION

Subject of the present invention is a pharmaceutical composition comprising at least one inhibitor of a microorganism selected from the family Chlamydiaceae. 142-. (canceled)43. A pharmaceutical composition comprising at least one inhibitor of a microorganism selected from the family Chlamydiaceae , optionally together with pharmaceutically acceptable carriers , adjuvants , diluents or/and additives , wherein the inhibitor is selected from compounds capable of inhibiting the nucleotide metabolism , in particular nucleotide metabolism essential for chlamydial growth , propagation or/and infection.44. The pharmaceutical composition as claimed in claim 43 , wherein inhibition of the nucleotide metabolism includes{'sub': '—', '(a) inhibition of the activity of GMP synthase, in particular GMP synthase EC 6.3.5.2, more particular GMP synthase described by genbank entry NM003875, or'}{'sub': '—', '(b) inhibition of the activity of IMP dehydrogenase 2, in particular IMP dehydrogenase 2 EC 1.1.1.205, more particular IMP dehydrogenase 2 described by genbank entry NM000884.'}45. The pharmaceutical composition as claimed in claim 43 , wherein inhibition comprises inhibition of growth or/and propagation of the microorganism selected from the family Chlamydiaceae.46. The pharmaceutical composition as claimed in claim 43 , wherein inhibition comprises inhibition of the interaction of the microorganism with the host cell.47. The pharmaceutical composition as claimed in claim 43 , wherein inhibition comprises(i) reduction of the number of EB that infected the host cell, or/and(ii) reduction of the number of RB inside the host cell.48. The pharmaceutical composition as claimed in claim 43 , wherein the at least one inhibitor of the microorganism is selected from the group of nucleic acids claim 43 , nucleic acid analogues such as ribozymes claim 43 , peptides claim 43 , polypeptides claim 43 , and antibodies claim 43 , wherein the nucleic acid encodes a GMP synthase or a IMP ...

Dual Targeted siRNA Therapeutics for Treatment of Diabetic Retinopathy and Other Ocular Neovascularization Diseases

The present invention relates to compositions and methods for treating diabetic retinopathy and other ocular neovascularization diseases. In one embodiment, the composition comprises at least two different siRNA duplexes and a pharmaceutically acceptable carrier. One of the duplexes binds to an mRNA molecule that encodes VEGF, and the other binds to an mRNA molecule that encodes VEGFR2. In another embodiment, the composition further comprises an siRNA duplex that binds to an mRNA molecule that encodes TGFβ1. 1. A composition comprising at least two different siRNA duplexes and a pharmaceutically acceptable carrier , wherein one of said siRNA duplexes binds to an mRNA molecule that encodes VEGF and the other of said siRNA duplexes binds to an mRNA molecule that encodes VEGFR2.2. The composition of further comprising an siRNA duplex that binds to an mRNA molecule that encodes TGFβ1.3. The composition of wherein said siRNA duplexes target both human mRNA and homologous mouse mRNA.4. The composition of wherein said siRNA duplexes target both human mRNA and homologous mouse mRNA.5. The composition of wherein said siRNA duplexes comprise oligonucleotides with a length of 16-27 base pairs.7. The composition of wherein said siRNA duplexes comprise oligonucleotides with a length of 21-25 base pairs.8. The composition of wherein said siRNA duplexes comprises oligonucleotides with a length of 25 base pairs.9. The composition of wherein said siRNA duplexes comprise oligonucleotides with blunt ends at both ends.10. The composition of wherein said siRNA duplexes are selected from the siRNA duplexes listed in Tables 1 and 2.11. The composition of wherein said siRNA duplexes are selected from the siRNA duplexes in Tables 1-3.14. The composition of wherein said duplexes are selected from the group consisting of:a. derived duplexes consisting of 24 contiguous base pairs of any one or more of the duplexes in Tables 1 and 2;b. derived duplexes consisting of 23 contiguous base pairs of ...

Compositions and methods for silencing apolipoprotein b

The present invention provides compositions and methods for the delivery of interfering RNAs such as siRNAs that silence APOB expression in cells such as liver cells. In particular, the nucleic acid-lipid particles provide efficient encapsulation of nucleic acids and efficient delivery of the encapsulated nucleic acid to cells such as liver cells in vivo. The compositions of the present invention are highly potent, thereby allowing effective knock-down of APOB at relatively low doses. In addition, the compositions and methods of the present invention are less toxic and provide a greater therapeutic index compared to compositions and methods previously known in the art.

Method for Inhibiting HIV Replication in Mammal and Human Cells

The present invention describes a method to inhibit replication of the human immunodeficiency virus (HIV) by negatively modulating or altering the cytoskeleton, more precisely the proteins forming the intermediate cytoskeletal filaments, wherein the said proteins are vimentin and/or keratin-10. The replication of the virus is inhibited in human cells by intervening in the structure of these proteins. The present invention is also related to the use of agents, which comprise peptides and/or interfering RNA and/or lipidic compounds, said agents producing a negative modulation or alteration of the cytoskeleton to prevent or to treat the HIV infection. The invention provides means and methods for altering the cytoskeleton/filament structure of cells, as a result of which the infection of human cells by HIV is disturbed and can even be completely inhibited. The cytoskeleton is altered by reducing the amount of vimentin and/or keratin (e.g. by transcriptional control using interfering RNA) or by using peptides that disrupt the cytoskeleton. 1. A method to inhibit the replication of the human immunodeficiency virus (HIV) comprising disrupting the structure of cytoskeletal intermediate filaments (IFs) in a mammalian cell.2. The method according to wherein said IFs comprise vimentin and/or keratin proteins.3. The method according to wherein said IFs comprise vimentin and/or keratin-10 proteins.4. The method according to comprising decreasing the amount of vimentin and/or keratin-10 in said IF.5. The method according to comprising decreasing the expression of the genes coding for vimentin and/or keratin-10.6. The method according to wherein the disruption of said IF is achieved by an agent selected from a group consisting of polypeptides claim 1 , peptides claim 1 , nucleic acids and chemical compounds.7. The method according to wherein said agent is a peptide selected from the group of peptides identified as SEQ ID No. 1 to SEQ ID No. 10 claim 6 , and homologues thereof.8. ...

METHOD OF TREATING TUMOR RESISTANT TO HERCEPTIN OR PACLITAXEL USING FOXM1 INHIBITORS AND DETECTING SAME

The invention provides methods of treating cancer, especially breast cancer, and in particular HER2/ErbB2 positive breast cancer using a FoxM1 inhibitor in conjunction with trastuzumab and/or paclitaxel. Pharmaceutical compositions comprising a FoxM1 inhibitor in the presence of trastuzumab and/or paclitaxel are also provided. The invention further provides methods of identifying and treating trastuzumab resistant and/or paclitaxel resistant cancer. Also provided are methods of promoting breast tumor cell differentiation. 196-. (canceled)97. A pharmaceutical composition for inhibiting tumor growth comprising a combination of a FoxM1 inhibitor and trastuzumab or paclitaxel or both trastuzumab and paclitaxel , wherein the combination is in a therapeutically effective amount , and a pharmaceutically acceptable excipient , diluent or carrier.98. The pharmaceutical composition of wherein the combination comprises a FoxM1 inhibitor and trastuzumab and paclitaxel.99. The pharmaceutical composition of wherein the FoxM1 inhibitor comprises an inhibitory P19ARF peptide.100. The pharmaceutical composition of wherein the inhibitory P19ARF peptide comprises a peptide having the sequence of SEQ ID NO:6 or SEQ ID NO:7.101. The pharmaceutical composition of wherein the FoxM1 inhibitor comprises a FoxM1-specific siRNA.102. The pharmaceutical composition of claim 101 , wherein the FoxM1-specific siRNA comprises a polynucleotide having the sequence of SEQ ID NO:8 claim 101 , SEQ ID NO:9 claim 101 , SEQ ID NO:10 claim 101 , or SEQ ID NO:11.103. The pharmaceutical composition of wherein the FoxM1 inhibitor comprises a thiazole antibiotic.104. The pharmaceutical composition of claim 103 , wherein the thiazole antibiotic is siomycin A or thiostrepton.105. The pharmaceutical composition of wherein the FoxM1 inhibitor is an antioxidant.106. The pharmaceutical composition of wherein the antioxidant is N-acetyl-L-cysteine (NAC) claim 105 , catalase claim 105 , 4-Hydroxy-2 claim 105 ,2 claim ...

METHODS AND COMPOSITIONS FOR TREATING PROSTATE CANCER

Treatment of prostate cancer by regional and prolonged release of one or more nucleotide-based RNAi agents is provided. 1. A millimeter-scale drug delivery device (DDD) comprising:A. A biodegradable polymeric matrix; andB. An RNAi (RNA interference) agent that targets a prostate carcinoma-related gene, incorporated within said biodegradable polymeric matrix.2. The DDD of claim 1 , wherein said target is selected from the group consisting of: Androgen Receptor claim 1 , PAPPA pregnancy-associated plasma protein A (Pappalysin) claim 1 , Neurophilin and tolloid-like 2 (NETO2) claim 1 , Protein tyrosine phosphatase receptor a (PTPRA) claim 1 , BMI1 polycomb ring finger oncogene (BMI-1) claim 1 , IL6ST interleukin 6 signal transducer/gp130 claim 1 , Human telomerase reverse transcriptase (hTERT) claim 1 , BRD4 bromodomain containing 4 (BRD4) claim 1 , ErbB3/HER3 claim 1 , PSCA prostate stem cell antigen (PSCA) claim 1 , Enhancer of zeste homolog 2 (EZH2) claim 1 , TMPRSS2/ERG claim 1 , CA12 Carbonic anhydrase XII (CA12) claim 1 , MEK4/MAP2K4 claim 1 , p63/KET claim 1 , Transmembrane and coiled-coil protein 1 (TMCC1) claim 1 , TMCC2 claim 1 , TMCC3 claim 1 , Neurotrimin claim 1 , CD70 claim 1 , Tmem50b claim 1 , Claudin-11 claim 1 , Neuroplastin (NPTN) claim 1 , and CD44.3. The DDD of claim 2 , wherein said target is selected from the group consisting of: Androgen Receptor claim 2 , Pappalysin claim 2 , NETO2 claim 2 , PTPRA claim 2 , BMI-1 claim 2 , IL6ST/gp130 claim 2 , hTERT claim 2 , BRD4 claim 2 , ErbB3/HER3 claim 2 , PSCA claim 2 , and EZH2.4. The DDD of claim 1 , wherein said DDD comprises RNAi agents targeting at least 2 genes selected from the group consisting of: Androgen Receptor claim 1 , Pappalysin claim 1 , NETO2 claim 1 , PTPRA claim 1 , BMI-1 claim 1 , IL6ST/gp130 claim 1 , hTERT claim 1 , BRD4 claim 1 , ErbB3/HER3 claim 1 , PSCA claim 1 , EZH2 claim 1 , TMPRSS2/ERG claim 1 , CA12 claim 1 , MEK4/MAP2K4 claim 1 , p63/KET claim 1 , TMCC1 claim 1 , TMCC2 ...

ANTICANCER COMPOSITION

Disclosed is an anticancer composition, comprising an inhibitor against WIG1 and/or YPEL5 or against a protein encoded by the gene. A composition for screening an anticancer agent comprising a nucleic acid having a sequence complementary to an mRNA of WIG1 and/or YPEL5, or an antibody to a protein encoded by the gene is also provided. Also, a method is provided for screening an anticancer agent, which comprises: (A) quantitatively analyzing expression of WIG1 and/or YPEL5 at an mRNA or protein level in a tumor cell which is not treated with a candidate for an anticancer agent; (B) quantitatively analyzing expression of the gene at an mRNA or protein level in a tumor cell after treatment of the candidate for an anticancer agent; and (C) selecting the candidate if the expression level of the gene is increased in step (B), compared to step (A). 1. An anticancer composition , comprising an inhibitor against a gene selected from the group consisting of WIG1 (wild-type p53 induced gene-1) , YPEL5 (yippee-like 5) and a combination thereof , or against a protein encoded by the gene.2. The anticancer composition of claim 1 , wherein the anticancer activity is based on premature senescence in tumor cells.3. The anticancer composition of claim 1 , wherein the gene is an mRNA.4. The anticancer composition of claim 3 , wherein the inhibitor is an siRNA.5. The anticancer composition of claim 4 , wherein the siRNA has the sense sequence of SEQ ID NO: 7 or 9.6. The anticancer composition of claim 1 , wherein the inhibitor against a protein is an antibody.7. A composition for screening an anticancer agent claim 1 , comprising a nucleic acid having a sequence complementary to an mRNA of a gene selected from the group consisting of WIG1(wild-type p53 induced gene-1) claim 1 , YPEL5 (yippee-like 5) and a combination thereof claim 1 , or an antibody to a protein encoded by the gene.8. The composition of claim 7 , wherein the nucleic acid is a DNA complementary to the mRNA.9. The ...

Asymmetric Liposomes for the Highly Efficient Encapsulation of Nucleic Acids and Hydrophilic Anionic Compounds, and Method for Preparing Same

The present invention relates to asymmetric liposomes for high encapsulation efficiency of nucleic acids and hydrophilic anionic compounds, and to a method for preparing same, and specifically, to asymmetric liposomes consisting of a cationic lipid having a small head group as an internal lipid and a neutral or PEGylated lipid having a big head group as an external lipid, wherein nucleic acids and/or anionic compounds are encapsulated in the internal lipid. According to the present invention, asymmetric liposomes, in which nucleic acids and hydrophilic anionic compounds are encapsulated with high efficiency, may be prepared, and thus the same may be used for various purposes, such as gene therapy, and the delivery of hydrophilic anionic drugs which are difficult to prepare as prodrugs, and drug delivery, imaging, etc. can be carried out by encapsulating a fluorescent contrast agent in the liposome. 1. An asymmetric liposome comprising a cationic lipid having a small head group as an internal lipid and a neutral or PEGylated lipid having a big head group as an external lipid , wherein nucleic acids and/or anionic compounds are encapsulated in the internal lipid.2. The asymmetric liposome as set forth in claim 1 , further comprising a function group attached to a surface thereof for cell target-oriented transmission and cell permeation claim 1 ,wherein the function group is antibody or a peptide.3. (canceled)4. The asymmetric liposome as set forth in claim 1 , wherein the internal lipid comprises dioleoyl dimethylammonium-propane (DODAP) and dipalmitoylphosphatidyl ethanolamine (DOPE) or dioleoyl phosphatidylethanolamine (DPPE) claim 1 , in a composition ratio of DODAP:DOPE or DPPE=1:1 to 1:9.5. The asymmetric liposome as set forth in claim 1 , wherein the external lipid comprises a neutral phospholipid claim 1 , a PEGylated phospholipid claim 1 , and cholesterol.6. The asymmetric liposome as set forth in claim 5 , wherein the neutral phospholipid comprises distearoyl ...

COMPOSITIONS AND METHODS FOR TREATING CANCER AND MODULATING STRESS GRANULE FORMATION

The invention provides methods for treating or decreasing the likelihood of developing a stress-granule related disorder and/or cancer by administering one or more poly-ADP-ribose polymerase (PARP) inhibitors, one or more PARP activators, one or more poly-ADP-ribose glycosylase (PARG) activators, and/or one or more poly-ADP-ribose glycohydrolase ARH3 activators. The invention also provides corresponding methods of decreasing stress granule formation and/or proliferation in a cell or a population of cells. The invention further provides methods of increasing the number of stress granules and proliferation in a cell or a population of cells by administering one or more PARP activators, one or more PARP inhibitors, one or more PARG inhibitors, and/or one or more ARH3 inhibitors. The invention also provides methods for screening for agents for treating or decreasing the likelihood of developing a stress granule-related disorder or cancer, and methods for determining the propensity for developing a stress granule-related disorder or cancer, as well as compositions and kits containing one or more PARP inhibitors, one or more PARP activators, one or more PARG activators, and one or more ARH3 activators. 1. A method of treating or decreasing the likelihood of developing a stress granule-related disorder in a subject comprising administering to said subject a therapeutically effective amount of one or more poly-ADP-ribose polymerase (PARP) inhibitor(s) , one or more poly-ADP ribose glycolase (PARG) activators , and/or one or more PARP11 activators.2. The method of claim 1 , wherein said one or more PARP inhibitor(s) selectively decrease the expression and/or one or more activities of one or more PARP(s) selected from the group consisting of PARP5a claim 1 , PARP12 claim 1 , PARP13 isoform 1 (PARP13.1) claim 1 , PARP13 isoform 2 (PARP13.2) claim 1 , and PARP15.3. The method of claim 2 , wherein:(a) said decrease in expression is a decrease in the level of one or more nucleic ...

NOVEL DIAGNOSTIC AND THERAPEUTIC TARGET IN INFLAMMATORY AND/OR CARDIOVASCULAR DISEASES

Methods for diagnosing inflammatory and/or cardiovascular diseases by assaying for Fibroblast Activation Protein (FAP) expression in a body fluid is provided as well as therapeutic means based thereon. 1. A method of determining the presence of an inflammatory and/or cardiovascular disease or condition in a patient comprising assaying(i) a sample of a body fluid taken from said patient for expression of Fibroblast Activation Protein (FAP), wherein expression or an increased expression of said FAP compared to a control sample is indicative for the disease or condition in said patient; and/or(ii) a sample of a thrombus or plaque taken from said patient for expression of FAP, wherein an increased expression of FAP as compared to its expression in a sample of a body fluid taken from said patient is indicative for the disease or condition.2. The method of claim 1 , wherein said body fluid is blood.3. The method of claim 1 , wherein said disease is selected from the group atherosclerosis claim 1 , rheumatoid arthritis claim 1 , stroke or an acute coronary syndrome such as myocardial infarction claim 1 , heart attack claim 1 , chronic liver disease claim 1 , cerebral venous thrombosis claim 1 , deep venous thrombosis or pulmonary embolism.4. The method of claim 2 , wherein the condition is vulnerable atherosclerotic plaques or atherothrombosis.5. The method of claim 1 , comprising assaying said sample for FAP protein or mRNA.6. The method of claim 5 , wherein said assay is an immunoassay.7. The method of claim 6 , wherein said assay is an immunohistochemical assay.8. The method of claim 7 , wherein said assay comprises fluorescence activated cytometry (FACS) claim 7 , indirect ELISA claim 7 , sandwich ELISA or cell culture ELISA.9. The method of claim 6 , wherein said immunoassay comprises contacting said sample with a monoclonal or polyclonal antibody which binds specifically to FAP.10. The method of claim 9 , wherein said monoclonal antibody is a mouse anti-human ...

INTRACELLULAR DNA RECEPTOR

Provided herein are methods of identifying and using compounds that modulate an AIM2 polypeptide-mediated immune response. Further provided herein are methods of treating disease comprising administering to a patient a compound that decreases expression of an AIM2 polypeptide. Further provided herein are methods of providing gene therapy to a patient comprising administering to the patient a gene therapy agent and a compound that decreases expression of an AIM2 polypeptide. In certain embodiments, a compound that decreases expression of an AIM2 polypeptide comprises an siRNA or an shRNA. 1. A method of treating an autoimmune disease in a patient , comprising administering to the patient a compound that decreases expression of an AIM2 polypeptide.2. The method of claim 1 , wherein the compound comprises an siRNA or an shRNA.3. The method of claim 1 , wherein expression of the AIM2 polypeptide is decreased by at least 50%.4. The method of claim 1 , wherein the disease is selected from the group consisting of: rheumatoid arthritis claim 1 , systemic lupus erythematosis claim 1 , scleroderma claim 1 , dermatomyositis claim 1 , and psoriasis.5. A method of treating an infection comprising administering to a patient a compound that decreases expression of an AIM2 polypeptide.6. The method of claim 5 , wherein the compound comprises an siRNA or an shRNA.7. The method of claim 5 , wherein expression of the AIM2 polypeptide is decreased by 50%.8. The method of claim 5 , wherein the infection is caused by a bacterial pathogen.9ShigellaFrancisellaChlamyidaListeria monocytogenes, Mycobacterium tuberculosis, Mycobacterium leprae, Mycobacterium avium intracellulare, BrucellaSalmonellaLegionella,Rickettsia.. The method of claim 8 , wherein the bacterial pathogen is selected from the group consisting of spp. claim 8 , spp. spp. spp. claim 8 , spp. claim 8 , and10. The method of claim 5 , wherein the infection is caused by a viral pathogen.11. The method of claim 10 , wherein the ...

REGULATORS OF NFAT AND/OR STORE-OPERATED CALCIUM ENTRY

Embodiments of the inventions relate to modulating NFAT activity, modulating store-operated Ca entry into a cell and treating and/or preventing hyperactivity or inappropriate immune response by inhibiting the expression or activities of proteins involved in the calcineurin/NFAT axis. 1. A method of modulating NFAT activity in a subject in need thereof , the method comprising administering a therapeutically effective amount of a pharmaceutical composition comprising an agent that inhibits the activity a protein and/or the expression of a gene identified in Table 4.2. The method of claim 1 , wherein the modulation of NFAT activity comprises increasing the immune response in a subject in need thereof.3. The method of claim 2 , wherein the subject is suffering from an immunodeficiency disorder selected from a group consisting of HIV (human immunodeficiency virus) and AIDS (acquired immunodeficiency syndrome) claim 2 , X-linked agammaglobulinemia claim 2 , selective IgA deficiency claim 2 , Wiskott-Aldrich syndrome claim 2 , chronic granulomatous disease claim 2 , leukocyte adhesion defects claim 2 , Bruton disease claim 2 , kidney failure claim 2 , and combined immunodeficiency disease.4. The method of claim 1 , wherein the subject is suffering from a cell proliferation disease or disorder.5. The method of claim 4 , wherein the cell proliferation disease or disorder is a neoplastic cell proliferation disorder.6. The method of claim 4 , wherein the neoplastic cell proliferation disorder is a therapy resistant cancer claim 4 , a metastasis or malignant cancer.7. The method of claim 1 , wherein the subject is suffering from a cardiovascular disorder.8. The method of claim 7 , wherein the cardiovascular disorders is cardiac hypertrophy claim 7 , restenosis claim 7 , atherosclerosis claim 7 , or angiogenesis.9. The method of claim 1 , wherein the subject is suffering from a bone disease associated with excessive osteoclast formation and the excessive activity needs to be ...

Antibody-Based Depletion of Antigen-Presenting Cells and Dendritic Cells

Disclosed herein are methods and compositions comprising anti-CD74 and/or anti-HLA-DR antibodies for treatment of GVHD and other immune dysfunction diseases. In preferred embodiments, the anti-CD74 and/or anti-HLA-DR antibodies are effective to deplete antigen-presenting cells, such as dendritic cells. Most preferably, administration of the therapeutic compositions depletes all subsets of APCs, including mDCs, pDCs, B cells and monocytes, without significant depletion of T cells. In alternative embodiments, administration of the therapeutic compositions suppresses proliferation of allo-reactive T cells, while preserving cytomegalovirus (CMV)-specific, CD8 memory T cells. The compositions and methods provide a novel conditioning regimen for preventing aGVHD and/or treating chronic GVHD, without altering preexisting anti-viral immunity. 1. A method of killing antigen-presenting cells or dendritic cells comprising:a. exposing the antigen-presenting cell or dendritic cell to an anti-HLA-DR and/or anti-CD74 antibody or antigen-binding fragment thereof; andb. killing the antigen-presenting cell or dendritic cell.2. The method of claim 1 , wherein the anti-CD74 antibody or fragment thereof competes for binding to CD74 with claim 1 , or binds to the same epitope of CD74 as claim 1 , a murine LL1 antibody comprising the light chain CDR sequences CDR1 (RSSQSLVHRNGNTYLH; SEQ ID NO:1) claim 1 , CDR2 (TVSNRFS; SEQ ID NO:2) claim 1 , and CDR3 (SQSSHVPPT; SEQ ID NO:3) and the heavy chain variable region CDR sequences CDR1 (NYGVN; SEQ ID NO:4) claim 1 , CDR2 (WINPNTGEPTFDDDFKG; SEQ ID NO:5) claim 1 , and CDR3 (SRGKNEAWFAY; SEQ ID NO:6).3. The method of claim 1 , wherein the anti-CD74 antibody or fragment thereof comprises the light chain CDR sequences CDR1 (RSSQSLVHRNGNTYLH; SEQ ID NO:1) claim 1 , CDR2 (TVSNRFS; SEQ ID NO:2) claim 1 , and CDR3 (SQSSHVPPT; SEQ ID NO:3) and the heavy chain variable region CDR sequences CDR1 (NYGVN; SEQ ID NO:4) claim 1 , CDR2 (WINPNTGEPTFDDDFKG; SEQ ...

RNA Interference Mediated Inhibition of Prolyl Hydroxylase Domain 2 (PHD2) Gene Expression Using Short Interfering Nucleic Acid (siNA)

The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond expressed/synthetic to the modulation of PHD2 gene expression and/or activity, and/or modulate a beta-catenin gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short inter-fering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsR-NA), micro-RNA (miRNA), and short hair-pin RNA (shRNA) molecules that are capa-ble of mediating or that mediate RNA inter-ference (RNAi) against PHD2 gene expres-sion. 1. A double-stranded short interfering nucleic acid (siNA) molecule comprising R-008039846-001E , R-008039847-001N , R-008039882-001P , R-008039848-001X , R-008039849-001F , R-008053961-001S , R-008054086-001B , R-008147454-000S or any combination thereof.2. A composition comprising one or more siNA molecules of and a pharmaceutically acceptable carrier or diluent.3. A composition comprising:{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, '(a) one or more siNA molecules of ;'}(b) a cationic lipid;(c) cholesterol;(d) DSPC; and(e) PEG-DMG.4. A composition comprising:{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, 'one or more siNA molecules of ;'}(b) (13Z,16Z)—N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine;(c) cholesterol;(d) DSPC; and(e) PEG-DMG.5. The composition according to claim 4 , wherein the (13Z claim 4 ,16Z)—N claim 4 ,N-dimethyl-3-nonyldocosa-13 claim 4 ,16-dien-1-amine claim 4 , cholesterol claim 4 , DSPC claim 4 , and PEG-DMG have a molar ratio of 50:30:10:2 respectively.6. A composition comprising the composition according to and a pharmaceutically acceptable carrier or diluent.7. A method of treating a human subject suffering from a condition which is mediated by the action claim 1 , or by loss of action claim 1 , of PHD2 claim 1 , which comprises administering to said subject an ...

NCAM-VASE AND NEURODEGENERATION

Inhibitors of NCAM-VASE, compositions comprising said inhibitors, and methods of using said inhibitors for stimulation of neuroplasticity and/or neuroregeneration in the central nervous system, and for increasing neuronal cell response to agents that stimulate neuroplasticity and/or neuroregeneration in the central nervous system, are provided. The inhibitor or composition may be used, for example, for treating brain or spinal cord injury; schizophrenia, motor neurone disease; a neurodegenerative disorder such as Alzheimer's disease, multiple sclerosis or Parkinson's disease; ischaemia caused by stroke; or for improving learning and/or memory. 1. (canceled)2. (canceled)3. The method of wherein the inhibitor is an antisense RNA molecule or an interfering RNA that is capable of causing a reduction of NCAM-VASE mRNA transcription.4. The method of wherein the inhibitor is a soluble polypeptide comprising the Ig4 domain of NCAM-VASE.5. The method of wherein the inhibitor is a soluble polypeptide comprising a further sequence from NCAM-VASE in addition to the Ig4 domain.6. The method of wherein the inhibitor is an antibody or antibody fragment or derivative able to bind selectively to NCAM-VASE.7. The method of claim 12 , wherein the inhibitor is administered in combination with a second agent which promotes neuroplasticity and/or neuroregeneration.8. The method of claim 7 , wherein the second agent is selected from the list consisting of NGF claim 7 , BDNF claim 7 , FGF claim 7 , CNTF claim 7 , GDNF claim 7 , NT3 claim 7 , NT4/5 dbcAMP and forskolin.9. The method of claim 12 , wherein the method is for treating brain or spinal cord injury.10. The method of claim 12 , wherein the method is for treating schizophrenia claim 12 , motor neurone disease claim 12 , for treating a neurodegenerative disorder including Alzheimer's disease claim 12 , multiple sclerosis or Parkinson's disease; for treating ischaemia caused by stroke; or for improving learning and/or memory.11. ( ...

Inhibition of LAR Phosphatase to Enhance Therapeutic Angiogenesis

The present invention relates to the regulation of angiogenesis and arteriogenesis by leukocyte antigen-related protein tyrosine phosphatase (LAR). The invention further relates to the use of inhibitors of LAR expression and/or activity to stimulate angiogenesis and/or arteriogenesis. 12-. (canceled)3. A method of increasing angiogenesis and/or arteriogenesis in a tissue of a subject , comprising decreasing the expression and/or activity of LAR in said tissue of said subject.4. A method of treating or preventing ischemia in a tissue of a subject , comprising decreasing the expression and/or activity of LAR in said tissue of said subject.5. The method of claim 3 , wherein said subject has diabetes.6. The method of claim 3 , wherein said subject has cardiovascular or cerebrovascular disease or has experienced ischemia or stroke.7. The method of claim 3 , wherein said subject is at risk for ischemia.8. The method of claim 3 , wherein said subject has a graft or other transplanted tissue claim 3 , anastomosis claim 3 , wound claim 3 , ulcer claim 3 , burn claim 3 , male pattern baldness claim 3 , atherosclerosis claim 3 , ischemic heart tissue claim 3 , ischemic peripheral tissue claim 3 , myocardial or cerebral infarction claim 3 , or vascular occlusion or stenosis.9. The method of claim 3 , comprising delivering an inhibitor of LAR expression and/or activity to said tissue.10. The method of claim 9 , wherein said tissue is in a limb.11. The method of claim 10 , wherein said tissue is in a foot or toe.12. The method of claim 9 , wherein said tissue is in the heart or brain.13. The method of claim 3 , wherein decreasing the expression and/or activity of LAR comprises decreasing the level of a nucleic acid encoding LAR.14. The method of claim 13 , wherein the method comprises delivering an antisense RNA to said subject to decrease the level of a nucleic acid encoding LAR.15. The method of claim 13 , wherein the method comprises delivering an siRNA to said subject to ...

PROSTAGLANDIN TRANSPORTER INHIBITORS

The present invention generally relates to prostaglandin transport. More specifically, the invention is directed to compounds that inhibit prostaglandin transport and subsequent COX-2 induction, and methods relating thereto. 112-. (canceled)1445-. (canceled)46. A method of inhibiting COX-2 in a mammal , the method comprising administering an inhibitor of prostaglandin transporter activity to the mammal.47. The method of claim 46 , wherein the inhibitor is an antisense nucleic acid claim 46 , a ribozyme or an siRNA claim 46 , wherein the antisense nucleic acid claim 46 , the ribozyme or the siRNA is specific for the mRNA of the prostaglandin transporter.48. The method of claim 46 , wherein the inhibitor is an antibody or aptamer that specifically inhibits the prostaglandin transporter.51. The method of claim 49 , wherein R2 comprises a carboxyl or phenol group.52. The method of claim 49 , wherein R2 is a C-Cstraight or branched alkyl claim 49 , a phenyl claim 49 , a fused aryl claim 49 , a fused heteroaryl claim 49 , or any combination thereof claim 49 , optionally substituted with a halogen claim 49 , a carboxyl claim 49 , an amino claim 49 , a nitro claim 49 , a SCH claim 49 , a hydroxyl claim 49 , a C-Calkoxy claim 49 , C-Cstraight or branched alkyl claim 49 , an azido claim 49 , or a combination thereof.53. The method of claim 49 , wherein R2 is a C-Cstraight or branched alkyl claim 49 , a phenyl claim 49 , a fused aryl claim 49 , or a combination of a C-Cstraight or branched alkyl and a phenyl claim 49 , optionally substituted with a halogen claim 49 , one or more hydroxyls claim 49 , a methoxy claim 49 , a nitro claim 49 , a carboxy claim 49 , or a combination thereof.56. The method of claim 46 , wherein the mammal is a human suffering from a disease or disorder at least partially mediated by a cyclooxygenase-2.57. The method of claim 56 , wherein the disease or disorder involves pain and/or inflammation.58. The method of claim 56 , wherein the disease or ...

METHOD FOR PRONGF ASSAY FOR IN VITRO DIAGNOSIS OF CANCER IN PARTICULAR BREAST, THYROID OR LUNG CANCER AND THERAPEUTIC USE OF PRONGF

A ProNGF inhibitor for preparing a drug, said drug being in particular useful for blocking remote dissemination and cell invasion in patients suffering from cancer, in particular breast, thyroid or lung cancer. 1. A method for treatment of a patient suffering from cancer , comprising administering a therapeutically effective amount of a ProNGF inhibitor to said patient.2. The method as claimed in claim 1 , wherein the amount is effective for blocking cell migration or invasion in patients suffering from cancer.3. The method as claimed in claim 1 , wherein the ProNGF inhibitor is an anti-ProNGF antibody or a ProNGF receptor analog in soluble form.4. The method as claimed in claim 1 , wherein said ProNGF inhibitor is able to specifically penetrate into cells of interest.5. The method as claimed in claim 1 , wherein the ProNGF inhibitor is an siRNA of a ProNGF receptor.6. A method of blocking cancerous cell migration claim 1 , comprising administering an effective amount of a ProNGF inhibitor to a person claim 1 , thereby blocking migration of cancer cells.7. A pharmaceutical composition claim 1 , comprising claim 1 , as an active ingredient claim 1 , at least one ProNGF inhibitor in combination with a pharmaceutually acceptable excipient.8. A pharmaceutical composition as claimed in claim 7 , wherein the ProNGF inhibitor is an anti-ProNGF antibody or a ProNGF receptor analog in soluable form.9. A pharmaceutical composition as claimed in claim 7 , wherein the ProNGF inhibitor is an siRNA of a ProNGF receptor.10. A pharmaceutical composition as claimed in claim 7 , wherein said ProNGF inhibitor is able to specifically penetrate into cells of interest. This is a Continuation of application Ser. No. 13/137,101 filed Jul. 20, 2011, which is a Division of application Ser. No. 12/087,606 filed Jul. 10, 2008, which in turn is a National Phase of PCT/FR2007/050708, filed Jan. 30, 2007. The disclosures of the prior applications are hereby incorporated by reference herein in ...

Selective inhibition of polyglutamine protein expression

The present invention relates to the selective inhibition of protein expression of CAG repeat-related disease proteins such as Huntingtin Disease Protein and Ataxin-3 using double-stranded RNAs and nucleic acid analogs. Chemically-modified RNAs having at least one mismatch as compared to the target CAG repeat sequence are specifically contemplated.

COMPOSITION FOR REGENERATING NORMAL TISSUE FROM FIBROTIC TISSUE

The present invention relates to a pharmaceutical composition and a method for regenerating normal tissue from fibrotic tissue, the pharmaceutical composition and the method employing a collagen-reducing substance. In accordance with the present invention, normal tissue can be therapeutically regenerated from fibrotic tissue. 1. A pharmaceutical composition comprising a collagen-reducing substance in an amount effective for regenerating normal tissue from fibrotic tissue.2. The pharmaceutical composition according to claim 1 , wherein the collagen-reducing substance is selected from the group consisting of a suppressor of collagen production by collagen-producing cells claim 1 , a promoter of collagen decomposition claim 1 , and a suppressor of a collagen decomposition inhibitor.3. The pharmaceutical composition according to claim 1 , wherein it further comprises a targeting agent for collagen-producing cells in fibrotic tissue.4. The pharmaceutical composition according to claim 3 , wherein the targeting agent is a retinoid.51. The pharmaceutical composition according to Claim claim 3 , wherein the fibrotic tissue continually receives a fibrotic stimulus.6. The pharmaceutical composition according to claim 1 , wherein the pharmaceutical composition is for regenerating normal tissue from fibrotic tissue in a space for the growth and differentiation of stem cells claim 1 , the space being formed by a reduction of collagen accumulated in the fibrotic tissue.7. The pharmaceutical composition according to claim 2 , wherein the suppressor of collagen production by collagen-producing cells is selected from the group consisting of a TGFβ inhibitor claim 2 , HGF or a substance promoting the production thereof claim 2 , a PPARγ ligand claim 2 , an angiotensin inhibitor claim 2 , a PDGF inhibitor claim 2 , relaxin or a substance promoting the production thereof claim 2 , a substance that inhibits the production and secretion of an extracellular matrix component claim 2 , a ...

POTENTIATOR OF ACTIVITY OF ANTI-CANCER AGENT AND USE THEREOF, AND BIOMARKER FOR PREDICTION OF PROGNOSIS IN CANCER PATIENT AND USE THEREOF

Disclosed is a means for improving the clinical outcomes of cancer therapy. Specifically disclosed is an activity potentiator comprising a compound capable of inhibiting the expression of RFP (RET finger protein) gene or the activity of RFP as an active ingredient. The activity of an anti-cancer agent having an oxidative stress inducing ability can be potentiated by using the anti-cancer agent in combination with the activity potentiator. Further specifically disclosed are a biomarker useful for the recognition of prognosis in a cancer patient and use of the biomarker. 115-. (canceled)16. An action enhancing agent of an anticancer drug having an oxidative stress-inducing ability , comprising a compound , as an active ingredient , for suppressing expression of a RFP (RET finger protein) gene or action of RFP.17. The action enhancing agent according to claim 16 , wherein the compound is selected from the group consisting of the following (a) to (d):(a) siRNA targeting the RFP gene;(b) a nucleic acid construct for generating the siRNA targeting the RFP gene in a cell;(c) an antisense nucleic acid targeting a transcriptional product of the RFP gene; and(d) a ribozyme targeting a transcriptional product of the RFP gene.18. The action enhancing agent according to claim 16 , which is used in combination with an anticancer drug having an oxidative stress-inducing ability.19. A method for enhancing action of an anticancer drug having an oxidative stress-inducing ability claim 16 , the method comprising a step of suppressing expression of a RFP gene or action of RFP in a target cell.20. A method for treating a cancer claim 16 , the method comprising:{'claim-ref': {'@idref': 'CLM-00016', 'claim 16'}, 'a step of administering the action enhancing agent according to ; and'}a step of administering an anticancer drug having an oxidative stress-inducing ability.21. A method for testing resistance to an anticancer drug claim 16 , the method comprising:a step of examining an ...

TREATMENT OF ABNORMAL OR EXCESSIVE SCARS

Methods and compositions comprising combinations and uses of a first anti-connexin agent and a second anti-connexin agent, for example, one or more anti-connexin polynucleotides and one or more anti-connexin peptides or peptidomimetics, are provided for the treatmen or prevention of abnormal or excessive scarring. 1. A method of treating a subject having or at risk for developing an abnormal or excessive scar , comprising administering to the subject a composition comprising therapeutically effective amounts of an anti-connexin peptide.2. A method of claim 1 , wherein said peptide comprises a sequence selected from SEQ.ID.NOS:15 to 23.3. A method of claim 1 , wherein said peptide comprises said anti-connexin 43 peptide or anti-connexin 43 peptidomimetic.4. A method according to claim 3 , wherein the composition comprises about 0.01 to about 100 milligrams of said anti-connexin 43 peptide or anti-connexin 43 peptidomimetic.5. A method of treating a subject having or at risk for developing an abnormal or excessive scar claim 3 , comprising administering to the subject a composition comprising therapeutically effective amounts of a first anti-connexin agent and a second anti-connexin agent claim 3 , wherein said first agent is an anti-connexin polynucleotide and said second agent is an anti-connexin peptide or peptidomimetic.6. A method according to claim 5 , wherein said polynucleotide is an antisense polynucleotide.7. A method according to claim 6 , wherein said antisense polynucleotide comprises a sequence selected from SEQ.ID.NOS:1 to 12.8. A method according to claim 6 , wherein said antisense polynucleotide is selected from: GTA ATT GCG GCA AGA AGA ATT GTT TCT GTC (SEQ ID NO:1); GTA ATT GCG GCA GGA GGA ATT GTT TCT GTC (SEQ ID NO:2); and claim 6 , GGC AAG AGA CAC CAA AGA CAC TAC CAG CAT (SEQ ID NO:3).9. A method according to claim 6 , wherein said antisense polynucleotide has from about 15 to about 35 nucleotides and is sufficiently complementary to connexin 43 ...

COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF MUTANT EGFR GENE

The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting a mutant Epidermal Growth Factor Receptor (EGFR), and methods of using the dsRNA to inhibit expression of mutant EGFR. 1. A double-stranded ribonucleic acid (dsRNA) , wherein said dsRNA comprises at least two sequences that are complementary to each other and wherein a sense strand comprises a first sequence and an antisense strand comprises a second sequence comprising a region of complementarity which is substantially complementary to at least a part of a mRNA encoding an delta-Epidermal Growth Factor Receptor (deltaEGFR) , and wherein said region of complementarity is less than 30 nucleotides in length.2. The dsRNA of claim 1 , wherein said dsRNA comprises at least one modified nucleotide.3. The dsRNA of claim 2 , wherein at least one of said modified nucleotides is chosen from the group of: a 2′-O-methyl modified nucleotide claim 2 , a nucleotide comprising a 5′-phosphorothioate group claim 2 , and a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group.4. The dsRNA of claim 2 , wherein said modified nucleotide is chosen from the group of: a T-deoxy-2′-fluoro modified nucleotide claim 2 , a 2′-deoxy-modified nucleotide claim 2 , a locked nucleotide claim 2 , an abasic nucleotide claim 2 , 2′-amino-modified nucleotide claim 2 , 2′-alkyl-modified nucleotide claim 2 , morpholino nucleotide claim 2 , a phosphoramidate claim 2 , and a non-natural base comprising nucleotide.5. The dsRNA of claim 1 , wherein the region of complementary is at least 15 nucleotides in length.6. The dsRNA of claim 1 , wherein the region of complementarity is between 19 and 21 nucleotides in length.7. The dsRNA of claim 1 , wherein the dsRNA comprises a sense strand consisting of a sense strand sequence selected from Tables 2 and 3 claim 1 , and an antisense strand consisting of an antisense sequence selected from Tables 2 and 3.8. The dsRNA of claim 1 , wherein the sense ...

COMPOSITIONS AND METHODS FOR INHIBITION OF OR TREATMENT OF DENGUE VIRUS INFECTION

The present invention relates to a method of interfering with dengue infection comprising interfering with dengue virus binding to a syndecan present on a cell targeted by dengue virus. The present invention further relates to treating a patient for dengue virus infection comprising administering to a patient, either having a dengue infection or a patient exposed to dengue infection, an effective amount of an agent that interferes with dengue virus binding to a syndecan on a surface of a cell targeted by dengue virus. The present invention further relates to a pharmaceutical composition comprising a pharmaceutically acceptable carrier, and an effective amount of an agent that interferes with dengue virus binding to a syndecan on a surface of a cell targeted by dengue virus. 1. A method of interfering with dengue virus infection comprising:interfering with dengue virus binding to syndecan-2, syndecan-4, or both, present on a cell targeted by dengue virus.2. The method according to claim 1 , wherein said interfering is carried out with an antibody specific to syndecan-2 claim 1 , syndecan-4 claim 1 , or a combination thereof.3. The method according to claim 2 , wherein the antibody is a polyclonal antibody claim 2 , monoclonal antibody claim 2 , or active fragment thereof.4. (canceled)5. The method according to claim 1 , wherein said interfering is carried out with heparin or heparan sulfate.6. The method according to claim 1 , wherein said interfering is carried out by introducing an RNAi into the cell to inhibit expression of syndecan-2 claim 1 , syndecan-4 claim 1 , or a combination thereof.7. (canceled)8. The method according to claim 1 , wherein the dengue virus is contacted with a soluble extracellular domain of syndecan-2 claim 1 , syndecan-4 claim 1 , or a combination thereof.9. (canceled)10. The method according to claim 1 , wherein a small molecule inhibitor of syndecan-2 claim 1 , and/or syndecan-4 is used.11. The method according to claim 1 , wherein the ...

METHOD FOR PREDICTING THE RESPONSIVENESS TO CHEMOTHERAPY

The present invention concerns a method for predicting the responsiveness of an individual suffering from leukemia to a chemotherapeutic drug. In particular, this method comprises determining the proportion of leukemic cells expressing cytoplasmic PCNA in a biological sample of the individual. The present invention also relates to a tyrosine kinase inhibitor for use for the treatment of an individual suffering from leukemia and having a proportion of leukemic cells expressing cytoplasmic PCNA in a biological sample lower than a predetermined threshold. The invention also pertains to a method for diagnosing whether an individual suffers, or is at risk of suffering, from leukemia. 1. A method for predicting the responsiveness of an individual suffering from leukemia to a chemotherapeutic drug , said method comprising determining the proportion of leukemic cells expressing cytoplasmic PCNA in a biological sample of the individual.2. The method of claim 1 , wherein a proportion of leukemic cells expressing cytoplasmic PCNA higher than a predetermined threshold is indicative that the individual is likely not to respond to the chemotherapeutic drug.3. The method of claim 1 , wherein a proportion of leukemic cells expressing cytoplasmic PCNA of at least 50% is indicative that the individual is likely not to respond to the chemotherapeutic drug.4. The method of claim 1 , wherein the chemotherapeutic drug is selected from the group consisting of alkaloids claim 1 , alkylating agents claim 1 , antimetabolites claim 1 , antibiotics claim 1 , tyrosine kinase inhibitors claim 1 , topoisomerase inhibitors claim 1 , monoclonal antibodies claim 1 , biological response modifiers and corticosteroids.5. The method of claim 1 , wherein the chemotherapeutic drug is a tyrosine kinase inhibitor or a topoisomerase inhibitor.6. The method of claim 1 , wherein the chemotherapeutic drug is imatinib mesilate or doxorubicin.7. The method of claim 1 , wherein the leukemia is a myelocytic ...

INHIBITORS OF LONG AND VERY LONG CHAIN FATTY ACID METABOLISM AS BROAD SPECTRUM ANTI-VIRALS

The present invention provides methods and compounds for treating viral infections using modulators of host cell enzymes relating to long chain fatty acid and lipid droplet metabolism. It includes a method of treating viral infections using triacsin C and its relatives, analogues and derivatives as well as other inhibitors of long chain fatty acid metabolism and lipid droplet metabolism. 181-. (canceled)82. A method of treating or preventing viral infection in a mammal , comprising administering to a mammalian subject in need thereof a therapeutically effective amount of an agent that inhibits a long chain fatty acid synthesis enzyme.83. The method of claim 82 , wherein the enzyme is an elongase.84. The method of claim 82 , wherein the enzyme is selected from the group consisting of:i) acyl-CoA synthetase long-chain family member 1 (ACSL1)ii) elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 (ELOVL2),iii) elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3 (ELOVL3),iv) elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 6 (ELOVL6), andv) solute carrier family 27 (fatty acid transporter), member 3 (SLC27A3).85. The method of claim 82 , wherein the agent is an inhibitory polynucleotide.86. The method of claim 82 , wherein the agent is a small molecule.96. The method of claim 82 , wherein the virus is an enveloped virus.97. The method of claim 82 , wherein the virus is human cytomegalovirus (HCMV) claim 82 , hepatitis C virus (HCV) claim 82 , herpes simplex virus (HSV) claim 82 , hepatitis B virus (HBV) claim 82 , Human immunodeficiency virus (HIV) claim 82 , or influenza virus.981. The method of claim claim 82 , wherein the virus is HCMV claim 82 , which further comprises administering a therapeutically effective amount of an agent that inhibits HCMV-encoded DNA polymerase.991. The method of claim claim 82 , wherein the virus is HSV claim 82 , which further comprises administering a ...

Methods and Compositions Related to DLK-1 and the P38 MAPK Pathway in Nerve Regeneration

Disclosed are compositions and methods for treating neurodegenerative disease. 1C. elegans.. A method of regenerating axons , the method comprising activating a gene in the p38 MAPK pathway of2C. elegans.. A method of regenerating axons in a subject , the method comprising activating a gene with 80% or greater homology to a gene in the p38 MAPK pathway of3. The method of claim 2 , wherein the subject is a mammal.4. The method of claim 3 , wherein the mammal is a human.5. The method of or claim 3 , wherein the gene in the p38 MAPK pathway is selected from the group comprising dlk-1 claim 3 , mkk-4 claim 3 , and pmk-3.6C. elegans.. A method of regenerating axons claim 3 , the method comprising inhibiting a gene in the p38 MAPK pathway of7C. elegans.. A method of regenerating axons in a subject claim 3 , the method comprising inhibiting a gene with 80% or greater homology to a gene in the p38 MAPK pathway of8. The method of or claim 3 , wherein the subject is a mammal.9. The method of claim 8 , wherein the mammal is a human.10. The method of or claim 8 , wherein the gene in the p38 MAPK pathway is selected from the group comprising rpm-1 and fsn-1.11. The method of claim 7 , wherein the gene is inhibited with siRNA.12. The method of claim 11 , wherein the gene that is inhibited is phr-1.13C. elegans.. A method of treating a subject with a neurodegenerative disease claim 11 , the method comprising activating a gene with 80% or greater homology to a gene in the p38 MAPK pathway of14C. elegans.. A method of treating a subject with a neurodegenerative disease claim 11 , the method comprising inhibiting a gene with 80% or greater homology to a gene in the p38 MAPK pathway of15C. elegans. A method of regenerating axons in a subject claim 11 , the method comprising activating a gene with 80% or greater homology to a gene in the p38 MAPK pathway of by contacting the gene with a compound that activates said gene.16. A pharmaceutical composition comprising the compound of .17C. ...

Methods and compositions for improving sleep and memory

A method for determining whether a substance can increase the expression level of a fatty acid binding protein (FABP) in an animal. The method includes using a cell that includes an expression construct that comprises a FABP promoter operably linked to a polynucleotide sequence encoding a reporter molecule, wherein the cell is contacted with a candidate substance and then cultivating the cell under conditions conducive to expression of the reporter molecule. Increased expression of the construct in the presence of the candidate substance as compared to a control leads to improved sleep and long-term memory in the subject.

CNS TARGETING AAV VECTORS AND METHODS OF USE THEREOF

The invention in some aspects relates to recombinant adeno-associated viruses useful for targeting transgenes to CNS tissue, and compositions comprising the same, and methods of use thereof. In some aspects, the invention provides methods and compositions for treating CNS-related disorders. 1. A method for delivering a transgene to CNS tissue in a subject , the method comprising:administering an effective amount of a rAAV by intrathecal administration, wherein the rAAV comprises (i) a capsid protein comprising a sequence as set forth in SEQ ID NO: 9 and (ii) a nucleic acid comprising a promoter operably linked with a transgene.2. The method of further comprising administering an effective amount of the rAAV by intracerebral administration.3. A method for delivering a transgene to central nervous system (CNS) tissue in a subject claim 1 , the method comprising:administering an effective amount of a rAAV by intrathecal administration and by intracerebral administration, wherein the rAAV infects cells of CNS tissue in the subject and comprises a nucleic acid comprising a promoter operably linked with a transgene.4. The method of claim 2 , wherein the intracerebral administration is an intraventricular administration.5. The method of claim 1 , wherein the intrathecal administration is in the lumbar region of the subject6. The method of claim 4 , wherein the intraventricular administration is an administration into a ventricular region of the forebrain of the subject.7. The method of claim 1 , wherein the dose of the rAAV for intrathecal administration is in a range of 10genome copies to 10genome copies.8. The method of claim 2 , wherein the dose of the rAAV for intracerebral administration is in a range of 10genome copies to 10genome copies.9. The method of claim 1 , wherein the transgene is a CNS-associated gene.10. The method of claim 9 , wherein the CNS-associated gene is neuronal apoptosis inhibitory protein (NAIP) claim 9 , nerve growth factor (NGF) claim 9 , glial ...

METHODS OF ALTERING BONE GROWTH BY ADMINISTRATION OF SOST OR WISE ANTAGONIST OR AGONIST

The present invention provides a method of promoting local bone growth by administering a therapeutic amount of a Sost antagonist to a mammalian patient in need thereof. Preferably, the Sost antagonist is an antibody or FAB fragment selectively recognizing any one of SEQ ID NOS: 1-23. The Sost antagonist may be coadministered together or sequentially with a matrix conducive to anchoring new bone growth. Orthopedic and Periodontal devices comprising an implantable portion adapted to be permanently implanted within a mammalian body and bearing an external coating of a Sost antagonist are also disclosed, as it a method of increasing bone density by administering to a mammalian patient a therapeutic amount of a Sost antagonist together with an antiresorptive drug. 1. A method of increasing bone density in a mammalian patient in need thereof , comprising the steps of:systemically administering to a said mammalian patient a therapeutic comprising an effective amount of a Sclerostin antagonist sequentially with an antiresorptive drug.2. The method according to claim 1 , wherein said patient is a human.3. The method according to claim 2 , wherein said patient has low bone density.4. The method according to claim 3 , wherein said Sclerostin antagonist interferes with the interaction of Sclerostin with its receptor.5. The method according to claim 4 , wherein said Sclerostin antagonist is Usag-1 claim 4 , ectodin or sostdc1.6. The method according to claim 4 , wherein said Sclerostin antagonist is a Sclerostin mimetic or vinylogous peptoid.7. The method according to claim 3 , wherein said Sclerostin antagonist is siRNA or a nucleic acid aptamer.8. The method according to claim 7 , wherein said Sclerostin antagonist is Sc12.9. The method according to claim 3 , wherein said Sclerostin antagonist is an antibody or FAB fragment specifically binding a peptide selected from the group consisting of SEQ ID NOS:2-13 claim 3 , 22 and 23.10. The method according to claim 9 , wherein ...

Micro-RNA family that Modulates Fibrosis and Uses Thereof

The present invention relates to the identification of a microRNA family, designated miR-29a-c, that is a key regulator of fibrosis in cardiac tissue. The inventors show that members of the miR-29 family are down-regulated in the heart tissue in response to stress, and are up-regulated in heart tissue of mice that are resistant to both stress and fibrosis. Also provided are methods of modulating expression and activity of the miR-29 family of miRNAs as a treatment for fibrotic disease, including cardiac hypertrophy, skeletal muscle fibrosis other fibrosis related diseases and collagen loss-related disease. 188-. (canceled)89. A method of regulating expression of one or more extracellular matrix genes in a subject in need thereof comprising administering to the fibroblast cells of the subject a polynucleotide comprising a pri-miRNA , pre-miRNA , or mature sequence of miR-29a , miR-29b , and/or miR-29c , wherein the expression of one or more extracellular matrix genes in the fibroblast cells of the subject is reduced following administration of the polynucleotide.90. The method of claim 89 , wherein one or more extracellular matrix genes is elastin (ELN) claim 89 , fibrillin 1 (FBN1) claim 89 , collagen type I α1 (COL1A1) claim 89 , collagen type I α2 (COL1A2) claim 89 , collagen type III α1 (COL3A1) claim 89 , collagen type IV α4 (COL4A4) claim 89 , collagen type V α3 (COL5A3) claim 89 , collagen type XI α1 (COL11A1) claim 89 , collagen type V α1 (COL5A1) claim 89 , or collagen type IV α5 (COL4A5).91. The method of claim 89 , wherein the subject has tissue fibrosis or is identified as being at risk of developing tissue fibrosis.92. The method of claim 89 , wherein the tissue fibrosis is cardiac fibrosis claim 89 , scleroderma claim 89 , skeletal muscle fibrosis claim 89 , hepatic fibrosis claim 89 , kidney fibrosis claim 89 , pulmonary fibrosis claim 89 , or diabetic fibrosis.93. The method of claim 89 , wherein the polynucleotide comprises a sequence of SEQ ID NO: ...

DETECTION AND TREATMENT OF AUTOIMMUNE DISORDERS

Disclosed herein are methods of treatment of autoimmune diseases such as systemic lupus erythematosus (SLE) as well as clinical assays for detection of autoimmune disease activity in patients utilizing a PD1 ligand. 139.-. (canceled)40. A method of treating or preventing an autoimmune disease or treating or preventing the symptoms of an autoimmune disease comprising the steps of: identifying a patient in need of such treatment; and administering to the patient at least one caspase inhibitor in an amount sufficient to induce or increase PD-L1 expression by the cells of the patient , thereby treating or preventing the autoimmune disease or treating or preventing the symptoms of the autoimmune disease.41. The method of claim 40 , wherein the at least one caspase inhibitor comprises a poly-caspase inhibitor.42. The method of claim 40 , wherein the at least one caspase inhibitor comprises at least one of Z-WFHD-fmk claim 40 , Z-VDVAD-fmk claim 40 , Z-DEVD-fmk claim 40 , Z-YVAD-fmk claim 40 , Z-VE1D-fmk claim 40 , Z-IETD-fmk Z-LEHD-fmk claim 40 , Z-AEVD-fmk claim 40 , Z-LEED-fmk claim 40 , Z-VAD-fmk and OPH.43. The method of claim 40 , wherein the-caspase inhibitor is OPH.44. The method of claim 40 , wherein the autoimmune disease is SLE.45. The method of claim 40 , wherein the autoimmune disease is rheumatoid arthritis.46. The method of claim 40 , wherein the administering of the caspase inhibitor to the patient comprises at least one of intravenous claim 40 , intraperitoneal claim 40 , inhalation claim 40 , intramuscular claim 40 , subcutaneous claim 40 , nasal and oral administration.47. The method of claim 40 , further comprising the administration of at least one selected from therapeutics targeting HLA molecules claim 40 , CD18 claim 40 , CD2 claim 40 , CD4 claim 40 , CD28 claim 40 , Fc-gamma 3 receptor claim 40 , Fc gamma receptor 2a claim 40 , CTLA4 claim 40 , or TGF-b in an amount sufficient to induce or increase PD-L1 expression by the cells of the patient. This ...

COMPOSITIONS AND METHODS FOR THE TREATMENT OF A NEOPLASIA

The invention provides methods for the treatments of neoplasia featuring agents that interfere with the expression or activity of a TNFa receptor. 1. A method of reducing neoplastic cell survival or proliferation , the method comprising contacting a neoplastic cell with an agent that selectively reduces the expression or activity of a p75 or p55 TNF-α receptor in the neoplastic cell relative to an untreated control cell , thereby reducing neoplastic cell survival or proliferation.2. The method of claim 1 , wherein the method selectively reduces the expression or activity of the p75 TNF-α receptor in the neoplastic cell while the expression or activity of the p55 TNF-α receptor is not disrupted.3. The method of claim 1 , wherein the method selectively reduces the expression or activity of the p55 TNF-α receptor in the neoplastic cell while the expression or activity of the p75 TNF-α receptor is not disrupted.4. (canceled)5. The method of claim 1 , wherein the agent is an inhibitory nucleic acid molecule selected from the group consisting of an antisense molecule claim 1 , an siRNA claim 1 , and an shRNA that is complementary to at least a portion of a p75 or p55 TNF-α receptor nucleic acid molecule.6. (canceled)7. The method of claim 5 , wherein the inhibitory nucleic acid molecule comprises or consists essentially of a nucleic acid molecule with a sequence selected from the group consisting SEQ ID NO: 1 claim 5 , SEQ ID NO: 2 claim 5 , SEQ ID NO: 3 claim 5 , and SEQ ID NO: 4.8. The method of claim 1 , wherein the agent is an antibody or fragment thereof that selectively binds to the p75 or p55 TNF-α receptor.9. (canceled)10. The method of claim 1 , wherein the method increases cell death or reduces blood vessel formation in a neoplasia.11. A method of inhibiting angiogenesis or increasing cell death in a neoplasia claim 1 , the method comprising contacting a neoplastic or endothelial cell with an agent that selectively reduces the expression or activity of a p55 or ...

Modulation of nitric oxide signaling to normalize tumor vasculature

The instant invention provides methods for treating a solid tumor in a subject comprising modulating nitric oxide production in the tumor to normalize tumor vasculature and administering an anti-tumor therapy to the subject. The invention further provides methods of treating a solid tumor in a subject comprising selectively increasing cyclic guanosine monophosphate (cGMP) or cGMP dependent protein kinase G production in the tumor vasculature to an amount effective to normalize tumor vasculature and administering an anti-tumor therapy to the subject.

Promoting Erythropoietin, Erythrocyte, and Hematopoietic Stem Cell Production By Activating HIF In OsteoBlasts

Methods are provided for promoting the production of erythropoietin and the production of erythrocytes and hematopoietic stem and progenitor cells. These methods find us in the treatment of subjects with conditions in which erythrocyte cell numbers are reduced, for example, anemia, chronic kidney disease, and following chemotherapy treatment. 1. A method of promoting the cellular production of erythropoietin (EPO) comprising the steps of:contacting an osteoblast with a hypoxia inducible factor (HIF) activating agent under conditions sufficient to promote the survival of said osteoblast,wherein EPO is produced.2. The method of claim 1 , wherein said HIF activating agent promotes the transcriptional activity of a hypoxia inducible factor (HIF).32. The method of claim 1 , wherein said transcriptional activity of a HIF is promoted by stabilizing said HIF.4. The method of claim 2 , wherein said HIF is selected from the group consisting of hypoxia inducible factor 1 alpha (HIF1A) claim 2 , hypoxia inducible factor 2 alpha (HIF2A/EPAS1) claim 2 , and hypoxia inducible factor 3 alpha (HIF3A).5. The method of claim 1 , wherein said contacting step occurs in vitro.6. The method of claim 1 , wherein said contacting step occurs in vivo.7. The method of claim 6 , wherein said HIF activating agent is administered directly to the bone marrow.8. A method of promoting the production of cells of the hematopoietic lineage from a population of hematopoietic progenitor cells claim 6 , comprising:contacting an osteoblast with a HIF activating agent,culturing a population of hematopoietic progenitor cells in the presence of said osteoblast under conditions sufficient to promote the survival of said hematopoietic progenitor cells,wherein cells of the hematopoietic lineage are produced.9. The method of claim 8 , wherein said cells of the hematopoietic lineage that are produced comprise erythrocytes.10. The method of claim 9 , wherein the number of erythrocytes that is produced is increased ...

Novel biomarkers and targets for ovarian carcinoma

Novel biomarkers and targets associated with ovarian cancer, particularly clear-cell carcinoma, endometrioid carcinoma, and uterine carcinoma, are disclosed. Mutations in genes encoding proteins that form part of the SWI/SNF chromatin remodelling protein complex, including ARID1A, or loss of expression of such proteins, including BAF250a, can be used to evaluate the likelihood endometriosis will progress or transform to cancer, to provide a prognosis for a patient with cancer, to assess whether conventional treatment is likely to be effective against a cancer, and/or in a synthetic lethal screen to identify novel targets and therapeutics for the treatment of cancer.

Methods for modulating skeletal remodeling and patterning by modulating shn2 activity, shn3 activity, or shn2 and shn3 activity in combination

This invention is based, at least in part, on the discovery that Shn2 and Shn3 play an important role in skeletal remodeling and skeletal patterning. Accordingly, the present invention provides methods for identifying medulators of Shn2 activity and methods for modulating bone formation and mineralization and Shn2-associated disorders using agents that modulate Shn2 expression and/or activity, in addition to methods for modulating Shn2 and Shn3.

Targeted Particles Comprising Landscape Phage Fusion Proteins and Heterologous Nucleic Acid

Disclosed are targeted particles comprising or consisting of a plurality of landscape phage fusion proteins complexed with heterologous nucleic acid, the landscape phage fusion proteins displaying a heterologous peptide and the targeted particle binding specifically to a target site. The particles may be utilized in methods for modulating expression of genes in target cells. 1. A targeted particle comprising a plurality of landscape phage fusion proteins complexed with heterologous nucleic acid , the landscape phage fusion proteins displaying a heterologous peptide and the targeted particle binding specifically to a target site.2. The targeted particle of claim 1 , wherein the landscape phage fusion proteins comprise a filamentous phage protein and the heterologous nucleic acid is 10-50 nucleotides in length.3. The targeted particle of claim 2 , wherein the heterologous nucleic acid is siRNA.4. The targeted particle of claim 2 , wherein the filamentous phage protein is a pVIII major coat protein.5. The targeted particle of claim 1 , wherein the heterologous peptide comprises no more than 9 amino acids.6. The targeted particle of claim 1 , wherein the targeted nanoparticle binds specifically to cancer cells.7. The targeted particle of claim 6 , wherein the cancer cells are breast cancer cells.8. The targeted particle of claim 1 , wherein the heterologous nucleic acid is siRNA that inhibits expression of a gene selected from a group consisting of ABI1 claim 1 , ABL2 claim 1 , ACSL6 claim 1 , AF1Q claim 1 , AF5Q31 claim 1 , AKT1 claim 1 , AKT2 claim 1 , ARNT claim 1 , ASPSCR1 claim 1 , ATF1 claim 1 , ATIC claim 1 , BCL10 claim 1 , BCRP claim 1 , BFHD claim 1 , BIRC3 claim 1 , BMPR1A claim 1 , BTG1 claim 1 , CBFA2T1 claim 1 , CBFA2T3 claim 1 , CBFB claim 1 , CCND1 claim 1 , CDC2 claim 1 , CDK4 claim 1 , CHIC2 claim 1 , CHN1 claim 1 , COPEB claim 1 , COX6C claim 1 , CTNNB1 claim 1 , CYLD claim 1 , DDB2 claim 1 , DDIT3 claim 1 , DEK claim 1 , Eif4a claim 1 , EIF4A2 claim ...

PREPARATION OF MICROVESICLE-siRNA COMPLEXES AND USE THEREOF IN AIDS TREATMENT

The present invention provides drugs for treating AIDS, which comprises microvesicles carrying anti-HIV specific siRNA. The present invention also provides a preparation method of the drug.

METHODS AND COMPOSITIONS FOR INHIBITION OF AXONAL DEGENERATION BY MODULATION OF THE DLK/JNK PATHWAY

Methods of reducing Wallerian degeneration are disclosed. These methods comprise inhibiting expression or activity of a mixed lineage kinase such as a dual leucine-zipper-bearing kinase (DLK), inhibiting expression or activity of a molecule acting downstream from DLK, such as a c-Jun N-terminal kinase (JNK), or a combination thereof. Further disclosed are methods of screening candidate compounds for DLK inhibition activity. These methods comprise providing a neuronal culture comprising a plurality of axons; contacting the culture with a candidate compound and with an axon degeneration-triggering agent; and comparing axonal degeneration in the culture to a control culture comprising the axon degeneration-triggering agent but not the candidate compound. 1. A method of mitigating a neuropathy in a mammal , the method comprising administering to a mammal in need thereof , an inhibitor of dual leucine-zipper-bearing kinase activity in an amount effective to inhibit axonal degeneration in diseased and/or injured neurons.2. A method in accordance with claim 1 , wherein the neuropathy is an axonopathy.3. A method in accordance with claim 2 , wherein the axonopathy comprises Wallerian degeneration.4. A method in accordance with claim 1 , wherein the neuropathy is hereditary or congenital or associated with a neurodegenerative disease claim 1 , a motor neuron disease claim 1 , a neoplasia claim 1 , an endocrine disorder claim 1 , a metabolic disease claim 1 , a nutritional deficiency claim 1 , atherosclerosis claim 1 , an autoimmune disease claim 1 , a mechanical injury claim 1 , a chemical injury claim 1 , a drug-induced injury claim 1 , a thermal injury claim 1 , a radiation injury claim 1 , a nerve compression claim 1 , a retinal nerve disorder claim 1 , an optic nerve disorder claim 1 , a mitochondrial dysfunction claim 1 , a progressive dementia demyelinating disease claim 1 , ischemia claim 1 , stroke claim 1 , an infectious disease or an inflammatory disease.5. A ...

METHODS AND COMPOSITIONS FOR THE TREATMENT OF INSULIN-ASSOCIATED MEDICAL CONDITIONS

A method of increasing insulin content in a pancreatic beta cell is disclosed. The method comprising expressing in the pancreatic beta cell an exogenous polynucleotide encoding at least one microRNA or a precursor thereof, wherein the microRNA is selected from the group consisting of miR-15, miR-16, miR-24, miR-26, miR-27, miR-29, miR-30, miR-129, miR-141, miR-148, miR-182, miR-200, miR-376 and Let-7, thereby increasing the insulin content in the pancreatic beta cell. 1. A method of increasing an insulin content in a pancreatic beta cell , the method comprising expressing in the pancreatic beta cell an exogenous polynucleotide encoding at least one microRNA or a precursor thereof , wherein said microRNA is selected from the group consisting of miR-15 , miR-16 , miR-24 , miR-26 , miR-27 , miR-29 , miR-30 , miR-129 , miR-141 , miR-148 , miR-182 , miR-200 , miR-376 and Let-7 , thereby increasing the insulin content in the pancreatic beta cell.2. A method of treating a condition associated with an insulin deficiency in a subject in need thereof , the method comprising administering to the subject an exogenous polynucleotide encoding at least one microRNA or a precursor thereof , wherein said microRNA is selected from the group consisting of miR-15 , miR-16 , miR-24 , miR-26 , miR-27 , miR-29 , miR-30 , miR-129 , miR-141 , miR-148 , miR-182 , miR-200 , miR-376 and Let-7 , thereby treating the condition associated with an insulin deficiency.3. (canceled)4. The method of claim 2 , wherein said polynucleotide is operably linked to a cis acting regulatory element active in pancreatic beta cell.5. The method of claim 2 , wherein said condition associated with an insulin deficiency comprises diabetes mellitus.6. A nucleic acid construct comprising a nucleic acid sequence encoding a microRNA or a precursor thereof said nucleic acid sequence being operably linked to a pancreatic beta cell specific promoter.7. The nucleic acid construct of claim 6 , wherein said microRNA is ...

GENE DEFECTS AND MUTANT ALK KINASE IN HUMAN SOLID TUMORS

Novel gene deletions and translocations involving chromosome 2 resulting in fusion proteins combining part of Anaplastic Lymphoma Kinase (ALK) kinase with part of a secondary protein have been identified herein in human solid tumors, e.g. non-small cell lung carcinoma (NSCLC). Secondary proteins include Echinoderm Microtubule-Associated Protein-Like 4 (EML-4) and TRK-Fusion Gene (TFG). The EML4-ALK fusion protein, which retains ALK tyrosine kinase activity, was confirmed to drive the proliferation and survival of NSCLC characterized by this mutation. The invention therefore provides, in part, isolated polynucleotides and vectors encoding the disclosed mutant ALK kinase polypeptides, probes for detecting it, isolated mutant polypeptides, recombinant polypeptides, and reagents for detecting the fusion and truncated polypeptides. The disclosed identification of this new fusion protein enables methods for screening for compounds that inhibit the proteins, and methods for inhibiting the progression of a cancer characterized by the mutant polynucleotides or polypeptides. 1. A method of characterizing a mammalian lung cancer , comprising(a) obtaining a biological sample from said mammalian lung cancer; and(b) detecting the presence of an Anaplastic Lymphoma Kinase (ALK) fusion polynucleotide or polypeptide in said sample, thereby characterizing said lung cancer based on the presence or absence of the ALK fusion polynucleotide or polypeptide.2. The method of claim 1 , wherein said lung cancer is non-small cell lung cancer (NSCLC).3. The method according to claim 1 , wherein the presence of an ALK fusion polypeptide is being detected.4. The method of claim 3 , wherein said ALK fusion polypeptide is detected by using an antibody.5. The method of claim 3 , wherein the polypeptide is detected in a flow-cytometry (FC) claim 3 , immuno-histochemistry (IHC) claim 3 , or immunofluorescence (IF) assay format.6. The method according to claim 1 , wherein the presence of an ALK fusion ...

GENE THERAPY FOR DIABETES WITH CHITOSAN-DELIVERED PLASMID ENCODING GLUCAGON-LIKE PEPTIDE 1

Chitosan delivers a plasmid encoding Glucagon-Like Peptide 1 (GLP-1) to cells in a patient for gene therapy of diabetes. Chitosan is optimized for plasmid transfection by modulating three of its physico-chemical properties: degree of deacetylation (DDA), molecular weight (MW), and ratio of amines on chitosan to phosphates on DNA (N:P ratio), Chitosan 92-10-5 (DDA-MW-N:P) is more efficient than chitosans 80-10-10 and 80-80-5 in delivering a plasmid encoding luciferase or GLP-1(7-37) to cells. In the Zucker Diabetic Fatty (ZDF) rat model of diabetes, chitosan-delivered pVax plasmid encoding GLP-1 lowers glucose levels, increases insulin production and reduces weight gain. 1. A composition comprising chitosan and a plasmid DNA sequence encoding for Glucagon like peptide-1 (GLP-1) , a GLP-1 variant or a GLP-1 derivative.2. The composition of claim 1 , wherein the GLP-1 variant is GLP-1(7-34) claim 1 , GLP-1(7-35) claim 1 , GLP-1(7-36) claim 1 , Val-GLP-1(7-37) claim 1 , Gln-GLP-1(7-37) claim 1 , D-Gln-GLP-1(7-37) claim 1 , Thr-Lys-GLP-1(7-37) claim 1 , Lys-GLP-1(7-37) claim 1 , His-GLP-1 (7-37) claim 1 , Ser-GLP-1(7-37) or Tyr-GLP-1(7-37).3. The composition of claim 2 , wherein the GLP-1 variant is SEQ ID NO:3 or SEQ ID NO:4.4. The composition of claim 1 , wherein the chitosan is heterogeneously deacetylated.5. (canceled)6. The composition of claim 1 , wherein the plasmid DNA comprises an expression facilitating sequence derived from a CMV promoter (CMV Pro); a sequence coding for a furin cleavage site (FCS); and a sequence coding for GLP-1 claim 1 , GLP-1 variant or GLP-1 derivative thereof that is operably linked to said expression facilitating sequence.7. The composition of claim 1 , wherein the plasmid DNA is pVax1 plasmid.8. The composition of claim 1 , wherein the chitosan has a molecular weight of 5 kDa to 150 kDa and a deacetylation degree (DDA) of 75% to 95%.9. The composition of claim 8 , wherein the molecular weight of the chitosan is 5 to 15 kDa and the DDA ...

COMPOSITION AND METHOD FOR INNER EAR SENSORY HAIR CELL REGENERATION AND REPLACEMENT

A composition and method for replacement and regeneration of hair cells of the inner ear is provided. The composition comprises an active agent in an amount effective to decrease Hes1 gene expression in a tissue of the inner ear. The active agent can be short interfering RNA (siRNA) molecules encapsulated in a biodegradable nanoparticle. The method involves administering a solution to the inner ear where the solution contains an active agent in an amount effective to decrease Hes1 gene expression. 145-. (canceled)46. A composition for regenerating hair cells of the inner ear comprising:a nanoparticle formed of a biodegradable polymer, the nanoparticle comprising a siRNA molecule sufficient to decrease the expression of Hes 1, wherein the siRNA molecule is in an amount effective to regenerate hair cells of the inner ear.47. The composition of claim 46 , wherein the siRNA molecule comprises SEQ ID NO: 3 and SEQ ID NO. 4.48. The composition of claim 47 , wherein the nanoparticle further comprises a second siRNA molecule sufficient to decrease the expression of Hes 1 claim 47 , the second siRNA molecule comprises SEQ ID NO: 5 and SEQ ID NO. 6.49. The composition of claim 48 , wherein the nanoparticle further comprises a third siRNA molecule sufficient to decrease the expression of Hes 1 claim 48 , the third siRNA molecule comprises SEQ ID NO: 7 and SEQ ID NO. 8.50. The composition of claim 47 , wherein the nanoparticle further comprises a second siRNA molecule sufficient to decrease the expression of Hes 1 claim 47 , the second siRNA molecule comprises SEQ ID NO: 7 and SEQ ID NO. 8.51. The composition of claim 46 , wherein the siRNA molecule comprises SEQ ID NO: 5 and SEQ ID NO. 6.52. The composition of claim 51 , wherein the nanoparticle further comprises a second siRNA molecule sufficient to decrease the expression of Hes 1 claim 51 , the second siRNA molecule comprises SEQ ID NO: 7 and SEQ ID NO. 8.53. The composition of claim 46 , wherein the siRNA molecule ...

CANCER THERAPY

The present invention provides agents useful in the treatment of cancer, as well as systems for identifying and/or characterizing such agents, and systems for identifying and/or characterizing patient populations responsive to particular agents. 1. A method of treating cancer by administering to a patient in need thereof an agent that inhibits palmitoylation of NRAS.2. The method of claim 1 , wherein the cancer is associated with an oncogene that acts upstream of RAS.3. The method of or claim 1 , wherein the cancer is not associated with a mutation of NRAS.43. The method of any one of - wherein the agent comprises an siRNA.5. The method of wherein the siRNA targets a RAS palmitoyl-acyl transferase.6. The method of wherein the siRNA targets a fatty acid synthase involved in palmitate production7. A method of identifying agents useful in the treatment of cancer claim 4 , the method comprising steps of:providing one or more agents that inhibit RAS palmitoylation; andassessing ability of the agents to inhibit proliferation of cancer cells.8. The method of claim 7 , wherein the cancer cells do not contain NRAS mutations.9. A method of treating cancers associated with activated RAS that requires palmitoylation claim 7 , the method comprising steps of:administering a FASN inhibitor to a subject suffering from a cancer that is associated with activated RAS requiring palmitoylation.10. A method for treating cancer comprising:administering a FASN inhibitor and a RAS palmitoylation inhibitor in combination.11. A method comprising steps of:identifying in a cancer patient suffering from or susceptible to a cancer associated with an activated RAS that requires palmitoylation;determining, based on the identification, that the patient is a good candidate for therapy with a FASN inhibitor and/or a RAS palmitoylation inhibitor. This application claims priority to U.S. Provisional Application No. 61/357,845, entitled Cancer Therapy, filed Jun. 23, 2010, the entire contents of which ...

Method of Treatment

A method of treating autoimmune and inflammatory diseases or conditions in a mammal, such as a human, which comprises the administration of a inhibitor of the bromodomain-containing protein: SP110 1. A method of treating autoimmune and inflammatory diseases and conditions which comprises inhibiting the bromodomain-containing protein SP110 in a mammal.2. A method of treating autoimmune and inflammatory diseases or conditions in a mammal , such as a human , which comprises the administration of a therapeutically effective amount of an inhibitor of the bromodomain-containing protein SP110.3. (canceled)4. (canceled)5. A pharmaceutical formulation for use in the treatment of autoimmune and inflammatory diseases or conditions , comprising an inhibitor of the bromodomain-containing protein SP110 , together with at least one pharmaceutical carrier.6. A method for identifying compounds that will be useful in treating autoimmune and inflammatory diseases or conditions comprising the step of determining whether the compound inhibits or the step of determining whether the compound activates the bromodomain-containing protein SP110. The present invention is concerned with new methods of treatment. More particularly, the present invention relates to methods for treatment or prevention of autoimmune and inflammatory diseases and conditions by inhibiting or modifying the expression or function of bromodomain-containing proteins. In a further aspect the invention relates to a method for identifying agents useful in said methods of treatment. The invention particularly describes the role of certain bromodomain—containing proteins, particularly SP110 in these diseases and conditions and their use as therapeutic and screening targets.Chromatin is the complex combination of DNA and protein that makes up chromosomes. It is found inside the nuclei of eukaryotic cells and is divided between heterochromatin (condensed) and euchromatin (extended) forms. A range of different states of ...

Cell Growth Inhibitor and Screening Method Thereof

An object is to provide a cell growth inhibitor also effective for androgen-independent prostate cancer. The present invention provides a cell growth inhibitor having, as an active ingredient, an expression inhibitor or function inhibitor of PSF.

Polynucleotides for reducing respiratory syncytial virus gene expression

This invention pertains to polynucleotides, such as small interfering RNA (siRNA), useful for reducing the expression of respiratory syncytial virus (RSV) genes within a subject; and methods for treating a patient suffering from, or at risk of developing, an RSV infection by administering such polynucleotides to the subject.

Methods for the Treatment and Prevention of Metabolic Disorders

Described herein are methods for detecting, characterizing, preventing, and treating metabolic diseases, including obesity and obesity-associated disorders such as diabetes. 1. A method for preventing or treating obesity or an obesity-associated disorder in a subject comprising administering to the subject an agent that inhibits TDP-43 expression and/or activity to thereby treat obesity or an obesity-associated disorder.2. The method of claim 1 , wherein the agent is selected from the group consisting of an inhibitory nucleic acid molecule claim 1 , an anti-TDP-43 antibody claim 1 , a non-activating form of TDP-43 polypeptide or fragment thereof claim 1 , a small molecule inhibitor of TDP-43 claim 1 , a ribozyme and zinc finger DNA binding protein.3. The method of claim 1 , wherein the obesity-associated disorder is selected from the group consisting of: diabetes; cardiovascular disease; high blood pressure; deep vein thrombosis; osteoarthritis; obstructive sleep apnea; cancer and non-alcoholic fatty liver disease.418-. (canceled)19. A method for assessing the efficacy of an agent for increasing fat metabolism in a subject comprising:a) detecting in a first subject sample obtained from the subject at a first point in time the expression and/or activity of TDP-43;b) detecting in a second subject sample obtained at a second point in time the expression and/or activity of TDP-43, wherein the second point in time is subsequent to administration of an agent; andc) comparing the expression and/or activity detected in steps a) and b), wherein a higher expression and/or activity of TDP-43 in the first subject sample than the second subject sample indicates that the agent is effective for increasing fat metabolism in the subject.20. The method of claim 19 , wherein between the first point in time and the subsequent point in time claim 19 , the subject has undergone treatment for a metabolic disorder claim 19 , has completed treatment for a metabolic disorder claim 19 , and/ ...

Combinations of TGFBeta and COX-2 Inhibitors and Methods for Their Therapeutic Application

The present invention provides compositions and methods for using combinations of TGFβ1 and Cox-2 inhibitors and TGFβ1 and Hoxb13 inhibitors for the treatment of various medical conditions, including skin scaring due to trauma wounds and surgery, corneal and retina scaring due to injury and surgery, internal organ scaring due to injury and surgery, heart tissue scaring due to heart attack and surgery, and lung, liver, and kidney fibrosis due to inflammation and injury. One example is to use siRNA inhibitors to silence TGFβ1 and Cox-2 at the same time, resulting in significant less scar formation. 1. A composition comprising an siRNA molecule that binds to an mRNA that codes for TGFβ1 protein in a mammalian cell and an siRNA molecule that binds to an mRNA that codes for Cox-2 protein in a mammalian cell.2. The composition of wherein the siRNA molecules produce a synergistic effect in the cell.3. The composition of further comprising an siRNA molecule that binds to an mRNA that codes for Hoxb13 protein in a mammalian cell.4. The composition of wherein the siRNA molecules produce a synergistic effect in the cell.5. A composition comprising an siRNA molecule that binds to an mRNA that codes for TGFβ1 protein in a mammalian cell and an siRNA molecule that binds to an mRNA that codes for Hoxb13 protein in a mammalian cell.6. The composition of wherein the siRNA molecules produce a synergistic effect in the cell.7. The composition of wherein the siRNA molecules are selected from the siRNA molecules identified in Table 1 (SEQ ID NOS 30-81).8. The composition of wherein an siRNA molecule targets TGFβ1 mRNA with a sequence of hmTF-25-2: sense claim 1 , 5′-r(CCCAAGGGCUACCAUGCCAACUUCU)-3′ (SEQ ID NO: 36) claim 1 , antisense claim 1 , 5′-r(AGAAGUUGGCAUGGUAGCCCUUGGG)-3′ (SEQ ID NO: 37) claim 1 , and an siRNA molecule targets Cox-2 mRNA with a sequence of hmCX-25-1: sense claim 1 , 5′r(GGUCUGGUGCCUGGUCUGAUGAUGU)-3′ (SEQ ID NO: 50) claim 1 , antisense claim 1 , 5′-r( ...

SiRNA TARGETING ETS1 AND ELK1 AND METHOD OF USING SAME IN THE INHIBITION OF CIP2A GENE IN CANCER TREATMENT

Disclosed are methods of attenuating activity of the gene promoter of CIP2A. siRNAs are used to target against Ets1 and Elk1 transcriptional factors, thereby blocking the binding of Ets1 and Elk1 to the CIP2A gene promoter. It is disclosed that the siRNAs targeted against Ets1 and Elk1 attenuate the gene expression of CIP2A. A kit containing siRNA reagents for attenuating the CIP2A gene expression is also disclosed. 1. A method of inhibiting gene expression of CIP2A in a cell , comprising the steps of:(i) providing a first siRNA targeted against Ets1 mRNA, said first siRNA hybridizes to a target sequence of Ets1 mRNA selected from the group consisting of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 and SEQ ID NO: 37;(ii) providing a second siRNA targeted against Elk1 mRNA, said second siRNA hybridizes to a target sequence of Elk1 mRNA selected from the group consisting of SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 and SEQ ID NO: 41; and(iii) exposing said first siRNA and said second siRNA to a cell, wherein said first siRNA and said second siRNA together inhibit the gene expression of CIP2A in said cell.2. The method of claim 1 , wherein said first siRNA is at least one siRNA selected from the group consisting of SEQ ID NO: 30 and SEQ ID NO: 31.3. The method of claim 1 , wherein said second siRNA is at least one siRNA selected from the group consisting of SEQ ID NO: 32 and SEQ ID NO: 33.4. A pharmaceutical composition claim 1 , comprising a first siRNA targeted against Ets1 mRNA; a second siRNA targeted against Elk1 mRNA; and a pharmaceutical acceptable carrier claim 1 , said pharmaceutical composition inhibits gene expression of CIP2A.5. The pharmaceutical composition of claim 4 , wherein said first siRNA contains at least one siRNA selected from the group consist of SEQ ID NO: 30 and SEQ ID NO: 31.6. The pharmaceutical composition of claim 4 , wherein said second siRNA contains at least one siRNA selected from the group consisting of SEQ ID NO: 32 and SEQ ID NO: ...

COMPOSITIONS AND METHODS TO INDUCE TARGETED APOPTOSIS

Embodiments herein concern compositions and methods for treating a subject having or suspected of developing a pulmonary disorder or cancer. Certain embodiments concern modulating protein tyrosine phosphatase non-receptor type 13 (PTP-N13) expression and/or activity in a subject to treat uncontrolled cellular growth in the subject. 1. A method for treating uncontrolled cellular growth in a subject in need thereof , comprising , administering a pharmaceutically effective composition comprising an agent for modulating protein tyrosine phosphatase 13 (PTPN13) expression or activity in the subject and reducing cell growth in the subject compared to a subject not receiving the composition.2. The method of claim 1 , wherein the agent comprises one or more cytokine(s).3. The method of claim 2 , wherein the cytokines comprise one or more of tumor necrosis factor alpha (TNF-α) claim 2 , interferon gamma (IFN-γ) claim 2 , interleukin-1 beta (IL1-β) claim 2 , interleukin-18 (IL-18) claim 2 , interleukin-12 (IL-12) and other cytokines.4. The method of claim 2 , wherein the cytokines comprise TNF-α claim 2 , IFN-γ or a combination thereof.5. The method of claim 1 , wherein the subject has a pulmonary condition.6. The method of claim 1 , wherein the subject has cancer.7. The method of claim 1 , wherein the uncontrolled cellular growth comprises uncontrolled growth of one or more of fibroblasts and myofibroblasts cells.8. A method for treating a pulmonary disorder in a subject comprising:administering a therapeutically effective amount of an agent capable of associating with PTPN13 to a subject and modulating PTPN13 expression or activity in the subject wherein modulating PTPN13 expression or activity treats the pulmonary disorder in the subject.9. The method of claim 8 , wherein modulation of PTPN13 expression comprises modulating one or more of mRNA and protein expression.10. The method of claim 8 , wherein modulation of PTPN13 comprises modulating PTPN13 activity.11. The method ...

GENETIC INHIBITION BY DOUBLE-STRANDED RNA

A process is provided of introducing an RNA into a living cell to inhibit gene expression of a target gene in that cell. The process may be practiced ex vivo or in vivo. The RNA has a region with double-stranded structure. Inhibition is sequence-specific in that the nucleotide sequences of the duplex region of the RNA and of a portion of the target gene are identical. The present invention is distinguished from prior art interference in gene expression by antisense or triple-strand methods. 1. A method to inhibit expression of a target gene in a cell comprising introduction of a ribonucleic acid (RNA) into the cell in an amount sufficient to inhibit expression of the target gene , wherein the RNA comprises a double-stranded structure with an identical nucleotide sequence as compared to a portion of the target gene.2. The method of in which the target gene is a cellular gene.3. The method of in which the target gene is an endogenous gene.4. The method of in which the target gene is a transgene.5. The method of in which the target gene is a viral gene.6. The method of in which the cell is from an animal.7. The method of in which the cell is from a plant.8. The method of in which the cell is from an invertebrate animal.9. The method of in which the cell is from a nematode.10. The method of in which the identical nucleotide sequence is at least 50 bases in length.11. The method of in which the target gene expression is inhibited by at least 10%.12. The method of in which the cell is present in an organism and inhibition of target gene expression demonstrates a loss-of function phenotype.13. The method of in which the RNA comprises one strand which is self-complementary.14. The method of in which the RNA comprises two separate complementary strands.15. The method of further comprising synthesis of the two complementary strands and initiation of RNA duplex formation outside the cell.16. The method of further comprising synthesis of the two complementary strands and ...

Methods for Promoting Reinnervation of Auditory Hair Cells

This invention relates to methods for promoting reinnervation of auditory hair cells, specifically, by inhibiting Repulsive Guidance Molecule a (RGMa), a repulsive axonal guidance molecule that is expressed in the cochlea, or its receptor, neogenin. 1. A method of promoting or enhancing innervation of auditory hair cells , the method comprising administering to the neurons an effective amount of one or both of an inhibitor of Repulsive Guidance Molecule a (RGMa) or an inhibitor of neogenin.2. A method of promoting or enhancing innervation of auditory hair cells in the inner ear of a subject in need thereof , the method comprising administering to the inner ear of the subject an effective amount of one or both of an inhibitor of RGMa or an inhibitor of neogenin.3. A method of treating a subject who has or is likely to have hearing loss or a balance disorder as a result of loss of or decrease in innervation of auditory hair cells , the method comprising administering to the inner ear of the subject an effective amount of one or both of an inhibitor of RGMa or an inhibitor of neogenin.4. A method of treating a subject who has or is likely to have hearing loss as a result of loss of or decrease in auditory neurons , or a balance disorder as a result of loss of or decrease in vestibular neurons , the method comprising administering to the inner ear of the subject:one or more neural progenitor cells; andan effective amount of one or both of an inhibitor of RGMa or an inhibitor of neogenin.5. The method of claim 1 , wherein the inhibitor is an inhibitory antibody or antigen-binding portion thereof that binds specifically to RGMa claim 1 , an inhibitory nucleic acid that specifically reduces expression of RGMa claim 1 , an inhibitory antibody or antigen-binding portion thereof that binds specifically to neogenin claim 1 , or an inhibitory nucleic acid that specifically reduces expression of neogenin.6. The method of claim 5 , wherein the inhibitory nucleic acid is antisense ...

USE OF LEUKOTRIENE B4 IN COMBINATION WITH A TOLL-LIKE RECEPTOR LIGAND, A RIG-I-LIKE RECEPTOR LIGAND, OR A NOD-LIKE RECEPTOR LIGAND TO ENHANCE THE INNATE IMMUNE RESPONSE

The present invention relates to the use of leukotriene Bto enhance the response of Toll-like receptor (TLR), RIG-I-like receptor (RLR), and NOD-like receptor (NLR) when stimulated simultaneously with respective proper ligands. The use in combination of LTBwith those ligands is useful to potentiate immune response for the treatment of autoimmune diseases, immunosuppressive diseases, as well as immunological disorders. 174-. (canceled)75. A pharmaceutical composition comprising leukotriene B(LTB) and at least one modulator of a receptor selected from the group consisting of a Toll-like receptor (TLR) , a RIG-I-like receptor (RLR) , and a NOD-like receptor (NLR) , for potentiating an immune response , for stimulating neutrophils , for stimulating secretion of a pro-inflammatory cytokine , for stimulating intracellular kinase activation , for stimulating release of Tumor necrosis factor α (TNF-α) or for treating a viral infection.7690-. (canceled)91. The pharmaceutical composition of claim 75 , wherein said kinase is TAK-1 claim 75 , p38 claim 75 , a c-Jun N-terminal kinase (JNK kinase) or a combination thereof.9299-. (canceled)100. The pharmaceutical composition of claim 75 , wherein said viral infection is from cytomegalovirus.101. The pharmaceutical composition according to claim 75 , wherein said Toll-like receptor is selected from the group consisting of TLR1 to TLR10.102. The pharmaceutical composition according to claim 75 , Toll-like receptor is a TLR1/2 complex.103. The pharmaceutical composition according to claim 75 , wherein said Toll-like receptor is a TLR2/6 complex.104. The pharmaceutical composition according to claim 75 , wherein said Toll-like receptor is a TLR1 claim 75 , TLR2 claim 75 , TLR4 claim 75 , TLR5 or TLR6.105. The pharmaceutical composition according to claim 75 , wherein said Toll-like receptor is a TLR3.106. The pharmaceutical composition according to claim 75 , wherein the modulator of said Toll-like receptor is a TLR2 ligand claim 75 , ...

PHARMACEUTICAL COMPOSITION INCLUDING AN HIF-2 ALPHA INHIBITOR AS AN ACTIVE INGREDIENT FOR PREVENTING OR TREATING ARTHRITIS

The present invention relates to a pharmaceutical composition for preventing or treating arthritis, including, as an active ingredient, a material which inhibits the expression of the hypoxia-inducible factor-2α (HIF-2α) gene or the activity of the HIF-2α protein. According to the present invention, the HIF-2α of the present invention increases the expression thereof in chondrocytes or tissue in which osteoarthritis is induced, and triggers the expression of various cartilage degeneration factors and the activation of mitogen-activated protein (MAP) kinase. In addition, when HIF-2α is inhibited, the expression level of cartilage degeneration factors and the phosphorylation of MAP kinase are significantly reduced by the inhibited degree of HIF-2α. Thus, the composition of the present invention may be applied to the prevention or treatment of arthritis, and may be used for the development of therapeutics for arthritis. 117-. (canceled)18. A method for preventing or treating arthritis , comprising administering to a subject in need thereof a substance inhibiting the expression of the hypoxia-inducible factor-2α (HIF-2α) gene or the activity of the HIF-2α protein.19. The method according to claim 18 , wherein the HIF-2α protein increases the expression of cartilage degeneration-inducing factor in an mRNA level or protein level.20. The method according to claim 18 , wherein the active ingredient is siRNA claim 18 , shRNA claim 18 , miRNA claim 18 , ribozyme claim 18 , DNAzyme claim 18 , PNA (peptide nucleic acids) claim 18 , antisense oligonucleotides claim 18 , peptides claim 18 , antibodies claim 18 , aptamers claim 18 , natural extracts or chemicals.21. The method according to claim 18 , wherein the arthritis is osteoarthritis claim 18 , degenerative joint disease claim 18 , osteochondritis dissecans claim 18 , ligament injuries claim 18 , meniscus injuries claim 18 , malalignment of joint claim 18 , osteonecrosis claim 18 , rheumatoid arthritis claim 18 , juvenile ...

NANOTOPOGRAPHY-MEDIATED REVERSE UPTAKE PLATFORM FOR NUCLEIC ACID DELIVERY AND APPLICATIONS THEREOF

This application discloses a nanotopography-mediated reverse uptake (NanoRU) platform useful for intracellular delivery of nucleic acids into mammalian cells, in particular stem cells, as well as methods of preparation and applications thereof. In particular, this system can be used to deliver small interfering ribonucleic acids (siRNAs) into neural stem cells and enhance neuronal differentiation of the stem cells. 1. A nucleic acid delivery system comprising a self-assembled silicon oxide (silica) nanoparticle (SiNP) monolayer coated with a film comprising one or more of extracellular matrix (ECM) proteins , the film having topographical features capable of facilitating delivery of a nucleic acid into cells.2. The nucleic acid delivery system of claim 1 , wherein said silica nanoparticles (SiNPs) are assembled on a thin film of gold coated with a self-assembled monolayer (SAM) of a bifunctional organic compound.3. The nucleic acid delivery system of claim 2 , wherein said bifunctional organic compound comprises a thiol (—SH) end group and a carboxylic acid (—COOH) end group.4. The nucleic acid delivery system of claim 1 , wherein said one or more ECM proteins are independently selected from the group consisting of laminin claim 1 , fibronectin claim 1 , collagen claim 1 , and combinations thereof.5. The nucleic acid delivery system of claim 1 , wherein said ECM protein is laminin.6. The nucleic acid delivery system of claim 1 , wherein the sizes of silica nanoparticles are in the range of 50 nm to 700 nm.7. The nucleic acid delivery system of claim 1 , wherein the sizes of silica nanoparticles are in the range of 100 nm to 300 nm.8. The nucleic acid delivery system of claim 1 , wherein said nucleic acid is a small interfering ribonucleic acid (siRNA).9. The nucleic acid delivery system of claim 1 , wherein said cells are mammalian cells.10. The nucleic acid delivery system of claim 1 , wherein said cells are astrocytes or cancer cells.11. The nucleic acid delivery ...

CANCER THERAPY USING Bcl-XL-SPECIFIC siNA

The invention relates to a double-stranded short interfering nucleic acid (siNA) molecule specific to the Bcl-Xtranscript, comprising a sense and an antisense region, wherein the sense region comprises the nucleotide sequence SEQ ID NO: 1 or a sequence having at least 70% identity, preferably at least 80% identity, more preferably at least 90% identity with said sequence, and the antisense region comprises a nucleotide sequence that is complementary to the sense region, and its use for treating cancer. 1. A method of treating cancer in a patient in need thereof , comprising administering to said patient a pharmaceutically effective dose of a pharmaceutical composition , wherein the pharmaceutical composition comprises an acceptable carrier and at least:a double-stranded short interfering nucleic acid molecule specific to the Bcl-XL transcript (Bcl-XL siNA) comprising a sense and an antisense region, wherein the sense region comprises the nucleotide sequence SEQ ID NO: 1 or a sequence having at least 70% identity with said sequence, and the antisense region comprises a nucleotide sequence that is complementary to the sense region, and wherein each strand comprises 15 to about 30 nucleotides, and each strand comprises 15 to about 30 nucleotides that are complementary to the nucleotides of the other strand; anda short interfering nucleic acid molecule targeting the Mcl-1 transcript (Mcl-1 siNA).2. The method according to claim 1 , wherein said cancer is selected from the group consisting of: ovarian claim 1 , nasopharyngeal claim 1 , breast claim 1 , prostate and colon carcinoma claim 1 , glioma claim 1 , mesothelioma claim 1 , and melanoma.3. The method according to claim 1 , wherein said cancer is ovarian cancer.4. The method according to claim 1 , wherein said Bcl-XL siNA and/or said Mcl-1 siNA comprises a 19- to 21-nucleotide duplex.5. The method according to claim 1 , wherein said Bcl-XL siNA and/or said Mcl-1 siNA comprises ribonucleotides.6. The method according ...

DELIVERY OF dsRNA TO ARTHROPODS

The invention is to methods of gene silencing in arthropods using dsRNA. The method is include contacting the arthropod with, and/or directly feeding the arthropod, the dsRNA to the arthropods to deliver the dsRNA to arthropod tissues. It is envisaged that the methods of the invention will have use in determining the biological function of genes in arthropods. Methods of pest control of arthropods, and of protecting arthropods against parasites and predators are provided. Transgenic arthropods expressing dsRNA molecules are also provided by the present invention. 138-. (canceled)39. A method of reducing the level of a target RNA in a lepidopteran or dipteran insect comprising feeding to the insect in a larval stage a composition comprising a dsRNA molecule and a lipid containing compound as a transfection promoting agent , wherein the dsRNA molecule specifically reduces the level of the target RNA in a cell of the insect.40. The method of claim 39 , wherein production of a protein encoded by the target RNA is reduced.41. The method of claim 39 , wherein the method comprises wholly or partially soaking the insect in the composition comprising the dsRNA.42. The method of claim 41 , wherein the composition further comprises a nucleic acid condensing agent.43. The method of claim 42 , wherein the nucleic acid condensing agent is selected from the group consisting of: spermidine and protamine sulfate.44. The method of claim 39 , wherein the dsRNA is from a transgenic organism expressing the dsRNA.45. The method of claim 44 , wherein the transgenic organism is a transgenic plant.46. The method of claim 39 , wherein the dsRNA comprises a nucleotide sequence having at least 90% identity to at least a portion of the sequence of the target RNA.47. The method of claim 39 , wherein the dsRNA molecule comprises 21 contiguous nucleotides in a sequence identical to the sequence of a portion of the target RNA.48. The method of claim 39 , wherein the dsRNA confers lethality on the ...

RNA INTERFERENCE FOR THE TREATMENT OF HEART FAILURE

The present invention relates to targeted RNAi for the treatment of heart failure by modulating defective cardiac Ca.sup.2+ homeostasis via decreasing expression or activity of phospholamban (PLB) using adeno-associated virus (AAV) transfection of cardiomyocytes. Methods for decreasing ventricular arrhythmias, as well as methods for overall improvement of survival from heart failure in subjects are also disclosed. Further, the present invention provides methods which can be used to diagnose susceptibility to treatment by RNAi, and includes pharmaceutical compositions, kits and vectors including an RNAi sequence. 1. A method of treating heart failure in a subject comprising administering to a subject in need thereof a vector comprising an RNAi expression cassette , wherein the cassette comprises an RNAi sequence whose expression product decreases expression or activity of phospholamban (PLB) , in an amount effective to treat heart failure of the subject.2. The method of claim 1 , wherein the RNAi expression cassette comprises a nucleotide sequence as set forth in SEQ ID NO:1 claim 1 , thereby improving systolic function in the subject as compared to prior to administering the vector.3. The method of claim 1 , wherein the vector is a virion.4. The method of wherein the vector is a plasmid.5. The method of claim 3 , wherein the virion is a parvovirus.6. The method of claim 5 , wherein the parvovirus is an adeno-associated virus (AAV).7. The method of claim 6 , wherein the AAV is serotype 9.8. The method of claim 1 , wherein expression of PLB mRNA is inhibited.9. The method of claim 2 , wherein SEQ ID NO: 1 is flanked by AAV terminal repeats.10. The method of claim 3 , wherein the genome of the virion vector is self-complementary.1112-. (canceled)13. A pharmaceutical composition comprising a recombinant adeno-associated virus (AAV) vector and a pharmaceutically acceptable carrier claim 3 , wherein the vector comprises an RNAi expression cassette whose RNA expression ...

NANOPARTICLES, NANOPARTICLE DELIVERY METHODS, AND SYSTEMS OF DELIVERY

In accordance with the purpose(s) of the present disclosure, as embodied and broadly described herein, embodiments of the present disclosure, in one aspect, relate to nanoparticles, compositions including nanoparticles, methods of making nanoparticles, and the like. In particular, embodiments of the present disclosure include nanoparticles and compositions for the sustained release (e.g., release at a predetermined rate to maintain a certain concentration for a certain period of time) of an agent, such as a small interfering RNA (siRNA) from the nanoparticle. 1. A composition comprising:a nanoparticle including a siRNA-cationic lipid conjugate, wherein the siRNA-cation lipid conjugate is disposed within the nanoparticle.2. A composition comprising:a nanoparticle including a siRNA-cationic lipid conjugate, wherein the nanoparticle has a lipid monolayer enclosing the nanoparticle core, wherein the siRNA-cationic lipid conjugate is disposed within the nanoparticle core.3. The composition of claim 2 , wherein the nanoparticle core includes a solid lipid.4. The composition of claim 3 , wherein the solid lipid is selected from the group consisting of: monoglycerides claim 3 , diglycerides claim 3 , triglycerides claim 3 , fatty acids claim 3 , steroids claim 3 , waxes claim 3 , and a combination thereof.5. The composition of claim 3 , wherein the lipid monolayer is selected from the group consisting of: lecithin claim 3 , phosphatidylcholines claim 3 , phosphatidic acid claim 3 , phosphatidylethanolamines claim 3 , phosphatidylglycerols claim 3 , phosphatidylserines claim 3 , phosphatidylinositols claim 3 , cardiolipins claim 3 , lipid-polyethyleneglycol conjugates claim 3 , and a combination thereof.6. The composition of claim 3 , wherein the nanoparticle core includes an agent selected from the group consisting of: a drug claim 3 , an imaging agent claim 3 , a nonionic surfactant claim 3 , other types of lipids claim 3 , and a combination thereof.7. The composition of ...

Micro-RNA Family that Modulates Fibrosis and Uses Thereof

The present invention relates to the identification of a microRNA family, designated miR-29a-c, that is a key regulator of fibrosis in cardiac tissue. The inventors show that members of the miR-29 family are down-regulated in the heart tissue in response to stress, and are up-regulated in heart tissue of mice that are resistant to both stress and fibrosis. Also provided are methods of modulating expression and activity of the miR-29 family of miRNAs as a treatment for fibrotic disease, including cardiac hypertrophy, skeletal muscle fibrosis other fibrosis related diseases and collagen loss-related disease. 188-. (canceled)89. A method for increasing fibrotic tissue formation in the wall of a vessel in a subject having one or more soft plaques comprising delivering an antisense oligonucleotide comprising a sequence that is at least partially complementary to a miR-29a , miR-29b , and/or miR-29c sequence to one or more soft plaque sites in the vessel wall , wherein the soft plaque is converted to fibrotic tissue following delivery of the antisense oligonucleotide.90. The method of claim 89 , wherein the antisense oligonucleotide comprises a sequence that is at least partially complementary to SEQ ID NO: 18 claim 89 , SEQ ID NO: 19 claim 89 , and/or SEQ ID NO: 20.91. The method of claim 90 , wherein the antisense oligonucleotide comprises a sequence that is at least 85% complementary to SEQ ID NO: 18 claim 90 , SEQ ID NO: 19 claim 90 , and/or SEQ ID NO: 20.92. The method of claim 90 , wherein the antisense oligonucleotide comprises a sequence that is at least 95% complementary to SEQ ID NO: 18 claim 90 , SEQ ID NO: 19 claim 90 , and/or SEQ ID NO: 20.93. The method of claim 90 , wherein the antisense oligonucleotide comprises a sequence that is 100% complementary to SEQ ID NO: 18 claim 90 , SEQ ID NO: 19 claim 90 , and/or SEQ ID NO: 20.94. The method of claim 89 , wherein the antisense oligonucleotide comprises a sequence that is substantially complementary to a pre-miR ...

METHODS AND COMPOSITIONS TO TREAT CANCER USING BIFUNCTIONAL SRC 3 shRNA

The present invention includes compositions and methods of making and using an expression vector comprising a promoter and a nucleic acid insert operably linked to the promoter, wherein the insert encodes one or more short hairpin RNAs (shRNA) capable of inhibiting an expression of a SRC-3 gene via RNA interference, wherein the one or more shRNA comprise a bifunctional RNA molecule that activates a cleavage-dependent and a cleavage-independent RNA-induced silencing complex for reducing the expression level of the SRC-3. 1. An expression vector comprising:a promoter; anda nucleic acid insert operably linked to the promoter,wherein the insert encodes one or more short hairpin RNAs (shRNA) capable of inhibiting an expression of a SRC-3 gene via RNA interference;wherein the one or more shRNA comprise a bifunctional RNA molecule that activates a cleavage-dependent and a cleavage-independent RNA-induced silencing complex for reducing the expression level of the SRC-3.2. The expression vector of claim 1 , wherein the one or more shRNA's is comprises a sequence selected from SEQ ID NO: 2 claim 1 , SEQ ID NO: 3 claim 1 , SEQ. ID NO: 4 claim 1 , SEQ ID NO: 5 claim 1 , SEQ ID NO: 6 claim 1 , SEQ ID NO: 7 claim 1 , SEQ ID NO: 8 claim 1 , SEQ ID NO: 9 claim 1 , SEQ ID NO: 10 claim 1 , SEQ ID NO: 11 claim 1 , or combinations or modifications thereof.3. The expression vector of claim 1 , wherein a sequence arrangement for the shRNA comprises a 5′ stem arm-19 nucleotide target (SRC-3 gene)-TA-15 nucleotide loop-19 nucleotide target complementary sequence-3′stem arm-Spacer-5′ stem arm-19 nucleotide target variant-TA-15 nucleotide loop-19 nucleotide target complementary sequence-3′stem arm.4. A therapeutic delivery system comprising:a therapeutic agent carrier; andan expression vector comprising a promoter and a nucleic acid insert operably linked to the promoter, wherein the insert encodes one or more short hairpin RNA (shRNA) capable of inhibiting an expression of a SRC-3 gene via ...

Micro-RNA Family That Modulates Fibrosis and Uses Thereof

The present invention relates to the identification of a microRNA family, designated miR-29a-c, that is a key regulator of fibrosis in cardiac tissue. The inventors show that members of the miR-29 family are down-regulated in the heart tissue in response to stress, and are up-regulated in heart tissue of mice that are resistant to both stress and fibrosis. Also provided are methods of modulating expression and activity of the miR-29 family of miRNAs as a treatment for fibrotic disease, including cardiac hypertrophy, skeletal muscle fibrosis other fibrosis related diseases and collagen loss-related disease. 188-. (canceled)89. A method of inducing collagen deposition in a tissue of a subject in need thereof comprising contacting said tissue with an antisense oligonucleotide comprising a sequence that is at least partially complementary to a miR-29a , miR-29b , and/or miR-29c sequence.90. The method of claim 89 , wherein the antisense oligonucleotide comprises a sequence that is at least partially complementary to SEQ ID NO: 18 claim 89 , SEQ ID NO: 19 claim 89 , and/or SEQ ID NO: 20.91. The method of claim 90 , wherein the antisense oligonucleotide comprises a sequence that is at least 85% complementary to SEQ ID NO: 18 claim 90 , SEQ ID NO: 19 claim 90 , and/or SEQ ID NO: 20.92. The method of claim 90 , wherein the antisense oligonucleotide comprises a sequence that is at least 95% complementary to SEQ ID NO: 18 claim 90 , SEQ ID NO: 19 claim 90 , and/or SEQ ID NO: 20.93. The method of claim 90 , wherein the antisense oligonucleotide comprises a sequence that is 100% complementary to SEQ ID NO: 18 claim 90 , SEQ ID NO: 19 claim 90 , and/or SEQ ID NO: 20.94. The method of claim 89 , wherein the antisense oligonucleotide comprises a sequence that is substantially complementary to a pre-miR-29a claim 89 , pre-miR-29b claim 89 , or pre-miR-29c sequence.95. The method of claim 89 , wherein the antisense oligonucleotide is about 15 to about 50 nucleotides in length.96. ...

METHODS OF TREATING CANCER

The present invention relates to metastases. More specifically, the invention relates to compositions and methods for the inhibition of metastases of cancer cells, such as prostate cancer cells, to bones and soft tissue. The present invention also relates to the treatment of cancer, including but not limited to prostate cancer. Also provided are animal models for studying cancer metastasis; particularly, prostate cancer metastasis. Further provided are compositions, processes and systems to prognosticate cancer. 1. A method for treating cancer in a mammalian subject in need thereof , comprising:providing an agent capable of inhibiting RANK and/or RANKL, and an agent capable of inhibiting HGF-c-Met/VEGFR2/neuropilin-1-mediated signaling; andadministering the agent capable of inhibiting RANK and/or RANKL and the agent capable of inhibiting HGF-c-Met/VEGFR2/neuropilin-1-mediated signaling to the mammalian subject to treat cancer.2. The method of claim 1 , wherein the agent capable of inhibiting RANK and/or RANKL is provided in a first composition and the agent capable of inhibiting HGF-c-Met/VEGFR2/neuropilin-1-mediated signaling is provided in a second composition.3. The method of claim 1 , wherein the agent capable of inhibiting RANK and/or RANKL and the agent capable of inhibiting HGF-c-Met/VEGFR2/neuropilin-1-mediated signaling are provided in one composition.4. The method of claim 1 , wherein the agent capable of inhibiting RANK and/or RANKL is denosumab claim 1 , RANK-Fc claim 1 , OPG-Fc claim 1 , shRNA claim 1 , or siRNA.5. (canceled)6. The method of claim 1 , wherein the agent capable of inhibiting RANK and/or RANKL is denosumab.7. The method of claim 1 , wherein the agent capable of inhibiting HGF-c-Met/VEGFR2/neuropilin-1-mediated signaling is denosumab claim 1 , RANK-Fc claim 1 , OPG-Fc claim 1 , shRNA claim 1 , siRNA claim 1 , crizotinib claim 1 , or VEGFR2 kinase inhibitor III (CAS 204005-46-9).8. (canceled)9. The method of claim 1 , wherein the cancer is ...

NUCLEIC ACIDS TARGETING TCTP FOR USE IN THE TREATMENT OF CHEMO-OR HORMONE- RESISTANT CANCERS

The present invention concerns a TCTP antagonist, in particular a nucleic acid targeting an m RNA encoding Translationally-Controlled Tumor Protein (TCTP), wherein said nucleic acid is capable of reducing the amount of TCTP in cells, for use in the treatment or prevention of hormone-independent cancer or chemo-resistant cancer, such as an androgen-independent prostate cancer. 1. A method for treating of preventing cancer comprising the step of administering an effective amount of a Translationally-Controlled Tumor Protein (TCTP) antagonist to an individual in need thereof.2. The method of claim 1 , wherein said cancer is a hormone-independent cancer or chemo-resistant cancer.3. The method of claim 2 , wherein said cancer is a hormone-independent cancer or chemo-resistant prostate cancer.4. The method of claim 1 , wherein said antagonist is a nucleic acid targeting an mRNA encoding TCTP claim 1 , and wherein said nucleic acid is capable of reducing the amount of TCTP in cells.5. The method of claim 4 , wherein said nucleic acid is an antisense oligonucleotide.6. The method of claim 4 , wherein said nucleic acid is an interfering RNA (iRNA).7. The method of claim 4 , wherein said nucleic acid targets a sequence overlapping with nucleotides 153 to 173 claim 4 , with nucleotides 221 to 240 claim 4 , with nucleotides 300 to 320 claim 4 , or with nucleotides 320 to 340 of SEQ ID NO: 5.8. The method of claim 4 , wherein said nucleic acid comprises a fragment of at least 10 consecutive nucleotides of a sequence selected from the group consisting of SEQ ID NO: 2 claim 4 , SEQ ID NO: 3 claim 4 , SEQ ID NO: 14 claim 4 , SEQ ID NO: 15 claim 4 , SEQ ID NO: 17 claim 4 , SEQ ID NO: 25 claim 4 , SEQ ID NO: 26 claim 4 , SEQ ID NO: 27 claim 4 , SEQ ID NO: 28 claim 4 , SEQ ID NO: 29 claim 4 , SEQ ID NO: 34 claim 4 , SEQ ID NO: 36 claim 4 , SEQ ID NO: 38 and SEQ ID NO: 40.9. The method of wherein said nucleic acid comprises a fragment of at least 10 consecutive nucleotides of a ...

Agents, Compositions, And Methods For Treating Pruritis And Related Skin Conditions

This invention relates generally to a therapeutic use of TLR3 and TLR7 inhibitors to treat or reduce pruritus in a subject. 1. A method of reducing or inhibiting pruritus in a subject , the method comprising administering to the subject a therapeutically effective amount of a toll-like receptor (TLR) 3 or TLR7 inhibitor , thereby reducing or inhibiting pruritus in the subject.2. The method of claim 1 , wherein the method comprises administering to the subject a therapeutically effective amount of a TLR3 inhibitor.3. The method of claim 2 , wherein the TLR3 inhibitor is an anti-TLR3 antibody or an antigen-binding fragment thereof.4. The method of claim 2 , wherein the TLR3 inhibitor is an inhibitory nucleic acid effective to specifically reduce expression of TLR3.5. The method of claim 4 , wherein the inhibitory nucleic acid is a small interfering RNA molecule or antisense nucleic acid.6. The method of claim 2 , wherein the TLR3 inhibitor is a small molecule.7. The method of claim 1 , wherein method comprises administering to the subject a therapeutically effective amount of a TLR7 inhibitor.8. The method of claim 7 , wherein the TLR7 inhibitor is an anti-TLR7 antibody or an antigen-binding fragment thereof.9. The method of claim 7 , wherein the TLR7 inhibitor is an inhibitory nucleic acid effective to specifically reduce expression of TLR7.10. The method of claim 9 , wherein the inhibitory nucleic acid is a small interfering RNA molecule or antisense nucleic acid.11. The method of claim 7 , wherein the TLR7 inhibitor is a small molecule.12. The method of claim 1 , wherein the subject has claim 1 , or is at risk of developing claim 1 , pruritus.13. The method of claim 1 , wherein the subject has atopic dermatitis claim 1 , psoriasis claim 1 , renal disease claim 1 , or liver disease.14. The method of claim 1 , wherein the subject is infected with a virus.15. The method of claim 14 , wherein the virus is human immunodeficiency virus or varicella zoster virus.16. The ...

METHODS FOR TREATING TRIPLE NEGATIVE BREAST CANCER USING BIFUNCTIONAL SRC 3 shRNA

The present invention includes compositions and methods treating triple negative breast cancer comprising administering a therapeutically effective amount of a formulation that includes vector that expresses an SRC-1-specific bifunctional shRNA, an SRC-3-specific bifunctional shRNA, or both, to impair triple negative breast cancer cell growth. 1. A method for treating triple negative breast cancer comprising administering a therapeutically effective amount of a formulation that includes vector that expresses an SRC-1-specific bifunctional shRNA , an SRC-3-specific bifunctional shRNA , or both , to impair triple negative breast cancer cell growth.2. The method of claim 1 , wherein the formulation further comprises a cationic liposomal preparation.3. The method of claim 2 , wherein the cationic liposomal preparation comprises a single vector that encodes the SRC-1-specific bifunctional shRNA claim 2 , the SRC-3-specific bifunctional shRNA claim 2 , or both the SRC-1-specific bifunctional shRNA and the SRC-3-specific bifunctional shRNA.4. The method of claim 1 , wherein the one or more shRNA's is comprises a sequence selected from SEQ ID NO: 2 claim 1 , SEQ ID NO: 3 claim 1 , SEQ. ID NO: 4 claim 1 , SEQ ID NO: 5 claim 1 , SEQ ID NO: 6 claim 1 , SEQ ID NO: 7 claim 1 , SEQ ID NO: 8 claim 1 , SEQ ID NO: 9 claim 1 , SEQ ID NO: 10 claim 1 , SEQ ID NO: 11 claim 1 , or combinations or modifications thereof.5. The method of claim 1 , wherein a sequence arrangement for the shRNA comprises a 5′ stem arm-19 nucleotide target (SRC-3 gene)-TA-15 nucleotide loop-19 nucleotide target complementary sequence-3′ stem arm-Spacer-5′ stem arm-19 nucleotide target variant-TA-15 nucleotide loop-19 nucleotide target complementary sequence-3′ stem arm.6. The method of claim 1 , wherein the one or more polycations is a 10 kDA polyethylene glycol (PEG)-substituted cysteine-lysine 3-mer peptide (CK30PEG10k).7. The method of claim 1 , wherein the compacted DNA nanoparticles are further ...

NANOTECHNOLOGY APPROACH FOR INHALATION THERAPIES

This invention relates to lipid nanoparticle compositions and methods for the localized delivery of active agents via inhalation therapy. 1. A composition comprising a plurality of lipid nanoparticles , wherein at least one lipid nanoparticle comprises: (i) a lipid membrane surrounding an inner compartment of the nanoparticle , (ii) an aqueous phase encapsulated by the inner compartment , and (iii) at least one water-soluble active agent contained within the aqueous phase , wherein the active agent is selected from the group consisting of water-soluble prostaglandins , water-soluble prostaglandin analogues , water-soluble antioxidants , and combinations thereof , wherein each lipid nanoparticle has a diameter ranging from 1 nm to 1000 nm.2. A composition comprising a plurality of lipid nanoparticles , wherein at least one lipid nanoparticle comprises: (i) a mixture of solid and liquid lipids and (ii) at least one lipid-soluble active agent contained within the lipid mixture , wherein the active agent is selected from the group consisting of lipid-soluble prostaglandins , lipid-soluble prostaglandin analogues , lipid-soluble antioxidants , and combinations thereof , wherein each lipid nanoparticle has a diameter ranging from 1 nm to 1000 nm.3. The composition of claim 1 , wherein the active agent is water-soluble prostaglandin E2.4. The composition of claim 2 , wherein the active agent is lipid-soluble α-tocopherol.5. The composition of claim 1 , further comprising claim 1 , in combination with the plurality of lipid nanoparticles claim 1 , one or more pharmaceutical excipients selected from the group consisting of humectants claim 1 , viscosity modifiers claim 1 , surfactants claim 1 , pH stabilizers claim 1 , freeze drying protectants claim 1 , polymers claim 1 , and combinations thereof.6. The composition of claim 2 , further comprising claim 2 , in combination with the plurality of lipid nanoparticles claim 2 , one or more pharmaceutical excipients selected from ...

NANOPARTICLES OF CERIUM AND AMINO ACIDS

A process for making nanoparticles of biocompatible materials is described, wherein an aqueous reaction mixture comprising cerous ion, an α-amino acid, an oxidant and water is provided along with temperature conditions to effectively form nanoparticles. These biocompatible nanoparticles may be further conjugated to biologically active agents, such as plasmid DNA, siRNA or proteins, such that a cell transfection agent is formed. 1. A process of making nanoparticles , comprising:(a) forming a reaction mixture comprising cerous ion, an α-amino acid, an oxidant, and water; and(b) forming a dispersion of nanoparticles from the reaction mixture.2. The process according to claim 1 , further comprising the step adjusting said reaction mixture to a pH less than about 3.3. The process according to claim 1 , further comprising the step of heating or cooling said reaction mixture to a temperature in the range of about 0° C. to about 100° C.4. The process according to claim 1 , wherein said nanoparticles comprise crystalline or semi-crystalline material.5. The process according to claim 1 , wherein said oxidant is hydrogen peroxide.6. A nanoparticle comprising an α-amino acid and a metal.7. The nanoparticle of claim 6 , wherein the metal is cerium.8. The nanoparticle of claim 7 , wherein said cerium comprises a cerium oxide.9. The nanoparticle of claim 6 , characterized by a zeta potential greater than zero.10. A process of making a conjugate claim 6 , comprising:contacting a nanoparticle comprising an α-amino acid and a metal, with a biologically active agent.11. The process of claim 10 , wherein said nanoparticle further comprises cerium.12. The process of claim 10 , wherein said biologically active agent is comprised of ribonucleic acid claim 10 , deoxyribonucleic acid claim 10 , protein or lipid.13. A conjugate claim 10 , comprising:a nanoparticle comprising an α-amino acid and a metal; anda biologically active agent.14. The conjugate of claim 13 , wherein said nanoparticle ...

MODULATION OF FACTOR 11 EXPRESSION

Disclosed herein are antisense compounds and methods for decreasing Factor 11 and treating or preventing thromboembolic complications in an individual in need thereof. Examples of disease conditions that can be ameliorated with the administration of antisense compounds targeted to Factor 11 include thrombosis, embolism, and thromboembolism, such as, deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke. Antisense compounds targeting Factor 11 can also be used as a prophylactic treatment to prevent individuals at risk for thrombosis and embolism. 154-. (canceled)55. A method of treating a thromboembolic complication in an animal , comprising administering to an animal in need thereof a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides , wherein the modified oligonucleotide is at least 90% complementary to a Factor 11 nucleic acid.56. The method of claim 55 , wherein the administering prolongs aPTT in the animal.57. The method of claim 55 , wherein the administering reduces platelet quantity as measured by platelet factor-4 quantification in the animal.58. The method of claim 55 , wherein the administering reduces amount of bleeding in response to injury in the animal.59. The method of claim 55 , wherein the administering prevents thrombus formation in the animal.60. The method of claim 55 , wherein the thromboembolic complication is any of the group consisting of deep vein thrombosis claim 55 , pulmonary embolism claim 55 , myocardial infarction claim 55 , and stroke.61. The method of claim 55 , wherein the compound is for coadministation with any of the group consisting of aspirin claim 55 , clopidogrel claim 55 , dipyridamole claim 55 , heparin claim 55 , lepirudin claim 55 , ticlopidine claim 55 , warfarin claim 55 , apixaban claim 55 , rivaroxaban claim 55 , LOVENOX claim 55 , and Factor Xa inhibitor.62. The method of claim 55 , wherein the compound is for concomitant administration with any of the ...

MACROPHAGE-SYNTHESIZED CCL3 PROMOTES BREAST CANCER METASTASIS

Methods and compositions are provided for inhibiting metastasis of a tumor in a subject, or of inhibiting progression of a primary tumor in a subject which requires macrophages for progression. 1. A method of inhibiting metastasis of a tumor in a subject , or of inhibiting progression in a subject of a primary tumor which requires macrophages for progression , comprising administering to the subject an amount of an inhibitor of CCL3 effective to inhibit metastasis of a tumor or inhibit progression of a primary tumor requiring macrophages for progression.2. A method of inhibiting metastasis of a tumor in a subject , or of inhibiting progression in a subject of a primary tumor which requires macrophages for progression , comprising administering to the subject an amount of an antagonist of a CCR5 receptor or of an antagonist of a CCR1 receptor effective to inhibit metastasis of a tumor or inhibit progression of a primary tumor requiring macrophages for progression.3. The method of claim 1 , wherein the tumor is a tumor of the breast claim 1 , nasopharynx claim 1 , pharynx claim 1 , lung claim 1 , bone claim 1 , brain claim 1 , sialaden claim 1 , stomach claim 1 , esophagus claim 1 , testes claim 1 , ovary claim 1 , uterus claim 1 , endometrium claim 1 , liver claim 1 , small intestine claim 1 , appendix claim 1 , colon claim 1 , rectum claim 1 , gall bladder claim 1 , pancreas claim 1 , kidney claim 1 , urinary bladder claim 1 , breast claim 1 , cervix claim 1 , vagina claim 1 , vulva claim 1 , prostate claim 1 , thyroid or skin or is a glioma.4. The method of claim 1 , wherein the tumor is a tumor of the breast claim 1 , endometrium or prostate or wherein the primary tumor is a brain tumor or glioma.5. The method of claim 1 , wherein metastasis is inhibited in lung claim 1 , bone and/or brain tissue.6. The method of claim 1 , wherein the inhibitor of CCL3 is an antibody claim 1 , a fragment of an antibody claim 1 , a small organic molecule of less than 2000 daltons ...

Methods and compositions for rnai-based cancer treatment

The present invention generally concerns methods and compositions for treating mutated K-ras expressing cancers.

METHODS TO ENHANCE RNAI OLIGONUCLEOTIDE DELIVERY TO RESPIRATORY EPITHELIAL CELLS

The present invention relates to methods of reducing a level of a target mRNA in a well-differentiated airway epithelial cell by contacting the cell with a sensitizing agent followed by contacting the cell with a therapeutic RNAi agent. 1. A method of reducing a level of a target mRNA in a well-differentiated airway epithelial cell comprising contacting the cell with a sensitizing agent followed by contacting the cell with a therapeutic RNAi agent , wherein the mRNA level of the target mRNA is reduced by at least 1% as compared to a control cell that has not been contacted with the sensitizing compound.2. The method of claim 1 , wherein the mRNA level of the target mRNA is reduced by at least 10%.3. The method of claim 1 , wherein the mRNA level of the target mRNA is reduced by at least 20%.4. The method of claim 1 , wherein well differentiated cells are more than five days old.5. The method of claim 1 , wherein the sensitizing agent is a small molecule PI3K inhibitor claim 1 , EGF claim 1 , LY-294002 claim 1 , wortmannin or triciribine.6. The method of claim 1 , wherein the RNAi molecule is an siRNA claim 1 , an miRNA claim 1 , and/or an anti-sense oligonucleotide.7. The method of claim 1 , wherein the cell is contacted on its mucosal surface.8. The method of claim 1 , wherein the airway epithelial cell is a lung cell claim 1 , a nasal cell claim 1 , a tracheal cell claim 1 , a bronchial cell claim 1 , a bronchiolar or alveolar epithelial cell.9. A method of treating a subject having an airway epithelial disease comprising administering to the subject an effective amount of a sensitizing agent and an effective amount of a therapeutic agent to alleviate the symptoms of the airway epithelial disease by inducing a therapeutic effect.10. The method of claim 9 , wherein the sensitizing agent is administered orally.11. The method of claim 9 , wherein the sensitizing agent is administered by inhalation.12. The method of claim 9 , wherein the sensitizing agent is ...

siRNA FOR INHIBITION OF Hif1alpha EXPRESSION AND ANTICANCER COMPOSITION CONTAINING THE SAME

Disclosed are small interfering RNA (siRNA) that complementarily binds to a base sequence of Hif1α mRNA transcript, thereby inhibiting expression of Hif1α without inducing immune responses, and a use of the siRNA for prevention and/or treatment of cancer. Since Hif1α is commonly overexpressed in almost all cancer cells, the siRNA that complementarily binds to Hif1α-encoding mRNA may inhibit expression of Hif1α through RNA-mediated interference (RNAi), thereby inhibiting proliferation and metastasis of cancer cells, and thus, the siRNA may be useful as an anticancer agent. 2. The siRNA according to claim 1 , wherein the siRNA targets mRNA corresponding to at least one base sequence selected from the group consisting of SEQ ID NOs 6 claim 1 , 10 claim 1 , and 12.3. The siRNA according to claim 1 , wherein the siRNA comprises an overhang consisting of 1 to 5 nucleotides (nt) at 3′ end claim 1 , 5′ end claim 1 , or both ends.5. The siRNA according to claim 4 , wherein the siRNA is selected from the group consisting ofsiRNA 5 comprising a sense sequence of SEQ ID NO 27 and an antisense sequence of SEQ ID NO 28,siRNA 9 comprising a sense sequence of SEQ ID NO 35 and an antisense sequence of SEQ ID NO 36,siRNA 11 comprising a sense sequence of SEQ ID NO 39 and an antisense sequence of SEQ ID NO 40,siRNA 18 comprising a sense sequence of SEQ ID NO 53 and an antisense sequence of SEQ ID NO 28,siRNA 19 comprising a sense sequence of SEQ ID NO 54 and an antisense sequence of SEQ ID NO 36, andsiRNA 20 comprising a sense sequence of SEQ ID NO 55 and an antisense sequence of SEQ ID NO 40.6. The siRNA according to claim 1 , wherein the sugar or base structure of at least one ribonucleic acid claim 1 , or a bond between the ribonucleic acids is chemically modified.7. The siRNA according to claim 6 , wherein the chemical modification is selected from the group consisting of:substitution of a phosphodiester bond in the backbone with boranophosphate or phosphorothioate, ...

FSH AND FSH RECEPTOR MODULATOR COMPOSITIONS AND METHODS FOR INHIBITING OSTEOCLASTIC BONE RESORPTION AND BONE LOSS IN OSTEOPOROSIS

The invention discloses compositions and methods for decreasing osteoclast which are useful for the treatment of a variety of bone loss disorders. 18.-. (canceled)9. A pharmaceutical composition for decreasing osteoclast activity and/or osteoclast differentiation in a subject , comprising:at least one of a follicle stimulating hormone modulator (FSHM) or a follicle stimulating hormone receptor modulator (FSHRM) in an amount effective to reduce bioactivity or bioavailability of follicle stimulating hormone in a subject,at least one second therapeutic agent that treats a bone loss disorder in a subject; anda pharmaceutically acceptable carrier.10. The composition of claim 9 , wherein the at least one follicle stimulating hormone modulators or follicle stimulating hormone receptor modulators are selected from the group consisting of small molecules claim 9 , proteins claim 9 , peptides claim 9 , antibodies claim 9 , nucleic acids claim 9 , and combinations thereof.11. The composition of claim 9 , wherein the at least one follicle stimulating hormone modulators or follicle stimulating hormone receptor modulators are selected from the group consisting of siRNA claim 9 , antibodies claim 9 , and combinations thereof.12. The composition of claim 9 , wherein the follicle stimulating hormone receptor modulator comprises (7-[4-[Bis-(2-carbamoyl-ethyl)-amino]-6-chloro-(1 claim 9 ,3 claim 9 ,5)-triazin-2-ylamino)-4-hydroxy-3-(4-methoxy-phenylazo)-naphthalene]-2-sulfonic acid.13. The composition of claim 9 , wherein the follicle stimulating hormone modulator comprises an aminoalkylamide FSH antagonist.14. The composition of claim 9 , wherein the follicle stimulating hormone receptor modulator comprises a thiazolidinone FSH receptor antagonist.15. The composition of claim 9 , wherein the at least one second therapeutic agent is selected from the group consisting of estrogen claim 9 , estrogen agonists claim 9 , estrogen antagonists claim 9 , estrogen receptor modulators claim 9 , ...

COMPOSITIONS AND METHODS TO BLOCK MTB-MEDIATED EVASION

Method and compositions are disclosed for inhibiting Mtb-mediated evasion of host immunity or treating a disease or condition caused by Mtb infection in subject or patient, administering an effective amount of a molecular inhibitor, an isolated Mtb EIS peptide, polynucleotide encoding an Mtb EIS peptide, an EIS polynucleotide, or biological equivalents of each thereto. 1. A method for inhibiting Mtb-mediated evasion of host immunity , comprising administering to a subject in need thereof an effective amount of one or more of a molecular inhibitor , an isolated Mtb EIS peptide , a polynucleotide encoding an Mtb EIS peptide , an EIS polynucleotide , or a biological equivalent of each thereof , thereby inhibiting Mtb-mediated evaluation of host immunity.2. The method of claim 1 , wherein the Mtb EIS peptide further comprises a cell penetrating domain.3. The method of claim 1 , wherein the biological equivalent of the Mtb EIS peptide is the retro-inverso form of the Mtb EIS peptide.4. The method of claim 1 , wherein the cell penetrating domain comprises a HIV TAT peptide.5. The method of claim 1 , wherein the EIS polynucleotide is a siRNA.6. The method of claim 1 , wherein the EIS peptide is an antibody.7. The method of claim 1 , wherein the molecular inhibitor is a small molecule.8. A method for inhibiting Mtb infection or treating a disease or condition related to Mtb infection claim 1 , comprising administering to a subject in need thereof an effective amount of one or more of a molecular inhibitor claim 1 , an isolated Mtb EIS peptide claim 1 , polynucleotide encoding an Mtb EIS peptide claim 1 , an EIS polynucleotide claim 1 , or biological equivalents of each thereto claim 1 , thereby inhibiting Mtb infection or treating a disease or condition related to Mtb infection.9. The method of claim 8 , wherein the Mtb EIS peptide further comprises a cell penetrating domain.10. The method of claim 8 , wherein the biological equivalent of the Mtb EIS peptide is the retro- ...

METHODS AND COMPOSITIONS FOR TREATING DISORDERS ASSOCIATED WITH HYPERACTIVE IMMUNE SYSTEM

The present invention provides methods and compositions for treating disorders associated with hyperactive immune responses. The invention also provides methods for lithibiting activation of CD4T cells and/or suppressing proliferation other overactivated T cells (e.g., CD4CD8 T cells). These methods typically involve the administration to the subject a therapeutically effective amount of a compound that lithibits or suppresses IL-7 signaling or IL- 15 signaling.

PVRL4 (Nectin4) is a Receptor for Measles Virus

PVRL4 is a tumor marker that is highly expressed on the surfaces of many carcinomas. Disclosed herein are compositions and methods that provide impetus for using measles virus as an oncolytic agent against PVRL4+ carcinomas and use of PVRL4-binding agents to interfere with viral infection.

COMPOSITIONS AND METHODS FOR TREATING ALPHAVIRUS INFECTION

Provided herein are compositions and methods for treating a disease or disorder associated with an alphavirus infection. Specifically, the invention relates to administering a Natural Resistance-Associated Macrophage Protein (NRAMP) antagonist to prevent binding or infection of an alphavirus to its host. 1. A method for treating a disease or disorder associated with an alphavirus infection in a subject , the method comprising: administering to said subject an effective amount of a molecule that inhibits the activity of a Natural Resistance-Associated Macrophage Protein (NRAMP) , thereby in treating said disease or disorder in said subject.2. The method of claim 1 , wherein said NRAMP is NRAMP1.3. The method of claim 1 , wherein said NRAMP is NRAMP2.4. The method of claim 1 , wherein said alphavirus is a Sindbis virus.5. The method of claim 1 , wherein said alphavirus is a Venezuelan Equine Encephalitis virus.6. The method of claim 1 , wherein said disease is a Sindbis fever.7. The method of claim 1 , wherein said molecule is a nucleic acid molecule.8. The method of claim 1 , wherein said molecule is a dsRNA claim 1 , miRNA claim 1 , siRNA claim 1 , anti-sense RNA claim 1 , enzymatic RNA claim 1 , aptamer claim 1 , or an oligonucleotide molecule against said NRAMP.9. The method of claim 1 , wherein said molecule is a protein or peptide molecule.10. The method of claim 1 , wherein said molecule is an antibody that binds specifically to said NRAMP.11. The method of claim 1 , wherein said molecule is a small molecule compound.12. The method of claim 1 , wherein said molecule is an iron containing compound.13. A method for identifying a molecule that treats a disease or disorder associated with an alphavirus infection claim 1 , the method comprising contacting a cell that expresses a Natural Resistance-Associated Macrophage Protein (NRAMP) with a candidate molecule claim 1 , and comparing the biological activity of the NRAMP in the cell contacted by the candidate ...

TARGETING EN2, PAX2, AND/OR DEFB1 FOR TREATMENT OF PROSTATE CONDITIONS

The present invention relates to methods and compositions for treating a prostate condition in a subject. The method comprises administering to the subject a subject effective amount of a pharmaceutical composition having a first agent that inhibits EN2 expression and/or EN2 activity and a second agent that inhibits PAX2 expression and/or PAX2 activity. The pharmaceutical composition may further comprise a third agent that enhances DEFB1 expression or activity. 1. A method for treating a prostate condition in a subject , comprising:administering to the subject an effective amount of a pharmaceutical composition comprising:a first agent that inhibits Engrailed-2 (EN2) expression and/or EN2 activity; anda second agent that inhibits PAX2 expression and/or PAX2 activity.2. The method of claim 1 , wherein said first agent is selected from the group consisting of siRNA claim 1 , aptamer-siRNA chimera claim 1 , EN2 binding inhibitor claim 1 , double-stranded oligonucleotide binding decoy comprising an EN2 binding site claim 1 , single stranded antisense oligonucleotide claim 1 , triplex forming oligonucleotide claim 1 , ribozyme claim 1 , external guide sequence and combinations thereof.3. The method of claim 1 , wherein said first agent comprises an antisense EN2 polynucleotide or EN2 siRNA.45-. (canceled)6. The method of claim 1 , wherein said second agent is selected from the group consisting of PAX2 siRNA claim 1 , aptamer-siRNA chimera claim 1 , single stranded antisense oligonucleotide claim 1 , triplex forming oligonucleotide claim 1 , ribozyme claim 1 , external guide sequence claim 1 , polynucleotide encoding a PAX2 siRNA claim 1 , PAX2 binding inhibitor claim 1 , double-stranded oligonucleotide binding decoy comprising a PAX2 binding site in the beta defensin-1 (DEFB1) promoter claim 1 , antagonist of angiotensin II claim 1 , antagonist of the angiotensin II receptor claim 1 , antagonist of angiotensin-converting enzyme (ACE) claim 1 , antagonist of mitogen- ...