ПРОИЗВОДНЫЕ БЕНЗОТИАЗОЛА, ХАРАКТЕРИЗУЮЩИЕСЯ АГОНИСТИЧЕСКОЙ АКТИВНОСТЬЮ К БЕТА-2-АДРЕНОРЕЦЕПТОРАМ

Изобретение относится к соединениям общей формулы (I) и их фармацевтически приемлемым солям в качестве агонистов β2-адренорецептора, к способу их получения и применению, а также к фармацевтической композиции на их основе. Соединения могут найти применение для лечения состояний, которые можно предотвратить или снизить интенсивность симптомов при активации β2 -адренорецептора, например обструктивных или воспалительных заболеваний дыхательных путей. В общей формуле (I) X означает -R1-Ar-R2 или -Ra-Y; Ar означает фенилен, необязательно замещенный группой из ряда: галоген, гидрокси, C1-С10алкил, C1-С10алкокси, фенил, C1-С10алкокси, замещенный фенильной группой, или фенил, замещенный C1-С10 алкоксигруппой; R1 и R2присоединены к соседним атомам углерода в составе группы Ar, и либо R1 означает C1-С10алкилен, a R2 означает водород, C1-С10алкил или галоген, Ra означает связь или C1-С10алкилен, необязательно замещенный группой из ряда: гидрокси, C1-С10алкокси, C6-С10арил или C7-С14аралкил; Y означает ...

ПРОИЗВОДНЫЕ ПИРАЗОЛА С КОНДЕНСИРОВАННЫМ ЦИКЛОМ

Изобретение относится к соединениям формулы I, которые являются антагонистами рецептора CRF, где Ar означает необязательно замещенный фенил или моноциклический 6-членный гетероарил, содержащий один гетероатом, выбранный из атомов азота, кислорода или серы, R1-R4 имеют значения, указанные в формуле изобретения, или их фармацевтически приемлемым солям. Изобретение также относится к способам получения указанных соединений и к фармацевтическим композициям, содержащим указанные соединения, которые пригодны для введения субъекта с заболеваниями, которые облегчаются при терапии антагонистом CRF. 6 н. и 20 з.п. ф-лы, 10 табл.

D-ТАРТРАТ(-)ЦИС-6(S)-ФЕНИЛ-5(R)-[4-(2-ПИРРОЛИДИН-1-ИЛЭТОКСИ)ФЕНИЛ]-5,6,7,8 -ТЕТРАГИДРОНАФТАЛИН-2-ОЛА, СПОСОБ ЕГО ПОЛУЧЕНИЯ, СПОСОБ ПРЕДОТВРАЩЕНИЯ СОСТОЯНИЙ, ПОДДАЮЩИХСЯ ВОЗДЕЙСТВИЮ АГОНИСТОВ ЭСТРОГЕНА, ФАРМАЦЕВТИЧЕСКАЯ КОМПОЗИЦИЯ

Описан способ получения D-тартрат(-)цис-6(S)-фенил-5(R)-[4-(2-пирролидин-1-илэтокси)фенил] -5,6,7,8-тетрагидронафталин-2-ола, который полезен как агонист эстрогена и может быть использован для предотвращения у млекопитающих состояний, поддающихся воздействию агонистов эстрогена, например остеопороза, сердечно-сосудистого заболевания при гиперлипидермии, заболевания предстательной железы, гиперхолестеролемии, ожирения, рака молочной железы, эндометриоза. 4 с. и 7 з.п. ф-лы.

ПРОФИЛАКТИКА ИЛИ ЛЕЧЕНИЕ ЗАДЕРЖКИ ВНУТРИУТРОБНОГО РАЗВИТИЯ ИЛИ ТОКСИКОЗА БЕРЕМЕННОСТИ

Изобретение относится к области медицины и фармакологии и касается средства для профилактики или лечения задержки внутриутробного развития или токсикоза беременности, содержащего фенилэтаноламинотетралин, обладающего повышенной активностью. 3 з.п. ф-лы, 5 табл.

ПРОИЗВОДНЫЕ ДИТИЕПИНО[6,5-B]ПИРИДИНА, СПОСОБЫ ИХ ПОЛУЧЕНИЯ, ФАРМАЦЕВТИЧЕСКАЯ КОМПОЗИЦИЯ НА ИХ ОСНОВЕ И СПОСОБЫ ИНГИБИРОВАНИЯ И ЛЕЧЕНИЯ РАССТРОЙСТВ

Изобретение предоставляет новые дитиепино[6,5-b]пиридины формул (I) и (II) где значения радикалов представлены в формуле изобретения. Соединения полезны в качестве антагонистов кальциевых каналов с сердечно-сосудистой, антиастматической и бронхолитической активностью. Изобретение относится также к фармацевтическим композициям и способам профилактики и лечения расстройств, таких как повышенная чувствительность, аллергия, астма, бронхоспазм, дисменорея, эзофагоспазм, глаукома, преждевременные роды, расстройства мочевых путей, расстройства двигательной функции желудочно-кишечного тракта и сердечно-сосудистые расстройства. 7 с. и 20 з.п. ф-лы, 7 табл.

АНАЛОГИ ПРОСТАГЛАНДИНОВ, СПОСОБ ИХ ПОЛУЧЕНИЯ И ФАРМАЦЕВТИЧЕСКАЯ КОМПОЗИЦИЯ, ОБЛАДАЮЩАЯ СЕЛЕКТИВНОЙ АГОНИСТИЧЕСКОЙ АКТИВНОСТЬЮ В ОТНОШЕНИИ РЕЦЕПТОРА EP4

Изобретение относится к аналогам простагландина формулы I: где А означает -СН2-СН2 или -СН=СН-, В отсутствует или означает фенил, Z означает -C(O)OR' или тетразол-5-ил, где R' означает водород или C1-С6алкил, m равно 1, 2, 3, 4, 5 или 6, R1 означает C1-С6 алкил, незамещенный фенил или фенил, замещенный по меньшей мере одним заместителем, выбранным из группы, включающей трифторметил, галоген, -Y-Ra, -Y-ORa и -Y-C(O)Ra, где Y означает химическую связь или C1-С3алкиленовую группу, a Ra означает C1-С6алкил, незамещенный фенил или фенил, замещенный по меньшей мере одним заместителем, выбранным из группы, включающей C1-С6алкил, C1-С6алкокси, трифторметил и галоген, при условии, что В означает фенил, a R3, R4, R5 и R6 одновременно не означают водород, или R1 означает незамещенный фенил или фенил, замещенный по меньшей мере одним заместителем, выбранным из группы, включающей трифторметил, галоген, -Y-Ra, -Y-ORa и -Y-C(O)Ra, где Y означает химическую связь или C1-С3алкиленовую группу, a Ra означает ...

СОЕДИНЕНИЯ, СПОСОБ ПОЛУЧЕНИЯ СОЕДИНЕНИЯ, ФАРМАЦЕВТИЧЕСКАЯ КОМПОЗИЦИЯ

Описывается соединение формулы (I) в свободной форме или в форме соли, где Ar обозначает группу формулы R1 обозначает водород или гидрокси, R2 и R3 каждый независимо друг от друга обозначает водород или С1-С4алкил, R4, R5, R6 и R7 каждый независимо друг от друга обозначает водород, С1-С4алкокси, C1-С4алкил или С1-С4алкил, замещенный С1-С4алкоксигруппой, или R5 и R6 вместе с атомами углерода, к которым они присоединены, обозначают 6-членное циклоалифатическое кольцо или 6-членное гетероциклическое кольцо, содержащее два атома кислорода, R8 обозначает -NHR13, где R13 обозначает водород, С1-С4алкил или -COR14, где R14обозначает водород, или R13 обозначает –SO2R17, где R17 обозначает С1-С4алкил, и R9 обозначает водород, или R8 обозначает -NHR18, где -NHR18 и R9 вместе с атомами углерода, к которым они присоединены, обозначают 6-членный гетероцикл, R10 обозначает -ОН, Х обозначает С1-С4алкил, Y обозначает углерод, n равно 1 или 2, p равно 1, q означает 1, r означает 0 или 1. Описывается также ...

СПОСОБ ЛЕЧЕНИЯ АНОМАЛИИ СОКРАТИТЕЛЬНОЙ ДЕЯТЕЛЬНОСТИ МАТКИ В РОДАХ

Изобретение относится к медицине, в частности к акушерству, и касается лечения аномалий сократительной деятельности матки в родах. Для этого при выявлении дискоординации сократительной деятельности матки в первом периоде родов вводят грандаксин в дозе 100 мг - 2 таблетки 1 раз в день, до нормализации сократительной деятельности матки. Способ обеспечивает нормализацию родовой деятельности в сочетании с мягким психостимулирующим эффектом у рожениц при отсутствии побочного воздействия на организм плода.

СПИРОЦИКЛИЧЕСКИЕ ИНГИБИТОРЫ МЕТАЛЛОПРОТЕАЗ

Изобретение относится к новым спирокеталям формулы I где Ar - фенил, замещенный фенил, где заместители представляют: алкокси, алкил, алкоксиалкил, фенокси, галоген, пиридилокси, алкоксиалкокси, галогенфенокси; R1 - H; R2 - H, С1-С4алкил; W представляет О или один или несколько С1-С4 алкильных фрагментов; Y - независимо один или несколько членов группы, состоящей из H2, SR3, алкокси; R3 - H, алкил; Z - карбоциклический или гетероциклический спиро-фрагмент с 3-7 членами кольцевой системы, где гетероциклический фрагмент включает 2 атома кислорода или серы, или один атом азота, причем спироцикл может быть незамещенным или замещен гидрокси, С1-С4алкилом, бензилокси; n=1-3; оптические изомеры, диастереомеры или энантиомеры или их фармацевтически приемлемые соли. Соединение I ингибируют металлопротеазу, что позволяет использовать их в фармацевтической композиции для лечения или предупреждения заболевания, связанного с повышенной активностью металлопротеаз. 2 с. и 8 з.п. ф-лы, 5 табл.

СПОСОБ ЛЕЧЕНИЯ ПАТОЛОГИЧЕСКОГО ПРЕЛИМИНАРНОГО ПЕРИОДА

Изобретение относится к медицине, в частности к акушерству, и касается лечения патологического прелиминарного периода. Для этого 5 мкг гинипрала разводят в 100 мл 0,9% раствора натрия хлорида и вводят внутривенно капельно. При этом одновременно с введением гинипрала внутривенно капельно вводят 5 мг верапамила в 100 мл 0,9% раствора натрия хлорида. Введение указанных растворов продолжают до нормализации параметров сократительной деятельности матки. За счет специально разработанных доз способ обеспечивает достижение оптимальной биологической готовности к родам у беременных с патологическим прелиминарным периодом, нормализацию маточной активности с последующим спонтанным развитием родовой деятельности.

СПОСОБ ЛЕЧЕНИЯ ГЕСТОЗА БЕРЕМЕННЫХ

Изобретение относится к медицине, в частности к акушерству, и касается лечения гестоза беременных. Для этого в течение шести дней осуществляют эндоваскулярное лазерное облучение крови. Далее в течение восьми дней вводят полифепан внутрь в дозе 0,5 г/кг массы тела беременной 3-4 раза в день. Способ, за счет выбранного режима, обеспечивает терапевтический эффект при сокращении сроков лечения и снижении лекарственной нагрузки на организм беременных.

17α-АЦЕТОКСИ-3β-ФЕНИЛПРОПИОНИЛОКСИ-6-МЕТИЛПРЕГНА-4,6-ДИЕН-20-ОН, ОБЛАДАЮЩИЙ ГЕСТАГЕННОЙ АКТИВНОСТЬЮ, И ЛЕКАРСТВЕННОЕ СРЕДСТВО НА ЕГО ОСНОВЕ

Новоесоединение-17α-ацетокси-3β -фенилпропионилокси-6-метилпрегна-4,6-диен-20-он формулы I, обладающий гестагенной активностью. В состав лекарственного средства новое соединение входит в количестве 0,8-3,0 мас.%. Средство предназначено для сохранения беременности и может найти применение в акушерской практике и гинекологии. 2 с. и 1 з.п.ф-лы, 3 ил., 4 табл.

СПОСОБ КОРРЕКЦИИ НАРУШЕНИЯ МИКРОЦИРКУЛЯЦИИ В ПЛАЦЕНТЕ ПОЛИВИТАМИННО-МИНЕРАЛЬНЫМ КОМПЛЕКСОМ ПРИ ADMA-ПОДОБНОЙ МОДЕЛИ ГЕСТОЗА В ЭКСПЕРИМЕНТЕ

Изобретение относится к медицине, в частности к экспериментальной фармакологии, и может быть использовано при разработке способов коррекции эндотелиальной дисфункции у беременных. Для этого в условиях эксперимента у лабораторных беременных крыс воспроизводят ADMA-подобную модель гестоза введением ингибитора NO-синтазы L-NAME. На фоне этого для коррекции патологии вводят ежедневно в течение 7 суток внутрижелудочно витаминно-минеральный препарат «Компливит Триместрум 3 триместр» в дозе 0,084 таб/кг/сут. Способ обеспечивает выраженную коррекцию нарушений микроциркуляции в плаценте за счет эндотелиопротективного эффекта препарата в выбранных для этого дозах. 1 пр.

СПОСОБ КОРРЕКЦИИ НАРУШЕНИЯ МИКРОЦИРКУЛЯЦИИ В ПЛАЦЕНТЕ ПРИ ADMA-ПОДОБНОЙ МОДЕЛИ ГЕСТОЗА В ЭКСПЕРИМЕНТЕ ОДНОКРАТНЫМ ИШЕМИЧЕСКИМ ЭПИЗОДОМ

Изобретение относится к медицине, в частности к экспериментальной фармакологии, и может быть использовано для коррекции нарушения микроциркуляции в плаценте у беременных. Сущность способа состоит в воспроизведении модели гестоза у крыс линии Wistar ежедневным с 14 по 20 день беременности внутрибрюшинным введением L-нитро-аргинин-метилового эфира в дозе 25 мг/кг. При этом для коррекции нарушения микроциркуляции в плаценте используют на 21 день беременности за 90 минут до регистрации микроциркуляции однократное воспроизведение 10 минутной ишемии задних конечностей, путем пережатия бедренной артерии в верхней трети с последующей реперфузией. Использование заявленного способа позволяет скорректировать нарушения микроциркуляции в плаценте при моделируемой патологии. 1 пр.

ПРИМЕНЕНИЕ 2-АЛКОКСИФЕНИЛ-ЗАМЕЩЕННЫХ ИМИДАЗОТРИАЗИНОВ

... 1. Применение 2-фенил-замещенных имидазотриазинонов общей формулы (I) в которой R1 означает метил или этил, R2 означает этил или пропил, R3 и R4 являются одинаковыми или различными и означают неразветвленную или разветвленную алкильную цепь, имеющую до 5 атомов углерода, которая, при необходимости, до двух раз одинаково или различно замещена гидрокси или метокси, или R3 и R4 вместе с атомом азота образуют кольцо пиперидинила, морфолинила, тиоморфолинила или остаток формулы где R5 означает водород, формил, ацил или алкоксикарбонил, имеющий соответственно до 3 атомов углерода, или неразветвленный или разветвленный алкил, имеющий до 3 атомов углерода, который, при необходимости, от одного до двух раз, одинаково или различно замещен гидрокси, карбоксилом, неразветвленным или разветвленным алкокси или алкоксикарбонилом, имеющим соответственно до 3 атомов углерода, или группами формул -(D)a -NR6R7или -P(O)(OR8)(OR9), где а означает число 0 или 1, D означает группу формулы -СО, R6 и R7 являются ...

АРИЛАНИЛИНОВЫЕ АГОНИСТЫ БЕТА2 АДРЕНЕРГИЧЕСКИХ РЕЦЕПТОРОВ

... 1. Соединение формулы (I) где каждый из R1-R5 независимо выбран из группы, включающей водород, алкил, алкенил, алкинил, арил, гетероарил, циклоалкил, гетероциклил и Ra; или R1 и R2, R2 и R3, R3 и R4 или R4 и R5 объединены вместе с образованием группы, выбранной из группы, включающей -С(Rd)=C(Rd)С(=O)NRd-, -CRdRd-CRdRd-C(=O)NRd-, -NRdC(=O)C(Rd)=C(Rd)-, -NRdC(=O)CRdRd-CRdRd-, -NRdC(=O)S-, -SC(=O)NRd-, -(CRdRd)p-, -S(CRdRd)q-, -(CRdRd)qS-, -S(CRdRd)rO-, -O(CRdRd)rS- и -NHC(Rj)=C(Rk)-; R6 представляет собой водород, алкил или алкокси; R7 представляет собой водород или алкил; R8 представляет собой водород или алкил; или R8 вместе с R9представляет собой -CH2- или -СН2СН2-; R9 независимо выбран из группы, включающей алкил, алкенил, алкинил, арил, гетероарил, циклоалкил, гетероциклил и Ra, или R9вместе с R8 представляет собой -CH2 - или -СН2СН2-; R10 представляет собой водород или алкил; R11, R12 и R13 независимо выбраны из группы, включающей водород, алкил, циклоалкил, алкенил, алкинил, арил, ...

ПРЕДОТВРАЩЕНИЕ ВЫКИДЫША С ПОМОЩЬЮ ИММУНОМОДУЛЯЦИИНЕЭНДОГЕННЫХ ПРОИЗВОДНЫХ ГЕСТАГЕНА

... 1. Способ лечения или предупреждения спонтанного или привычного выкидыша, который включает введение женщине, нуждающейся в таком лечении, эффективного количества по меньшей мере одного неэндогенного гестагенного производного с момента начала овуляции. 2. Способ по п.1, отличающийся тем, что неэндогенное гестагенное производное представляет собой производное, которое не обладает андрогенным действием. 3. Способ по п.2, отличающийся тем, что неэндогенное гестагенное производное выбирают из ряда, включающего дезогестрел; диметистерон; дидрогестерон; этинодиол или диацетат этинодиола; этоногестрел; гестоден; гидроксипрогестерон или капроат гидроксипрогестерона; кетодезогестрел; линестренол; медрогестон; медроксипрогестерон или ацетат медроксипрогестерона; мегестрол или ацетат мегестрола; несторон; номегестрол или ацетат номегестрола; норэтинодрел; норгестимат; норгестриенон; промегестон; хингестанол или ацетат хингестанола и тримегестон. 4. Способ по п.3, отличающийся тем, что неэндогенное ...

СОЛИ ЗАМЕЩЕННЫХ ПРОИЗВОДНЫХ 1,2,3,4-ТЕТРАГИДРОХИНОЛИН-2- КАРБОНОВОЙ КИСЛОТЫ

... 1. Замещенные производные 1,2,3,4-тетрагидрохинолин-2-карбоновой кислоты общей формулы I в виде их физиологически совместимых солей с катионами, соответственно основаниями, необязательно в виде их рацематов, их чистых стереоизомеров, прежде всего энантиомеров или диастереомеров, либо в виде смесей стереоизомеров, прежде всего энантиомеров или диастереомеров, в любом их соотношении в смеси, при этом R1 и R2 совместно являются в каждом случае одно- или многозамещенными либо незамещенными и образуют группу -(СН2)n-, где n обозначает число от 3 до 10, -СН=СН-СН2-, -СН2-СН=СН-, -СН=СН-СН2-СН2-, -СН2-СН2-СН=СН-, -СН2-СН=СН-СН2-, -СН2-СН=СН-СН2-СН2-, -СН2-СН2-СН=СН-СН2-, -СН2-СН2-СН=СН-СН2 -СН2-, -O-СН2-СН2-, -СН2-СН2-O-, -O-СН2-СН2-СН2-, -СН2-СН2-СН2-O-, -СН2-O-СН2-, -СН2-СН2-O-СН2-, -CH2-O-CH2-CH2-, где X обозначает О или S; R3 обозначает Н или С1-С18алкил, С2-С18алкенил либо С2-С18алкинил, каждый из которых является разветвленным или неразветвленным, одно- или многозамещенным либо незамещенным ...

ПРОИЗВОДНЫЕ ПИРАЗОЛА С КОНДЕНСИРОВАННЫМ ЦИКЛОМ

... 1. Соединения общей формулы I или II или где R1 означает -ORa, -NRaRb, -CRcRdRe, CO2Ra или -C(O)NRaRb, водород, галоген, циклоалкенил, арил или гетероарил, где каждый арил или гетероарил незамещен или замещен одним или более заместителями, независимо выбранными из ряда C1-С6алкил, C1 -С6алкокси, C1-С6алкилтио, C1-С6алкилсульфонил, галоген, галогеналкил, циано, нитро, -C(O)NRaRb или -NRa'Rb', где Ra' и Rb' каждый независимо выбирают из группы, включающей водород, С1-С9алкил и С1-С9алкилкарбонил; R2 означает водород, C1-С6алкил, С3-С6циклоалкил, С3-С6циклоалкил(С1-С3)алкил, C1-С6 алкилкарбонил, C1-С6алкилсульфонил, арил или арилалкил, где указанный арил или арилалкил незамещен или замещен одним или более заместителями, независимо выбранными из ряда C1-С6алкил, галогеналкил, C1-С6алкокси и галоген; R3 и R4 каждый независимо выбирают из ряда водород и C1-С6алкил, или R3 и R4вместе с атомом углерода, к которому они присоединены, образуют С3-С6циклоалкильный цикл; Ar означает арил или гетероарил ...

Антагонисты рецептора брадикинина

... 1. Соединение формулы IA где R5А обозначает -XA-R6A или –N(R7A)R8A, где XA обозначает пиперидинилен или пиперазинилен, R6A обозначает Н, С1-С4алкил, С3-С4алкенил, С3-С4алкинил, С1-С4(алкоксиалкил), С1-С4 (карбоксиалкил), С5-С7гетероциклическую группу или фенилС1-С4алкил; R7A обозначает аминоС1-С4алкил или моно- или ди(С1-С5алкил)амино-С2-С5алкил и R8A обозначает Н, Сl-С4алкил или имеет значения, указанные для R7A; X1 обозначает двухвалентную группу формулы IA’ где n = 0 или 1; X3 обозначает СН или N; (а) X4 обозначает прямую связь, R3A и R4A вместе обозначают этилен и m = 2; или (б) X4 обозначает прямую связь, R3A обозначает Н, С1-С4алкил, С3-С6циклоалкил, С3-С6алкенил, С3-С6 алкинил, С7-С10аралкил или С6-C9 гетероаралкил, R4A обозначает Н и m = 1 или 2 или 3; или (в) X4 обозначает -CH(R12 )-, R3A обозначает Н и R4A и R12 вместе обозначают пропилен и m = 1, или этилен и m = 2; X2 обозначает двухвалентную группу формулы IA’’ где X3 обозначает СН или N; R11 обозначает С1-С4алкил, С3-С6циклоалкил ...

ИМИДАЗОЛИЛЬНЫЕ ПРОИЗВОДНЫЕ КАК ИНГИБИТОРЫ КОРТИКОТРОПИН-РИЛИЗИНГ ФАКТОРА

... 1. Соединение Формулы (I) или его фармацевтически приемлемая соль или сольват, где R1 обозначает Н, C1-6 алкил, C1-6 галогеналкил, C1-6алкокси, C1-6тиоалкил, циано, галоген, С3-7циклоалкил, -C1-6алкилен - С3-7циклоалкил, С2-6 алкенил или С3-6 алкинил; R2 обозначает C(D)NR3R4, D’-D’’(R3)R4 или CH2NR3R4 D’ обозначает СН2 или связь; D’’ обозначает С, С-ОН или СН, где указанный С присоединен к R3 ординарной или двойной связью; указанный С присоединен к R4 ординарной или двойной связью; при условии, что С не присоединен двойными связями ни к R3, ни к R4; указанный С присоединен к R3 и к R4 ординарными связями; указанный С группы С-ОН присоединен к R3 и R4 ординарными связями; D обозначает О или S; R3 и R4, каждый, независимо, выбирают из группы, состоящей из Н, C1-6алкила, C1-6галогеналкила, C1-6 гидроксиалкила, -С1-4алкилен-О- С1-4алкила, -С1-3алкилен-С1-6тиоалкила, -С2-6алкилиден-(С1-4алкокси)2, С3-7 циклоалкил, -С1-6алкилен-С3-7циклоалкил, С2-6алкенил, С3-6алкинил, -С1-6алкилен-CN, -C1-6алкиленгетероцикло ...

Aryl or heteroaryl fused imidazole compounds as anti-inflammatory and analgesic agents

2-Adrenergic receptor agonists

Substituted benzenesulfonamide derivatives as prodrugs of cox-2 inhibitors

Spiro-pyrimidine-2,4,6-trione metalloproteinase inhibitors

Phenethanolamine derivatives for treatment of respiratory diseases.

Il-8 receptor antagonists

Phenethanolamine derivatives for treatment of respiratory disease.

Stable liquid formulations of botulinum toxin

(-)cis-6 (S)-phenyl-5-(R) [4 (2-pyrrolidin-1-ylethoxy)phenyl]-5,6,7,8-tetrahydronaphthalen-2-old-tartrate

Pyrazolopyrimidinone cgmp PDE5 inhibitors for the treatment of sexual disfunction

1-Amino triazolo ¬4,3-A¾ quinazoline-5-ones and/or-5-thiones inhibiting phosphodiesterase iv

Pyrazolo[4,3-D] pyrimidine derivatives.

Compounds of formula (I) wherein R1. R2, R4 and R13 are as defined or a pharmaceudcally or veterinarfly acceptable salt or polymorph thereof, or a phannaceutically or veterinarfly acceptable solvate or pro-drug thereof: are potent and selective inhibitors of type 5 cyclic guanosine 3*. 5'-monophosphate pbospbodiesterase (cGMP PDE5) and have utility in the treatment of, inter alia, male erectile dysfunction (MED) and female sexual dysfunction (FSD).

(-) cis-6(s)-phenyl-5 (R) (4-(2-pyrrolidin-1-yl ethoxy)phenyl)-5,6,7,8,- tetrahydronaphthalen-2-ol-d- tartrate.

A method of preparation for the compound (-) cls-S(S)-phenyl-5(R)-[4-(2- pyrrolidin-1-yl ethoxy) phenylj-5,6,7,8-tetrahyaronaphthalen-2-ol D-tartrate which comprises: a) dissolving racemic or partially optically enriched cis-5-phenyi-5-[4-(2- pyrrolidin-1-yl ethoxy) phenyl]-5,6,7,3-tetrahydronaphtrv=ien-2-ol in boiling aqueous ethanol to form a solution; b) adding an equal molar amount of D-tartaric acid dissolved in aqueous ethanol to said solution to form a second solution; c) cooling said second solution; and d) collecting the product formed in step C ...

Substituted 6,6-hetero-bicyclic derivatives.

The invention relates to compounds of the formula i wherein a,b,d,e,k,g,r3 and r5 are as defined in the specification, and to the pharmaceutically acceptable salts of such compounds ...

Substituted 6,5-hetero-bicyclic derivatives.

Abstract: This invention relates to compounds of the formula (1), B wherein the dashed lines represent optional double bonds; A is nitrogen or CR ; B is -NR'R2, -CRW-Q-CR'R'X, -NHCRW0, -OCR'R2R10, -SCR]R2R10, -CR2R10NHR1, -CR^OR1, -CR^^SR1 or -COR2; J and K are each independently nitrogen or carbon and both J and K are not nitrogens: D and E are each selected, independently, from nitrogen, CR4, C=O, C=S, sulfur, oxygen, CR4R6 and NR8, G is nitrogen or carbon; and their use for the prevention or inhibition of a disorder that can be treated by antagonizing CRF.

Stable liquid formulations of botulinum toxin

Spiro-pyrimidine-2,4,6-trione metalloproteinase inhibitors

Pyrazolopyridine cGMP PDE5 inhibitors for the treament of sexual dysfunction.

Compounds of the formulae (IA) and (IB): wherein R1 is Ci to C3 alkyl optionally substituted with phenyl, Het or a N-linked heterocyclic group selected from piperidinyl and morpholinyl; wherein said phenyl group is optionally substituted by one or more substitutents selected from Ci to C4 alkoxy; halo; CN; CF3; OCF3 or Ci to C4 alkyl wherein said Ci to C< alkyl group is optionally substituted by C, to C* haloalkyl or haloalkoxy either of which is substituted by one or more halo atoms; R2 is Ci to C6 alkyl and R1 is OR3 or NR5R5, or pharmaceutically or veterinarily acceptable salts thereof, or pharmaceutically or veterinarily acceptable solvates of either entity are potent and selective inhibitors of type 5 cyclic guanosine 3',5'-monophosphate phosphodiesterase (cGMP PDE5) and have utility in the treatment of, inter alia, male erectile dysfunction (MED) and female sexual dysfunction (FSD).

Il-8 Receptor Antagonists.

Substituted benzenesulfonamide derivatives as products of COX-2 inhibitors.

Prodrugs of COX-2 inhibitors are described as beina useful in treating inflammation and inflammation-related disorders.

Aryl or heteroaryl fused imidazole compounds as anti-inflammatory and analgesic agents.

This invention provides a compound of the formula (i); or the pharmaceutically acceptable salts thereof, wherein y1, y2, y3, and y4 are independently selected from n, ch, etc., r1 is h, c1-8 alkyl, etc., q1 is 5-12 membered monocyclic or bicyclic aromatic ring optonally containing up to 4 heteroatoms selected from o,n and s,etc., a is a 5-6 membered monocyclic aromatic ring optionally containing up to 3 heteroatoms selected from o,n and s,etc.;B is c1-6 alkylene optionally substituted with an oxo group, etc.; w is nh, o, etc.; r2 is h,c1-4 alkyl, etc.; z is a 5-12 membered monocyclic or bicyclic aromatic ring optionally containing up to 3 heteroatoms selected from o,n and s, etc.; l is halo, c1-4 alkyl,,etc.; m is0, 1 or 2; r3 and r4 are independently selected from o,n and s, etc.; l is halo, c1-4 alkyl ; r5 is h, c1-4 alkyl, etc.; q2 is a 5-12 membered monocyclic or bicyclic aromatic ring ortricyclic ring optionally containing up to 3 heteroatoms selected from o, n and s, etc. These compounds ...

Stable liquid formulations of botulinum toxin

Substituted 6,6-hetero bicyclic derivatives

Substituted 6,5-hetero bicyclic derivatives

Heterocyclo-alkylsulfonyl pyrazole derivatives as ant-inflammatory/analgesic agents.

The present invention relates to compounds of formula (i)wherein r2, r3, r6 and a are defined as in the specification, to pharmaceutical compositions containing them and to their medicinal use. The compounds of the invention are useful in the treatment or alleviation of inflamation and other inlamation associated disorders, such as osteoarthritis, rheumatoid arthritis, colon cancer and alzheimers's disease, in mammals (preferably humans, dogs, cats and livestock) ...

Improvements of implantation rates after in vitro fertilization.

A method is provided for the improvement of implantation rates and/or pregnancy rates in a female mammal, comprising administering to a female mammal in whom prganancy is desired an effective amount of: a nitric oxide synthase substrate, a nitric oxide donor, or both, optionally in combination with, (b)a progestin, and, (c)optionally, in further combination with an estrogen. A method is also provided for fertility control for a female mammal, comprising administering to a female mammal in whom pregnancy is not desired and at risk of becoming pregnant an effective amount of nitric oxide synthase inhibitor in combination with an antiprogestin. Pharmaceutical compositions are also provided ...

Pyrazolopyrimidinone cgmp PDE5 inhibitors for the treatment of sexual disfunction

(-)cis-6 (S)-phenyl-5-(R) [4 (2-pyrrolidin-1-ylethoxy)phenyl]-5,6,7,8-tetrahydronaphthalen-2-old-tartrate

2-Adrenergic receptor agonists

1-amino triazolo[4,3-A] quinazoline-5-ones and/or-5-thiones inhibiting phosphodiesterase IV.

The invention relates to triazolo [4,3-a]quinazoline-5-ones and /or 5-thiones of formaula (i)or (ii), whereby (i)and (ii)are position isomers of group r on nitrogen 3 or 4. Optionally, the invention also relates to the racemic forms, isomers and pharmaceutically acceptable salts threof. The invention further relates to a method for the production thereof and to compositions containing said derivatives. The compounds act as inhibitors of phosphodiesterase iv (pde-4) ...

Substituted benzenesulfonamide derivatives as prodrugs of cox-2 inhibitors

Intraorally disintergrating valdecoxib compositions prepared by spray drying process

Orally disintergrating valdecoxib fast-melt tablets and processes for preparing such dosage forms are provided. The compositions are useful in treatment or prophylaxis of cycloosygenase-2 mediated conditions and disorders.

Pyrazolo '4,3-d pyrimidine derivatives

Spiro-pyrimidine-2,4,6-Trione Metalloproteinase inhibitors

The present invention relates to 5-spiro-pyrimidine-2,4,6-trione metalloproteinase inhibitors of the formula wherein said "A" is a 5-7 membered heterocyclic ring as defined in the specification and to pharmaceutical compositions and methods of treating inflamation, cancer and other disorders.

EP4 receptor inhibitors to treat rheumatoid arthritis.

The invention features a method of treating rheumatoid arthritis in a mammal comprising administering an agent that inhibits prostaglandin ep4 receptor (EP4) activity. Also featured is a method of identifying agents that selectively inhibit EP4 activity in vivo.

IL-8 RECEPTOR ANTAGONISTS

This invention relates to the novel use of dianilino squarates in the treatment of disease states mediated by the chemokine, Interleukin-8 (IL-8) ...

Il-8 receptor antagonists

Phenethanolamine derivatives for treatment of respiratory disease.

Aryl or heteroaryl fused imidazole compounds as anti-inflammatory and analgesic agents

1-Amino triazolo ¬4,3-A¾ quinazoline-5-ones and/or-5-thiones inhibiting phosphodiesterase iv

b2- Adrenergic receptor agonists.

Phenethanolamine derivatives for treatment of respiratory diseases

Substituted 6,6-hetero-bicyclic derivatives

Pyrazolo Ä4,3-DÜpyrimidine derivatives.

Substituted 6,5-hetero-bicyclic derivatives

(-)Cis-6(s)-phenil-5(r)-Ä4-(2-pyrrolidin-1-ylethoxy)phenylÜ-5,6,7,8-tetrahydronaphthalen-2-ol d-tartrade

Ep-4 receptor inhibitors to treat rheumatoid arthritis.

1-Amino triazolo Ä4,3-aÜquinazoline-5-ones et/ou- 5-thiones inhibitrices de phosphodiesterases IV.

IL-8 Receptor antagonists.

Heterocyclo-alkylsulfonyl pyrazole derivatives as anti-inflammatory/analgesic agents.

Intraorally disintegrating valdecoxib compositionsprepared by spray drying process.

Aryl or heteroaryl fused imidazole compounds as anti-inflammatory and analgesic agents.

IL-8 receptor antagonist.

Pharmaceutical composition based on micronized progesterone, preparaion method and uses thereof.

Pyrazolopyrimidinone cGMP PDE5 inhibitors for the treatment of sexual dysfunction.

Substituted benzenesulfonamide derivatives as prodrugs of cox-2 inhibitors

Beta 2-adrenergic receptor agonists.

Spiro-pyrimidine-2,4,6-trione metalloproteinase inhibitors.

Hetrocyclo-alkylsulfonyl pyrazole derivatives as anti-inflamatory/analgesic agents

Pyrazolo '4,3-d pyrimidine derivatives

Substituted 6,5-hetero bicyclic derivatives

2-Adrenergic receptor agonists

3Ep4 receptor inhibitors to treat rheumatoid arthritis

Substituted 6,6-hetero bicyclic derivatives

Intraorally disintergrating valdecoxib compositions prepared by spray drying process.

Hetrocyclo-alkylsulfonyl pyrazole derivatives as anti-inflamatory/analgesic agents

Pyrazolo '4,3-d pyrimidine derivatives

Il-8 receptor antagonists

3Ep4 receptor inhibitors to treat rheumatoid arthritis

Improvements of implantation rates after in vitro fertilization

Il-8 receptor antagonists

Intraorally disintergrating valdecoxib compositions prepared by spray drying process.

Il-8 receptor antagonists

Phenethanolamine derivatives for treatment of respiratory disease.

Stable liquid formulations of botulinum toxin

Bone-like prosthetic implants

A prosthetic implant comprising a biocompatible three-dimensional scaffold and at least two cell types selected from the group consisting of osteoblasts, osteoclasts, and endothelial cells or progenitors thereof.

Estrogen receptors and methods of use

The present invention provides isolated polypeptides having an amino acid sequence having at least 70% identity to SEQ ID NO:20, wherein the polypeptide has ER-α36 activity. The invention further provides methods for identifying agents that bind to such polypeptides, methods for detecting such polypeptides, and methods for altering the activity of such polypeptides. Also provided are antibodies that specifically bind to an amino acid sequence depicted at SEQ ID NO:1, or an immunogenic fragment thereof, and methods for making and using such antibodies.

Diastereoisomers of hypophosphorous acid derivatives

The invention relates to the diastereoisomers of hypophosphorous acid derivatives, having formula (I), wherein the phenyl group is substituted by one or several atoms or groups, occupying one or several positions on the phenyl ring, and a method for the separation thereof.

Thermosensitive hydrogel composition and method

A hydrogel-forming composition is provided that comprises an extracellular matrix protein, hyaluronic acid, and a thermosensitive biocompatible polymer such as methylcellulose. The hydrogels can provide a therapeutic effect; further, the hydrogels may comprise an optional therapeutic agent such as cells or a pharmaceutical composition. The composition may be injected to an area in need of treatment by the therapeutic agent. The composition may form a gel at about 37° C., such that the gel maintains the therapeutic agent in the area of the body in need of such treatment.

Method of preparing lipid nanoparticles

The present invention relates to a useful method for preparing nanocapsules having a liquid lipid core and a solid shell and charged with at least one active agent having a hydrophilic character, said method comprising at least the steps consisting in: i) providing at least a first microemulsion having a water-in-oil character, stabilized by at least one lipophilic surfactant and containing in its hydrophilic phase at least one active agent having a hydrophilic character, providing at least a second microemulsion, separate from the first microemulsion, formulated by phase inversion of an emulsion and stabilized by at least one heat-sensitive, nonionic hydrophilic surfactant; iii) adding said first microemulsion to said second microemulsion under conditions propitious for the formation of a novel microemulsion architecture in which said hydrophilic active agent remains present in the hydrophilic phase of the first microemulsion; and iv) chill-hardening the mixture formed in the previous step, so as to obtain nanocapsules comprising said hydrophilic active agent and being formed from a lipid core, which is liquid at room temperature, and encapsulated in a film which is solid at room temperature. Further, the invention relates to nanocapsules which are able to be obtained by said method.

Whitefly Ecdysone Receptor Nucleic Acids, Polypeptides, and Uses Thereof

The present invention relates to a novel isolated whitefly ecdysone receptor polypeptide. The invention also relates to an isolated nucleic acid encoding the whitefly ecdysone receptor polypeptide, to vectors comprising them and to their uses, in particular in methods for modulating gene expression in an ecdysone receptor-based gene expression modulation system and methods for identifying molecules that modulate whitefly ecdysone receptor activity.

Dentifrice composition and method of use

An exfoliating dentifrice composition is described that contains a plurality of granules and an orally acceptable vehicle. The granules include at least one polymeric binding agent. The composition includes at least one abrasive agent having an average particle diameter of 0.01 mm to 4 mm. Also included are methods of exfoliating an oral cavity soft tissue by use of the composition.

Composition and a method for producing contrast agent using the composition

A composition including a hydrophilic dye having a sulfonate group and a hydrophobic solvent, wherein the composition includes at least one of a nicotinic acid derivative and a tiamine derivative, can form densely accumulated particles and the like since the composition includes a hydrophilic dye that is likely to dissolve in a hydrophobic solvent.

Anesthesia reversal methods and systems

An apparatus for reversing inhaled anesthesia, which may be configured to be positioned along a breathing circuit or anesthesia delivery circuit, includes an anesthesia removal component and a blood flow acceleration component. The blood flow acceleration component facilitates an increase in the ventilation of the individual without resulting in a significant decrease in the individual's P a CO 2 level and, thus, a decrease in the rate at which blood flows through the individual's brain. A method of reversing the effects of inhaled anesthesia includes increasing the rate of ventilation of an anesthetized individual while causing the individual to inhale gases with at least atmospheric amounts of CO 2 .

siRNA Targeting Apolipoprotein B (APOB)

Efficient sequence specific gene silencing is possible through the use of siRNA technology. By selecting particular siRNAs by rational design, one can maximize the generation of an effective gene silencing reagent, as well as methods for silencing genes. Methods, compositions, and kits generated through rational design of siRNAs are disclosed including those directed to nucleotide sequences for APOB.

Novel cellular factor-containing solution compositions

The invention is directed to novel cellular factor-containing solution compositions (referred to herein as “CFS” compositions), including novel sustained-release cellular factor-containing solution compositions (referred to herein as “SR-CFS” compositions), methods of making such novel compositions and uses thereof.

Amphoteric liposomal compositions for cellular delivery of small rna molecules for use in rna interference

The present invention provides method and pharmaceutical composition for efficient delivery of siRNA (small interfering ribonucleic acids) into cultured mammalian cells. In addition, the present invention provides methods and compositions for knocking down the expression of a specific target gene by treating cells with the formulations comprising cationic amphiphile, a neutral colipid and a small RNA molecule. We demonstrate that our method delivers siRNA efficaciously into animal cells for the purpose of RNA interference. The area of medical science that is likely to benefit most from the present invention is RNAi therapeutics.

Anti bone-loss and anti attachment-loss effects of an oral composition

Methods for identifying compounds useful for treating diseases and conditions of the oral cavity are described herein.

Method of preparing pluripotent stem cells

The invention relates to biotechnology, and particularly to the preparation of pluripotent stem cells. The method involves introduction into umbilical cord and placental stem cells of RNA with at least one sequence which ensures the transition of cells to the pluripotent state. The method enables to effectively prepare pluripotent stem cells from the cells of mammalian placenta and umbilical cord which have not yet acquired somatic mutations, which reduces the risk of oncogenesis and other adverse effects of reprogramming.

Targeted integration into the ppp1r12c locus

Disclosed herein are methods and compositions for targeted integration of an exogenous sequence into the human PPP1R12C locus, for example, for expression of a polypeptide of interest.

Chemical method for sexual sterilization and libido elimination in male mammals

A chemical method for sexual sterilisation and libido suppression in male mammals is indicated to achieve the biological sterilisation of male mammals such as bovines, sheep, goats, equines, swine, dogs, cats and humans. The invention consists in a sterile aqueous solution containing an active sclerosing principle (lactic acid) and an enzyme (papain). The enzyme causes digestion of testicle tissue, intensifying the acid's necrosing effect and causing it to act faster and more efficiently. The association of these two active principles provokes an acute inflammatory reaction with a quick resolution characterised by fibrosing of the organ. This effect leads to the loss of the gametogenic and androgenic functions, and causes sterility and libido suppression, respectively. The biological sterilisation process can be easily carried out and does not require additional treatments, requiring less handling of the animals, with less stress and increased weight gain. The process is not painful either during or after administration, owing to the lesion of the testicle nerve endings at the moment of application, and to the fact that the greatest number of sensitive structures is located in the scrotal sac. The meat of thus treated cattle does not require for consumption a waiting period between application and slaughter, since the biological active principles can be easily metabolised by the animal organism. This method has already been successfully used in more than 3,000 animals, and is the only method available today in which naturally available biological active principles are used.

Zona pellucida binding peptides, expression vectors, compositions, and methods for species-specific immunocontraception of animals

Disclosed are methods, compositions, zona pellucida binding peptides and polypeptides, and expression vectors for use in species-specific immunocontraception of animals. The disclosed compositions may include immunogenic compositions or vaccines.

Mass spectrometric quantitation assay for metabolites of leflunomide

Methods are described for determining the amount of metabolites of leflunomide in a sample. More specifically, mass spectrometric methods are described for detecting and quantifying teriflunomide in a sample.

Polypeptides of Botryosphaeria Rhodina

The invention relates to functional polypeptides secreted from Botryospaeria rhodina CBS 274.96.

Cyanocobalamin low viscosity aqueous formulations for intranasal delivery

A stable pharmaceutical mercury-free aqueous solution of cyanocobalamin comprised of cyanocobalamin and water wherein said solution of cyanocobalamin is suitable for intranasal administration, has a viscosity less than about 1000 cPs, and wherein said solution of cyanocobalamin has a bioavailability of cyanocobalamin when administered intranasally of at least about 7% relative to an intramuscular injection of cyanocobalamin with the proviso that the solution is essentially free of mercury and mercury-containing compounds. The present invention is also directed towards a method for elevating the vitamin B12 levels in the cerebral spinal fluid (CSF) comprising administering, intranasally a sufficient amount of a mercury-free cyanocobalamin solution so as to increase the average ratio of vitamin B12 in the CSF to that in the blood serum (B12 CSF/B12 Serum×100) to at least about 1.1 comprising intranasally administering an aqueous solution of a cyanocobalamin, wherein said solution of cyanocobalamin has a bioavailability of at least 7% relative to an intramuscular injection of a cyanocobalamin.

Stable non-aqueous single phase viscous vehicles and formulations utilizing such vehicles

This invention relates to stable non-aqueous single phase viscous vehicles and to formulations utilizing such vehicles. The formulations comprise at least one beneficial agent uniformly suspended in the vehicle. The formulation is capable of being stored at temperatures ranging from cold to body temperature for long periods of time. The formulations are capable of being uniformly delivered from drug delivery systems at an exit shear rate of between about 1 to 1×10 −7 reciprocal second.

Generating induced pluripotent stem cells and progenitor cells from fibroblasts

The present disclosure provides a method of generating progenitor cells, such as hematopoietic or neural progenitor cells, from fibroblasts, such as dermal fibroblasts, comprising providing fibroblasts that express or are treated with a POU domain containing gene or protein and culturing the cells under conditions that allow production of progenitor cells, without traversing the pluripotent state. Also provided is a method of isolating a subpopulation of fibroblasts with reprogramming potential comprising providing fibroblasts that express an Oct-4-reporter and isolating cells that are positive for the reporter. Further provided is a method of generating reprogrammed fibroblast-derived induced pluripotent stem cells. Also provided are uses and assays of the cells produced by the methods of the disclosure.

Novel Cellular Factor-Containing Solution Compositions

The invention is directed to novel cellular factor-containing solution compositions (referred to herein as “CFS” compositions), including novel sustained-release cellular factor-containing solution compositions (referred to herein as “SR-CFS” compositions), methods of making such novel compositions and uses thereof.

Mammalian-type glycosylation in plants

The invention relates to the field of glycoprotein processing in transgenic plants used as cost efficient and contamination safe factories for the production of recombinant biopharmaceutical proteins or pharmaceutical compositions comprising these. The invention provides a plant comprising a functional mammalian enzyme providing N-glycan biosynthesis that is normally not present in plants, said plant additionally comprising at least a second mammalian protein or functional fragment thereof that is normally not present in plants.

Process for the preparation of drospirenone

A process is described for the preparation of drospirenone, a synthetic steroid with progestogenic, antimineralocorticoid and antiandrogenic activity, useful for preparing pharmaceutical compositions with contraceptive action; comprising the oxidation of 17α-(3-hydroxypropyl)-6β,7β,15β,16β-dimethylene-5β-androstane-3β,5,17β-triol.

Use of thiazolidinediones for the partial inhibition of androgen binding to aromatase

A method for the treatment or prophylaxis of a disorder, wherein the disorder is affected by estrogen, comprising partially inhibiting aromatase activity or interfering with the binding of androgen to aromatase by administering a therapeutically effective amount of a thiazolidinedione to the patient. The use of rosiglitazone or pioglitazone to partially inhibit the binding of androgen to aromatase by at least 20% is preferred.

siRNA Targeting Apoliprotein (APOB)

Efficient sequence specific gene silencing is possible through the use of siRNA technology. By selecting particular siRNAs by rational design, one can maximize the generation of an effective gene silencing reagent, as well as methods for silencing genes. Methods, compositions, and kits generated through rational design of siRNAs are disclosed including those directed to nucleotide sequences for APOB.

Cell surface coating with hyaluronic acid oligomer derivative

A method of localising reproduction assisting hyaluronic acid to reproductive cell surfaces by covalently linking it to lipids is disclosed.

Modified bovine somatotropin polypeptides and their uses

Modified bovine somatotropin polypeptides and uses thereof are provided.

Combinations of trospium and salivary stimulants for the treatment of overactive bladder

Disclosed herein are pharmaceutical compositions comprising a therapeutically effective amount of immediate release trospium, or a pharmaceutically acceptable salt thereof, and a therapeutically effective amount of pilocarpine, or a pharmaceutically acceptable salt thereof. Also disclosed herein are methods of treating a patient suffering from overactive bladder, the method comprising identifying a patient in need thereof, and administering to the patient a therapeutically effective amount of immediate release trospium, or a pharmaceutically acceptable salt thereof, and a therapeutically effective amount of pilocarpine, or a pharmaceutically acceptable salt thereof. Also disclosed herein are methods of alleviating a side effect of treatment for overactive bladder in a patient suffering therefrom, the method comprising identifying a patient in need thereof, and administering to the patient a therapeutically effective amount of immediate release trospium, or a pharmaceutically acceptable salt thereof, and a therapeutically effective amount of pilocarpine, or a pharmaceutically acceptable salt thereof.

Methods for reducing oxidative stress in a cell with a sulfhydryl protected glutathione prodrug

The present invention relates to compositions and methods for reducing oxidative stress in a cell, increasing glutathione levels in a cell, increasing L-cysteine levels in a cell and reducing hepatocytotoxicity by contacting a cell with a sulfhydryl protected glutathione prodrug or a sulfhydryl protected cysteine prodrug.

Polymeric reagents comprising a terminal vinylic group and conjugates formed therefrom

The present invention provides conjugates having a degradable linkage and polymeric reagents useful in preparing such conjugates. Methods of making polymeric reagents and conjugates, as well as methods for administering conjugates and compositions, are also provided.

Anti-Rhesus D Recombinant Polyclonal Antibody and Methods of Manufacture

The invention relates to a method for manufacturing an anti-RhD recombinant polyclonal antibody composition (anti-RhD rpAb). The method comprises obtaining a collection of cells transfected with a library of anti-RhD antibody expression vectors, wherein each cell in the collection is capable of expressing from a VH and VL comprising nucleic acid segment, one member of the library, which encodes a distinct member of anti-RhD recombinant polyclonal antibody composition and is located at the same site in the genome of individual cells in said collection. The cells are cultured under suitable conditions for expression of the recombinant polyclonal antibody, which is obtained from the cells or culture supernatant. Nucleic acid segments encoding the anti-RhD rpAb are introduced into the cells by transfection with a library of vectors for site-specific integration. The method is suitable for manufacturing anti-RhD rpAb, thereby making available a superior replacement of plasma-derived prophylactic and therapeutic immunoglobulin products.

Method for obtaining biologically active recombinant human g-csf

Provided is a method of obtaining biologically active recombinant human G-CSF from inclusion bodies, wherein the solubilization and refolding process can be performed at ambient temperature and the purification step comprises reversed phase chromatography (RP), in particular RP-HPLC. The G-CSF preparation so obtained is characterized by high purity and homogeneity.

Orally administered agent and an orally administered agent/supporting substrate complex

With an object of providing an orally administered agent (in particular a film-shaped orally administered agent) with which the ease and safety of taking the agent are improved, to attain this object, in an orally administered agent 1 b having one drug-containing layer 11 and two water-swellable gel-forming layers 12, the water-swellable gel-forming layers 12 are provided, either directly or via intermediate layers, on the both faces of the drug-containing layer 11.

Mitochondrial enhancement of cells

Certain embodiments disclosed herein include, but are not limited to, at least one of compositions, methods, devices, systems, kits, or products regarding rejuvenation or preservation of stem cells. Certain embodiments disclosed herein include, but are not limited to, methods of modifying stem cells, or methods of administering modified stem cells to at least one biological tissue.

Transient immortalization

The invention relates to a method for transiently immortalizing cells according to which immortalization proteins are introduced into the cells from outside. The invention also relates to a method for producing cells according to which organ-related cells are transiently immortalized by the exogenous supply of immortalization proteins and are remortalized after their expansion. The invention further relates to the cells produced according to the inventive method, to the use of said cells for producing a transplant and to the immortalization proteins used in the method.

Novel Cytokine Containing Compositions

The invention is directed to novel cellular factor-containing solution compositions (referred to herein as “CFS” compositions), including novel sustained-release cellular factor-containing solution compositions (referred to herein as “SR-CFS” compositions), methods of making such novel compositions and uses thereof.

Methods and apparatus for determining formulation orientation of multi-layered pharmaceutical dosage forms

Rapid and accurate determination of the formulation orientation of multi-layer capsule-shaped tablets with respect to different internal formulation layers proximate to the opposite narrow and rounded ends of the tablets is required. By including an appropriate color scheme in multi-layer osmotic tablets, detection of the formulation orientation is achieved by detecting the color at a spot location on a side of the tablet corresponding to one or another formulation layer or to one or another interface of two formulation layers depending on the formulation orientation of the tablet.

Induced pluripotent stem cells produced with oct3/4, klf and sox

The present invention relates to a nuclear reprogramming factor having an action of reprogramming a differentiated somatic cell to derive an induced pluripotent stem (iPS) cell. The present invention also relates to the aforementioned iPS cells, methods of generating and maintaining iPS cells, and methods of using iPS cells, including screening and testing methods as well as methods of stem cell therapy. The present invention also relates to somatic cells derived by inducing differentiation of the aforementioned iPS cells.

Novel methods for the preparation of p2x7r antagonists

Disclosed are novel methods for the synthesis of N-substituted indol-3-yl-alkylamide compounds which act as P2X7R antagonists, said methods involving the rearrangement of an oxime intermediate.

Pharmaceutical formulations

The present invention provides a pharmaceutical dosage form in the form of a tablet comprising: (a) a compressed inert core, (b) an optional subcoat over the compressed inert core, (c) a drug layer over the compressed core (a) or optional subcoat (b) comprising a drug having a water solubility at 25° C. of about 100 mg/l or less, a coating polymer and optionally a surfactant, and (d) optionally one or more layers coating the drug layer. The present invention also provides a process of making the same.

Compositions and methods for platelet enriched fibrin constructs

Compositions and methods are provided for tissue constructs that promote wound healing. The composition comprises a dimensionally stable fibrin construct for local administration to a wound site or region. In one embodiment, the fibrin construct is a wound healing composition, including components that promote wound healing, such as platelets, growth factors, white blood cells and fibrin clots. In another embodiment, the tissue treatment composition includes (i) aggregated fibrin, (ii) blood cells, and (iii) optionally, growth factors and/or other proteins.

Method For Restoring Alveolar Bone Via Transplant of a Regenerated Tooth Unit

The object of the present invention is to provide a method for restoring the alveolar bone of a mammal with a missing tooth. The present invention provides a method for restoring the alveolar bone in a mammal with a missing tooth comprising a step of transplanting a regenerated tooth unit to the said missing site. The regenerated tooth unit is characterized in that it has a periodontal tissue portion in addition to a tooth crown portion.

Bioassay for gene silencing constructs

The invention provides constructs and methods of screening for constructs useful in conferring resistance in plants to pests by gene silencing. The invention also provides pest-resistant plants transformed with the present constructs. One screening method of the invention comprises the steps of: selecting at least one pest target nucleotide sequence, producing a plurality of dsRNA test agents that target the pest target nucleotide sequence, testing and scoring the plurality of dsRNA test agents for toxicity to the pest, and producing a silencing construct based on a superior-scoring test agent.

Human Stem Cell Materials and Methods

Monocyte derived adult stem cells (MDSCs) isolated from peripheral blood of mammals is provided, along with pharmaceutical compositions containing an MDSC, kits containing a pharmaceutical composition, and methods of preparing, propagating and using MDSCs or differentiated derivatives thereof The uses of these biological materials include methods of treating disorders or diseases, as well as methods of ameliorating a symptom associated with any such disorder or disease.

Peptide having cell membrane penetrating activity

Provided are transmembrane complexes that contain a protein transduction domain (PTD) from the N-terminus of IgE-dependent histamine-releasing factor (HRF) and a target substance that is to be delivered into a cell. Also provided are nucleic acid molecules encoding the transmembrane complex, and methods of delivering the target substance into a cell interior by contacting the transmembrane complex with a cell. Also provided are transfection kits containing the PTD and the target substance.

Natural combination hormone replacement formulations and therapies

Estrogen and progesterone replacement therapies are provided herein. Among others, the following formulations are provided herein: solubilized estradiol without progesterone; micronized progesterone without estradiol; micronized progesterone with partially solubilized progesterone; solubilized estradiol with micronized progesterone; solubilized estradiol with micronized progesterone in combination with partially solubilized progesterone; and solubilized estradiol with solubilized progesterone.

Substituted 16,17-annellated steroid compounds for use in womens health

The present invention relates to substituted steroid compounds having the formula Wherein R 1 is H or halogen; R 2 is H, (1C-4C)alkyl, (1C-4C)acyl, glucuronyl or sulfamoyl; R 3 is H or halogen; R 4 is H, (1C-4C)alkyl, (2C-4C)alkenyl or (2C-4C)alkynyl; R 5 is methyl or ethyl; R 6 is H or methyl; R 7 is H or methyl; R 8 is H or acyl for use in the treatment and prevention of endometriosis, for contraception, for hormonal therapy in perimenopausal and post-menopausal women, for the treatment of osteoporosis and for the treatment uterine fibroids and other menstrual-related disorders, such as dysfunctional uterine bleeding.

Hsp70 fusion protein conjugates and uses thereof

The present invention relates to novel therapies that utilize HSP70 fusion proteins for the treatment of disorders or conditions regulated by HSP70.

ENHANCEMENT OF siRNA SILENCING ACTIVITY USING UNIVERSAL BASES OR MISMATCHES IN THE SENSE STRAND

One aspect of the present invention relates to a double stranded nucleic acid useful as an siRNA, that has a sense strand and an antisense strand relative to a target nucleic acid, where the sense strand contains one or more modified nucleobases, or one or more mismatch base pairings with the antisense strand. Another aspect of the present invention relates to a single-stranded oligonucleotide comprising at least one nucleoside comprising a non-natural nucleobase. Another aspect of the invention relates to a method of gene silencing, comprising administering to a mammal in need thereof a therapeutically effective amount of a double-stranded oligonucleotides containing a sense strand and an antisense strand, where the sense strand contains one or more modified nucleobases, or one or more mismatch base pairings with the antisense strand.

Expansion Of Stem/Progenitor Cells By Inhibition Of Enzymatic Reactions Catalyzed By The Sir2 Family Of Enzymes

Provided are ex vivo and in vivo methods of expanding renewable stem cells using agents capable of down-regulating Sir2 protein activity and/or expression, expanded populations of renewable stem cells, and uses thereof.

siRNA Targeting Myeloid Differentiation Primary Response Gene (88) (MYD88)

Efficient sequence specific gene silencing is possible through the use of siRNA technology. By selecting particular siRNAs by rational design, one can maximize the generation of an effective gene silencing reagent, as well as methods for silencing genes. Methods, compositions, and kits generated through rational design of siRNAs are disclosed including those directed to nucleotide sequences for MYD88.

Functionalized Water-Soluble Polyphosphazenes and Uses Thereof as Modifiers of Biological Agents

A polyphosphazene polymer which includes hydrophilic side groups and interacting side groups which are capable of bonding with a biological agent of interest. The bonding may be by non-covalent bonding.

Method of determining risk of scoliosis

A method for determining the risk for developing a scoliosis comprising monitoring osteopontin (OPN) expression in a sample from a subject over time; wherein an OPN expression that increases in the subject sample over time is indicative that the subject is at risk for developing a scoliosis.

Polypeptides Having Phytase Activity and Polynucleotides Encoding Same

The present invention relates to polypeptides having phytase activity. These polypeptides have an amino acid sequence which has at least 70% identity to either of three phytases derived from the bacterium Buttiauxella , and which comprises at least one of the following amino acids at the position indicated: 119N, 120L, and/or 121E. These phytases have an improved specific activity. Additional specific amino acid substitutions are also disclosed which characterize and distinguish additional phytases of the invention having improved properties such as temperature and/or pH stability, pH activity profile, temperature activity profile, substrate profile, improved performance in animal feed in vitro or in vivo. The invention also relates to isolated polynucleotides encoding the polypeptides, nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

Low flush niacin formulation

The invention relates to an extended-release matrix formulation capable of being directly compressed into tablets comprising niacin, a release-retarding agent, and other excipients. The resulting tablets of the invention demonstrate favorable release characteristics and a reduction in the severity, duration and incidences of cutaneous flushing commonly associated with niacin treatment.

Method for making homogeneous spray-dried solid amorphous drug dispersions utilizing modified spray-drying apparatus

Conventional spray-drying methods are improved by incorporation of a pressure nozzle and a diffuser plate to improve the flow of drying gas and a drying chamber extension to increase drying time, such improvements leading to the formation of homogeneous solid dispersions of drugs in concentration-enhancing polymers.

Stem cell packaging and shipping

This invention concerns methods of packaging and shipping stem cells. Also disclosed are related package products.

Process for delivering encapsulated neutral bioimaging molecules, complex, and process thereof

The present disclosure relates to delivering neutral bioimaging molecules encapsulated within icosahedral DNA capsules in vivo and in vitro. The present disclosure also discloses the entrapment of neutral bioimaging molecules like FITC dextran within the cavity of a DNA polyhedron without any molecular recognition or chemical conjugation between host (DNA icosahedron) and cargo (like FITC Dextran). This DNA polyhedron is structurally well defined and shows high encapsulation efficiency. The present disclosure also relates to complex formed due to the encapsulation of neutral bioimaging agents within icosahedral DNA capsules.

OPTIMIZED Fc VARIANTS

The present invention relates to Fc variants having decreased affinity for FcγRIIb, methods for their generation, Fc polypeptides comprising optimized Fc variants, and methods for using optimized Fc variants.

Maternal sialic acid supplementation

The invention provides methods and compositions for improving fetal and child health and development through nutritional supplementation with, for example, sialic acid. Sialic acid can be provided to a female before, during and/or after pregnancy to improve the health and development of a fetus and/or child. The sialic acid can be in a variety of forms in the supplements.

Outer layer having entanglement of hydrophobic polymer host and hydrophilic polymer guest

An outer layer having an entanglement comprising an intermingling of cloaked hydrophilic guest and a hydrophobic polymer host, wherein molecules of the guest have been crosslinked with each other. Under certain circumstances, using complexes of the guest may be desirable or even necessary. The intermingling of the guest and host includes a physical tangling, whether it also comprises crosslinking by primary bonding (e.g., chemical/covalent bonding) there-between. Also a method of producing an outer layer having such an entanglement, including the steps of: temporarily cloaking at least a portion of the hydrophilic groups of the guest; intermingling at least a portion of the cloaked groups with a porous polymeric structure by diffusing the guest with cloaked groups into at least a portion of the structure's pores; within the pores, crosslinking at least a portion of the molecules of the guest with the guest; and removing the cloaking. Cloaking may be performed by silylation or acylation. Intermingling may be performed by producing a mixture of guest and host (whether in solution, powdered, granular, etc., form); next, a crosslinking of the guest with itself is performed; then, the mixture is molded into the outer layer.

Aromatic-cationic peptides and uses of same

The present disclosure provides aromatic-cationic peptide compositions and methods of using the same. The methods comprise use of the peptides in electron transport and electrical conductance.

Natural combination hormone replacement formulations and therapies

Estrogen and progesterone replacement therapies are provided herein. Among others, the following formulations are provided herein: solubilized estradiol without progesterone; micronized progesterone without estradiol; micronized progesterone with partially solubilized progesterone; solubilized estradiol with micronized progesterone; solubilized estradiol with micronized progesterone in combination with partially solubilized progesterone; and solubilized estradiol with solubilized progesterone.

Natural combination hormone replacement formulations and therapies

Estrogen and progesterone replacement therapies are provided herein. Among others, the following formulations are provided herein: solubilized estradiol without progesterone; micronized progesterone without estradiol; micronized progesterone with partially solubilized progesterone; solubilized estradiol with micronized progesterone; solubilized estradiol with micronized progesterone in combination with partially solubilized progesterone; and solubilized estradiol with solubilized progesterone.

ALCOHOL-BASED COMPOSITIONS AND USES THEREOF

This disclosure relates to a method of reducing a fat deposit comprising injecting an alcohol-containing pharmaceutical composition into the fat deposit. The method may be effective in improving the appearance of or reducing the weight or volume of the fat deposit. 1. A method of reducing a fat deposit comprising injecting a pharmaceutical composition into the fat deposit , wherein the pharmaceutical composition comprises an alcohol , wherein the method is effective in reducing the weight or volume of the fat deposit.2. The method of claim 1 , wherein the alcohol is polidocanol.3. The method of claim 1 , wherein the alcohol comprises ethanol.4. The method of claim 3 , wherein the pharmaceutical composition further comprises polidocanol.5. The method of claim 1 , further comprising a steroid.6. The method of claim 1 , further comprising a bile salt.7. The method of claim 1 , further comprising a detergent.8. The method of claim 1 , further comprising a dermal filler.9. The method of claim 1 , further comprising a neurotoxin.10. The method of claim 1 , wherein the fat deposit is a lipoma.11. The method of claim 1 , wherein the fat deposit is cellulite.12. The method of claim 1 , wherein the fat deposit is on a human head.13. The method of claim 1 , wherein the fat deposit is on a human neck.14. The method of claim 1 , wherein the fat deposit is on a human torso.15. The method of claim 1 , wherein the fat deposit is on a human buttock.16. The method of claim 1 , wherein the fat deposit is on a human leg.17. The method of claim 1 , wherein the fat deposit is on a human foot.18. The method of claim 1 , wherein the fat deposit is on a human arm.19. The method of claim 1 , wherein the fat deposit is on a human hand.20. The method of claim 1 , wherein on a single day claim 1 , about 1 mg to about 20 mg of the pharmaceutical composition claim 1 , per cmof fat deposit claim 1 , is injected into the fat deposit. This application is a continuation in part of U.S. patent ...

ALPHA-AMINO ESTERS OF HYDROXYPROPYLTHIAZOLIDINE CARBOXAMIDE DERIVATIVE AND SALT FORM, CRYSTAL POLYMORPH THEREOF

The invention provides pharmaceutical compositions comprising a compound of formula (I) or (II) and an additional therapeutic agent Also provided is the HCI salt and crystalline form of the compound of formula (I). The compounds inhibit the prostaglandin F receptor (PGF2alpha) and thus useful in the treatment of disorders such as preterm labor at the early gestational stage. 3. The pharmaceutical composition of or , wherein said additional therapeutic agent is an additional tocolytic agent.4. The pharmaceutical composition of any one of - , wherein said pharmaceutical composition comprises one or more excipients.5. The pharmaceutical composition of any one of - , wherein said compound has a purity of at least 90% , 91% , 92% , 93% , 94% , 95% , 96% , 97% , 98% , 99% , or 99.9%.6. The pharmaceutical composition of claim 5 , wherein said purity is ascertained by high pressure liquid chromatography (HPLC).7. The pharmaceutical composition of claim 5 , wherein said purity is ascertained by NMR spectroscopy.8. The pharmaceutical composition of any one of - claim 5 , wherein said compound or pharmaceutical composition is formulated for oral administration to a subject.9. The pharmaceutical composition of any one of - claim 5 , wherein said compound or pharmaceutical composition is a tablet claim 5 , capsule claim 5 , gel cap claim 5 , powder claim 5 , liquid solution claim 5 , or liquid suspension.10. The pharmaceutical composition of any one of - claim 5 , wherein said compound or pharmaceutical composition is formulated for intravenous administration to a subject.11. The pharmaceutical composition of any one of - claim 5 , wherein said pharmaceutical composition comprises an oxytocin receptor antagonist.12. The pharmaceutical composition of claim 11 , wherein said oxytocin receptor antagonist is selected form the group consisting of atosiban claim 11 , retosiban claim 11 , barusiban claim 11 , epelsiban claim 11 , and nolasiban.13. The pharmaceutical composition of any ...

Thermosensitive hydrogel collagenase formulations

It is an object of the present disclosure to provide a formulation for injectable and topical collagenase, which will have extended residence time for the drug at the therapeutic targeted area for the indication being treated. It is a further object of the disclosure to provide a slow release formulation for collagenase, which is compatible with the active ingredient and does not adversely affect its activity. Still a further object of the disclosure is to provide an injectable formulation for collagenase which can be effectively administered to a patient with a small size needle without exhibiting pre-gelation, which would interfere with the ability to deliver the required dose for treatment. Still a further object of the disclosure is to provide a water-based topical formulation for collagenase which will be more compatible with other topically used medications to achieve better results.

USE OF BOTULINUM NEUROTOXIN IN THE TREATMENT OF SIALORRHEA

This invention relates to improved uses of botulinum neurotoxins in the treatment of sialorrhea or diseases or conditions relating to increased saliva production. In particular are botulinum neurotoxins disclosed which are administered into parotid and submandibular glands in a dose ratio between 1.45 to 1 and 1.7 to 1. 1. A method for treating a disease or condition associated with sialorrhea or increased saliva production in a patient , the method comprising administering a therapeutically effective amount of a botulinum neurotoxin by injection into the parotid glands and submandibular glands of the patient , and wherein the ratio between the amount of the botulinum neurotoxin administered into each of the parotid glands and each of the submandibular glands is between 1.45 to 1 and 1.7 to 1.2. The method according to claim 1 , wherein the total dose of said botulinum neurotoxin administered into the parotid glands and submandibular glands is between 70 U and 110 U.3. The method according to claim 1 , wherein said botulinum neurotoxin is administered in an aqueous composition having a botulinum neurotoxin concentration in the range between 45 and of 55 U/mL.4. The method according to claim 1 , wherein said botulinum neurotoxin is administered in 0.3 to 0.5 mL per injection site into the submandibular glands and in 0.5 to 0.7 mL per injection site into the parotid glands.5. The method according to claim 1 , wherein said botulinum neurotoxin is injected into one site of each submandibular gland and/or into one site of each parotid gland.6. The method according to claim 1 , wherein the botulinum neurotoxin is injected into the parotid glands and submandibular glands using ultrasound guidance or without using ultrasound guidance.7. The method according to claim 1 , wherein the botulinum neurotoxin is administered into the parotid glands and submandibular glands in at least two consecutive treatment cycles claim 1 , optionally in at least 2 claim 1 , at least 3 claim 1 ...

TRIPARTITE MODULATORS OF ENDOSOMAL G PROTEIN-COUPLED RECEPTORS

The present invention relates to tripartite compounds comprising a modulator moiety for endosomal G protein-coupled receptors like neurokinin-1 receptor, a linker and a lipid anchor suitable for anchoring the tripartite compound into a plasma membrane. The present invention also relates to a prodrug and a pharmaceutical composition comprising the tripartite compound and the use of the tripartite compound for the treatment of a disease or disorder mediated by endosomal G protein-coupled receptors signalling like NKR signalling. 3. The tripartite compound according to claim 1 , wherein the lipid anchor partitions into lipid membranes that are insoluble in non-ionic detergent at 4° C.; or a pharmaceutically acceptable salt thereof.13. A prodrug of the tripartite compound according to .14. A composition comprising the tripartite compound according to claim 1 , or a prodrug thereof.1529.-. (canceled)30. A pharmaceutical composition comprising a therapeutically effective amount of the tripartite compound according to claim 1 , or a pharmaceutically acceptable salt or prodrug thereof claim 1 , and at least one pharmaceutically acceptable carrier or diluent.31. A method of preventing and/or treating a disease or disorder that is affected by a tachykinin receptor antagonist claim 1 , comprising administering to a patient in need thereof an effective amount of the tripartite compound of or a pharmaceutically acceptable salt or prodrug thereof.32. A method of preventing and/or treating a disease or disorder that is mediated by endosomal NKiR signaling claim 1 , comprising administering to a patient in need thereof an effective amount of the tripartite compound of or a pharmaceutically acceptable salt or prodrug thereof.33. The method of claim 32 , wherein the disease or disorder mediated by endosomal NKiR signaling is selected from the group consisting of chemotherapy-induced nausea and vomiting (CINV) claim 32 , cyclic vomiting syndrome claim 32 , postoperative nausea and ...

TREATMENT OF DEVELOPMENTAL SYNDROMES

A method of treating a developmental syndrome in a patient in need thereof includes applying ultrasound to a target location in the patient's brain to enhance permeability of the patient's blood brain barrier at the target location and administering to the patient a vector encoding BDNF for delivery of BDNF to the target location, wherein the method provides improvement in at least one symptom of the developmental syndrome. Also provided is a method of treating a developmental syndrome in a patient in need thereof that includes administering to the patient an effective amount of a vector including (i) a constitutive promoter operatively linked to nucleic acid encoding BDNF, and (ii) a regulatory sequence including an AGRP promoter operatively linked to an interference RNA sequence, wherein the regulatory sequence down regulates expression of BDNF in response to BDNF induced physiological changes, and the method provides improvement in at least one symptom of the developmental syndrome. 148-. (canceled)49. A method of treating a developmental syndrome in a patient in need thereof comprising:applying ultrasound to a target location in the patient's brain to enhance permeability of the patient's blood brain barrier at the target location;administering to the patient a vector encoding BDNF for delivery of BDNF to the target location, wherein the method provides improvement in at least one symptom of the developmental syndrome.50. The method according to claim 49 , wherein the ultrasound is administered to the target location in the patient's brain at a frequency ranging from 250 kHz to 10 MHz claim 49 , sonication duration ranging from 100 nanoseconds to 30 minutes claim 49 , with continuous wave or burst mode operation claim 49 , where the burst mode repetition varies from 0.01 Hz to 1 MHz.51. The method according to claim 49 , wherein the ultrasound is administered to the target location in the patient's brain at a frequency ranging from 20 kHz to 5 MHz claim 49 , and ...

DNA plasmids for the Fast Generation of Homologous Recombination Vectors For Cell Line Development

The present invention provides homologous recombination vectors to insert transgenic DNA in cells. These vectors shorten the production time and allow for easy generation of genetically modified cells. The invention allows the user to test multiple tags and to generate homozygous modified cell line using the homologous recombination vector. The invention can be used to generate knockout cells, to generate cell lines with knockin genes, to generate cell lines for drug screening against any target, to create transgenic animals, or in gene therapy.

Cyanocobalamin low viscosity aqueous formulations for intranasal delivery

A stable pharmaceutical mercury-free aqueous solution of cyanocobalamin comprised of cyanocobalamin and water wherein said solution of cyanocobalamin is suitable for intranasal administration, has a viscosity less than about 1000 cPs, and wherein said solution of cyanocobalamin has a bioavailability of cyanocobalamin when administered intranasally of at least about 7% relative to an intramuscular injection of cyanocobalamin with the proviso that the solution is essentially free of mercury and mercury-containing compounds. The present invention is also directed towards a method for elevating the vitamin B12 levels in the cerebral spinal fluid (CSF) comprising administering intranasally a sufficient amount of a mercury-free cyanocobalamin solution so as to increase the average ratio of vitamin B12 in the CSF to that in the blood serum (B12 CSF/B12 Serum×100) to at least about 1.1 comprising intranasally administering an aqueous solution of a cyanocobalamin, wherein said solution of cyanocobalamin has a bioavailability of at least 7% relative to an intramuscular injection of a cyanocobalamin.

Dephosphorylated lysosomal storage disease proteins and methods of use thereof

Provided are substantially dephosphorylated forms of lysosomal storage disease (LSD) proteins, including dephosphorylated forms of iduronate-2-sulfatase (IDS, or I2D) and iduronidase (IDU), having increased ability to traverse or penetrate the blood brain barrier (BBB) relative to phosphorylated forms of the protein, and p97 conjugates thereof. Also provided are compositions comprising such dephosphorylated LSD proteins and p97 conjugates, and methods of use thereof, for instance, to treat any one or more lysosomal storage diseases, such as Hunter Syndrome (or MPS Type II).

DISULFIDE BOND STABILIZED POLYPEPTIDE COMPOSITIONS AND METHODS OF USE

Provided herein are polypeptides comprising one or more non-native cysteine residues that form a disulfide bridge between non-native cysteines within the protein or between non-native cysteines of two monomers of the protein. Such modified human polypeptides are useful in treatment of genetic diseases via enzyme replacement therapy and/or gene therapy. 1. A gene therapy vector comprising a nucleic acid construct comprising: a nucleic acid encoding a stabilized form of a protein for treating a genetic disorder , the stabilized form comprising one or more non-native cysteine residues that form a disulfide bridge between non-native cysteines within the protein or between non-native cysteines of two monomers of the protein.2. The gene therapy vector of claim 1 , wherein the protein is selected from the group consisting of alpha-galactosidase A claim 1 , β-glucocerebrosidase claim 1 , glucocerebrosidase claim 1 , lysosomal acid lipase claim 1 , glycosaminoglycan alpha-L-iduronidase claim 1 , alpha-L-iduronidase claim 1 , N-sulfoglucosamine sulfohydrolase (SGSH) claim 1 , N-acetyl-alpha-glucosaminidase (NAGLU) claim 1 , iduronate-2-sulfatase claim 1 , N-acetylgalactosamine-6-sulfatase claim 1 , glycosaminoglycan N-acetylgalactosamine 4-sulfatase claim 1 , alpha-glucosidase claim 1 , tripeptidyl peptidase 1 (TPP1) claim 1 , palmitoyl protein thioesterases (PPTs) claim 1 , ceroid lipofuscinoses neuronal 4 claim 1 , ceroid lipofuscinoses neuronal 10 (cathepsin D) claim 1 , ceroid lipofuscinoses neuronal 11 (progranulin) claim 1 , ceroid lipofuscinoses neuronal 13 (cathepsin F) claim 1 , ceroid lipofuscinoses neuronal 14 (KCTD7) claim 1 , ceroid lipofuscinoses neuronal 15 (TBCK) claim 1 , and cyclin dependent kinase like 5.3. The gene therapy vector of claim 1 , where the stabilized protein comprises a lysosomal enzyme.4. The gene therapy vector of claim 1 , wherein the stabilized protein comprises a stabilized α-galactosidase (α-GAL) protein or a stabilized palmitoyl protein ...

COMPOSITIONS AND METHODS FOR TREATMENT, AMELIORATION, AND PREVENTION OF ANESTHESIA-INDUCED HYPOTHERMIA

Compositions and methods are provided for treating, ameliorating, and preventing anesthesia-induced hypothermia and/or postsurgical associated hyperalgesia in a mammalian subject comprising administering to the subject an effective amount of an ion channel TRPV1 inhibitor. 1. A method of treating anesthesia-induced hypothermia in a mammalian subject in need thereof , comprising administering to the subject a composition comprising an agent capable of treating anesthesia-induced hypothermia , wherein the agent is an ion channel TRPV1 inhibitor , and wherein the anesthesia-induced hyperthermia is caused by administration of general anesthesia selected from at least one or more of an inhalation anesthetic or an intravenous anesthetic.2. The A-method of claim 1 , wherein the treating comprises a prophylactic treatment.3. The method of claim 1 , wherein the TRPV1 inhibitor is administered before claim 1 , after claim 1 , or simultaneous with administration of the general anesthesia.4. (canceled)5. The method of claim 1 , wherein the general anesthetic is selected at least one of from isoflurane claim 1 , sevoflurane claim 1 , desflurane claim 1 , halothane claim 1 , methoxyflurane claim 1 , sodium thiopental claim 1 , ketamine claim 1 , and propofol.6. (canceled)7. The method according to claim 1 , wherein the TRPV1 inhibitor is selected from the group consisting of: AMG 517 claim 1 , SB-366791 claim 1 , AMG 9810 claim 1 , civamide (zucapsaicin) claim 1 , ABT-102 claim 1 , GRC-6211 claim 1 , AZD1386 claim 1 , SB-705498 claim 1 , NGD 8243/MK-2295 claim 1 , JTS-653 claim 1 , JYL1421 claim 1 , JNJ 17203212 claim 1 , SAR-115740 claim 1 , KJM429 claim 1 , capsazepine claim 1 , N-(4-tertiarybutylphenyl)-4-(3-chloropyridin-2-yl)-tetrahydropyrazine-1 (2H)-carboxamide; N-(3-Methoxyphenyl)-4-chlorocinnamide; 1-Isoquinolin-5-yl-3-(4-trifluoromethyl-benzyl)-urea; (2E)-N-(2 claim 1 ,3-Dihydro-1 claim 1 ,4-benzodioxin-6-yl)-3-[4-(1 claim 1 ,1-dimethylethyl)phenyl]-2-propenamide; 2- ...

Compositions and Methods for Treating Stroke

The present invention includes a method of treating ischemic stroke, comprising administering to a subject with ischemic stroke an FGF-1, FGF-1, FGF-1, or combinations thereof, in an amount sufficient to cross the blood brain barrier and reduce or eliminate the ischemic stroke. In one aspect, the method also includes administering at least one other therapeutic agent to the subject, before, concurrently with or after the FGF-1, FGF-1, FGF-1, or combinations thereof. 1. A method of treating ischemic stroke , comprising administering to a subject with ischemic stroke an FGF-1 , FGF-1 , FGF-1 , or combinations thereof , in an amount sufficient to cross the blood brain barrier and treat the ischemic stroke.2. The method of claim 1 , further comprising administering at least one other therapeutic agent to the subject claim 1 , before claim 1 , concurrently with or after the FGF-1 claim 1 , FGF-1 claim 1 , FGF-1 claim 1 , or combinations thereof.3. The method of claim 2 , wherein the therapeutic agent is selected from the group consisting of a second antibody claim 2 , a second antibody fragment claim 2 , an immunoconjugate claim 2 , an immunomodulator claim 2 , an anti-angiogenic agent claim 2 , a pro-apoptotic agent claim 2 , a cytokine claim 2 , a chemokine claim 2 , a drug claim 2 , a hormone claim 2 , an siRNA claim 2 , a coagulation inhibitor claim 2 , a stem cell growth factor claim 2 , a lymphotoxin claim 2 , a hematopoietic factor claim 2 , a colony stimulating factor claim 2 , an interferon claim 2 , erythropoietin claim 2 , thrombopoietin claim 2 , an enzyme claim 2 , recombinant human thrombomodulin and activated human protein C.4. The method of claim 3 , wherein the FGF-1 claim 3 , FGF-1 claim 3 , FGF-1 claim 3 , or combinations thereof claim 3 , are provided intravenously claim 3 , subcutaneously claim 3 , intranasally claim 3 , stereotaxically delivered into a brain parenchyma claim 3 , into the cerebrospinal fluid claim 3 , or in an indwelling Ommaya ...

Non-Natural Consensus Albumin Binding Domains

Non-natural albumin binding domains, polynucleotides encoding thereof and methods of making and using these domains and polynucleotides are useful in controlling the half-life of therapeutic molecules for patients.

OLIGONUCLEOTIDE ANALOGUES TARGETING HUMAN LMNA

Provided are LMNA-targeted antisense oligonucleotides for reducing expression of one or more aberrantly spliced LMNA mRNA isoforms that encode progerin. 2. The antisense oligomer compound of claim 1 , wherein G is selected from SEQ ID NOS: 24 OR 25.6. The antisense oligomer compound according to any one of - claim 1 , wherein Ris acetyl.7. The antisense oligomer compound according to any one of - claim 1 , wherein the targeting sequence is SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC) and Z is 23.8. The antisense oligomer compound according to any one of - claim 1 , wherein the targeting sequence is SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG) and Z is 23.10. The antisense oligomer compound of claim 9 , wherein the target sequence is SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC) and Z is 23.11. The antisense oligomer compound of claim 9 , wherein the target sequence is SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG) and Z is 23.18. The antisense oligomer compound of any one of - claim 9 , wherein the antisense oligomer compound is a pharmaceutically acceptable salt of 0.6 HCl.19. A pharmaceutical composition claim 9 , comprising an antisense oligomer compound according to any one of - and a pharmaceutically acceptable carrier.20. A method for treating Hutchinson-Gilford progeria syndrome (HGPS) in a subject in need thereof comprising administering to the subject an antisense oligomer compound according to any one of - or the pharmaceutical composition of . This application is a continuation of Ser. No. 16/096,524, filed on Oct. 25, 2018, which is a national stage filing under 35 U.S.C. § 371 of International Application No. PCT/US2017/030174, filed Apr. 28, 2017, which application claims priority to U.S. Provisional Application No. 62/330,027, filed Apr. 29, 2016. The entire contents of these applications are incorporated herein by reference in their entirety.The Sequence Listing associated with this application is provided in text format in lieu of a paper copy, and is hereby ...

PPARo ACTIVATOR

The present invention provides a PPARδ activator containing a novel PPARδ agonist (peroxisome proliferator-activated receptor δ) as an active ingredient, and an exercise tolerance-improving agent containing the same as an active ingredient. The present invention is a PPARδ activator containing a guanidine derivative or a biguanidine derivative as an active ingredient, wherein the PPARδ activator activates transcriptional activity of PPARδ, and the guanidine derivative and the biguanidine derivative are capable of fitting within a PPARδ ligand binding pocket in a state where a guanidino group or a biguanidino group forms a hydrogen bond with amino acid residues corresponding to each of the 413th histidine, 287th histidine, 253rd threonine and the 437th tyrosine of human PPARδ, among amino acid residues constituting an interior surface of the ligand binding pocket; and is an exercise tolerance-improving agent containing the PPARδ activator as an active ingredient. 1. A PPARδ activator comprising a guanidine derivative or a biguanidine derivative as an active ingredient , whereinthe PPARδ activator activates transcriptional activity of PPARδ (peroxisome proliferator-activated receptor δ).2. The PPARδ activator according to claim 1 , whereinthe guanidine derivative and the biguanidine derivative are capable of fitting within a ligand binding pocket of PPARδ, in a state where a guanidino group or a biguanidino group form a hydrogen bond with amino acid residues corresponding to each of the 413th histidine, 287th histidine, 253rd threonine and the 437th tyrosine of human PPARδ, among amino acid residues constituting an interior surface of the ligand binding pocket.7. The PPARδ activator according to claim 1 , whereinat least one selected from the group consisting of metformin, phenformin and buformin is included as the active ingredient.8. An exercise tolerance-improving agent comprising the PPARδ activator defined in as an active ingredient.9. A pharmaceutical ...

COMPOSITIONS AND METHODS FOR MODULATION OF LMNA EXPRESSION

The present disclosure provides compounds comprising oligonucleotides complementary to a portion of the LMNA gene. Such compounds are useful for modulating the expression of LMNA in a cell or animal, and in certain instances reducing the amount of progerin mRNA and/or progerin protein. Progerin mRNA results from aberrant splicing of LMNA and is translated to generate progerin protein. Accumulation of progerin protein causes Hutchinson-Gilford progeria syndrome (HOPS), a premature aging disease. In certain embodiments, hybridization of oligonucleotides complementary to a portion of the LMNA gene results in a decrease in the amount of progerin mRNA and/or progerin protein. In certain embodiments, oligonucleotides are used to treat Hutchinson-Gilford Progeria Syndrome. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 , at least 13 , at least 14 , at least 15 , at least 16 , at least 17 , or at least 18 contiguous nucleobases complementary to an equal length portion of nucleobases 24759-24791 of SEQ ID NO: 1 , nucleobases 2176-2198 of SEQ ID NO: 2 or SEQ ID NO:4 , or nucleobases 2062-2085 of SEQ ID NO: 3.2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 , at least 13 , at least 14 , at least 15 , or at least 16 any of the nucleobase sequences of SEQ ID 14-157.3. An oligomeric compound comprising a modified oligonucleotide consisting of a modified oligonucleotide having a nucleobase sequence comprising at least 17 , at least 18 , at least 19 , or at least 20 of any of the nucleobase sequences of SEQ ID 14-38 , 75-101 , or 132-157.4. The oligomeric compound of , , or , wherein the modified oligonucleotide is at least 85% , at least 90% , at least 95% , or 100% complementary to SEQ ID NO: 1 , SEQ ID NO: 2 , SEQ ID NO: 3 , or SEQ ID NO: 4 over the ...

CNS-ACCESSIBLE PHARMACOLOGICAL CHAPERONES FOR TREATMENT OF ACID BETA-GLUCOSIDASE-RELATED DISEASE STATES

Disclosed herein are β-glucosidase (GCase) chaperones and methods of using GCase chaperones in an individual in need thereof. GBA1 mutations lead to GCase deficiency and substrate accumulation, causing Gaucher disease. Currently, no FDA or EMA-approved therapeutic for neuronopathic Gaucher disease is available. Improved GCase activity in brain cells using a chaperone may reduce substrate accumulation and associated pathology. Disclosed herein are novel non-inhibitory chaperone compounds of GCase that have properties of a central nervous system drug. Those compounds effectively restored mutant GCase activity by stabilizing protein and enhancing lysosomal localization and may be useful for chaperone therapy to treat neuronopathic Gaucher disease and likely to Parkinson's disease. 8. The method of claim 1 , wherein said chaperone is the R enantiomer.9. The method of claim 1 , wherein said administration is oral administration.10. The method of claim 1 , wherein said chaperone is administered in an amount sufficient to functionally recover mutant GCase by one or more of improving protein folding claim 1 , stability claim 1 , and trafficking to lysosome.11. The method of claim 1 , wherein said disorder is selected from Parkinson's disease or Gaucher disease.12. The method of claim 1 , wherein said chaperone is used in combination with substrate reduction therapy (SRT) claim 1 , wherein said SRT comprises administering a glucosylceramide synthase inhibitor in an amount sufficient for to degrade glucosylceramide.13. The method of claim 1 , wherein said administration is for the treatment of Parkinson's disease in an individual in need thereof.14. The method of claim 1 , wherein said administration is for the treatment of Gaucher disease in an individual in need thereof.15. A method of improving enzyme replacement therapy claim 1 , comprising administering a composition according to any preceding claim in combination with GCase replacement therapy claim 1 , wherein said ...

Preventive/therapeutic method and preventive/therapeutic agent for complications after cataract surgery

The present invention provides a method for the prevention and treatment of complications after cataract surgery such as secondary cataract and anterior capsule contraction that occur after cataract operation. The present invention relates to a preventive/therapeutic method comprising administering to a subject a medicine containing 4-fluoro-5-{[(2S)-2-methyl-1,4-diazepan-1-yl]sulfonyl}isoquinoline (Ripasudil) or a salt thereof, or a solvate thereof as an active ingredient.

COMPOSITIONS FOR IMPROVING SEXUAL FUNCTION

Compositions comprising L-arginine and L-citrulline in specific ratios are provided. Use of such compositions for improving sexual function in a healthy human subject are also provided. 1. A composition comprising L-arginine and L-citrulline or a physiologically acceptable salt or hydrate of any one thereof , wherein the composition is in a unit dosage form and wherein the content of L-arginine or a physiologically acceptable salt or hydrate thereof is at least 4.0 g and the content of L-citrulline or a physiologically acceptable salt or hydrate thereof is in the range from 1.1-3.0 g , wherein the composition comprises one or more proanthocyanidins.2. A composition according to claim 1 , wherein the content of L-arginine or a physiologically acceptable salt or hydrate thereof is in the range of from 4.0-10.0 g.3. A composition according to claim 1 , wherein the composition is in a unit dosage form for use on demand. This application is a divisional application of U.S. patent application Ser. No. 17/056,290, filed on Nov. 17, 2020, which is a § 371 national stage entry of International Patent Application No. PCT/EP2019/083983, filed on Dec. 6, 2019, which claims priority to Danish Patent Application No. PA 2018 70801, filed on Dec. 7, 2018, and U.S. patent application Ser. No. 17/056,290 is also a continuation in part application of U.S. patent application Ser. No. 16/706,087, filed on Dec. 6, 2019, now U.S. Pat. No. 10,993,924, the entire contents of which are incorporated herein by reference.The present invention relates to compositions comprising L-arginine and L-citrulline in specific ratios and the use thereof. In particular, the present invention relates to the use of such compositions for improving the sexual function in a sexually healthy human subject on demand.Sexuality is a complex interplay of multiple facets, including anatomical, physiological, psychological, developmental, cultural, and relational factors. All of these contribute to an individual's ...

Agent and composition for improving intrauterine bacterial flora, and method for determining whether intrauterine bacterial flora has been improved or normalized

The purpose of the present invention is to provide an agent for improving intrauterine bacterial flora, and a method for determining whether intrauterine bacterial flora has been improved or normalized. An aspect of the present invention is an agent for improving intrauterine bacterial flora that contains lactoferrin or a salt thereof as an active ingredient. Additionally provided are: an agent or composition for improving intrauterine flora or treating or preventing diseases caused by the imbalance of intrauterine bacterial flora, the agent or composition containing lactoferrin or a salt thereof; a method for treating or preventing diseases caused by imbalance of intrauterine bacterial flora, the method comprising administrating the agent or composition; and a method for determining whether intrauterine bacterial flora has been improved or normalized.

ESTROGEN RECEPTOR Beta PARTIAL AGONIST HAVING ESTROGEN RECEPTOR Alpha INHIBITORY EFFECT, AND GYNECOLOGICAL DISEASE THERAPEUTIC AGENT USING SAME

[Problem] To provide a therapeutic agent for estrogen-dependent gynecological diseases such as endometriosis, uterine fibroids, and uterus adenomyosis. [Solution] To use an estrogen receptor α-inhibiting β partial agonist represented by the formula (a), a pharmaceutically-acceptable salt thereof, or a hydrate of either of the afore-mentioned, as an active ingredient. 13-. (canceled)5. The method according to claim 4 , wherein the compound is a pharmaceutically acceptable salt of the compound represented by the formula (a).6. The method according to claim 5 , wherein the pharmaceutically acceptable salts is at least one organic salts selected from the group consisting of citrate claim 5 , fumarate claim 5 , succinate claim 5 , benzoate and malonate. The present invention relates to an estrogen receptor β partial agonist having estrogen receptor a inhibitory effect, and a gynecological disease therapeutic agent using the same.There are diseases caused by abnormality of estrogen or progesterone as organic gynecological diseases. Examples of the diseases include endometriosis, uterine fibroids, and uterus adenomyosis.As treatment of such diseases, administration of gonadotropin agonist (GnRH agonist), as a drug therapy, is known, however, a period for drug administration is restricted because of the side effects such as bone mineral loss and ovarian dysfunction symptoms, thus no gynecological disease therapeutic agents for long-term use have existed yet, and so surgical therapy such as surgical resection is still a first choice.Therefore, for the treatment of gynecological disease, a drug effective for long-term administration to inhibit the growth of ectopic endometrial tissue and suppress or improve the intra-uterine fibroids and uterus adenomyosis has been desired. It has also been desired to relief pains such as lower abdominal pain and low back pain caused by these gynecological diseases.Conventionally, as a drug to inhibit binding of estrogen to the receptor ...

A NOVEL LIQUID FORMULATION OF LONG-ACTING HUMAN GROWTH HORMONE CONJUGATE

The present invention relates to a liquid formulation of a long-acting human growth hormone conjugate and a preparation method thereof. 124-. (canceled)25. A liquid formulation of a long-acting human growth hormone (hGH) conjugate , comprising:(i) a long-acting hGH conjugate in which the hGH is linked to an immunoglobulin Fc region; and(ii) an albumin-free stabilizer comprising a buffer solution, sugar alcohol, non-ionic surfactant, and preservative, without an isotonic agent.26. The liquid formulation of claim 25 , wherein the long-acting hGH conjugate is in the form of a fusion protein claim 25 , in which hGH and an immunoglobulin Fc region are linked via a non-peptidyl polymer or a recombination technique.27. The liquid formulation of claim 26 , wherein the non-peptidyl polymer is selected from the group consisting of polypropylene glycol claim 26 , polyethylene glycol claim 26 , a copolymer of ethylene glycol and propylene glycol claim 26 , polyoxyethylated polyol claim 26 , polyvinyl alcohol claim 26 , polysaccharide claim 26 , dextran claim 26 , polyvinyl ethyl ether claim 26 , a biodegradable polymer such as polylactic acid (PLA) and polylactic-glycolic acid (PLGA) claim 26 , a lipid polymer claim 26 , chitins claim 26 , hyaluronic acid claim 26 , and a combination thereof; or wherein the non-peptidyl polymer is polyethylene glycol.28. The liquid formulation of claim 25 , wherein the buffer is a citrate buffer or acetate buffer; or wherein the buffer has a pH in a range of 4.0 to 7.0.29. The liquid formulation of claim 25 , wherein the sugar alcohol is at least one selected from the group consisting of mannitol claim 25 , sucrose claim 25 , and sorbitol; andherein the sugar alcohol has a concentration in a range of 1% (w/v) to 10% (w/v) relative to the total volume of the liquid formulation.30. The liquid formulation of claim 25 , wherein the non-ionic surfactant is polysorbate or poloxamer; andwherein the non-ionic surfactant has a concentration in a range ...

CONTROLLED-RELEASE CNP AGONISTS WITH INCREASED NEP STABILITY

The present invention relates to controlled-release CNP agonists having an at least 5-fold longer degradation half-life in an in vitro NEP degradation assay than the corresponding released CNP agonist, to pharmaceutical compositions comprising said controlled-release CNP agonist, their use and to methods of treatment. 1. A controlled-release CNP agonist , wherein the controlled-release CNP agonist releases one or more CNP agonist and wherein the controlled-release CNP agonist has an at least 5-fold longer degradation half-life in an in vitro NEP degradation assay than the corresponding released CNP agonist.2. The controlled-release CNP agonist of claim 1 , wherein the controlled-release CNP agonist releases at least one CNP agonist under physiological conditions with a release half-life of at least 6 hours.3. The controlled-release CNP agonist of claim 1 , wherein the controlled-release CNP agonist preferably comprises a CNP agonist selected from the group consisting of small molecules claim 1 , natural products claim 1 , oligonucleotides claim 1 , polypeptides and proteins.4. The controlled-release CNP agonist of claim 1 , wherein the CNP agonist is a polypeptide.5. The controlled-release CNP agonist of claim 1 , wherein the CNP agonist is CNP.6. The controlled-release CNP agonist of claim 1 , wherein the controlled-release CNP agonist is water-insoluble.7. The controlled-release CNP agonist of claim 1 , wherein the controlled-release CNP agonist is selected from the group consisting of crystals claim 1 , nanoparticles claim 1 , microparticles claim 1 , nanospheres and microspheres.8. The controlled-release CNP agonist of claim 1 , wherein the controlled-release agonist is a vesicle comprising at least one CNP agonist and wherein said vesicle is a micelle claim 1 , liposome or polymersome.9. The controlled-release CNP agonist of claim 1 , wherein the controlled-release CNP agonist is water-soluble.10. (canceled)11. A pharmaceutical composition comprising the ...

METHYLPHOSPHINIC ACID COMPOSITIONS AND METHODS FOR REDUCING AGING

A composition that includes methylphosphinic acid or a salt thereof, and optionally methylphosphonic acid or a salt thereof, and an ingredient acceptable for consumption by a mammal is provided herein. Also provided is a method for reducing aging in a mammal that involves providing or administering methylphosphinic acid or a salt thereof, and optionally, methylphosphonic acid or a salt thereof, to the mammal in need thereof for consumption. A composition for use in such a method and an article useful for such a method include those in the form of a food product such as a prepackaged or processed food or meal, a beverage, a nutritional supplement, or a nutraceutical. 1. A composition comprising methylphosphinic acid or a salt thereof and an ingredient acceptable for consumption by a mammal.2. The composition of claim 1 , wherein the ingredient acceptable for consumption by a mammal is an ingredient generally regarded as safe for human consumption.3. The composition of claim 1 , which is a liquid claim 1 , wherein the methylphosphinic acid or a salt thereof is at a concentration of about 2 mg/L to about 600 mg/L.4. The composition of claim 3 , which is a beverage claim 3 , wherein the methylphosphinic acid or a salt thereof is at a concentration of about 0.005 mg/L to about 1 mg/L.5. The composition of claim 4 , further comprising methylphosphonic acid or a salt thereof.6. The composition of claim 5 , which comprises about equal amounts of (a) the methylphosphinic acid or a salt thereof claim 5 , and (b) the methylphosphonic acid or a salt thereof.7. The composition of claim 1 , which is a solid that comprises about 0.3 mg to about 2 g of the methylphosphinic acid or a salt thereof per kilogram of the solid.8. The composition of claim 1 , which is prepackage food that comprises about 0.01 mg to about 5 mg of the methylphosphinic acid or a salt thereof per kilogram of the prepackaged food.9. The composition of claim 8 , further comprising methylphosphonic acid or a ...

Genetic polymorphisms associated with psoriasis, methods of detection and uses thereof

The present invention is based on the discovery of genetic polymorphisms that are associated with psoriasis and related pathologies. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, including groups of nucleic acid molecules that may be used as a signature marker set, such as a haplotype, a diplotype, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of using the nucleic acid and proteins as well as methods of using reagents for their detection.

Decontamination solution and its use for denaturation, modification, degradation, solubilisation and removal of proteins, nucleic acid molecules and microorganisms

The invention concerns a three component system comprising surface-active substances, vitamins and metal ions for efficient destruction and removal of contaminating proteins, nucleic acids and microorganisms from surfaces like for example laboratory benches, floors, equipment and instruments. These non-corrosive and non-toxic solutions for removal of proteins, nucleic acids and microorganisms are applied by spraying, rubbing or immersion of contaminated surfaces thereby destroying, solubilizing inactivating and removing proteins and nucleic acids. In that way also microorganisms are killed with high efficiency and at the same time all genetic information is inactivated.

Novel compounds

Compounds of formula (I) wherein R 1 is 2-indanyl, R 2 is 1-methylpropyl, R 3 is a group selected from 2,6-dimethyl-3-pyridyl or 4,6-dimethyl-3-pyridyl, R 4 represents methyl and R 5 represents hydrogen or methyl or, R 4 and R 5 together with the nitrogen atom to which they are attached represent morpholino and pharmaceutically acceptable derivatives thereof are described, as are processes for their preparation, pharmaceutical compositions containing them and their use in medicine, particularly their use as oxytocin antagonists.

OPTIMIZED Fc VARIANTS

The present invention relates to Fc variants having decreased affinity for FcγRIIb, methods for their generation, Fc polypeptides comprising optimized Fc variants, and methods for using optimized Fc variants.

Decellularized tissue

The present invention addresses the problem of providing a decellularized tissue having excellent cell adhesion properties. Provided is a decellularized tissue prepared by decellularizing a biological tissue, said decellularized tissue being characterized in that the ratio of endothermic energy amount, in terms of dry mass, of the decellularized tissue to the biological tissue before the decellularization is 0.70 or greater when measured by differential scanning calorimetry. The ratio by mass of DNA amount, in terms of dry mass, of the decellularized tissue to the biological tissue before the decellularization may be 0.300 or smaller.

METHODS OF TREATING RADIATION INDUCED GASTROINTESTINAL SYNDROME (RIGS) AND RELATED DISEASE STATES USING COMPOUND 512

The present disclosure is directed to method of treatment for treating or ameliorating various conditions caused by radiation exposure such as RIGS, enteritis, mucositis, e.g., oral mucositis, and proctitis by the administration of compound 512, or an analog thereof. 2. The method of claim 1 , wherein the compound is administered to the subject within 48 hours of the radiation exposure.3. The method of claim 1 , wherein the compound is administered to the subject after 24 hours of the radiation exposure.6. The method of claim 1 , wherein the subject received radiation therapy or chemotherapy.7. The method of claim 1 , wherein the injury of the GI tract is identified as one or more of radiation-induced gastrointestinal syndrome (RIGS) claim 1 , radiation-induced mucositis claim 1 , radiation-induced proctitis or radiation-induced enteritis.8. The method of claim 1 , wherein the injury of the GI tract is identified as one or more of chemotherapy-induced gastrointestinal syndrome claim 1 , chemotherapy-induced mucositis claim 1 , chemotherapy-induced proctitis or chemotherapy-induced enteritis. This application is a divisional application of U.S. patent application Ser. No. 16/058,943 and claims priority and is entitled to the filing date of U.S. provisional patent application Ser. No. 62/542,647 filed on Aug. 8, 2017. The contents of the aforementioned application are incorporated herein by reference.The risk of large populations encountering radiation exposure is real and growing due to the proliferation of rogue non state actors, political instability resulting in potential access of nuclear weapons by terrorist, and by natural disaster as evidenced by the release of radioactive material from the Fukushima nuclear power plant in early 2011. Total body exposure to radiation results acute radiation syndromes describing a clinical condition with multi organ syndrome. Radiation doses less than 8 Gy primarily develops hematopoietic injury and can be treated with ...

Heterocyclic diamidines

The present invention relates to pharmaceutical compositions comprising heterocyclic diamidines and their use in the prophylaxis and/or treatment of diseases associated with fibrosis, in particular for the treatment of diseases such as systemic sclerosis (limited cutaneous scleroderma and diffuse cutaneous scleroderma), pulmonary fibrosis, hepatic cirrhosis, renal fibrosis, chronic graft-versus-host disease, Crohn's disease, arthrofibrosis, myelofibrosis, Dupuytren's disease and nephrogenic systemic fibrosis and tumours selected from mamma carcinoma, endometrial adenocarcinoma, ovarian serous tumor, lung adenocarcinoma, lung squamous cell tumor, colorectal tumor and pancreatic tumor.

Use of an inhibitor of ntsr1 activation or expression for preventing weight loss, muscle loss, and protein blood level decrease in subjects in need thereof

Cachexia is a potentially lethal syndrome afflicting mammals, frequently complicates the treatment of infection, inflammation and cancer. It is characterized by involuntary weight loss, including muscle loss and decrease in protein blood level content. The inventors now show in 2 animal models (mice fed with normal diet and mice fed with high fat diet) that neutralisation of the long fragment of neurotensin with an inhibitor of NTSR1 activation or expression prevents weight loss, muscle loss and protein blood level decrease. Accordingly, the present invention relates to use of an inhibitor of NTSR1 activation or expression for preventing weight loss, muscle loss, and protein blood level decrease in subjects in need thereof.

Method of soft tissue augmentation

Particles made of a viscoelastic medium, are injectable gel particles, and have a size, when subjected to a physiological salt solution, in the range of from 1 to 5 mm. The particles are useful in a soft tissue augmentation implant. The implant includes particles of a viscoelastic medium, wherein a major volume of the particles are injectable gel particles The implant is useful in a method of soft tissue augmentation in a mammal, including man, comprising subepidermal administration at a site in said mammal where soft tissue augmentation is desirable, of an implant.

Method for Treating Gynecological Diseases

The present invention relates generally to a combination for use in the treatment of gynaecological diseases and associated disabling symptoms thereof, in a subject in need thereof, said pharmaceutical combination for use comprising co-administering a suitable pharmaceutical composition for oral administration comprising a first progesterone receptor modulator and a pharmaceutical composition suitable for vaginal and/or intrauterine administration comprising a second progesterone receptor modulator.