Constructs and methods for expression of recombinant HCV envelope proteins

CONSTRUCTS AND METHODS FOR EXPRESSION OF RECOMBINANT HCVENVELOPE PROTEINSFIELD OF THE INVENTIONThe present invention relates to the general field of recombinant protein expression.

More particularly, the present invention relates to the expression of hepatitis C virus envelope proteins in a eukaryote such as yeast. Constructs and methods are disclosed for the expression of core-glycosylated viral envelope proteins in yeast.

BACKGROUND OF THE INVENTIONHepatitis C virus (HCV) infection is a major health problem in both developed and developing countries. It is estimated that about 1 to 5 % of the world population is affected by the virus. HCV infection appears to be the most important cause of transfusion-associated hepatitis and frequently progresses to chronic liver damage. Moreover, evidence exists implicating HCV in induction of hepatocellular carcinoma. Consequently, the demand for reliable diagnostic methods and effective therapeutic agents is high. Also sensitive and specific screening methods of HCV-contaminated blood-products and improved methods to culture HCV are needed.

HCV is a positive stranded RNA virus of approximately 9,600 bases which encode a single polyprotein precursor of about 3000 amino acids. Proteolytic cleavage of the precursor coupled to co-and posttranslational modifications has been shown to result in at least three structural and six non-structural proteins. Based on sequence homology, the structural proteins have been functionally assigned as one single core protein and two envelope glycoproteins: El and E2. The El protein consists of 192 amino acids and contains 5 to 6 Nglycosylation sites, depending on the HCV genotype. The E2 protein consists of 363 to 370 amino acids and contains 9 to 11 N-glycosylation sites, depending on the HCV genotype (for reviews see: Major, M. E. and Feinstone, S. M. 1997, Maertens, G. and Stuyver, L. 1997).

The E1 protein contains various variable domains (Maertens, G. and Stuyver, L. 1997). TheE2 protein contains three hypervariable domains, of which the major domain is located at the N-terminus of the protein (Maertens, G. and Stuyver, L. 1997). The HCV glycoproteins localize predominantly in the ER where they are modified and assembled into oligomeric complexes.

In eukaryotes, sugar residues are commonly linked to four different amino acid residues. These amino acid residues are classified as O-linked (serine, threonine, and hydroxylysine) and N-linked (asparagine). The 0-linked sugars are synthesized in the Golgi or rough Endoplasmic Reticulum (ER) from nucleotide sugars. The N-linked sugars are synthesized from a common precursor, and subsequently processed. It is believed that HCV envelope proteins are N-glycosylated. It is known in the art that addition of N-linked carbohydrate chains is important for stabilization of folding intermediates and thus for efficient folding, prevention of malfolding and degradation in the endoplasmic reticulum, oligomerization, biological activity, and transport of glycoproteins (see reviews by Rose, J. K. and Doms, R. W. 1988, Doms, R. W. et al. 1993, Helenius, A. 1994)).STDC0868 The tripeptide sequences Asn-X-Ser and Asn-X-Thr (in which X can be any amino acid) on polypeptides are the consensus sites for binding N-linked oligosaccharides. After addition of the N-linked oligosaccharide to the polypeptide, the oligosaccharide is further processed into the complex type (containing N-acetylglucosamine, mannose, fucose, galactose and sialic acid) or the high-mannose type (containing N-acetylglucosamine and mannose). HCV envelope proteins are believed to be of the high-mannose type. N-linked oligosaccharide biosynthesis in yeast is very different from the biosynthesis in mammalian cells. In yeast the oligosaccharide chains are elongated in the Golgi through stepwise addition of mannose, leading to elaborate high mannose structures, leading to elaborate high mannose structures, referred to as hyperglycosylation.STDC0108 In contrast therewith, proteins expressed in prokaryotes are never glycosylated.

To date, vaccination against disease has been proven to be the most cost effective and efficient method for controlling diseases. Despite promising results, efforts to develop an efficacious HCV vaccine, however, have been plagued with difficulties. A conditio sine qua non for vaccines is the induction of an immune response in patients.

Consequently, HCV antigenic determinants should be identified, and administered to patients in a proper setting. Antigenic determinants can be divided in at least two forms, i. e. lineair and conformational epitopes. Conformational epitopes result from the folding of a molecule in a three-dimensional space, including co-and posttranslational modifications, such as glycosylation. In general, ^ it is believed that conformational epitopes will realize the most efficacious vaccines, since they represent epitopes which resemble native-like HCV epitopes, and which may be better conserved than the actual linear amino acid sequence.STDC0278 Hence, the eventual degree of glycosylation of the HCV envelope proteins is of the utmost importance for generating native-like HCV antigenic determinants. However, there are seemingly insurmountable problems with culturing HCV, that result in only minute amounts of virions.

In addition, there are vast problems with the expression and purification of recombinant proteins, that result in either low amounts of proteins, hyperglycosylated proteins, or proteins that are not glycosylated.

In order to obtain glycosylation of an expressed protein, said protein needs to be targeted to the endoplasmic reticulum (ER). This process requires the presence of a pre-proor pre-sequence, the latter also known as signal peptide or leader peptide, at the aminoterminal end of the expressed protein. Upon translocation of the protein into the lumen of theER, the pre-sequence is removed by means of a signal peptidase complex. A large number of pre-pro-and pre-sequences is currently known in the art.STDC0670 These include the S. cerevisiae amating factor leader (pre-pro; aMF or MFa), the Carcinus maenas hyperglycemic hormone leader sequence (pre; CHH), the S. occidentalis amylase leader sequence (pre; Amyl), the S. occidentalis glucoamylase Gaml leader sequence (pre; Gaml), the fungal phytase leader sequence (pre; Phy5), the Pichia pastoris acid phosphatase leader sequence (pre; phol), the yeast aspartic protease 3 signal peptide (pre; YAP3), the mouse salivary amylase signal peptide (pre) and the chicken lysozyme leader sequence (pre; CL).

The CHH leader has been coupled with hirudin and G-CSF (granulocyte colony stimulating factor) and expression of the CHH-hirudin and CHH-G-CSF proteins inHansenula polymorpha results in correct removal of the leader sequence (Weydemann, U. et al. 1995, Fischer et al. in WO00/40727). The chicken lysozyme leader sequence has been fused to human interferona2b (IFNa2b), human serum albumin and human lysozyme or 1,4ss-N-acetylmuramidase and expressed in S. cerevisiae (Rapp in GenBank accession numberAF405538, Okabayashi, K. et al. 1991, de Baetselier et al. in EP0362183, Oberto andDavison in EPO 184575). Mustilli and coworkers (Mustilli, A.STDC0220 C. et al. 1999) have utilized the Kluyweromyces lactis killer toxin leader peptide for expression of HCV E2 in S. cerevisiae and K. lactis.

The HCV envelope proteins have been produced by recombinant techniques inEscherichia coli, insect cells, yeast cells and mammalian cells. However, expression in higher eukaryotes has been characterised by the difficulty of obtaining large amounts of antigens for eventual vaccine production. Expression in prokaryotes, such as E. coli results in HCV envelope proteins that are not glycosylated. Expression of HCV envelope proteins in yeast resulted in hyperglycosylation. As already demonstrated in WO 96/04385, the expression ofHCV envelope protein E2 in Saccharomyces cerevisiae leads to proteins which are heavily glycosylated. This hyperglycosylation leads to shielding of protein epitopes. AlthoughMustilli and co-workers (Mustilli, A.STDC0482 C. et al. 1999) claims that expression of HCV E2 in S. cerevisiae results in core-glycosylation, the analysis of the intracellularly expressed material demonstrates that part of it is at least hyperglycosylated, while the correct processing of the remainder of this material has not been shown. The need for HCV envelope proteins derived from an intracellular source is well accepted (WO 96/04385 to Maertens et al. and Heile, J.

M. et al. 2000). This need is further exemplified by the poor reactivity of the secreted yeast derived E2 with sera of chimpanzee immunized with mammalian cell culture derived E2 proteins as evidenced in Figure 5 of Mustilli and coworkers (Mustilli, A. C. et al. 1999). This is further documented by Rosa and colleagues (Rosa, D. et al. 1996) who show that immunization with yeast derived HCV envelope proteins fails to protect from challenge.

Consequently, there is a need for efficient expression systems resulting in large and cost-effective amounts of proteins and, in particular, such systems are needed for production of HCV envelope proteins. If a pre-or pre-pro-sequence is used to direct the protein of interest to the ER, then efficiency of the expression system is, amongst others, dependent on the efficiency and fidelity with which the pre-or pre-pro-sequences are removed from the protein of interest.

SUMMARY OF THE INVENTIONA first aspect of the present invention relates to recombinant nucleic acids comprising a nucleotide sequence encoding a protein comprising an avian lysozyme leader peptide or a functional equivalent thereof joined to an HCV envelope protein or a part thereof. More specifically said protein is characterized by the structure CL-[(Al) a- (PSl) b- (A2) c]- HCVENV- [ (A3) d- (PS2) e- (A4) f] wherein:STDC0460CL is an avian lysozyme leader peptide or a functional equivalent thereof, Al, A2, A3 and A4 are adaptor peptides which can be different or the same, PS1 and PS2 are processing sites which can be the different or the same,HCVENV is a HCV envelope protein or a part thereof, a, b, c, d, e and fare 0 or 1, and wherein, optionally, Al and/or A2 are part of PS1 and/or wherein A3 and/or A4 are part of PS2.

The recombinant nucleic acids according to the invention may further comprise regulatory elements allowing expression of said protein in a eukaryotic host cell.

Another aspect of the invention relates to a recombinant nucleic acid according to the invention which are comprised in a vector. Said vector may be an expression vector and/or an autonomously replicating vector or an integrative vector.

A further aspect of the invention relates to a host cell harboring a recombinant nucleic acid according to the invention or a vector according to the invention. More particularly, said host cell is capable of expressing the protein comprising an avian lysozyme leader peptide or a functional equivalent thereof joined to an HCV envelope protein or a part thereof.STDC0697 More specifically, said protein is characterized by the structure CL-[(Al) a- (PSl) b- (A2) c]HCVENV- [ (A3) d- (PS2) e- (A4) f] wherein:CL is an avian lysozyme leader peptide or a functional equivalent thereof, Al, A2, A3 and A4 are adaptor peptides which can be different or the same,PS1 and PS2 are processing sites which can be the different or the same,HCVENV is a HCV envelope protein or a part thereof, a, b, c, d, e and f are 0 or 1, and wherein, optionally, Al and/or A2 are part of PS1 and/or wherein A3 and/or A4 are part of PS2.

The host cell according to the invention may be capable of removing the avian lysozyme leader peptide with high efficiency and fidelity and may be capable of processing the processing sites PS1 and/or PS2 in said protein translocated to the endoplasmic reticulum.

Said host cell may further be capable of N-glycosylating said protein translocated to the endoplasmic reticulum or said protein translocated to the endoplasmic reticulum and processed at said sites PS 1 and/or PS2. The host cell may be an eukaryotic cell such as a yeast cell.

A next aspect of the invention relates to a method for producing an HCV envelope protein or part thereof in a host cell, said method comprising transforming said host cell with a recombinant nucleic acid according to the invention or with a vector according to the invention, and wherein said host cell is capable of expressing a protein comprising the avian lysozyme leader peptide or a functional equivalent thereof joined to an HCV envelope protein or a part thereof.STDC0647 More particularly, said protein is characterized by the structure CL-[(Al) a- (PS l) b (A2) C]-HCVENV-[(A3) d- (Ps2) e- (A4) f] wherein:CL is an avian lysozyme leader peptide or a functional equivalent thereof, Al, A2, A3 and A4 are adaptor peptides which can be different or the same,PS 1 and PS2 are processing sites which can be the different or the same,HCVENV is a HCV envelope protein or a part thereof, a, b, c, d, e and fare 0 or 1, and wherein, optionally, Al and/or A2 are part of PS 1 and/or wherein A3 and/or A4 are part of PS2.

The method according to the invention may further comprise cultivation of said host cells in a suitable medium to obtain expression of said protein, isolation of the expressed protein from a culture of said host cells, or from said host cells. Said isolation may include one or more of (i) lysis of said host cells in the presence of a chaotropic agent, (ii) chemical modification of the cysteine thiol-groups in the isolated proteins wherein said chemical modification may be reversible or irreversible and (iii) heparin affinity chromatography.

FIGURE LEGENDSFigure 1. Schematic map of the vector pGEMT-ElsH6RB which has the sequence as defined in SEQ ID NO : 6.

Figure 2. Schematic map of the vector pCHH-Hir which has the sequence as defined in SEQID NO : 9.

Figure 3. Schematic map of the vector pFPMT121 which has the sequence as defined in SEQID NO : 12.

Figure 4. Schematic map of the vector pFPMT-CHH-El-H6 which has the sequence as defined in SEQ ID NO : 13.

Figure 5. Schematic map of the vector pFPMT-MFa-El-H6 which has the sequence as defined in SEQ ID NO : 16.

Figure 6. Schematic map of the vector pUCl 8-FMD-MFa-El-H6 which has the sequence as defined in SEQ ID NO : 17.

Figure 7. Schematic map of the vector pUC18-FMD-CL-El-H6 which has the sequence as defined in SEQ ID NO : 20.

Figure 8. Schematic map of the vector pFPMT-CL-El-H6 which has the sequence as defined in SEQ ID NO : 21.

Figure 9. Schematic map of the vector pSP72E2H6 which has the sequence as defined inSEQ ID NO : 22.

Figure 10. Schematic map of the vector pMPT121 which has the sequence as defined in SEQID NO : 23.

Figure 11. Schematic map of the vector pFPMT-MFa-E2-H6 which has the sequence as defined in SEQ ID NO : 24.

Figure 12. Schematic map of the vector pMPT-MFa-E2-H6 which has the sequence as defined in SEQ ID NO : 25.

Figure 13. Schematic map of the vector pMF30 which has the sequence as defined in SEQ IDNO : 28.

Figure 14. Schematic map of the vector pFPMT-CL-E2-H6 which has the sequence as defined in SEQ ID NO : 32.

Figure 15. Schematic map of the vector pUC18-FMD-CL-El which has the sequence as defined in SEQ ID NO : 35.

Figure 16. Schematic map of the vector pFPMT-CL-El which has the sequence as defined inSEQ ID NO : 36.

Figure 17. Schematic map of the vector pUC18-FMD-CL-H6-El-K-H6 which has the sequence as defined in SEQ ID NO : 39.

Figure 18. Schematic map of the vector pFPMT-CL-H6-K-El which has the sequence as defined in SEQ ID NO : 40.

Figure 19. Schematic map of the vector pYIG5 which has the sequence as defined in SEQ IDNO : 41.

Figure 20. Schematic map of the vector pYIG5ElH6 which has the sequence as defined inSEQ ID NO : 42.

Figure 21. Schematic map of the vector pSYl which has the sequence as defined in SEQ IDNO : 43.

Figure 22. Schematic map of the vector pSYl aMFEl sH6a which has the sequence as defined in SEQ ID NO : 44.

Figure 23. Schematic map of the vector pBSK-E2sH6 which has the sequence as defined inSEQ ID NO : 45.

Figure 24. Schematic map of the vector pYIG5HCCL-22aH6 which has the sequence as defined in SEQ ID NO : 46.

Figure 25. Schematic map of the vector pYYIGSE2H6 which has the sequence as defined inSEQ ID NO : 47.

Figure 26. Schematic map of the vector pYIG7 which has the sequence as defined in SEQ IDNO : 48.

Figure 27. Schematic map of the vector pYIG7El which has the sequence as defined in SEQID NO : 49.

Figure 28. Schematic map of the vector pSYlYIG7Els which has the sequence as defined inSEQ ID NO : 50.

Figure 29. Schematic map of the vector pPICZalphaA which has the sequence as defined inSEQ ID NO : 51.

Figure 30. Schematic map of the vector pPICZalphaD'which has the sequence as defined inSEQ ID NO : 52.

Figure 31. Schematic map of the vector pPICZalphaE'which has the sequence as defined inSEQ ID NO : 53.

Figure 32. Schematic map of the vector pPICZalphaD'El sH6 which has the sequence as defined in SEQ ID NOt58.

Figure 33. Schematic map of the vector pPICZalphaE'El sH6 which has the sequence as defined in SEQ ID NO : 59.

Figure 34. Schematic map of the vector pPICZalphaD'E2sH6 which has the sequence as defined in SEQ ID NO : 60.

Figure 35. Schematic map of the vector pPICZalphaE'E2sH6 which has the sequence as defined in SEQ ID NO : 61.

Figure 36. Schematic map of the vector pUCl 8MFa which has the sequence as defined inSEQ ID NO : 62.

Figure 37. Elution profile of size exclusion chromatography of IMAC-purified E2-H6 protein expressed from the MFa-E2-H6-expressing Hansenula pol'mofpha (see Example 15). The Xaxis indicates the elution volume (in mL). The vertical lines through the elution profile indicate the fractions collected."P1"= pooled fractions 4 to 9,"P2"= pooled fractions 30 to 35, and"P3"= pooled fractions 37 to 44. The Y-axis indicates absorbance given in mAU (milli absorbance units). The X-axis indicates the elution volume in mL.

Figure 38. The different pools and fractions collected after size exclusion chromatography (see Figure 37) were analyzed by non-reducing SDS-PAGE followed by silver staining of the polyacrylamide gel. The analyzed pools ("PI","P2", and"P3") and fractions (16 to 26) are indicated on top of the picture of the silver-stained gel. At the left (lane"M") are indicated the sizes of the molecular mass markers.

Figure 39. Fractions 17 to 23 of the size exclusion chromatographic step as shown in Figure 37 were pooled and alkylated. Thereafter, the protein material was subjected to Endo H treatment for deglycosylation. Untreated material and Endo H-treated material were separated on an SDS-PAGE gel and blotted to a PVDF membrane. The blot was stained with amido black.

Lane 1: Alkylated E2-H6 before Endo H-treatmentLane 2: Alkylated E2-H6 after Endo H-treatment.

Figure 40. Western-blot analysis of cell lysates of E1 expressed in Saccharomyces cerevisiae.

The Western-blot was developed using the El-specific monoclonal antibody IGH 201.

Lanes 1-4: expression product after 2,3,5 or 7 days expression, respectively, in a Saccharo7nyces clone transformed with pSYlYIG7Els (SEQ ID NO : 50, Figure 28) comprising the nucleotide sequence encoding the chicken lysozyme leader peptide joined to E1-H6.

Lanes 5-7: expression product after 2,3 or 5 days expression, respectively, in aSaccharomyces clone transformed with pSYlaMFElsH6aYIGl (SEQ ID NO : 44, Figure 22) comprising the nucleotide sequence encoding the a-mating factor leader peptide joined to E1- H6.

Lane 8: molecular weight markers with sizes as indicated.

Lane 9: purified Els produced by HCV-recombinant vaccinia virus-infected mammalian cells.

Figure 41. Analysis of the immobilized metal ion affinity chromatography (IMAC)-purifiedE2-H6 protein expressed by and processed from CL-E2-H6 to E2-H6 by H. polymolpha (seeExample 17). Proteins in different wash fractions (lanes 2 to 4) and elution fractions (lanes 5 to 7) were analyzed by reducing SDS-PAGE followed by silver staining of the gel (A, top picture) or by western blot using using a specific monoclonal antibody directed against E2 (B, bottom picture). The sizes of the molecular mass markers are indicated at the left.

Figure 42. Elution profile of the first IMAC chromatography step on a Ni-IDA column (Chelating Sepharose FF loaded with Ni2+, Pharmacia) for the purification of the sulfonatedH6-K-E1 protein produced by H. polymo7pha (see Example 18). The column was equilibrated with buffer A (50 mM phosphate, 6 M GuHCl, 1 % Empigen BB (v/v), pH 7.2) supplemented with 20 mM imidazole.STDC0488 After sample application, the column was washed sequentially with buffer A containing 20 mM and 50 mM imidazole, respectively (as indicated on chromatogram). A further washing and elution step of the His-tagged products was performed by the sequential application of buffer B (PBS, 1 % empigen BB, pH 7.2) supplemented with 50 mM imidazole and 200 mM imidazole respectively (as indicated on chromatogram).

Following fractions were pooled: the wash pool 1 (fractions 8 to 11, wash with 50 mM imidazole). The eluted material was collected as separate fractions 63 to 72 or an elution pool (fractions 63 to 69) was made. The Y-axis indicates absorbance given in mAU (milli absorbance units). The X-axis indicates the elution volume in mLFigure 43. Analysis of the IMAC-purified H6-K-E1 protein (see Figure 42) expressed by and processed from CL-H6-K-E1 to H6-K-E1 by H. polymorpha. Proteins in the wash pool 1 (lane 12) and elution fractions 63 to 72 (lanes 2 to 11) were analyzed by reducing SDS-PAGE followed by silver staining of the gel (A, top picture).STDC0374 Proteins present in the sample beforeIMAC (lane 2), in the flow-through pool (lane 4), in wash pool 1 (lane 5) and in the elution pool (lane 6) were analyzed by western blot using a specific monoclonal antibody directed against El (IGH201) (B, bottom picture; no sample was loaded in lane 3). The sizes of the molecular mass markers (lanes M) are indicated at the left.

Figure 44. Elution profile of the second IMAC chromatography step on a Ni-IDA column (Chelating Sepharose FF loaded with Ni2+, Pharmacia) for the purification of E1 resulting from the in vitro processing of H6-K-E1 (purification : see Figure 42) with Endo Lys-C. The flow through was collected in different fractions (1 to 40) that were screened for the presence of Els-products. The fractions (7 to 28), containing intact E1 processed from H6-K-E1 were pooled. The Y-axis indicates absorbance given in mAU (milli absorbance units). The X-axis indicates the elution volume in mLFigure 45. Western-blot analysis indicating specific Els proteins bands reacting with biotinylated heparin (see also Example 19).STDC0467 Els preparations purified from HCV-recombinant vaccinia virus-infected mammalian cell culture or expressed by H. polymorpha were analyzed. The panel right from the vertical line shows a Western-blot developed with the biotinylated El specific monoclonal IGH 200. The panel left from the vertical line shows aWestern-blot developed with biotinylated heparin. From these results it is concluded that mainly the lower-glycosylated E1 s has high affinity for heparin.

Lanes M: molecular weight marker (molecular weights indicated at the left).

Lanes 1: Els from mammalian cells and alkylated during isolation.

Lanes 2: Els-H6 expressed by H. polymo7pha and sulphonated during isolation.

Lanes 3: El s-H6 expressed by H. polymorpha and alkylated during isolation.

Lanes 4: same material as loaded in lane 2 but treated with dithiotreitol to convert the sulphonated Cys-thiol groups to Cys-thiol.

Figure 46. Size exclusion chromatography (SEC) profile of the purified H. polymo7pha- expressed E2-H6 in its sulphonated form, submitted to a run in PBS, 3% betain to force viruslike particle formation by exchange of Empigen BB for betain. The pooled fractions containing the VLPs used for further study are indicated by"X". The Y-axis indicates absorbance given in mAU (milli absorbance units). The X-axis indicates the elution volume in mL. See also Example 20.

Figure 47. Size exclusion chromatography (SEC) profile of the purified H. poly7iioipha- expressed E2-H6 in its alkylated form, submitted to a run in PBS, 3% betain to force viruslike particle formation by exchange of Empigen BB for betain. The pooled fractions containing the VLPs are indicated by"". The Y-axis indicates absorbance given in mAU (milli absorbance units). The X-axis indicates the elution volume in mL. See also Example 20.

Figure 48. Size exclusion chromatography (SEC) profile of the purified H. polymo7pha- expressed El in its sulphonated form, submitted to a run in PBS, 3% betain to force virus-like particle formation by exchange of Empigen BB for betain. The pooled fractions containing the VLPs are indicated by" < - > ". The Y-axis indicates absorbance given in mAU (milli absorbance units). The X-axis indicates the elution volume in mL. See also Example 20.

Figure 49. Size exclusion chromatography (SEC) profile of the purified H. polymorphaexpressed E1 in its alkylated form, submitted to a run in PBS, 3% betain to force virus-like particle formation by exchange of Empigen BB for betain. The pooled fractions containing the VLPs are indicated by"X". The Y-axis indicates absorbance given in mAU (milli absorbance units). The X-axis indicates the elution volume in mL. See also Example 20.

Figure 50. SDS-PAGE (under reducing conditions) and western blot analysis of VLPs as isolated after size exclusion chromatography (SEC) as described in Figures 48 and 49. Left panel: silver-stained SDS-PAGE gel. Right panel: western blot using a specific monoclonal antibody directed against El (IGH201). Lanes 1 : molecular weight markers (molecular weights indicated at the left); lanes 2: pool of VLPs containing sulphonated E1 (cfr. Figure 48) ; lanes 3: pool of VLPs containing alkylated El (cfr. Figure 49). See also Example 20.

Figure 51. E1 produced in mammalian cells ("M") or Hansenula-produced E1 ("H") were coated on a ELISA solid support to determine the end point titer of antibodies present in sera after vaccination of mice with E1 produced in mammalian cells (top panel), or after vaccination of mice with Hanse7zula-produced E1 (bottom panel). The horizontal bar represents the mean antibody titer. The end-point titers (fold-dilution) are indicated on the Yaxis. See also Example 22.

Figure 52. Hansenula-produced E1 was alkylated ("A") or sulphonated ("S") and coated on aELISA solid support to determine the end point titer of antibodies present in sera after vaccination of mice with Hansenula-produced E1 that was alkylated (top panel), or after vaccination of mice with Ha7lsenula-produced E1 that was sulphonated (bottom panel). The horizontal bar represents the mean antibody titer. The end-point titers (fold-dilution) are indicated on the Y-axis. See also Example 23.

Figure 53. HCV E1 produced by HCV-recombinant vaccinia virus-infected mammalian cells and HCV E1 produced by H. poly7nofpha were coated directly to ELISA plates. End point titers of antibodies were deteremined in sera of chimpanzees vaccinated with E1 produced by mammalian cells (top panel) and of murine monoclonal antibodies raised against E1 produced by mammalian cells (bottom panel). Chimpanzees Yoran and Marti were prophylactically vaccinated. Chimpanzees Ton, Phil, Marcel, Peggy and Femma were therapeutically vaccinated. Black filled bars: ELISA plate coated with El produced by mammalian cells.

Open bars: ELISA plate coated with El produced by Hansenula. The end-point titers (folddilution) are indicated on the Y-axis. See also Example 24.

Figure 54. Fluorophore-assisted carbohydrate gelelectrophoresis of oligosaccharides released from E1 produced by recombinant vaccinia virus-infected mammalian cells and from E1-H6 protein produced by Hansenula.

Lane 1: Glucose ladder standard with indication at the left of the number of monosaccharides (3 to 10, indicated by G3 to G10).

Lane 2: 25 p. g N-linked oligosaccharides released from (alkylated) El produced by mammalian cells.

Lane 3: 25 ag N-linked oligosaccharides released from (alkylated) E1-H6 produced byHansenula.

Lane 4: 100 pmoles maltotetraose.

See also Example 25.

DETAILED DESCRIPTION OF THE INVENTIONIn work leading to the present invention, it was observed that expression of HCV envelope proteins as aMF-HCVENV (a mating factor-HCV envelope protein) preproproteins in Saccharomyces cerevisiae, Pichia pastors and Hansenula polymorplza was possible but that the extent of removal of the pre-pro-or pre-sequences was unacceptably low and that removal of pre-pro-or pre-sequences is very often not occurring with high fidelity.

As a result, many different HCV envelope proteins are produced in these yeasts which do not have a natural amino-terminus (see Example 15). The majority of the HCV envelope proteins expressed in these yeast species were glycosylated (see Examples 6,10,13 and 25). More specifically the S. cerevisiae (glycosylation deficient mutant)-and H. polymorpha-expressedHCV envelope proteins were glycosylated in a manner resembling core-glycosylation. TheHCV envelope proteins expressed in Pichia pastoris were hyperglycosylated despite earlier reports that proteins expressed in this yeast are normally not hyperglycosylated (Gellissen, G.

2000, Sugrue, R. J. et al. 1997).

Constructs were made for expression of the HCV envelope proteins as pre-pro-or pre-proteins wherein these pre-pro-or pre-sequences were either the Carcinus maenas hyperglycemic hormone leader sequence (pre; CHH), the S. occidentalis amylase leader sequence (pre; Amyl), the S. occidentalis glucoamylase Gaml leader sequence (pre; Gaml), the fungal phytase leader sequence (pre; Phy5), the Pichia pastoris acid phosphatase leader sequence (pre; phol), the yeast aspartic protease 3 signal peptide (pre; YAP3), the mouse salivary amylase signal peptide (pre) and the chicken lysozyme leader sequence (pre; CL).

Only for one of these pre-pro-HCVENV or pre-HCVENV proteins, removal of the pre-pro-or pre-sequence with high frequency and high fidelity was observed. This was surprisingly found for the chicken lysozyme leader sequence (CL) and was confirmed both in S. cerevisiae and H. polo7norpha (see Example 16). The CL signal peptide is thus performing very well for expression of glycosylated HCV envelope proteins in eukaryotic cells. This unexpected finding is reflected in the different aspects and embodiments of the present invention as presented below.

A first aspect of the current invention relates to a recombinant nucleic acid comprising a nucleotide sequence encoding a protein comprising an avian lysozyme leader peptide or a functional equivalent thereof joined to an HCV envelope protein or a part thereof In one embodiment thereto, the recombinant nucleic acid comprising nucleotide sequence encodes characterized by the structure CL-UAl) a- (PSl) b- (A2) c]-HCVENV-[(A3) d- (PS2) e- (A4) f] wherein:STDC0488CL is an avian lysozyme leader peptide or a functional equivalent thereof, Al, A2, A3 and A4 are adaptor peptides which can be different or the same, PS1 and PS2 are processing sites which can be the different or the same,HCVENV is a HCV envelope protein or a part thereof, a, b, c, d, e and f are 0 or 1, and wherein, optionally, Al and/or A2 are part of PS1 and/or wherein A3 and/or A4 are part of PS2.

In a further embodiment, the recombinant nucleic acids according to the invention further comprise regulatory elements allowing expression in a eukaryotic host cell of said protein comprising an avian lysozyme leader peptide or a functional equivalent thereof joined to an HCV envelope protein or a part thereof, or of said protein characterized by the structure CL-[(Al) a- (PSl) b (A2) C]-HCVENV-[(A3) d- (PS2) e- (A4) f] The terms"polynucleotide","polynucleic acid","nucleic acid sequence","nucleotide sequence","nucleic acid molecule","oligonucleotide","probe"or"primer", when used herein refer to nucleotides, either ribonucleotides, deoxyribonucleotides, peptide nucleotides or locked nucleotides, or a combination thereof, in a polymeric form of any length or any shape (e. g. branched DNA).STDC0430 Said terms furthermore include double-stranded (ds) and singlestranded (ss) polynucleotides as well as triple-stranded polynucleotides. Said terms also include known nucleotide modifications such as methylation, cyclization and'caps'and substitution of one or more of the naturally occurring nucleotides with an analog such as inosine or with non-amplifiable monomers such as HEG (hexethylene glycol).

Ribonucleotides are denoted as NTPs, deoxyribonucleotides as dNTPs and dideoxyribonucleotides as ddNTPs.

Nucleotides can generally be labeled radioactively, chemiluminescently, fluorescently, phosphorescently or with infrared dyes or with a surface-enhanced Raman label or plasmon resonant particle (PRP).

Said terms"polynucleotide","polynucleic acid","nucleic acid sequence","nucleotide sequence","nucleic acid molecule","oligonucleotide","probe"or"primer"also encompass peptide nucleic acids (PNAs), a DNA analogue in which the backbone is a pseudopeptide consisting of N- (2-aminoethyl)-glycine units rather than a sugar. PNAs mimic the behavior ofDNA and bind complementary nucleic acid strands. The neutral backbone of PNA results in stronger binding and greater specificity than normally achieved. In addition, the unique chemical, physical and biological properties of PNA have been exploited to produce powerful biomolecular tools, antisense and antigene agents, molecular probes and biosensors.STDC0386 PNA probes can generally be shorter than DNA probes and are generally from 6 to 20 bases in length and more optimally from 12 to 18 bases in length (Nielsen, P. E. 2001). Said terms further encompass locked nucleic acids (LNAs) which are RNA derivatives in which the ribose ring is constrained by a methylene linkage between the 2'-oxygen and the 4'-carbon.

LNAs display unprecedented binding affinity towards DNA or RNA target sequences. LNA nucleotides can be oligomerized and can be incorporated in chimeric or mix-meric LNA/DNA or LNA/RNA molecules. LNAs seem to be nontoxic for cultured cells (Orum, H. and Wengel,J. 2001, Wahlestedt, C. et al. 2000). In general, chimeras or mix-mers of any of DNA, RNA,PNA and LNA are considered as well as any of these wherein thymine is replaced by uracil.

The term"protein"refers to a polymer of amino acids and does not refer to a specific length of the product; thus, peptides, oligopeptides, and polypeptides are included within the definition of protein. This term also does not refer to or exclude post-expression modifications of the protein, for example, glycosylations, acetylations, phosphorylations and the like. Included within the definition are, for example, polypeptides containing one or more analogues of an amino acid (including, for example, unnatural amino acids, PNA, etc.), polypeptides with substituted linkages, as well as other modifications known in the art, both naturally occurring and non-naturally occurring.

With"pre-pro-protein"or"pre-protein"is, when used herein, meant a protein comprising a pre-pro-sequence joined to a protein of interest or a protein comprising a prosequence joined to a protein of interest, respectively. As alternatives for"pre-sequence", the terms"signal sequence","signal peptide","leader peptide", or"leader sequence"are used; all refer to an amino acid sequence that targets a pre-protein to the rough endoplasmic reticulum (ER) which is a prerequisite for (N-) glycosylation.STDC0693 The"signal sequence","signal peptide", "leader peptide", or"leader sequence"is cleaved off, i. e."removed"from the protein comprising the signal sequence joined to a protein of interest, at the on the luminal side of thisER by host specific proteases referred to as signal peptidases. Likewise, a pre-pro-protein is converted to a pro-protein upon translocation to the lumen of the ER. Depending on the nature of the"pro"amino acid sequence, it can or can not be removed by the host cell expressing the pre-pro-protein. A well known pre-pro-amino acid sequence is the a mating factor pre-prosequence of the S. cerevisiae a mating factor.

With"recombinant nucleic acid"is intended a nucleic acid of natural or synthetic origin which has been subjected to at least one recombinant DNA technical manipulation such as restriction enzyme digestion, PCR, ligation, dephosphorylation, phosphorylation, mutagenesis, adaptation of codons for expression in a heterologous cell etc. In general, a recombinant nucleic acid is a fragment of a naturally occurring nucleic acid or comprises at least two nucleic acid fragments not naturally associated or is a fully synthetic nucleic acid.

With"an avian leader peptide or a functional equivalent thereof joined to a HCV envelope protein or a part thereof'is meant that the C-tenninal amino acid of said leader peptide is covalently linked via a peptide bond to the N-terminal amino acid of said HCV envelope protein or part thereof. Alternatively, the C-terminal amino acid of said leader peptide is separated from the N-terminal amino acid of said HCV envelope protein or part thereof by a peptide or protein. Said peptide or protein may have the structure-[(Al) a- (PSl) b - (A2) C] as defined above.

The derivation of the HCV envelope protein of interest from the protein comprising an avian lysozyme leader peptide or a functional equivalent thereof joined to an HCV envelope protein or a part thereof or of the protein characterized by the structure CL-[(Al) a- (PSl) b- (A2) C]-HCVENV-[(A3) d- (PS2) e- (A4) f] can be performed in vivo by the proteolytic machinery of the cells in which the pre-protein protein is expressed. More specifically, the step consisting of removal of the avian leader peptide is preferably performed in vivo by the proteolytic machinery of the cells in which the pre-protein is expressed.STDC0855 Derivation may, however, also be performed solely in vitro after and/or during isolation and/or purification of the pre-protein and/or protein from the cells expressing the pre-protein and/or from the culture fluid in which the cells expressing the pre-protein are grown. Alternatively, said in vivo derivation is performed in combination with said in vitro derivation. Derivation of the HCV protein of interest from a recombinantly expressed pre-protein can further comprise the use of (an) proteolytic enzyme (s) in a polishing step wherein all or most of the contaminating proteins co-present with the protein of interest are degraded and wherein the protein of interest is resistant to the polishing proteolytic enzyme (s). Derivation and polishing are not mutually exclusive processes and may be obtained by using the same single proteolytic enzyme.STDC0736 As an example is given here the HCV Els protein of HCV genotype lb (SEQ IDNO : 2) which is devoid of Lys-residues. By digesting of a protein extract containing said HCVE1 proteins with the Endoproteinase Lys-C (endo-lys C), the El proteins will not be degraded whereas contaminating proteins containing one or more Lys-residues are degraded. Such a process may significantly simplify or enhance isolation and/or purification of the HCV E1 proteins. Furthermore, by including in a pre-protein an additional Lys-residue, e. g. between a leader peptide and a HCV E1 protein, the additional advantageous possibility of correct in vitro separation of the leader peptide from the HCV E1 pre-protein is obtainable.STDC0401 Other HCVE1 proteins may comprise a Lys-residue at either one or more of the positions 4,40,42,44, 61,65 or 179 (wherein position 1 is the first, N-terminal natural amino acid of the E1 protein, i. e. position 192 in the HCV polyprotein). In order to enable the use of endo-lys C as described above, said Lys-residues may be mutated into another amino acid residue, preferably into an Arg-residue.

With a"correctly removed"leader peptide is meant that said leader peptide is removed from the protein comprising the signal sequence joined to a protein of interest with high efficiency, i. e. a large number of pre- (pro-) proteins is converted to pro-proteins or proteins, and with high fidelity, i. e. only the pre-amino acid sequence is removed and not any amino acids of the protein of interest joined to said pre-amino acid sequence. With"removal of a leader peptide with high efficiency"is meant that at least about 40%, but more preferentially about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or even 99% of the pre-proteins is converted to the protein from which the pre-sequence is removed.

Alternatively, if a substantial part of the expressed pre-proteins is not converted to the protein from which the pre-sequence is removed, these pre-proteins may still be purified.

With"functional equivalent of the avian lysozyme (CL) leader peptide"is meant a CL leader peptide wherein one or more amino acids have been substituted for another amino acid and whereby said substitution is a conservative amino acid substitution. With"conservative amino acid substitution"is meant a substitution of an amino acid belonging to a group of conserved amino acids with another amino acid belonging to the same group of conserved amino acids. As groups of conserved amino acids are considered: the group consisting of Met,Ile, Leu and Val; the group consisting of Arg, Lys and His; the group consisting of Phe, Trp and Tyr; the group consisting of Asp and Glu; the group consisting of Asn and Gln ; the group consisting of Cys, Ser and Thr; and the group consisting of Ala and Gly.STDC0391 An exemplary conservative amino acid substitution in the CL leader peptide is the naturally variation at position 6, the amino acid at this position being either Val or Ile ; another variation occurs at position 17, the amino acid at this position being, amongst others, Leu or Pro (see SEQ IDNO : 1). The resulting CL leader peptides are thus to be considered as functional equivalents.

Other functional equivalents of the CL leader peptides include those leader peptides reproducing the same technical aspects as the CL leader peptides as described throughout the current invention, including deletion variants and insertion variants.

With"A"or"adaptor peptide"is meant a peptide (e. g. 1 to 30 amino acids) or a protein which may serve as a linker between e. g. a leader peptide and a processing site (PS), a leader peptide and a protein of interest, a PS and a protein of interest, and/or a protein of interest and a PS; and/or may serve as a linker N-or C-terminal of e. g. a leader peptide, a PS or a protein of interest. The adaptor peptide"A"may have a certain three-dimensional structure, e. g. an a-helical or p-sheet structure or a combination thereof. Alternatively the three-dimensional structure of A is not well defined, e. g. a coiled-coil structure. The adaptorA may be part of e. g. a pre-sequence, a pro-sequence, a protein of interest sequence or a processing site.STDC0861 The adaptor A may serve as a tag enhancing or enabling detection and/or purification and/or processing of the protein of which A is a part. One examples of an A peptide is the his-tag peptide (HHHHHH; SEQ ID NO : 63) Hn wherein n usually is six, but may be 7,8,9,10,11, or 12. Other examples of A-peptides include the peptides EEGEPK (Kjeldsen et al. in W098/28429 ; SEQ ID NO : 64) or EEAEPK (Kjeldsen et al. inW097/22706 ; SEQ ID NO : 65) which, when present at the N-terminal of the a protein of interest, were reported to increase fermentation yield but also to protect the N-terminus of the protein of interest against processing by dipeptidyl aminopeptidase and thus resulting in a homogenous N-terminus of the polypeptide.STDC0717 At the same time, in vitro maturation of the protein of interest, i. e. removal of said peptides EEGEPK (SEQ ID NO : 64) and EEAEPK (SEQ ID NO : 65) from the protein of interest can be achieved by using e. g. endo-lys C which cleaves C-terminal of the Lys-residue in said peptides. Said peptides thus serve the function of adaptor peptide (A) as well as processing site (PS), (see below). Adaptor peptides are given in SEQ ID NOs : 63-65,70-72 and 74-82. Another example of an adaptor peptide is the G4S immunosilent linker. Other examples of adaptor peptides or adaptor proteins are listed inTable 2 of Stevens (Stevens et al. 2000).

With"PS"or"processing site"is meant a specific protein processing or processable site. Said processing may occur enzymatically or chemically. Examples of processing sites prone to specific enzymatic processing include IEGR > IX (SEQ ID NO : 66), IDGRX (SEQ ID NO : 67), AEGRX (SEQ ID NO : 68), all recognized by and cleaved between the Arg and Xaa (any amino acid) residues as indicated by the""by the bovine factor Xa protease (Nagai, K. and Thogersen, H. C. 1984). Another example of a PS site is a dibasic site, e. g. Arg-Arg, LysLys, Arg-Lys or Lys-Arg, which is cleavable by the yeast Kex2 protease (Julius, D. et al.

1984). The PS site may also be a monobasic Lys-site. Said monobasic Lys-PS-site may also be included at the C-terminus of an A peptide. Examples of A adaptor peptides comprising aC-terminal monobasic Lys-PS-site are given by SEQ ID NOs : 64-65 and 74-76.

Exoproteolytic removal of a His-tag (HHHHHH; SEQ ID NO : 63) is possible by using the dipeptidyl aminopeptidase I (DAPase) alone or in combination with glutamine cyclotransferase (Qcyclase) and pyroglutamic aminopeptidase (pGAPase) (Pedersen, J. et al.

1999). Said exopeptidases comprising a recombinant His-tag (allowing removal of the peptidase from the reaction mixture by immobilize metal-affinity chromatography, IMAC) are commercially available, e. g. as the TAGZyme System of Unizyme Laboratories (Hrsholm, DK). With"processing"is thus generally meant any method or procedure whereby a protein is specifically cleaved or cleavable at at least one processing site when said processing site is present in said protein. A PS may be prone to endoproteolytic cleavage or may be prone to exproteolytic cleavage, in any case the cleavage is specific, i. e. does not extend to sites other than the sites recognized by the processing proteolytic enzyme. A number of PS sites are given in SEQ ID NOs : 66-68 and 83-84.

The versatility of the [ (Al/3) a/d- (PSl/2) b/e- (A2/4) c/f :] structure as outlined above is demonstrated by means of some examples. In a first example, said structure is present at theC-terminal end of a protein of interest comprised in a pre-protein and wherein A3 is the "VIEGR"peptide (SEQ ID NO : 69) which is overlapping with the factor Xa"IEGRX"PS site (SEQ ID NO : 66) and wherein X=A4 is the histidine-tag (SEQ ID NO : 63) (d, e and f thus are all 1 in this case). The HCV protein of interest can (optionally) be purified by IMAC. After processing with factor Xa, the (optionally purified) HCV protein of interest will carry at its Cterminus a processed PS site which is"IEGR" (SEQ ID NO : 70).STDC0813 Variant processed factor Xa processing site, can be IDGR (SEQ ID NO : 71) or AEGR (SEQ ID NO : 72). In a further example, the [(Al/3) a/d- (PSl/2) b/e- (A2/4) c/f] structure is present at the N-terminus of theHCV protein of interest. Furthermore, Al is the histidine-tag (SEQ ID NO : 63), PS is the factor Xa recognition site (any of SEQ ID NOs : 66-68) wherein X is the protein of interest, and wherein a=b=l and c=0. Upon correct removal of a leader peptide, e. g. by the host cell, the resulting HCV protein of interest can be purified by IMAC (optional). After processing with factor Xa, the protein of interest will be devoid ofthe [(Al) a- (PSl) b- (A2) c] structure.

It will furthermore be clear that any of A1, A2, A3, A4, PS1 and PS2, when present, may be present in a repeat structure. Such a repeat structure, when present, is in this context still counted as 1, i. e. a, b, c, d, e, or f are 1 even if e. g. Al is occurring as e. g. 2 repeats (A1- A1).

With"HCV envelope proteins meant a HCV E1 or HCV E2 envelope protein or a part thereof whereby said proteins may be derived from a HCV strain of any genotype. More specifically, HCVENV is chosen from the group of amino acid sequences consisting of SEQID NOs : 85 to 98, amino acid sequences which are at least 90% identical to SEQ ID NOs : 85 to98, and fragments of any thereof. As"identical"amino acids are considered the groups of conserved amino acids as described above, i. e. the group consisting of Met, Ile, Leu and Val; the group consisting of Arg, Lys and His; the group consisting of Phe, Trp and Tyr; the group consisting of Asp and Glu; the group consisting of Asn and Gln ; the group consisting of Cys,Ser and Thr; and the group consisting of Ala and Gly.

More specifically, the term"HCV envelope proteins"relates to a polypeptide or an analogue thereof (e. g. mimotopes) comprising an amino acid sequence (and/or amino acid analogues) defining at least one HCV epitope of either the El or the E2 region, in addition to a glycosylation site. These envelope proteins may be both monomeric, hetero-oligomeric or homo-oligomeric forms of recombinantly expressed envelope proteins. Typically, the sequences defining the epitope correspond to the amino acid sequences of either the E1 or theE2 region of HCV (either identically or via substitutions of analogues of the native amino acid residue that do not destroy the epitope).

It will be understood that the HCV epitope may co-locate with the glycosylation site.

In general, the epitope-defining sequence will be 3 or 4 amino acids in length, more typically, 5, 6, or 7 amino acids in length, more typically 8 or 9 amino acids in length, and even more typically 10 or more amino acids in length. With respect to conformational epitopes, the length of the epitope-defining sequence can be subject to wide variations, since it is believed that these epitopes are formed by the three-dimensional shape of the antigen (e. g. folding). Thus, the amino acids defining the epitope can be relatively few in number, but widely dispersed along the length of the molecule being brought into the correct epitope conformation via folding. The portions of the antigen between the residues defining the epitope may not be critical to the conformational structure of the epitope.STDC0460 For example, deletion or substitution of these intervening sequences may not affect the conformational epitope provided sequences critical to epitope conformation are maintained (e. g. cysteines involved in disulfide bonding, glycosylation sites, etc.). A conformational epitope may also be formed by 2 or more essential regions of subunits of a homo-oligomer or hetero-oligomer.

As used herein, an epitope of a designated polypeptide denotes epitopes with the same amino acid sequence as the epitope in the designated polypeptide, and immunologic equivalents thereof. Such equivalents also include strain, subtype (=genotype), or type (group)-specific variants, e. g. of the currently known sequences or strains belonging to genotypes I a, lb, 1 c, I d, le, lf, 2a, 2b, 2c, 2d, 2e, 2f, 2g, 2h, 2i, 3a, 3b, 3c, 3d, 3e, 3f, 3g, 4a, 4b, 4c, 4d, 4e, 4f, 4g, 4h, 4i, 4j, 4k, 41, Sa, 5b, 6a, 6b, 6c, 7a, 7b, 7c, 8a, 8b, 9a, 9b, 10a, 11 (and subtypes thereof), 12 (and subtypes thereof) or 13 (and subtypes thereof) or any other newly defined HCV (sub) type.STDC0230 It is to be understood that the amino acids constituting the epitope need not be part of a linear sequence, but may be interspersed by any number of amino acids, thus fonning a conformational epitope.

The HCV antigens of the present invention comprise conformational epitopes from the E1 and/or E2 (envelope) domains of HCV. The E1 domain, which is believed to correspond to the viral envelope protein, is currently estimated to span amino acids 192-383 of the HCV polyprotein (Hijikata, M. et al. 1991). Upon expression in a mammalian system (glycosylated), it is believed to have an approximate molecular weight of 35 kDa as determined via SDSPAGE. The E2 protein, previously called NS1, is believed to span amino acids 384-809 or 384746 (Grakoui, A. et al. 1993) of the HCV polyprotein and also to be an envelope protein. Upon expression in a vaccinia system (glycosylated), it is believed to have an apparent gel molecular weight of about 72 kDa.STDC0739 It is understood that these protein endpoints are approximations (e. g. the carboxy terminal end of E2 could lie somewhere in the 730-820 amino acid region, e. g. ending at amino acid 730,735,740,742,744,745, preferably 746,747,748,750,760,770, 780, 790,800,809,810,820). The E2 protein may also be expressed together with E1, and/or core (aa 1-191), and/or P7 (aa 747-809), and/or NS2 (aa 810-1026), and/or NS3 (aa 1027-1657), and/or NS4A (aa 1658-1711) and/or NS4B (aa 1712-1972) and/or NS5A (aa 1973-2420), and/or NS5B (aa 2421-3011), and/or any part of any of these HCV proteins different from E2.

Likewise, the E1 protein may also be expressed together with the E2, and/or core (aa 1-191), and/or P7 (aa 747-809), and/or NS2 (aa 810-1026), and/or NS3 (aa 1027-1657), and/or NS4A (aa 1658-1711) and/or NS4B (aa 1712-1972), and/or NS5A (aa 1973-2420), and/or NS5B (aa 2421-3011), and/or any part of any of these HCV proteins different from El. Expression together with these other HCV proteins may be important for obtaining the correct protein folding.

The term"El"as used herein also includes analogs and truncated forms that are immunologically cross-reactive with natural E1, and includes E1 proteins of genotypes 1,2,3, 4,5,6,7,8,9,10,11,12 or 13 or any other newly identified HCV type or subtype. The term 'E2'as used herein also includes analogs and truncated forms that are immunologically crossreactive with natural E2, and includes E2 proteins of genotypes 1,2,3,4,5,6,7,8,9,10,11,12 or 13 or any other newly identified HCV type or subtype. For example, insertions of multiple codons between codon 383 and 384, as well as deletions of amino acids 384-387 have been reported (Kato, N. et al. 1992).STDC0372 It is thus also understood that the isolates used in the examples section of the present invention were not intended to limit the scope of the invention and that any HCV isolate from type 1, 2,3,4,5,6,7,8,9,10,11,12 or 13 or any other new genotype ofHCV is a suitable source of El and/or E2 sequence for the practice of the present invention.

Similarly, as described above, the HCV proteins that are co-expressed with the HCV envelope proteins of the present invention, can be derived from any HCV type, thus also from the same type as the HCV envelope proteins of the present invention.

"E1/E2"as used herein refers to an oligomeric form of envelope proteins containing at least one El component and at least one E2 component.

The term"specific oligomeric"El and/or E2 and/or E1/E2 envelope proteins refers to all possible oligomeric forms of recombinantly expressed El and/or E2 envelope proteins which are not aggregates. E1 and/or E2 specific oligomeric envelope proteins are also referred to as homo-oligomeric E1 or E2 envelope proteins (see below). The term'single or specific oligomeric'E1 and/or E2 and/or E1/E2 envelope proteins refers to single monomeric E1 or E2 proteins (single in the strict sense of the word) as well as specific oligomeric E1 and/or E2 and/or E1/E2 recombinantly expressed proteins.STDC0393 These single or specific oligomeric envelope proteins according to the present invention can be further defined by the following formula (El) x (E2) y wherein x can be a number between 0 and 100, and y can be a number between 0 and 100, provided that x and y are not both 0. With x=l and y=0 said envelope proteins include monomeric E1.

The term"homo-oligomer"as used herein refers to a complex of El or E2 containing more than one E1 or E2 monomer, e. g. El/El dimers, El/El/El trimers or El/El/El/El tetramers and E2/E2 dimers, E2/E2/E2 trimers or E2/E2/E2/E2 tetramers, El pentamers and hexamers, E2 pentamers and hexamers or any higher-order homo-oligomers of El or E2 are all 'homo-oligomers'within the scope of this definition. The oligomers may contain one, two, or several different monomers of E1 or E2 obtained from different types or subtypes of hepatitis C virus including for example those described by Maertens et al. in WO 94/25601 and WO 96/13590 both by the present applicants.STDC0157 Such mixed oligomers are still homo-oligomers within the scope of this invention, and may allow more universal diagnosis, prophylaxis or treatment of HCV.

The E1 and E2 antigens used in the present invention may be full-length viral proteins, substantially full-length versions thereof, or functional fragments thereof (e. g. fragments comprising at least one epitope and/or glycosylation site). Furthermore, the HCV antigens of the present invention can also include other sequences that do not block or prevent the formation of the conformational epitope of interest. The presence or absence of a conformational epitope can be readily determined through screening the antigen of interest with an antibody (polyclonal serum or monoclonal to the conformational epitope) and comparing its reactivity to that of a denatured version of the antigen which retains only linear epitopes (if any).STDC0197 In such screening using polyclonal antibodies, it may be advantageous to adsorb the polyclonal serum first with the denatured antigen and see if it retains antibodies to the antigen of interest.

The HCV proteins of the present invention may be glycosylated. Glycosylated proteins intend proteins that contain one or more carbohydrate groups, in particular sugar groups. In general, all eukaryotic cells are able to glycosylate proteins. After alignment of the different envelope protein sequences of HCV genotypes, it may be inferred that not all 6 glycosylation sites on the HCV E1 protein are required for proper folding and reactivity. For instance, HCV subtype lb E1 protein contains 6 glycosylation sites, but some of these glycosylation sites are absent in certain other (sub) types. The fourth carbohydrate motif (on Asn250), present in types lb, 6a, 7,8, and 9, is absent in all other types know today. This sugar-addition motif may be mutated to yield a type lb E1 protein with improved reactivity.STDC0511 Also, the type 2b sequences show an extra glycosylation site in the V5 region (on Asn299). The isolate S83, belonging to genotype 2c, even lacks the first carbohydrate motif in the V1 region (on Asn), while it is present on all other isolates (Stuyver, L. et al. 1994). However, even among the completely conserved sugar-addition motifs, the presence of the carbohydrate may not be required for folding, but may have a role in evasion of immune surveillance.STDC0729 Thus, the identification of the role of glycosylation can be further tested by mutagenesis of the glycosylation motifs.Mutagenesis of a glycosylation motif (NXS or NXT sequences) can be achieved by either mutating the codons for N, S, or T, in such a way that these codons encode amino acids different from N in the case of N, and/or amino acids different from S or T in the case of S and in the case of T. Alternatively, the X position may be mutated into P, since it is known that NPS or NPT are not frequently modified with carbohydrates. After establishing which carbohydrate addition motifs are required for folding and/or reactivity and which are not, combinations of such mutations may be made.STDC0176 Such experiments have been described extensively by Maertens et al. in WO 96/04385 (Example 8), which is included herein specifically by reference.

The term glycosylation as used in the present invention refers to N-glycsoylation unless otherwise specified.

In particular, the present invention relates to HCV envelope proteins, or parts thereof that are core-glycosylated. In this respect, the term"core-glycosylation"refers to a structure"similar" to the structure as depicted in the boxed structure in Figure 3 of Herscovics and Orlean (Herscovics, A. and Orlean, P. 1993). Thus, the carbohydrate structure referred to contains 10 or 11 mono-saccharides. Notably, said disclosure is herein incorporated by reference. The term"similar"intends that not more than about 4 additional mono-saccharides have been added to the structure or that not more than about 3 mono-saccharides have been removed from the structure.STDC0381 Consequently, a carbohydrate structure consists most preferentially of 10 mono-saccharides, but minimally of 7, and more preferentially of 8 or 9 mono-sacchariden, and maximally of 15 mono-saccharides, and more preferentially of 14,13,12, or 11 monosaccharides. The mono-saccharides connoted are preferentially glucose, mannose or N-acetyl glucosamine.

Another aspect of the present invention covers vectors comprising a polynucleic acid, or a part thereof, of the invention. Such vectors comprise universal cloning vectors such as the pUC-series or pEMBL-series vectors and furthermore include other cloning vectors such as cloning vectors requiring a DNA topoisomerase reaction for cloning, TA-cloning vectors and recombination-based cloning vectors such as those used in the Gateway system (InVitrogen).

Vectors comprise plasmids, phagemids, cosmids, bacmids (baculovirus vectors) or may be viral or retroviral vectors. A vector can merely function as a cloning tool and/or-vehicle or may additionally comprise regulatory sequences such as promoters, enhancers and terminators or polyadenylation signals. Said regulatory sequences may enable expression of the information contained within the DNA fragment of interest cloned into a vector comprising said regulatory sequences. Expression may be the production of RNA molecules or mRNA molecules and, optionally, the production of protein molecules thereof. Expression may be the production of an RNA molecule by means of a viral polymerase promoter (e. g.SP6, T7 or T3 promoter) introduced to the 5'-or 3'-end of the DNA of interest.STDC0836 Expression may furthermore be transient expression or stable expression or, alternatively, controllable expression. Controllable expression comprises inducible expression, e. g. using a tetracyclin regulatable promoter, a stress-inducible (e. g. human hsp70 gene promoter), a methallothionine promoter, a glucocorticoid promoter or a progesterone promoter. Expression vectors are known in the art that mediate expression in bacteria (e. g. Escherichia coli, Strepto7nyces species), insect cells (Spodoptera firlgiperda cells, Sf9 cells), plant cells (e. g. potato virus X-based expression vectors, see e. g. Vance et al. 1998 in W098/44097) and mammalian cells (e. g. CHO or COS cells, Vero cells, cells from the HeLa cell line).

This aspect of the invention thus specifically relates to a vector comprising the recombinant nucleic acids according to the invention encoding a protein comprising an avian lysozyme leader peptide or a functional equivalent thereof joined to an HCV envelope protein or a part thereof, or a protein characterized by the structure CL-[(Al) a- (PSl) b- (A2) c]-HCVENV- [ (A3) d- (PS2),- (A4) f].

Embodied in the present invention are also said vectors further comprising regulatory sequences allowing expression of said protein.

In a specific embodiment, said vector according to the invention is an expression vector.

In another specific embodiment, said vector according to the invention is an autonomously replicating vector or an integrative vector.

In yet another specific embodiment, said vector according to the invention is chosen from any of SEQ ID NOs: 20,21,32,35,36,39,40.

Suitable vectors or expression vectors of the invention are yeast vectors. A yeast vector may comprise a DNA sequence enabling the vector to replicate autonomously.

Examples of such sequences are the yeast plasmid 2, replication genes REP 1-3 and origin of replication. Other vectors are integrating partially or completely in the yeast genome. Such integrative vectors are either targeted to specific genomic loci or integrate randomly. In P. pastoris, foreign DNA is targeted to the AOXI and the HIS4 genes (Cregg, J. M. 1999), in P. metlzanolica to the AUGl gene (Raymond, C. K. 1999). In most recombinant H. polymorpha strains, foreign DNA can be randomly integrated using HARS-sequence-harboring circular plasmids for transformation (Hollenberg, C. P. and Gellissen, G. 1997).STDC0665 Targeted integration can be achieved by homologous recombination using the MOX/TRP3 locus for disruption/integration (Agaphonov, M. O. et al. 1995, Sohn, J. H. et al. 1999), the LEU2 gene (Agaphonov, M. O. et al. 1999) or the rDNA cluster (Cox, H. et al. 2000). Transformations in H. polymorpha typically result in a variety of individual, mitotically stable strains containing single to multiple copies of the expression cassette in a head-to-tail arrangement. Strains with up to 100 copies have been identified (Hollenberg, C. P. and Gellissen, G. 1997).STDC0845 Random multiple-copy integration can be forced in the uracil-auxotroph H. polymorpha strain RB11 by a sequence of passages under selective conditions if a H. polymorpha or S. cerevisiaederived URA3 gene is present. A HARS sequence can be excluded (Gatzke, R. et al. 1995) or can be present (Hollenberg, C. P. and Gellissen, G. 1997). This passaging furthermore leads to mitotically stable strains. The vector may also comprise a selectable marker, e. g. theSchizosaccharomyces pombe TPI gene as described by Russell (Russell, P. R. 1985), or the yeast URA3 gene. Other marker genes so far used for transformation of Saccharomyces, for example TRP5, LEU2, ADE1, ADE2, HIS3, HIS4, LYS2, may be obtained from e. g.

Haszsenula, Pichia or Schwanniomyces.

"Regulatory elements (or sequences) allowing expression of a protein in a eukaryotic host"are to be understood to comprise at least a genetic element displaying promoter activity and a genetic element displaying terminator activity whereby said regulatory elements are operably linked to the open reading frame encoding the protein to be expressed.

The term"promoter"is a nucleotide sequence which is comprised of consensus sequences which allow the binding of RNA polymerase to the DNA template in a manner such that mRNA production initiates at the normal transcription initiation site for the adjacent structural gene.

The term"operably linked"refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. A control sequence"operably linked"to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under, conditions compatible with the control sequences.

An"open reading frame" (ORF) is a region of a polynucleotide sequence which encodes a polypeptide and does not contain stop codons; this region may represent a portion of a coding sequence or a total coding sequence.

A"coding sequence"is a polynucleotide sequence which is transcribed into mRNA and/or translated into a polypeptide when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a translation start codon at the 5'-terminus and a translation stop codon at the 3'-terminus. A coding sequence can include but is not limited to mRNA, DNA (including cDNA), and recombinant polynucleotide sequences.

Many regulatory elements are known in the art. Examples of suitable yeast promoters are the Saccha7-oinyces cerevisiae MFal, TPI, ADH I, ADH IT or PGK promoters, or corresponding promoters from other yeast species, e. g. Schizosaccharomyces po7nbe.

Examples of suitable promoters are described by, for instance, (Alber, T. and Kawasaki, G.

1982, Ammerer, G. 1983, Ballou, L. et al. 1991, Hitzeman, R. A. et al. 1980, Kawasaki, G. and Fraenkel, D. G. 1982, Russell, D. W. et al. 1983, Russell, P. R. 1983, Russell, P. R. andHall, B. D. 1983). A suitable yeast terminator is, e. g. the TPI terminator (Alber, T. andKawasaki, G. 1982), or the yeast CYC1 terminator.STDC0835 For methylotrophic or facultative methylotrophic yeast species, the strong and regulatable promoters of the enzymes involved in the methanol utilization pathway are good candidate promoters and include the promoters of the alcohol oxidase genes (AOXI of Pichia pastoris, AUGI of P. methanolica, AODI ofCandida boidinii, and MOX of Hansenula polymorpha), the formaldehyde dehydrogenase promoter (FLDI of P. pastors), the dihydroxyacetone synthase promoter (DASI of C. boidinii) and the formate dehydrogenase promoter (FMD of H. polymorpha). Other promoters include the GAP1 promoter of P. pastoris or H. polymorpha and the PMA1 and 7P6'7 promoter of H.STDC0377 poly7norpha ( (Gellissen, G. 2000), and references cited therein). The terminator element derived from any of these genes are examples of suitable terminator elements, more specifically suitable terminator elements include the AOD1, AOXI and MOX terminator elements.

A further aspect of the current invention covers host cells comprising a recombinant nucleic acid or a vector according to the invention.

In a specific embodiment thereto, said host cells comprising a recombinant nucleic acid or a vector according to the invention are capable of expressing the protein according to the invention comprising the avian leader lysozyme leader peptide or a functional variant thereof joined to an HCV envelope protein or a part thereof.

In an alternative embodiment, said host cells are capable of expressing the protein characterized by the structure CL-[(Al) a- (PSl) b- (A2) C]-HCVENV-[(A3) d- (PS2) e- (A4) f] wherein:CL is an avian lysozyme leader peptide or a functional equivalent thereof, Al, A2, A3 and A4 are adaptor peptides which can be different or the same, PS 1 and PS2 are processing sites which can be the different or the same,HCVENV is a HCV envelope protein or a part thereof, a, b, c, d, e and f axe 0 or 1, and wherein, optionally, Al and/or A2 are part of PS1 and/or wherein A3 and/or A4 are part of PS2.

In a further specific embodiment thereto, said host cells comprising a recombinant nucleic acid or a vector according to the invention are capable of translocating the protein comprising the avian lysozyme leader peptide or a functional equivalent thereof joined to anHCV envelope protein or a part thereof to the endoplasmic reticulum upon removal of the avian lysozyme leader peptide.

In a further specific embodiment thereto, said host cells comprising a recombinant nucleic acid or a vector according to the invention are capable of translocating the protein [(Al) X- (PSl) y- (A2) z]-HCVENV-[(A3) x- (PS2) y- (A4) z] to the endoplasmic reticulum upon removal of the CL peptide wherein said protein and said CL peptide are derived from the protein characterized by the structure CL-[(A1)a-(PS1)b-(A2)c]-HCVENV-[(A3)d-(PS2)e (A4)f] wherein:STDC0461CL is an avian lysozyme leader peptide or a functional equivalent thereof, Al, A2, A3 and A4 are adaptor peptides which can be different or the same,PS1 and PS2 are processing sites which can be the different or the same,HCVENV is a HCV envelope protein or a part thereof, a, b, c, d, e and f are 0 or 1, and wherein, optionally, Al and/or A2 are part of PS1 and/or wherein A3 and/or A4 are part of PS2.

Also embodied are host cells comprising a recombinant nucleic acid or a vector according to the invention which are capable of processing the processing sites PS1 and/orPS2 in said protein translocated to the endoplasmic reticulum.

Also embodied are host cells comprising a recombinant nucleic acid or a vector according to the invention which are capable of N-glycosylating said protein translocated to the endoplasmic reticulum.

Also embodied are host cells comprising a recombinant nucleic acid or a vector according to the invention which are capable of N-glycosylating said protein translocated to the endoplasmic reticulum and processed at said sites PS1 and/or PS2.

More specifically, the host cells comprising a recombinant nucleic acid or a vector according to the invention are eukaryotic cells and, more particularly, yeast cells such as cells of strains of Saccharomyces, such as Saccharomyces cerevisiae, Saccharomyces Iduyveri, or Saccharomyces uvarum, Schizosaccharomyces, such as Schizosaccharomvces ponzbe, Kluyvero7nyces, such as Kluyveromyces lactis, Yarrowia, such as Yarrowia lipolytica, Ha7zsenula, such as Hansenula poly7no7pha, Pichia, such as Pichia pastors, Aspergillus species, Neurospora, such as Neurospora crassa, or Schwanniom'ces, such as Schwanniomyces occide7ztalis,STDC0053 or mutant cells derived from any thereof.

The term"eukaryotic cells"includes lower eukaryotic cells as well as higher eukaryotic cells. Lower eukaryotic cells are cells such as yeast cells, fungal cells and the like. Particularly suited host cells in the context of the present invention are yeast cells or mutant cells derived from any thereof as described above. Mutant cells include yeast glycosylation minus strains, such as Saccharomyces glycosylation minus strains as used in the present invention.Glycosylation minus strains are defined as strains carrying a mutation, in which the nature of the mutation is not necessarily known, but resulting in a glycosylation of glycoproteins comparable to the core-glycosylation In particular, it is contemplated that Saccharomyces glycosylation minus strains carry a mutation resulting in a significant shift in mobility onPAGE of the invertase protein.STDC0478 Invertase is a protein which is normally present inSaccharomyces in a hyperglycosylated form only (Ballou, L. et al. 1991). Glycosylation minus strains include mnn2, and/or ochl and/or 7nnn9 deficient strains. The mutant host cells of the invention do not include cells which, due to the mutation, have lost their capability to remove the avian lysozyme leader peptide from a protein comprising said leader peptide joined to a protein of interest.

Higher eukaryotic cells include host cells derived from higher animals, such as mammals, reptiles, insects, and the like. Presently preferred higher eukaryote host cells are derived from Chinese hamster (e. g. CHO), monkey (e. g. COS and Vero cells), baby hamster kidney (BHK), pig kidney (PK15), rabbit kidney 13 cells (RK13), the human osteosarcoma cell line 143 B, the human cell line HeLa and human hepatoma cell lines like Hep G2, and insect cell lines (e. g. Spodoptera fi ugiperda). The host cells may be provided in suspension or flask cultures, tissue cultures, organ cultures and the like. Alternatively the host cells may also be transgenic animals or transgenic plants.

Introduction of a vector, or an expression vector, into a host cell may be effectuated by any available transformation or transfection technique applicable to said host cell as known in the art. Such transformation or transfection techniques comprise heat-shock mediated transformation (e. g. of E. coli), conjugative DNA transfer, electroporation, PEG-mediated DNA uptake, liposome-mediated DNA uptake, lipofection, calcium-phosphate DNA coprecipitation, DEAE-dextran mediated transfection, direct introduction by e. g. microinjection or particle bombardment, or introduction by means of a virus, virion or viral particle.

Yet another aspect of the invention relates to methods for producing a HCV envelope protein or part thereof in a host cell, said method comprising transforming said host cell with the recombinant nucleic acid according to the invention or with the vector according to the invention, and wherein said host cell is capable of expressing a protein comprising the avian lysozyme leader peptide or a functional equivalent thereof joined to a HCV envelope protein or a part thereof.

In a specific embodiment thereto, said method for producing a HCV envelope protein or part thereof in a host cell is comprising the step of transforming said host cell with the recombinant nucleic acid according to the invention or with the vector according to the invention, and wherein said host cell is capable of expressing the protein characterized by the structure CL-[(Al) a- (PSl) b- (A2) C]-HCVENV-[(A3) d- (PS2) e- (A4) f] wherein:STDC0462CL is an avian lysozyme leader peptide or a functional equivalent thereof, Al, A2, A3 and A4 are adaptor peptides which can be different or the same,PS 1 and PS2 are processing sites which can be the different or the same,HCVENV is a HCV envelope protein or a part thereof, a, b, c, d, e and f are 0 or 1, and wherein, optionally, Al and/or A2 are part of PS1 and/or wherein A3 and/or A4 are part of PS2.

In another specific embodiment thereto, the host cell in said method is capable of translocating the protein CL-[(Al) a- (PSl) b- (A2) C]-HCVENV-[(A3) d- (PS2) e- (A4) f] to the endoplasmic reticulum upon removal of the CL peptide wherein said protein and said CL peptide are derived from the protein characterized by the structure CL-[(Al) a- (PSl) b- (A2) c]-HCVENV-[(A3) d- (PS2) e- (A4) f] wherein:STDC0491CL is an avian lysozyme leader peptide or a functional equivalent thereof, Al, A2, A3 and A4 are adaptor peptides which can be different or the same, PS 1 and PS2 are processing sites which can be the different or the same,HCVENV is a HCV envelope protein or a part thereof, a, b, c, d, e and f are 0 or l, and wherein, optionally, Al and/or A2 are part of PS1 and/or wherein A3 and/or A4 are part of PS2.

Also embodied is the method for producing a HCV envelope protein or part thereof wherein said host cell is capable of N-glycosylating said protein translocated to the endoplasmic reticulum.

Further embodied is the method for producing a HCV envelope protein or part thereof wherein said host cell is capable of N-glycosylating said protein translocated to the endoplasmic reticulum and processed at said sites PS1 and/or PS2.

More specifically, the host cell in any of said methods for producing a HCV envelope protein or part thereof is an eukaryotic cell and, more particularly, a yeast cell such as a cell of strains of Saccharo7nyces, such as Saccharomyces cerevisiae, Saccha o7zyces kluyveri, orSaccharomyces uvarum, Schizosaccharomyces, such as Schizosaccharo7nyces pombe, Kluyveromyces, such as Kluyveromyces lactis, Yarrowia, such as Yarj owia lipolytica, Hansenula, such as Hasaseiaula polymorpha, Pichia, such as Pichia pastors, Aspergillus species, Neurospora, such as Neurospora crassa, or Schwanniomyces, such asSchwanniomyces occidentalis, or mutant cells derived from any thereof.

Any of the methods according to the invention for producing a HCV envelope protein or part thereof may further comprise cultivation of the host cells comprising a recombinant nucleic acid or a vector according to the invention in a suitable medium to obtain expression of said protein.

A further embodiment thereto comprises isolation of the produced HCV envelope protein or part thereof from a culture of said host cells, or, alternatively, from said host cells.Said isolation step may include one or more of (i) lysis of said host cells in the presence of chaotropic agent, (ii) chemical and/or enzymatic modification of the cysteine thiol-groups in the isolated proteins wherein said modification may be reversible or irreversible, and producing a HCV envelope protein or part thereof (iii) heparin affinity chromatography.

Exemplary"chaotropic agents"are guanidinium chloride and urea. In general, a chaotropic agent is a chemical that can disrupt the hydrogen bonding structure of water. In concentrated solutions they can denature proteins because they reduce the hydrophobic effect In the HCV envelope proteins or parts thereof as described herein comprising at least one cysteine residue, but preferably 2 or more cysteine residues, the cysteine thiol-groups can be irreversibly protected by chemical or enzymatic means. In particular,"irreversible protection"or"irreversible blocking"by chemical means refers to alkylation, preferably alkylation of the HCV envelope proteins by means of alkylating agents, such as, for example, active halogens, ethylenimine or N- (iodoethyl) trifluoro-acetamide.STDC0494 In this respect, it is to be understood that alkylation of cysteine thiol-groups refers to the replacement of the thiolhydrogen by (CH2) nR, in which n is 0,1,2,3 or 4 and R= H, COOH, NH2, CONH2, phenyl, or any derivative thereof. Alkylation can be performed by any method known in the art, such as, for example, active halogens X (CH2) nR in which X is a halogen such as I, Br, Cl or F.

Examples of active halogens are methyliodide, iodoacetic acid, iodoacetamide, and 2bromoethylamine. Other methods of alkylation include the use of NEM (N-ethylmaleimide) or Biotin-NEM, a mixture thereof, or ethylenimine or N- (iodoethyl) trifluoroacetamide both resulting in substitution of-H by-CH2-CH2-NH2 (Hermanson, G. T. 1996). The term "alkylating agents"as used herein refers to compounds which are able to perform alkylation as described herein. Such alkylations finally result in a modified cysteine, which can mimic other aminoacids. Alkylation by an ethylenimine results in a structure resembling lysine, in such a way that new cleavage sites for trypsine are introduced (Hermanson, G. T. 1996).

Similarly, the usage of methyliodide results in an amino acid resembling methionine, while the usage of iodoacetate and iodoacetamide results in amino acids resembling glutamic acid and glutamine, respectively. In analogy, these amino acids are preferably used in direct mutation of cysteine. Therefore, the present invention pertains to HCV envelope proteins as described herein, wherein at least one cysteine residue of the HCV envelope protein as described herein is mutated to a natural amino acid, preferentially to methionine, glutamic acid, glutamine or lysine. The term"mutated"refers to site-directed mutagenesis of nucleic acids encoding these amino acids, ie to the well kown methods in the art, such as, for example, site-directed mutagenesis by means of PCR or via oligonucleotide-mediated mutagenesis as described in (Sambrook, J. et al. 1989).STDC0180 It should be understood that for theExamples section of the present invention, alkylation refers to the use of iodo-acetamide as an alkylating agent unless otherwise specified.

It is further understood that in the purification procedure, the cysteine thiol-groups of the HCV proteins or the parts thereof of the present invention can be reversibly protected. The purpose of reversible protection is to stabilize the HCV protein or part thereof. Especially, after reversible protection the sulfur-containing functional group (eg thiols and disulfides) is retained in a non-reactive condition. The sulfur-containing functional group is thus unable to react with other compounds, e. g. have lost their tendency of forming or exchanging disulfide bonds, such as, for example Rl-SH + Rz-SH---X--- > Rl-S-S-R2 Rl-S-S-R2 + R3-SH---X--- > Rl-S-S-R3 + R2-SH ; ---X--- > R1-S-S-R3 + R2-S-S-R4.

The described reactions between thiols and/or disulphide residues are not limited to intermolecular processes, but may also occur intramolecularly.

The term"reversible protection"or"reversible blocking"as used herein contemplates covalently binding of modification agents to the cysteine thiol-groups, as well as manipulating the environment of the HCV protein such, that the redox state of the cysteine thiol-groups remains unaffected throughout subsequent steps of the purification procedure (shielding). Reversible protection of the cysteine thiol-groups can be carried out chemically or enzymatically.

The term"reversible protection by enzymatical means"as used herein contemplates reversible protection mediated by enzymes, such as for example acyl-transferases, e. g. acyltransferases that are involved in catalysing thio-esterification, such as palmitoyl acyltransferase (see below).

The term"reversible protection by chemical means"as used herein contemplates reversible protection: 1. by modification agents that reversibly modify cysteinyls such as for example by sulphonation and thio-esterification;Sulphonation is a reaction where thiol or cysteines involved in disulfide bridges are modified to S-sulfonate : RSH RS-SOs' (Darbre, A. 1986) or RS-SR 2 RS-SO3- (sulfitolysis; (Kumar, N. et al. 1986)). Reagents for sulfonation are e. g. Na2S03, or sodium tetrathionate. The latter reagents for sulfonation are used in a concentration of 10200 mM, and more preferentially in a concentration of 50-200 mM.STDC0247 Optionally sulfonation can be performed in the presence of a catalysator such as, for example Cu2+ (100 uM-l mM) or cysteine (1-10 mM).

The reaction can be performed under protein denaturing as well as native conditions (Kumar, N. et al. 1985, Kumar, N. et al. 1986).

Thioester bond formation, or thio-esterification is characterised by: RSH + R'COX o RS-COR' in which X is preferentially a halogenide in the compound R'CO-X.

2. by modification agents that reversibly modify the cysteinyls of the present invention such as, for example, by heavy metals, in particular Zn2+, Cd2+, mono-, dithio-and disulfide compounds (e. g. aryl-and alkylmethanethiosulfonate, dithiopyridine, dithiomorpholine, dihydrolipoamide, Ellmann reagent, aldrothioltm (Aldrich) (Rein, A. et al. 1996), dithiocarbamates), or thiolation agents (e. g. gluthathion, N-Acetyl cysteine, cysteineamine). Dithiocarbamate comprise a broad class of molecules possessing an R1R2NC (S) SR3 functional group, which gives them the ability to react with sulphydryl groups.STDC0772 Thiol containing compounds are preferentially used in a concentration of 0.1-50 mM, more preferentially in a concentration of 1-50 mM, and even more preferentially in a concentration of 10-50 mM; 3. by the presence of modification agents that preserve the thiol status (stabilise), in particular antioxidantia, such as for example DTT, dihydroascorbate, vitamins and derivates, mannitol, amino acids, peptides and derivates (e. g. histidine, ergothioneine, carnosine, methionine), gallates, hydroxyanisole, hydoxytoluene, hydroquinon, hydroxymethylphenol and their derivates in concentration range of 10 pM-10 mM, more preferentially in a concentration of 1-10 mM ;STDC0379 4. by thiol stabilising conditions such as, for example, (i) cofactors as metal ions (Zn2+, Mg2+), ATP, (ii) pH control (e. g. for proteins in most cases pH-5 or pH is preferentially thiol pKa-2 ; e. g. for peptides purified by Reversed Phase Chromatography at pH-2).

Combinations of reversible protection as described in (1), (2), (3) and (4) may result in similarly pure and refolded HCV proteins. In effect, combination compounds can be used, such as, for example Z103 (Zn carnosine), preferentially in a concentration of 1-10 mM. It should be clear that reversible protection also refers to, besides the modification groups or shielding described above, any cysteinyl protection method which may be reversed enzymatically or chemically, without disrupting the peptide backbone. In this respect, the present invention specifically refers to peptides prepared by classical chemical synthesis (see above), in which, for example, thioester bounds are cleaved by thioesterase, basic buffer conditions (Beekman, N. J. et al. 1997) or by hydroxylamine treatment (Vingerhoeds, M. H. et al. 1996).

Thiol containing HCV proteins can be purified, for example, on affinity chromatography resins which contain (1) a cleavable connector arm containing a disulfide bond (e. g. immobilised 5,5' dithiobis (2-nitrobenzoic acid) (Jayabaskaran, C. et al. 1987) and covalent chromatography on activated thiol-Sepharose 4B (Pharmacia)) or (2) a aminohexanoyl-4-aminophenylarsine as immobilised ligand. The latter affinity matrix has been used for the purification of proteins, which are subject to redox regulation and dithiol proteins that are targets for oxidative stress (Kalef, E. et al. 1993).

Reversible protection may also be used to increase the solubilisation and extraction of peptides (Pomroy, N. C. and Deber, C. M. 1998).

The reversible protection and thiol stabilizing compounds may be presented under a monomeric, polymeric or liposomic form.

The removal of the reversibly protection state of the cysteine residues can chemically or enzymatically accomplished by e. g.: - a reductant, in particular DTT, DTE, 2-mercaptoethanol, dithionite, SnCl2, sodium borohydride, hydroxylamine, TCEP, in particular in a concentration of 1-200 mM, more preferentially in a concentration of 50-200 mM; - removal of the thiol stabilising conditions or agents by e. g. pH increase; - enzymes, in particular thioesterases, glutaredoxine, thioredoxine, in particular in a concentration of 0.01-5 I1M, even more particular in a concentration range of 0.1-5 I1M. ; - combinations of the above described chemical and/or enzymatical conditions.

The removal of the reversibly protection state of the cysteine residues can be carried out in vitro or in vivo, e. g. in a cell or in an individual.

It will be appreciated that in the purification procedure, the cysteine residues may or may not be irreversibly blocked, or replaced by any reversible modification agent, as listed above.

A reductant according to the present invention is any agent which achieves reduction of the sulfur in cysteine residues, e. g."S-S"disulfide bridges, desulphonation of the cysteine residue (RS-SO3-+ RSH). An antioxidant is any reagent which preserves the thiol status or minimises"S-S"formation and/or exchanges. Reduction of the"S-S"disulfide bridges is a chemical reaction whereby the disulfides are reduced to thiol (-SH). The disulfide bridge breaking agents and methods disclosed by Maertens et al. in WO 96/04385 are hereby incorporated by reference in the present description."S-S"Reduction can be obtained by (1) enzymatic cascade pathways or by (2) reducing compounds. Enzymes like thioredoxin, glutaredoxin are known to be involved in the in vivo reduction of disulfides and have also been shown to be effective in reducing"S-S"bridges in vitro.STDC0753 Disulfide bonds are rapidly cleaved by reduced thioredoxin at pH 7.0, with an apparent second order rate that is around 104 times larger than the corresponding rate constant for the reaction with DTT. The reduction kinetic can be dramatically increased by preincubation the protein solution with 1 mM DTT or dihydrolipoamide (Holmgren, A. 1979). Thiol compounds able to reduce protein disulfide bridges are for instance Dithiothreitol (DTT), Dithioerythritol (DTE), (3-mercaptoethanol, thiocarbamates, bis (2-mercaptoethyl) sulfone and N, N'-bis (mercaptoacetyl) hydrazine, and sodium-dithionite.STDC0867 Reducing agents without thiol groups like ascorbate or stannous chloride (SnCl2), which have been shown to be very useful in the reduction of disulfide bridges in monoclonal antibodies (Thakur, M. L. et al. 1991), may also be used for the reduction ofHCV proteins. In addition, changes in pH values may influence the redox status of HCV proteins. Sodium borohydride treatment has been shown to be effective for the reduction of disulfide bridges in peptides (Gailit, J. 1993). Tris (2-carboxyethyl) phosphine (TCEP) is able to reduce disulfides at low pH (Burns, J. et al. 1991). Selenol catalyses the reduction of disulfide to thiols when DTT or sodium borohydride is used as reductant. Selenocysteamine, a commercially available diselenide, was used as precursor of the catalyst (Singh, R. and Kats,L. 1995).

Heparin is known to bind to several viruses and consequently binding to the HCV envelope has already been suggested (Garson, J. A. et al. 1999). In this respect, in order to analyze potential binding of HCV envelope proteins to heparin, heparin can be biotinylated and subsequently the interaction of heparin with HCV envelope proteins can be analyzed, e. g. on microtiterplates coated with HCV envelope proteins. In this way different expression systems can be scrutinized. For example, a strong binding is observed with part of the HCVE1 expressed in Hansenula, while binding with HCV E1 from mammalian cell culture is absent. In this respect, the term"heparin affinity chromatography"relates to an immobilized heparin, which is able to specifically bind to HCV envelope proteins.STDC0646 Proteins of the highmannose type bind agglutinins such as Lens culinaris, Galaozthus nivalis, Narcissus pseudonarcissus Pisum sativum or Allium ui-sinum. Moreover, N-acetylglucosamine can be bound by lectins, such as WGA (wheat germ agglutinin) and its equivalents. Therefore, one may employ lectins bound to a solid phase to separate the HCV envelope proteins of the present invention from cell culture supernatants, cell lysates and other fluids, e. g. for purification during the production of antigens for vaccine or immunoassay use.STDCDBPG0141* With"HCV-recombinant vaccinia virus"is meant a vaccinia virus comprising a nucleic acid sequence encoding a HCV protein or part thereof.

A further aspect of the invention relates to an isolated HCV envelope protein or part thereof resulting from the method of production as described herein. In particular, the invention relates to an isolated HCV envelope protein or part thereof resulting from the expression in an eukaryotic cell of a recombinant nucleic acid comprising a nucleotide sequence encoding a protein comprising an avian lysozyme leader peptide or a functional equivalent thereof joined to said HCV envelope protein or a part thereof.STDC0701 More specifically, said recombinant nucleic acid is encoding a protein which is characterized by the structure CL- [ (AI) a- (PS 1) b- (A2) c]-HCVENV- [ (A3) d- (PS2) e- (A4) f] wherein:CL is an avian lysozyme leader peptide or a functional equivalent thereof, Al, A2, A3 and A4 are adaptor peptides which can be different or the same, PS1 and PS2 are processing sites which can be the different or the same,HCVENV is a HCV envelope protein or a part thereof, a, b, c, d, e and f are 0 or 1, and wherein, optionally, Al and/or A2 are part of PS1 and/or wherein A3 and/or A4 are part of PS2.

In a specific embodiment, the isolated HCV envelope protein or part thereof is derived from said protein comprising an avian lysozyme leader peptide or a functional equivalent thereof joined to said HCV envelope protein or a part thereof. In another specific embodiment, the isolated HCV envelope protein or part thereof is derived from said protein which is characterized by the structure CL-[(Al) a- (PSl) b- (A2) C]-HCVENV-[(A3) d- (PS2) e - (A4) f] wherein:STDC0520CL is an avian lysozyme leader peptide or a functional equivalent thereof, Al, A2, A3 and A4 are adaptor peptides which can be different or the same, PS 1 and PS2 are processing sites which can be the different or the same,HCVENV is a HCV envelope protein or a part thereof, a, b, c, d, e and f axe 0 or 1, and wherein, optionally, Al and/or A2 are part of PS1 and/or wherein A3 and/or A4 are part of PS2.

Another aspect of the current invention relates to the use of the avian lysozyme leader peptide to direct a recombinantly expressed protein to the endoplasmic reticulum of Hansenula polymospha or any mutant thereof.

Thus, all aspects and embodiments of the current invention as described above and relating to a HCV envelope protein can, specific for H. polymorpha or any mutant thereof as host cell, be read as relating to a protein instead of relating to a HCV envelope protein.

More specifically, the current invention also relates to a recombinant nucleic acid comprising a nucleotide sequence encoding a protein comprising an avian lysozyme leader peptide or a functional equivalent thereof joined to a protein of interest or a part thereof.

In one embodiment thereto, the recombinant nucleic acid comprising nucleotide sequence encodes characterized by the structure CL- [(Al) a- (PS l) b (A2) ]-PROT-[(A3) d- (PS2) e- (A4) f] wherein:CL is an avian lysozyme leader peptide or a functional equivalent thereof, Al, A2, A3 and A4 are adaptor peptides which can be different or the same, PS1 and PS2 are processing sites which can be the different or the same,PROT is a protein of interest or a part thereof, a, b, c, d, e and f are 0 or 1, and wherein, optionally, Al and/or A2 are part of PS1 and/or wherein A3 and/or A4 are part of PS2.

In a further embodiment, the recombinant nucleic acids according to the invention further comprise regulatory elements allowing expression in a H. polymorpha cell or any mutant thereof of said protein comprising an avian lysozyme leader peptide or a functional equivalent thereof joined to a protein of interest or a part thereof, or of said protein characterized by the structure CL-[(Al) x- (PSl) y- (A2) z]-PROT-[(A3) x- (PS2) y- (A4) z].

Further included are vectors comprising said recombinant nucleic acids, host cells comprising said recombinant nucleic acids or said vectors, said host cells expressing the protein comprising an avian lysozyme leader peptide or a functional variant thereof joined to a protein of interest and methods for producing said protein of interest in said host cells.

A further aspect of the invention relates to an isolated protein of interest or part thereof resulting from the expression in a Hansenula cell of a recombinant nucleic acid comprising a nucleotide sequence encoding a protein comprising an avian lysozyme leader peptide or a functional equivalent thereof joined to said protein of interest or a part thereof.

More specifically, said recombinant nucleic acid is encoding a protein which is characterized by the structure CL-[(Al) a- (PSl) b- (A2) C]-PROT-[(A3) d- (PS2) e- (A4) f] wherein:CL is an avian lysozyme leader peptide or a functional equivalent thereof, Al, A2, A3 and A4 are adaptor peptides which can be different or the same,PS1 and PS2 are processing sites which can be the different or the same,PROT is a protein of interest or a part thereof, a, b, c, d, e and fare 0 or 1, and wherein, optionally, Al and/or A2 are part of PS1 and/or wherein A3 and/or A4 are part of PS2.

In a specific embodiment, the isolated protein of interest or part thereof is derived from said protein comprising an avian lysozyme leader peptide or a functional equivalent thereof joined to said protein of interest or a part thereof. In another specific embodiment, the isolated protein of interest or part thereof is derived from said protein which is characterized by the structure CL-[(Al) a- (PSl) b- (A2) C]-PROT-[(A3) d- (PS2) e- (A4) f] wherein:STDC0513CL is an avian lysozyme leader peptide or a functional equivalent thereof, Al, A2, A3 and A4 are adaptor peptides which can be different or the same, PS1 and PS2 are processing sites which can be the different or the same,PROT is a protein of interest or a part thereof, a, b, c, d, e and f are 0 or 1, and wherein, optionally, Al and/or A2 are part of PS1 and/or wherein A3 and/or A4 are part of PS2.

In a specific embodiment of the invention, said protein of interest or fragment thereof can e. g. be a viral envelope protein or a fragment thereof such as a HCV envelope protein or HBV (hepatitis B) envelope protein, or fragments thereto. In general, said protein of interest or fragment thereof can be any protein needing the N-glycosylation characteristics of the current invention. Other examplary viral envelope proteins include the HIV (human immunodeficiency virus) envelope protein gpl20 and viral envelope proteins of a virus belonging to the Flavirideae.

The tenns"HCV virus-like particle formed of a HCV envelope protein""oligomeric particles formed of HCV envelope proteins"are herein defined as structures of a specific nature and shape containing several basic units of the HCV E1 and/or E2 envelope proteins, which on their own are thought to consist of one or two E1 and/or E2 monomers, respectively.

It should be clear that the particles of the present invention are defined to be devoid of infectious HCV RNA genomes. The particles of the present invention can be higher-order particles of spherical nature which can be empty, consisting of a shell of envelope proteins in which lipids, detergents, the HCV core protein, or adjuvant molecules can be incorporated.

The latter particles can also be encapsulated by liposomes or apolipoproteins, such as, for example, apolipoprotein B or low density lipoproteins, or by any other means of targeting said particles to a specific organ or tissue. In this case, such empty spherical particles are often referred to as"virus-like particles"or VLPs. Alternatively, the higher-order particles can be solid spherical structures, in which the complete sphere consists of HCV E1 or E2 envelope protein oligomers, in which lipids, detergents, the HCV core protein, or adjuvant molecules can be additionally incorporated, or which in turn may be themselves encapsulated by liposomes or apolipoproteins, such as, for example, apolipoprotein B, low density lipoproteins, or by any other means of targeting said particles to a specific organ or tissue, e. g. asialoglycoproteins.STDC0253 The particles can also consist of smaller structures (compared to the empty or solid spherical structures indicated above) which are usually round (see further)shaped and which usually do not contain more than a single layer of HCV envelope proteins.

A typical example of such smaller particles are rosette-like structures which consist of a lower number of HCV envelope proteins, usually between 4 and 16. A specific example of the latter includes the smaller particles obtained with E1 s in 0.2% CHAPS as exemplified herein which apparently contain 8-10 monomers of Els. Such rosette-like structures are usually organized in a plane and are round-shaped, e. g. in the form of a wheel. Again lipids, detergents, theHCV core protein, or adjuvant molecules can be additionally incorporated, or the smaller particles may be encapsulated by liposomes or apolipoproteins, such as, for example, apolipoprotein B or low density lipoproteins, or by any other means of targeting said particles to a specific organ or tissue.STDC0472 Smaller particles may also form small spherical or globular structures consisting of a similar smaller number of HCV E1 or E2 envelope proteins in which lipids, detergents, the HCV core protein, or adjuvant molecules could be additionally incorporated, or which in turn may be encapsulated by liposomes or apolipoproteins, such as, for example, apolipoprotein B or low density lipoproteins, or by any other means of targeting said particles to a specific organ or tissue.STDC0480 The size (i. e. the diameter) of the above-defined particles, as measured by the well-known-in-the-art dynamic light scattering techniques (see further in examples section), is usually between 1 to 100 nm, more preferentially between 2 to 70 nm, even more preferentially between 2 and 40 mn, between 3 to 20 nm, between 5 to 16 mn, between 7 to 14 nm or between 8 to 12 nm.

In particular, the present invention relates to a method for purifying hepatitis C virus (HCV) envelope proteins, or any part thereof, suitable for use in an immunoassay or vaccine, which method comprising: (i) growing Hansenula or Saccharomyces glycosylation minus strains transformed with an envelope gene encoding an HCV E1 and/or HCV E2 protein, or any part thereof, in a suitable culture medium; (ii) causing expression of said HCV E1 and/or HCV E2 gene, or any part thereof ; and (iii) purifying said HCV E1 and/or HCV E2 protein, or any part thereof, from said cell culture.

The invention further pertains to a method for purifying hepatitis C virus (HCV) envelope proteins, or any part thereof, suitable for use in an immunoassay or vaccine, which method comprising: (i) growing Hansenula or Saccharomyces glycosylation minus strains transformed with an envelope gene encoding an HCV El and/or HCV E2 protein, or any part thereof, in a suitable culture medium ; (ii) causing expression of said HCV El and/or HCV E2 gene, or any part thereof ; and (iii) purifying said intracellularly expressed HCV E1 and/or HCV E2 protein, or any part thereof, upon lysing the transformed host cell.

The invention further pertains to a method for purifying hepatitis C virus (HCV) envelope proteins, or any part thereof, suitable for use in an immunoassay or vaccine, which methodcomprising: (i) growing Hansenula or Saccharomyces glycosylation minus strains transformed with an envelope gene encoding an HCV El and/or HCV E2 protein, or any part thereof, in a suitable culture medium, in which said HCV E1 and/or HCV E2 protein, or any part thereof, comprises at least two Cys-amino acids; (ii) causing expression of said HCV El and/or HCV E2 gene, or any part thereof; and (iii) purifying said HCV E1 and/or HCV E2 protein, or any part thereof, in which saidCys-amino acids are reversibly protected by chemical and/or enzymatic means, from said culture.

The invention further pertains to a method for purifying hepatitis C virus (HCV) envelope proteins, or any part thereof, suitable for use in an immunoassay or vaccine, which method comprising: (i) growing Hansenula or Saccharomyces glycosylation minus strains transformed with an envelope gene encoding an HCV El and/or HCV E2 protein, or any part thereof, in a suitable culture medium, in which said HCV E1 and/or HCV E2 protein, or any part thereof, comprises at least two Cys-amino acids; (ii) causing expression of said HCV E1 and/or HCV E2 gene, or any part thereof; and, (iii) purifying said intracellulary expressed HCV E1 and/or HCV E2 protein, or any part thereof, upon lysing the transformed host cell, in which said Cys-amino acids are reversibly protected by chemical and/or enzymatic means.

The present invention specifically relates to a method for purifying recombinant HCV-yeast proteins, or any part thereof, as described herein, in which said purification includes heparin affinity chromatography.

Hence, the present invention also relates to a method for purifying recombinant HCV yeast proteins, or any part thereof, as described above, in which said chemical means is sulfonation.

Hence, the present invention also relates to a method for purifying recombinant HCV yeast proteins, or any part thereof, as described above, in which said reversibly protection ofCys-amino acids is exchanged for an irreversible protection by chemical and/or enzymatic means.

Hence, the present invention also relates to a method for purifying recombinant HCV yeast proteins, or any part thereof, as described above, in which said irreversible protection by chemical means is iodo-acetamide.

Hence, the present invention also relates to a method for purifying recombinant HCV yeast proteins, or any part thereof, as described above, in which said irreversible protection by chemical means is NEM or Biotin-NEM or a mixture thereof.

The present invention also relates to a composition as defined above which also comprises HCV core, E1, E2, P7, NS2, NS3, NS4A, NS4B, NS5A and/or NS5B protein, or parts thereof. The core-glycosylated proteins E1, E2, and/or E1/E2 of the present invention may, for example, be combined with other HCV antigens, such as, for example, core, P7,NS3, NS4A, NS4B, NS5A and/or NSSB. The purification of these NS3 proteins will preferentially include a reversible modification of the cysteine residues, and even more preferentially sulfonation of cysteines. Methods to obtain such a reversible modification, including sulfonation have been described for NS3 proteins in Maertens et al.

(PCT/EP99/02547). It should be stressed that the whole content, including all the definitions, of the latter document is incorporated by reference in the present application.

Also, the present invention relates to the use of a envelope protein as described herein for inducing immunity against HCV, characterized in that said HCV envelope protein is used as part of a series of time and compounds. In this regard, it is to be understood that the term"a series of time and compounds"refers to administering with time intervals to an individual the compounds used for eliciting an immune response. The latter compounds may comprise any of the following components: a HCV envelope protein according to the invention, HCV DNA vaccine composition, HCV polypeptides.

In this respect, a series comprises administering, either: (i) an HCV antigen, such as, for example, a HCV envelope protein according to the invention, with time intervals, or (ii) an HCV antigen, such as, for example, a HCV envelope protein according to the invention in combination with a HCV DNA vaccine composition, in which said envelope protein and said HCV DNA vaccine composition, can be administered simultaneously, or at different time intervals, including at alternating time intervals, or (iii) either (i) or (ii), possibly in combination with other HCV peptides, with time intervals.

In this regard, it should be clear that a HCV DNA vaccine composition comprises nucleic acids encoding HCV envelope peptide, including E1-, E2-, El/E2-peptides, NS3 peptide, other HCV peptides, or parts of said peptides. Moreover, it is to be understood that said HCV peptides comprises HCV envelope peptides, including E1-, E2-, El/E2-peptides, other HCV peptides, or parts thereof. The term"other HCV peptides"refers to any HCV peptide or fragment thereof. In item (ii) of the above scheme, the HCV DNA vaccine composition comprises preferentially nucleic acids encoding HCV envelope peptides.STDC0871 In item (ii) of the above scheme, the HCV DNA vaccine composition consists even more preferentially of nucleic acids encoding HCV envelope peptides, possibly in combination with a HCV-NS3 DNA vaccine composition. In this regard, it should be clear that an HCV DNA vaccine composition comprises a plasmid vector comprising a polynucleotide sequence encoding an HCV peptide as described above, operably linked to transcription regulatory elements. As used herein, a"plasmid vector"refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Preferred vectors are those capable of autonomous replication and/or expression of nucleic acids to which they have been linked. In general, but not limited to those, plasmid vectors are circular double stranded DNA loops which, in their vector form, are not bound to the chromosome.STDC0776 As used herein, a "polynucleotide sequence"refers to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and single (sense or antisense) and double-stranded polynucleotides. As used herein, the term "transcription regulatory elements"refers to a nucleotide sequence which contains essential regulatory elements, such that upon introduction into a living vertebrate cell it is able to direct the cellular machinery to produce translation products encoded by the polynucleotide. The term"operably linked"refers to a juxtaposition wherein the components are configured so as to perform their usual function.STDC0152 Thus, transcription regulatory elements operably linked to a nucleotide sequence are capable of effecting the expression of said nucleotide sequence.

Those skilled in the art can appreciate that different transcriptional promoters, tenninators, carrier vectors or specific gene sequences may be used succesfully.

Alternatively, the DNA vaccine may be delivered through a live vector such as adenovirus, canary pox virus, MVA, and the like.

The HCV envelope proteins of the present invention, or the parts thereof, are particularly suited for incorporation into an immunoassay for the detection of anti-HCV antibodies, and/or genotyping of HCV, for prognosing/monitoring of HCV disease, or as a therapeutic agent.

A further aspect of the invention relates to a diagnostic kit for the detection of the presence of anti-HCV antibodies in a sample suspected to comprise anti-HCV antibodies, said kit comprising a HCV envelope protein or part thereof according to the invention. In a specific embodiment thereto, said HCV envelope protein or part thereof is attached to a solid support. In a further embodiment, said sample suspected to comprise anti-HCV antibodies is a biological sample.

The term"biological sample"as used herein, refers to a sample of tissue or fluid isolated from an individual, including but not limited to, for example, serum, plasma, lymph fluid, the external sections of the skin, respiratory-, intestinal-or genito-urinary tracts, oocytes, tears, saliva, milk, blood cells, tumors, organs, gastric secretions, mucus, spinal cord fluid, external secretions such as, for example, excrement, urine, sperm, and the like.

Another aspect of the invention refers to a composition comprising an isolated HCV envelope protein or fragment thereof according to the invention. Said composition may further comprise a pharmaceutically acceptable carrier and can be a medicament or a vaccine.

A further aspect of the invention covers a medicament or a vaccine comprising a HCV envelope protein or part thereof according to the invention.

Yet another aspect of the invention comprises a pharmaceutical composition for inducing a HCV-specific immune response in a mammal, said composition comprising an effective amount of a HCV envelope protein or part thereof according to the invention and, optionally, a pharamaceutically acceptable adjuvant. Said pharmaceutical composition comprising an effective amount of a HCV envelope protein or part thereof according to the invention may also be capable of inducing HCV-specific antibodies in a mammal, or capable of inducing a T-cell function in a mammal. Said pharmaceutical compostion comprising an effective amount of a HCV envelope protein or part thereof according to the invention may be prophylactic composition or a therapeutic composition. In a specific embodiment said mammal is a human.

A"mammal"is to be understood as any member of the higher vertebrate class Mammalia, including humans; characterized by live birth, body hair, and mammary glands in the female that secrete milk for feeding the young. Mammals thus also include non-human primates and trimera mice (Zauberman et al. 1999).

A"vaccine"or"medicament"is a composition capable of eliciting protection against a disease, whether partial or complete, whether against acute or chronic disease; in this case the vaccine or medicament is a prophylactic vaccine or medicament. A vaccine or medicament may also be useful for treatment of an already ill individual, in which case it is called a therapeutic vaccine or medicament. Likewise, a pharmaceutical composition can be used for either prophylactic and/or therapeutic purposes in which cases it is a prophylactic and/or therapeutic composition, respectively.

The HCV envelope proteins of the present invention can be used as such, in a biotinylated form (as explained in WO 93/18054) and/or complexed to Neutralite Avidin (Molecular Probes Inc., Eugene, OR, USA), avidin or streptavidin. It should also be noted that "a vaccine"or"a medicament''may comprise, in addition to an active substance, a "pharmaceutically acceptable carrier"or"pharmaceutically acceptable adjuvant"which may be a suitable excipient, diluent, carrier and/or adjuvant which, by themselves, do not induce the production of antibodies harmful to the individual receiving the composition nor do they elicit protection.STDC0634 Suitable carriers are typically large slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers and inactive virus particles. Such carriers are well known to those skilled in the art. Preferred adjuvants to enhance effectiveness of the composition include, but are not limited to: aluminium hydroxide, aluminium in combination with 3-0-deacylated monophosphoryl lipid A as described in WO 93/19780, aluminium phosphate as described inWO 93/24148, N-acetyl-muramyl-L-threonyl-D-isoglutamine as described in U. S.STDC0670 Patent N 4,606,918, N-acetyl-normuramyl-L-alanyl-D-isoglutamine, N-acetylmuramyl-L-alanyl-D isoglutamyl-L-alanine2- (1'2'dipahnitoyl-sn-glycero-3-hydroxyphosphoryloxy) ethylamine, RIBI (ImmunoChem Research Inc., Hamilton, MT, USA) which contains monophosphoryl lipid A, detoxified endotoxin, trehalose-6, 6-dimycolate, and cell wall skeleton (MPL + TDM + CWS) in a 2% squalene/Tween 80 emulsion. Any of the three components MPL, TDM or CWS may also be used alone or combined 2 by 2. The MPL may also be replaced by its synthetic analogue referred to as RC-529.STDC0747 Additionally, adjuvants such as Stimulon (Cambridge Bioscience, Worcester, MA, USA), SAF-1 (Syntex) or bacterial DNA-based adjuvants such as ISS (Dynavax) or CpG (Coley Pharmaceuticals) may be used, as well as adjuvants such as combinations between QS21 and 3-de-O-acetylated monophosphoryl lipidA (W094/00153), or MF-59 (Chiron), or poly [di (carboxylatophenoxy) phosphazene] based adjuvants (Virus Research Institute), or blockcopolymer based adjuvants such as Optivax (Vaxcel, Cythx) or inulin-based adjuvants, such as Algammulin and Gammalnulin (Anutech), Incomplete Freund's Adjuvant (IFA) or Gerbu preparations (Gerbu Biotechnik).STDC0405 It is to be understood that Complete Freund's Adjuvant (CFA) may be used for non-human applications and research purposes as well."A vaccine composition"may further contain excipients and diluents, which are inherently non-toxic and non-therapeutic, such as water, saline, glycerol, ethanol, wetting or emulsifying agents, pH buffering substances, preservatives, and the like.

Typically, a vaccine composition is prepared as an injectable, either as a liquid solution or suspension. Injection may be subcutaneous, intramuscular, intravenous, intraperitoneal, intrathecal, intradermal. Other types of administration comprise implantation, suppositories, oral ingestion, enteric application, inhalation, aerosolization or nasal spray or drops. Solid forms, suitable for solution on, or suspension in, liquid vehicles prior to injection may also be prepared. The preparation may also be emulsified or encapsulated in liposomes for enhancing adjuvant effect. The polypeptides may also be incorporated into Immune StimulatingComplexes together with saponins, for example Quil A (ISCOMS).STDC0847 Vaccine compositions comprise an effective amount of an active substance, as well as any other of the abovementioned components."Effective amount"of an active substance means that the administration of that amount to an individual, either in a single dose or as part of a series, is effective for prevention or treatment of a disease or for inducing a desired effect. This amount varies depending upon the health and physical condition of the individual to be treated, the taxonomic group of the individual to be treated (e. g. human, non-human primate, primate, etc.), the capacity of the individual's immune system to mount an effective immune response, the degree of protection desired, the formulation of the vaccine, the treating doctor's assessment, the strain of the infecting pathogen and other relevant factors.STDC0118 It is expected that the amount will fall in a relatively broad range that can be determined through routine trials.

Usually, the amount will vary from 0.01 to 1000 llg/dose, more particularly from 0.1 to 100 llg/dose. Dosage treatment may be a single dose schedule or a multiple dose schedule. The vaccine may be administered in conjunction with other immunoregulatory agents.

The present invention is illustrated by the Examples as set forth below. TheseExamples are merely illustrative and are not construed to restrict or limit the invention in any way.

EXAMPLESEXAMPLE 1CONSTRUCTION OF pFPMT-MFa-El-H6 SHUTTLE VECTORPlasmids for Hansenaula polymorpha transformation were constructed as follows. The pFPMT-MFa-El-H6 shuttle vector has been constructed in a multi-step procedure. Intially the nucleic acid sequence encoding the HCV Els protein (SEQ ID NO : 2) was cloned after aCHH leader sequence (CHH = Carcinus marnas hyperglycemic hormone) which was subsequently changed for a MFa leader sequence (MFa = Saccharomyces cerevisiae amating factor).

At first a pUC18 derivative has been constructed harboring the CHH-E1-H6 unit as aEcoRIlBamHI fragment by the seamless cloning method (Padgett, K. A. and Sorge, J. A.

1996). Thereto, the Els-H6-encoding DNA fragment and the pCHH-Hir-derived acceptor plasmid were generated by PCR as described below.

Generation of Els-H6-encoding DNA fragmentThe E1-H6 DNA fragment (coding for HCV type lb Els protein consisting of the amino acids 192 to 326 of Els elongated with 6 His-residues; SEQ ID NO : 5) was isolated by PCR from the plasmid pGEMTElsH6 (SEQ ID NO : 6; Figure 1). The following primers were used thereto: - CHHEl-F : 5'-agttactcttca. aggtatgaggtgcgcaacgtgtccg-3 (SEQ ID NO : 7);The Earnll04I site is underlined, the dot marks the cleavage site. The bold printed bases are complementary to those of primer CHH-links.STDC0700 The non-marked bases anneal within the start region of E1 (192-326) in sense direction; and -CHHE1-R : 5'-agttactcttca. cagggatcctccttaatggtgatggtggtggtgcc-3' (SEQ ID NO: 8);The EG/K1104I site is underlined, the dot marks the cleavage site. The bold printed bases are complementary to those of primer MF30-rechts. The bases forming the BamHI site usefull for later cloning procedures are printed in italics. The non-marked bases anneal in antisense direction within the end of the El H6 unit, including the stop codon and three additional bases between the stop codon and the BamHI site.

The reaction mixture was constituted as follows: total volume of 50 I1L containing 20 ng of Eco311-linearizedpGEMTElsH6, each 0.2, uM of primers CHHE1-F and CHHE1-R, dNTP's (each at 0.2 aM), 1 x buffer 2 (Expand Long Template PCR System; Boehringer; Cat No 1681 834), 2.5 U polymerase mix (Expand Long Template PCR System; Boehringer; Cat No 1681 834).

Program 1 was used, said program consisting of the following steps: 1. denaturation: 5min 95 C ; 2.10 cycles of 30 sec denaturation at 95 C, 30 sec annealing at 65 C, and 130 sec elongation at 68 C 3. termination at 4 C.

Then 5 u. L 10 x buffer 2 (Expand Long Template PCR System; Boeringer; Cat No 1681 834), 40 pL H20, and 5 tL of [dATP, dGTP, and dTTP (2mM each); 10mM 5-methyl-dCTP] were added to the sample derived from program 1, and further amplification was performed following program 2 consisting of the following steps: 1. denataruation: 5 min at 95 C 2.5 cycles of 45 sec denaturation at 95 C, 30 sec annealing at 65 C, and 130 sec at 68 C 3. termination at 4 C.

Generation of pCHH-Hir-derived acceptor plasmidThe acceptor fragment was made by PCR from the pCHH-Hir plasmid (SEQ ID NO : 9; Figure 2) and consists of almost the complete pCHH-Hir plasmid, except that the Hir-coding sequence is not present in the PCR product. Following primers were used for this PCR: 1. CHH-links : 5'-agttactcttca. cctcttttccaacgggtgtgtag-3' (SEQ ID NO: 10);The Eam1104I site is underlined, the dot marks the cleavage site. The bold printed bases are complementary to those of primer CHHE1-F. The non-marked bases anneal within the end of the CHH sequence in antisense direction; and 2.STDC0482 MF30-rechts: 5'-agtcactcttca. ctgcaggcatgcaagcttggcg-3' (SEQ ID NO: 11);The Eaml 104I site is underlined, the dot marks the cleavage site. The bold printed bases are complementary to those of primer CHHE1-R. The non-marked bases anneal within the pUC18 sequences behind the cloned CHH-Hirudin HL20 of pCHH-Hir, pointing away from the insert.

The reaction mixture was constituted as follows: total volume of 50 gel containing 20 ng of Asp718I-linearized pCHH-Hir, each 0.2 M of primers CHH-links and MF30-rechts, dNTP's (each at 0.2 mM), 1 x buffer 2 (Expand Long Template PCR System; Boeringer ; Cat No 1681 834), 2.5 U polymerase mix (Expand Long Template PCR System; Boeringer; Cat No 1681 834).

Program 1 was as described above was used.

Then 5 gel 10 x buffer 2 (Expand Long Template PCR System; Boeringer; Cat No 1681 834), 40 I1L H20, and 5 aL of [dATP, dGTP, and dTTP (2mM each); lOmM 5-methyl-dCTP] were added to the sample derived from program 1, and further amplification was performed following program 2 as described above.

Generation of vector pCHHEl The Els-H6-encoding DNA fragment and the. pCHH-Hir-derived acceptor plasmid generated by PCR as described above were purified using the PCR product purification kit (Qiagen) according to the supplier's specifications. Subsequently the purified fragments were digested separately with Ea7nllO4I. Subsequently, the Els-H6 DNA fragment was ligated into the pCHH-Hir-derived acceptor plasmid using T4 ligase (Boehringer) following the specifications of the supplier.

E. coli XL-Gold cells were transformed with the ligation mixture and the plasmid DNA of several ampicillin-resistant colonies were analyzed by digestion with EcoRI and BamHI. A positive clone was selected and denominated as pCHHEl.

Generation of vector pFPMT-CI-ElH6 The EcoRI/BanHI fragment of pCHHEl was ligated with the EcoRI/BamHI digested vector pFPMT121 (SEQ ID NO : 12; Figure 3). T4 ligase (Boehringer) was used according to the supplier's instructions. The ligation mixture was used to transform E. coli DH5aF'cells. Several transformants were analyzed on restriction pattern of the plasmid DNA and a positive clone was withheld which was denominated pFPMT-CHH-ElH6 (SEQ ID NO : 13 ; Figure 4).

Generation of pFPMT-MFa-El-H6Finally the shuttle vector pFPMT-MFa-El-H6 was generated by ligation of three fragments, said fragments being: 1. the 6.961 kb EcoRI/BamHI digested pFPMT121 (SEQ ID NO : 12; Figure 3), 2. the 0.245 EcoRIlHindIII fragment of pUC18-MFa (SEQ ID NO : 62; Figure 36), and 3. the 0.442 kb HindIII/BamHI fragment of a 0.454 kb PCR product derived from pFPMT CHH-E1H6.

The 0.454 kb PCR product giving rise to fragment No. 3 was obtained by PCR using the following primers : 1. primer MFa-El f-Hi : 5'-aggggtaagcttggataaaaggtatgaggtgcgcaacgtgtccgggatgt-3' (SEQ IDNO : 14); and 2. primer El back-Bam : 5'-agttacggatccttaatggtgatggtggtggtgccagttcat-3' (SEQ ID NO : 15).

The reaction mixture was constituted as follows: Reaction mixture volume 50 uL, pFPMT-CHH-El-H6 (EcoRI-linearized ; 15 ng/ L), 0.5 gel; primer MFa-El f-Hi (50 M), 0.25 I1L ; primer E1 back-Bam (50 M), 0.25 aL ; dNTP's (all at 2mM), 5 aL ; DMSO, 5llL ; H2O, 33.5, uL; Expand Long Template PCR System (Boeringer Mannheim; Cat No 1681 834)Buffer 2 (10 x concentrated), 5 u. L ; Expand Long Template PCR System Polymerase mixture (1 U/ L), 0.5 ttL.

The PCR program consisting of the following steps was used: 1. denaturation: 5 min at 95 C 2.29 cycles of 45 sec denaturation at 95 C, 45 sec annealing at 55 C, and 40 sec elongation at 68 C 3. termination at 4 C.

Based on the primers used, the resulting 0.454kb PCR product contained the codons ofE1 (192-326) followed by six histidine codons and a"taa"stop codon, upstream flanked by the 22 3'-terminal base pairs of the MFa prepro sequence (including the cloning relevantHindIII site plus a six base pairs overhang) and downstream flanked by a (cloning relevant)BamHI site and a six base pairs overhang.

For the ligation reaction, T4 DNA ligase (Boehringer Mannheim) has been used according to the supplier's conditions (sample volume 20 uL).

E. coli HB101 cells were transformed with the ligation mixture and positive clones withheld after restriction analysis of the plasmids isolated from several transformants. A positive plasmid was selected and denominated as pFPMT-MFa-El-H6 (SEQ ID NO : 16; Figure 5).

EXAMPLE 2CONSTRUCTION OF pFPMT-CL-El-H6 SHUTTLE VECTORPlasmids for Hansenula polymorpha transformation were constructed as follows. The pFPMT-CL-El-H6 shuttle vector was constructed in three steps starting from pFPMT-MFaE1-H6 (SEQ ID NO : 16, Figure 5).

In a first step, the MFa-El-H6 reading frame of pFPMT-MFa-El-H6 was subcloned into the pUC18 vector. Therefore a 1.798kb SaIIlBamHI fragment of pFPMT-MFa-El-H6 (containing the FMD promotor plus MFa-El-H6) was ligated to the SalIlBamHI vector fragment of pUC18 with T4 ligase (Boehringer) accordig to the supplier's conditions.STDC0603 This resulted in plasmid that is depicted in Figure 6 (SEQ ID NO : 17), and further denominated as pMal2-1 (pUC18-FMD-MFa-El-H6). The ligation mixture was used to transform E. coli DH5aF'cells. Several ampicillin-resistant colonies were picked and analyzed by restriction enzyme digestion of plasmid DNA isolated from the picked clones. A positive clone was further analyzed by determining the DNA sequence of the MFa-El-H6 coding sequence.STDC0618 A correct clone was used for PCR directed mutagenesis to replace the MFa pre-pro-sequence with the codons of the avian lysozyme pre-sequence ("CL" ; corresponding to amino acids 1 to 18 of avian lysozyme; SEQ ID NO : 1). The principle of the applied PCR-directed mutagenesis method is based on the amplification of an entire plasmid with the desired alterations located at the 5'-ends of the primers. In downstream steps, the ends of the linear PCR product are modified prior to self-ligation resulting in the desired altered plasmid.

The following primers were used for the PCR reaction: 1. primer CL hin : 5'-tgcttcctaccactagcagcactaggatatgaggtgcgcaacgtgtccggg-3' (SEQ IDNO : 18); 2. primer CL her neu: 5'-tagtactagtattagtaggcttcgcatgaattcccgatgaaggcagagagcg-3' (SEQ IDNO : 19).

The underlined 5'regions of the primers contain the codons of about half of the avian lysozyme pre-sequence. Primer CL her neu includes a SpeI restriction site (italic). The nonunderlined regions of the primers anneal with the codons for amino acid residues 192 to 199 of E1 (CL hin) or the with the"atg"start codon over the EcoRI site up to position-19 (counted from the EcoRI site) of FMD promoter. The primers are designed to amplify the complete pMal2-1 thereby replacing the codons of the MFa pre-pro-sequence with the codons of the avian lysozyme pre sequence.

The reaction mixture was constituted as follows: pUC18-FMD-Mfa-El-H6 (pMal2-1 ; 1.3 ng/ L), 1 L ; primer CL hin (100 I1M), 2pL ; primer CL her neu (100 M), 2 AL ; dNTP's (all at 2.5mM), 8 uL ; H2O, 76 uL ; Expand Long Template PCR System (Boeringer; Cat No 1681 834) Buffer 2 (10 x concentrated), 10 L ; Expand Long Template PCR System Polymerase mixture (1 U/IlL), 0.75 uL.

The PCR program consisting of the following steps was applied: 1. denaturation: 15 min at 95 C 2.35 cycles of 30 sec denaturation at 95 C, 1 min annealing at 60 C, and 1 min elongation at 72 C 3. termination at 4 C.

The resulting PCR product was checked by agarose gel electrophoresis for its correct size (3.5 kb). Thereafter the 3'-A overhangs form the PCR product were removed by a T4 polymerase reaction resulting in blunt ends with 3'-and 5'-OH-groups. Therefore, the PCR product was treated with T4 polymerase (Boehringer; 1 U/IlL) : to the remaining 95 uL of PCR reaction mix were added 1 I1L T4 polymerase and 4 I1L dNTP's (all at 2.5 mM). The sample was incubated for 20 min at 37 C. Subsequently, the DNA was precipitated with ethanol and taken up in 16 I1L H2O.

Subsequently 5'-phosphates were added to the blunt-ended PCR product by a kinase reaction.

Therefore, to the 16 uL blunt-ended PCR product were added 1 1L T4 polynucleotide kinase (Boehringer; lU/llL), 2 L 10-fold concentrated T4 polynucleotide kinase reaction buffer (Boehringer), and 1 p1L ATP (lOmM). The sample was incubated for 30 min at 37 C.

Subsequently the DNA was applied onto a 1% agarose gel and the correct product band was isolated by means of the gel extraction kit (Qiagen) according to the supplier's conditions.

Fifty (50) ng of the purified product was then self-ligated by use of T4 ligase (Boehringer) according to the supplier's conditions. After 72 h incubation at 16 C, the DNA in the ligation mix was precipitated with ethanol and dissolved in 20 uL water.

E. coli DH5a-F'cells were subsequently transformed with 10 RL of the ligation sample. The plasmid DNA of several ampicillin-resistant clones was checked by means of restriction enzyme digestion. A positive clone was withheld and denominated p27d-3 (pUCl 8-FMD-CL- E1-H6, SEQ ID NO : 20, Figure 7). Subsequently the CL-E1-H6 reading frame was verified byDNA sequencing.

In a last step the pFPMT-CL-El-H6 shuttle vector was constructed as described below. The 0.486kb EcoRIlBamHI fragment of p27d-3 (harboring CL-E1 (192-326)-H6) was ligated with EcoRI/BamHI-digested pFPMT121 (SEQ ID NO : 12, Figure 3). For the reaction, T4 ligase (Boehringer) has been used according to the supplier's recommendations.STDC0656 The DNA in the ligation sample was precipitated with ethanol and dissolved in 10 uL H20. E. coli DH5a F' cells were transformed with 10 gL of the ligation sample, and the plasmid DNA of several ampicillin-resistant colonies were analyzed by digestion with EcoRI and BamHI. Plasmid clone p37-5 (pFPMT-CL-El-H6 ; SEQ ID NO : 21, Figure 8) showed the desired fragment sizes of 0.486kb and 6.961kb. The correct sequence of CL-E1-H6 of p37-5 was verified by sequencing.

EXAMPLE 3CONSTRUCTION OF pFPMT-MFa-E2-H6 AND pMPT-MFa-E2-H6 SHUTTLEVECTORSPlasmids for Hansenula polynl07pha transformation were constructed as follows. The DNA sequence encoding the MFa-E2s (amino acids 384-673 of HCV E2)-VIEGR-His6 (SEQ IDNO : 5) was isolated as a 1.331kb EcoRI/BglII fragment from plasmid pSP72E2H6 (SEQ IDNO : 22, Figure 9). This fragment was ligated with either the EcoRI/BgIII-digested vectors pFPMT121 (SEQ ID NO : 12, Figure C+2) or pMPT121 (SEQ ID NO : 23, Figure 10) using T4DNA ligase (Boehringer Mannheim) according to the supplier's recommendations.STDC0346 After transformation of E. coli and checking of plasmid DNA isolated from different transformants by restriction enzyme digestion, positive clones were withheld and the resulting shuttle vectors are denominated pFPMT-MFa-E2-H6 (SEQ ID NO : 22, Figure 11) and pMPT-MFaE2-H6 (SEQ ID NO : 23, Figure 12), respectively.

EXAMPLE 4CONSTRUCTION OF pFPMT-CL-E2-H6 SHUTTLE VECTORThe shuttle vector pFPMT-CL-E2-H6 was assembled in a three-step procedure. An intermediate construct was prepared in which the E2 coding sequence was cloned behind the signal sequence of a-amylase of Schwanniomyces accidentalis. This was done by the seamless cloning method (Padgett, K. A. and Sorge, J. A. 1996).

Generation of E2s-H6 encoding DNA fragmentAt first the DNA sequence encoding E2-H6 (amino acids 384 to 673 of HCV E2 extended with the linker peptide"VIEGR"and with 6 His residues, SEQ ID NO : 5) was amplified from the pSP72E2H6 plasmid (SEQ ID NO : 24, Figure 11) by PCR.STDC0604 The used primers were denoted MF30E2/F and MF30E2/R and have the following sequences: - primer MF30E2/F : 5'-agtcactcttca. aggcatacccgcgtgtcaggaggg-3' (SEQ IDNO : 26; the Eaml 104I site is underlined, the dot marks the enzyme's cleavage site; the last codon of the S. occidentalis signal sequence is printed in bold; the non-marked bases anneal with the codons of E2 (amino acids 384-390 of HCV E2); - primer MF30E2/R:STDC0580 5'-agtcactcttca. cagggatccttagtgatggtggtgatg-3' (SEQ ID NO : 27; the Eamll04I site is underlined, the dot marks the enzyme's cleavage site; the bold printed bases are complementary to the bold printed bases of primer MF30-Rechts (see below); a BamHI site to be introduced into the construct is printed in italic ; the non-marked sequence anneals with the stop codon and the six terminal His codons of E2 (384-673)VIEGR-H6 (SEQ ID NO : 5).

The reaction mixture was constituted as follows: total volume of 50 uL containing 20 ng of the 1.33kb EcoRIlBglII fragment of pSP72E2H6, each 0.2 RM of primers MF30E2/F andMF30E2/R, dNTP's (each 0.2 I1M), lx buffer 2 (Expand Long Template PCR System; Boeringer ; Cat No 1681 834), 2.5 U polymerase mix (Expand Long Template PCR System;Boeringer; Cat No 1681 834).

The PCR program 3 consisting of the following steps was used: 1. denaturation: 5 min at 95 C 2.10 cycles of 30 sec denaturation at 95 C, 30 sec annealing at 65 C, and 1 min elongation at 68 C 3. termination at 4 C.

Then 10 pL 10 x buffer 2 (Expand Long Template PCR System; Boeringer; Cat No 1681 834), 40 1L H20, and 5 aL of [dATP, dGTP, and dTTP (2mM each); lOmM 5-methyl-dCTP] have been added to the sample derived from PCR program 3, and it has been continued withPCR program 4 consisting of the following steps: 1. denaturation: 5 min at 95 C 2.5 cycles of 45 sec denaturation at 95 C, 30 sec annealing at 65 C, and 1 min elongation at 68 C 3. termination at 4 C.

Generation of pMF30-derived acceptor plasmidThe second fragment originated from the plasmid pMF30 (SEQ ID NO : 28, Figure 13), the amplicon was almost the complete pMF30 plasmid excluding the codons of the mature aamylase of S. occidentalis, modifications relevant for cloning were introduced by primer design.STDC0770 The following set of primers was used: - primer MF30-Links:5'-agtcactcttca. cctcttgtcaaaaataatcggttgag-3' (SEQ ID NO : 29; the Eai, nl 1041 site is underlined, the dot marks the enzyme's cleavage site; the bold printed "cct"is complementary to the bold printed"agg"of primer MF30E2/F (see above); the non-marked and the bold printed bases anneal with the 26 terminal bases of the codons of the a-Amylase of S. occidentalis in pMF30); - primer MF30-Rechts: 5'-agtcactcttca. ctgcaggcatgcaagcttggcg-3' (SEQ IDNO : 11 ; the EamllO4I site is underlined, the dot marks the enzyme's cleavage site; the bold printed"ctg"is complementary to the bold printed"cag"of primer MF30E2/R (see above);STDC0155 the non-marked bases anneal with pUC18 sequences downstream of the stop codon of the a-Amylase of S. occidentalis in pMF30).

The reaction mixture was constituted as follows: total volume of 50 1L containing 20 ng of the BglII-linearized pMF30, each 0.2 AM of primers MF30-Links and MF30-Rechts, dNTP's (each 0.2 HM) J lx buffer 1 (Expand Long Template PCR System; Boeringer; Cat No 1681 834), 2.5 U polymerase mix (Expand Long Template PCR System; Boeringer; Cat No 1681 834). The same PCR programs (programs 3 and 4) as described above were used, except for the elongation times which were extended from 1 minute to 4 minutes in both programs.

Generation of vector pAMY-E2 The E2s-H6 encoding DNA fragment and pMF30-derived acceptor plasmid obtained by PCR were controlled on their respective size by gel electrophoresis on a 1 % agarose gel. The PCR products were purified with a PCR product purification kit (Qiagen) according to the supplier's instructions. Subsequently the purified fragments were digested separately with Eanzl 1004I. Ligation of the E2s-H6 fragment with the pMF30-derived acceptor plasmid was performed by using T4 ligase (Boehringer) according to the supplier's recommendations. The ligation mixture was used to transform Ecoli DH5aF'cells and the plasmid DNA of several. clones was analyzed by EcoRI/Ba7nHI digestion.STDC0136 A positive clone was selected, its plasmid further denominated as pAMY-E2, and utilized for further modifications as described below.

Generation of vector pUC18-CL-E2-H6 The pAMY-E2 was subjected to PCR-directed mutagenesis in order to replace the codons of the a-amylase signal sequence with the codons of the avian lysozyme pre sequence. This is further denominated as"CL", corresponding to the first 18 amino acids of avian lysozymeORF (SEQ ID NO : 1). For this mutagenesis following primers were used: - primer CL2 hin : 5'-tqcttcctaccactagcagcactacrqacatacccgcgtgtcaggaggggcag-3' (SEQID NO : 30); and - primer CL2 her: 5'-taqta tcactggccgtcgtttta- caacgtc-3' (SEQ ID NO : 31).

The underlined 5'-regions of the primers contain the DNA sequence of about half of the avian lysozyme pre sequence. Primer CL2 her includes SpeI (italic) and EcoRI (italic, double underlined) restriction sites. The non-underlined regions of the primers anneal with the codons of amino acid residues 384 to 392 of E2 (CL2 hin) or the with the"atg"start codon over the EcoRI site up to position-19 (counted from the EcoRI site) of FMD promoter. The primers are designed to amplify the complete pAMY-E2 vector thereby replacing the codons of the a-amylase signal sequence with the codons of the avian lysozyme pre-sequence.

The PCR reaction was performed according to the following program: 1. denaturation: 15 min at 95 C 2.35 cycles of 30 sec denaturation at 95 C, 1 min annealing at 60 C, and 1 min elongation at 72 C 3. termination at 4 C.

The following reaction mixture was used: pAMY-E2 (1 ng/uL), luL ; primer CL2 hin (100 M), 2 L ; primer CL2 her (100 uM), 2 uL ; dNTP's (2.5mM each), 8 uL ; H20, 76 gL ;Expand Long Template PCR System (Boeringer; Cat No 1681 834) Buffer 2 (10 x concentrated), 10 u. L ; Expand Long Template PCR System Polymerase mixture (lU/uL), 0.75 1L.

The resulting PCR product was checked by gel electrophoresis on a 1% agarose gel. Prior to ligation the PCR fragment was modified as follows. The 3'-A overhangs were removed by T4 polymerase resulting in blunt ends with 3'-and 5'-OH-groups. Thereto 1 gL T4 polymerase (Boehringer, lU/ L) was added to the residual 95 IL PCR reaction mixture along with 4 I1L dNTP's (2.5 mM each). The sample was incubated for 20 min at 37 c. Subsequently the DNA was precipitated with ethanol and dissolved in 16 I1L deionized water. This was followed by a kinase treatment to add 5'-phosphates to the blunt-ended PCR product.STDC0395 To the 16 pL dissolved blunt-ended PCR product were added 1 tL T4 polynucleotide kinase (Boehringer, 1U/ L), 2 L 10-fold concentrated T4 polynucleotide kinase reaction buffer (Boehringer) and 1 u. L ATP (10 mM). The sample was incubated for 30 min at 37 C.

The kinase treated sample was subsequently separated on a 1% agarose gel. The product band was isolated. The DNA was extracted from the agarose slice by means of the Gel Extraction kit (Qiagen) according to the supplier's recommendations. Fifty (50) ng of the purified product was then self-ligated by use of T4 ligase (Boehringer) according to the supplier's conditions. After 16 h incubation at 16 C, the DNA in the ligation mix was precipitated with ethanol and dissolved in 20 I1L H20 (ligation sample).

E. coli DH5aF'cells were transformed with 10 tL of the ligation sample. Several ampicillin- resistant clones were further characterized via restriction analysis of the isolated plasmidDNA. A positive clone was denominated as pUC18-CL-E2-H6 and was used for further modifications as described below.

Generation of shuttle vector pFPMT-CL-E2-H6A 0.966 kb EcoRIlBanHI fragment was isolated from pUC18-CL-E2-H6 (harboring CLE2 (384-673)-VIEGR-H6) and was ligated into the EcoRI/BamHI-digested pFPMT121 (SEQID NO : 12, Figure 3). For the reaction, T4 ligase (Boehringer) was used according to the supplier's conditions. The ligation sample was precipitated with ethanol and dissolved in 10 fiL water. This was used to transform E. coli DH5aF'cells, a positive clone was withheld after restriction analysis and the respective plasmid is denominated pFPMT-CL-E2-H6 (SEQID NO : 32, Figure 14).

EXAMPLE 5CONSTRUCTION OF pFPMT-CL-K-H6-El SHUTTLE VECTORThe construction of the shuttle vector was comprised of two steps.

In a first step the pUC18-FMD-CL-H6-K-El-H6 construct was constructed by site-directed mutagenesis. The pUC18-FMD-CL-El-H6 was used as template (SEQ ID NO : 20; Figure 7).

The following primers were used : - Primer H6K hin neu : 5'-catcacaaatatgaggtgcgcaacgtgtccgggatgtac-3' (SEQID NO : 37).

-Primer H6KRK her neu: 5'-gtgatqqtqgtcttcctagtgctgctagtggtaggaagcatag-3' (SEQ ID N0 : 38).

(The bases providing additional codons are underlined.)The PCR reaction mixture was constituted as follows: pUC18-FMD-CL-El-H6 (2 ng/ L), 1 L ; primer H6K hin neu (100 I1M), 2, uL ; primer H6KRK her neu (100 M), 2lull ; dNTP's (2.5 mM each), 8 L ; H20,76 gel ; Expand Long Template PCR System (Boeringer ; Cat No 1681 834) Buffer 2 (10 x concentrated), 10 1L ; Expand Long Template PCR SystemPolymerase mixture (1 U/IlL), 0.75 I1L.

The PCR program used consisted of the following steps: - denaturation step : 15minat 95 C - 35 cycles of 30 sec denaturation at 95 C, 1 min annealing at 60 C, and 5 min elongation at 72 C - termination at 4 C.

An aliquot of the PCR sample was analyzed on a 1% agarose gel to check its size, which was correct (-4. 2 kb).

Thereafter the 3'-A overhangs from the PCR product were removed by a T4 polymerase reaction resulting in blunt ends with 3'-and 5'-OH groups. Therefore, to the remaining 95 aL of the PCR reaction were added 1 L T4 polymerase (Boehringer ; 1 U/ L) and 4 1L dNTP's (2.5mM each). The sample was incubated for 20 min at 37 C. Subsequently, the DNA in the sample was precipitated with ethanol and dissolved in 16 pL H20.

Subsequently 5'-phosphates were added to the blunt-ended PCR product by a kinase reaction.

Therefore, to the 16 I1L dissolved blunt-ended PCR product were added 1, uL T4 polynucleotide kinase (Boehringer ; 1 U/ L), 2 L 10-fold concentrated T4 polynucleotide kinase reaction buffer (Boehringer), and 1 aL ATP (10 mM). The sample was incubated for 30 min at 37 C.

Subsequently the sample was applied onto a 1 % agarose gel and the correct product band was isolated, by means of the gel extraction kit (Qiagen) according to the supplier's conditions.

Fifty (50) ng of the purified product has then been self-ligated by use of T4 ligase (Boehringer) according to the supplier's recommendations. After 72 h incubation at 16 C theDNA in the ligation sample was precipitated with ethanol and dissolved in 10 je, L water.

E. coli DH5aF'cells were transformed with 5 gL of the ligation sample. The plasmid DNA of several ampicillin-resitant colonies was analyzed by restriction enzyme digestion, a positive clone was withheld and the corresponding plasmid denominated: pUC18-FMD-CL-H6-El-K- H6 (SEQ ID NO : 39, Figure 17).

In a second step the transfer vector was constructed by a two-fragment ligation. In the following construction fragments with Bell cohesive ends were involved. Since Bcll can cleave its site only on unmethylated DNA, an E. coli dani-strain was transformed with the involved plasmids pUC18-FMD-CL-H6-K-El-H6 (SEQ ID NO : 39, Figure 17) and pFPMTCL-E1 (SEQ ID NO : 36, Figure 16). From each transformation, an ampicillin-resistant colony was picked, grown in a liquid culture and the unmethylated plasmid DNAs were prepared for the further use.STDC0807 The 1.273kb BclIlHindIII fragment of the unmethylated plasmid pUC18FMD-CL-H6-K-E1-H6 (harbouring the FMD promoter, the codons of the CL-H6-K unit, and the start of El) and the 6.057kb BclI/HndIII fragment of plasmid pFPMT-CL-El (harbouring the missing part of the El reading frame starting from the BclI site, without C-terminal His tag, as well as the pFPMT121-located elements except for the FMD promoter) were prepared and ligated together for 72 h at 16 C by use of T4 ligase (Boehringer) in a total volume of 20 u. L according to the supplier's specifications.STDC0462 Subsequently, the ligation mixture was placed on a piece of nitrocellulose membrane floating on sterile deionized water in order to desalt the ligation mixture (incubation for 30 min at room temperature). E. coli TOP10 cells were transformed by electroporation with 5 tL of the desalted sample. The plasmid DNA of several resulting ampicillin-resistant colonies was analyzed by restriction enzyme digestion.

A positive clone was withheld and denominated pFPMT-CL-H6-K-El (SEQ ID NO : 40,Figure 18).

EXAMPLE 6TRANSFORMATION OF HANSENULA POLYMORPHA AND SELECTION OFTRANSFORMANTSH. polymorpha strain RB11 was been transformed (PEG-mediated DNA uptake protocol essentially as described by (Klebe, R. J. et al. 1983) with the modification of (Roggenkamp,R. et al. 1986) with the different parental shuttle vectors as described in Examples 1 to 5. For each transformation, 72 uracil-prototrophic colonies were selected and used for strain generation by the following procedure. For each colony, a 2 mL liquid culture was inoculated and grown in test tubes for 48h (37 C ; 160 rpm; angle 45 ) in selective medium (YNB/glucose, Difco). This step is defined as the, first passaging step.STDC0143 A 150 pL aliquot of the cultures of the first passaging step were used to inoculate 2 mL fresh YNB/glucose medium.

Again, the cultures have been incubated as described above (second passaging step).Together, eight of such passaging steps were carried out. Aliquots of the cultures after the third and the eighth passaging steps were used to inoculate 2 mL of non-selective YPD medium (Difco). After 48 h of incubation at 37 C (160 rpm; angle 45 ; the so-called first stabilization step), 150 pL aliquots of these YPD cultures have been used to inoculate fresh 2 mL YPD cultures which were incubated as described above (second stabilization step).

Aliquots of the cultures of the second stabilization step were then streaked on plates containing selective YNB/agar. These plates were incubated for four days until macroscopic colonies became visible. A well-defined single colony of each separation was defined as strain and used for further expression analysis. Expression analysis was performed on small-scale shake flask cultures. A colony was picked from the above mentioned YNB/agar plate and inoculated in 2 mL YPD and incubated for 48 h as mentioned above. This 2 mL-aliquot was used as seed culture for 20 mL shake flask culture. Glycerol (1%) was used as medium and the shake flask was incubated on a rotary shaker (200 rpm, 37 C). After 48 h of growth 1 % MeOH was added to the culture for induction of the expression cassette.STDC0722 At different time intervals cell pellets of 1 mL aliquots were collected and stored at-20 C until further analysis. Specific protein expression was analyzed by SDS-PAGE/Western blotting. Therefore cell pellets were solubilized in samplebuffer (TrisHCl-SDS) and incubated for > 15 minutes at 95 C. Proteins were separated on a 15% polyacryl-amide gel and blotted (wet-blot; bicarbonate buffer) onto nitrocellulose membranes. Blots were developed using a specific murine anti-EI (IGH 201) or murine antiE2 (IGH 216, described by Maertens et al. in W096/04385) as first antibody, Rabbit-AntiMouse-AP was used as second antibody. Staining was performed with NBT-BCIP.

Positive strains were withheld for further investigation.

Five of these positive clones were used in a shake flask expression experiment. A colony of the respective strain was picked from YNB plate and used to inoculate 2 mL YPD. These cultures were incubated as described above. This cell suspension was used to inoculate a second seed culture of 100 mL YPD medium in a 500 mL shake flask. This shake flask was incubated on a rotary shaker for 48 h at 37 C and 200 rpm.STDC0707 A 25 mL aliquot of this seed culture was used to inoculate 250 mL YPGlycerol (1%) medium and was incubated in a baffled 2-1 shake flask under the above described conditions. 48 h after inoculation 1 % MeOH (promotor induction) was added and the shake flasks were further incubated under the above described conditions. 24 h post induction, the experiment was stopped and cell pellets collected by centrifugation. The expression level of the five different clones was analyzed bySDS-PAGE/Western blotting (conditions as above). A titration series of each clone was loaded onto the gel and the most productive strain was selected for further fermentation and purification trials.

Surprisingly, H. polymorpha, a yeast strain closely related to Pichia pastors (Gellissen, G.

2000), is able to express HCV proteins essentially without hyperglycosylation and thus with sugar moieties comparable in size to the HCV envelope proteins expressed by HCVrecombinant vaccinia virus-infected mammalian cells.

The Hansenula polyino7pha strain RB11 was deposited on April 19,2002 under the conditions of the Budapest Treaty at the Mycoth que de 1'UCL (MUCL), Universit Catholique de Louvain, Laboratoire de mycologie, Place Croix du Sud 3 bte 6, B-1348Louvain-la-Neuve, Belgium and has the MUCL accession number MUCL43805.

EXAMPLE 7 CONSTRUCTION OF pSYlaMFElsH6a VECTORThe S. cerevisiae expression plasmid was constructed as follows. An El-coding sequence was isolated as a NsIllEco52I fragment from pGEMT-ElsH6 (SEQ ID NO : 6, Figure 1) which was made blunt-ended (using T4 DNA polymerase) and cloned in the pYIG5 vector (SEQ IDNO : 41, Figure 19) using T4 DNA ligase (Boehringer) according to the supplier's specifications. The cloning was such that the Els-H6 encoding fragment was joined directly and in frame to the aMF-coding sequence.STDC0324 The ligation mixture was transformed in E. coli DH50cF'cells. Subsequently, the plasmid DNA of several ampicilin resistant clones was analyzed by restriction digestion and a positive clone was withheld and denominated as pYIG5ElH6 (ICCG3470; SEQ ID NO : 42, Figure 20).

The expression cassette (containing the aMF-sequence and the Els-coding region with a Histag) was transferred as a BamHI fragment (2790 bp) of pYIG5E1H6 into the BamBI-digested E. colilS. cerevisiae pSYI shuttle vector (SEQ ID NO : 21, Figure 43). The ligation was performed with T4 DNA ligase (Boehringer) according to supplier's conditions. The ligation mix was transformed to E. coli DH5aF'cells, and the plasmid DNA of several ampicilin resistant colonies was analyzed by restriction enzyme digestion. A positive clone was withheld and denominated pSYlaMFElsH6a (ICCG3479; SEQ ID NO : 44, Figure 22).

EXAMPLE 8CONSTRUCTION OF pSYYIGSE2H6 VECTORThe S. ceoevisiae expression plasmid pSYYIGSE2H6 was constructed as follows. An E2 coding sequence was isolated as a SalIlKpTZI fragment from pBSK-E2sH6 (SEQ ID NO : 45,Figure 23) which was made blunt-ended (using T4 DNA polymerase) and subsequently cloned in the pYIG5 vector (SEQ ID NO : 41, Figure 19) using T4 DNA ligase (Boehringer) according to the supplier's specifications. The cloning was such that the E2-H6 encoding fragment was joined directly and in frame to the aMF-coding sequence.STDC0316 The ligation mixture was then transformed to E. coli DH5aF'cells, the plasmid DNA of several ampicilin resistant clones was analyzed by restriction digestion and a positive clone withheld and denominated as pYIG5HCCL-22aH6 (ICCG2424; SEQ ID NO : 46, Figure 24).

The expression cassette (containing the aMF-sequence and the E2 (384-673) coding region with a His-tag) was transferred as a BamHI fragment (3281 bp) of pYIG5HCCL-22aH6 into the BamHI opened E. colilS. cerevisiae pSYl shuttle vector (SEQ ID NO : 43, Figure 21). The ligation was performed with T4 DNA ligase (Boehringer) according to supplier's conditions.

The ligation mix was transformed to E. coli DH5aF'cells and the plasmid DNA of several ampicilin resistant colonies was analyzed by restriction enzyme digestion. A restriction positive clone was withheld and denominated pSYYIGSE2H6 (ICCG2466; SEQ ID NO : 47,Figure 25).

EXAMPLE 9CONSTRUCTION OF pSYlYIG7Els VECTORThe S. cerevisiae expression plasmid pSYlYIG7Els was constructed as follows. An El coding sequence was isolated as a NsIllEco521 fragment from pGEMT-Els (SEQ ID NO : 6,Figure 1) which was made blunt-ended and cloned into the pYIG7 vector (SEQ ID NO : 48,Figure 26) using T4 DNA ligase (Boehringer) according to the supplier's specifications. The cloning was such that the El-encoding fragment was joined directly and in frame to the aMFcoding sequence. The ligation mixture was transformed to E. coli DH5aF'cells, the plasmidDNA of several ampicilin resistant clones analyzed by restriction digestion and a positive clone withheld and denominated as pYIG7El (SEQ ID NO : 49, Figure 27).

The expression cassette (containing the CL leader sequence and the E1 (192-326) coding region) was transferred as a BamlYI fragment (2790 bp) of pYIG7El into the BamHI-digestedE. colilS. cerevisiae pSYI shuttle vector (SEQ ID NO : 43, Figure 21). The ligation was performed with T4 DNA ligase (Boehringer) according to supplier's conditions. The ligation mix was transformed to E. coli DH5aF'cells and the plasmid DNA of several ampicilin resistant colonies was analyzed by restriction enzyme digestion. A positive clone was withheld and denominated pSYlYIG7Els (SEQ ID NO : 50, Figure 28).

EXAMPLE 10TRANSFORMATION OF SACCHA : ROMYCES CEREVISIalE AND SELECTION OFTRANSFORMANTSIn order to overcome hyper-glycosylation problems, often reported for proteins overexpressed in Saccharomyces cerevisiae, a mutant screening was set-up. This screening was based on the method of Ballou (Ballou, L. et al. 1991), whereby spontaneous recessive orthovanadate-resistant mutants were selected. Initial strain selection was performed based on the glycosylation pattern of invertase, as observed after native gel electrophoresis. A strain, reduced in glycosylation capabilities, was withheld for further recombinant protein expression experiments and denominated strain IYCC155. The nature of mutation has not been further studied.

Said glycosylation-deficient strain IYCC155 was transformed with the plasmids as described in Examples 7 to 9 essentially by to the lithium acetate method as described byElble (Elble, R. 1992). Several Ura complemented strains were picked from a selective YNB + 2 % agar plate (Difco) and used to inoculate 2ml YNB+2% glucose. These cultures were incubated for 72 h, 37 C, 200 rpm on orbital shaker, and the culture supernatant and intracellular fractions were analysed for expression of E1 by western blot developed with a E1 specific murine monoclonal antibody (IGH 201). A high producing clone was withheld for further experiments.

The expression of proteins in the S. cef-ivisiae glycosylation deficient mutant used here is hampered by the suboptimal growth characteristics of such strains which leads to a lower biomass yield and thus a lower yield of the desired proteins compared to wild-type S. cerivisiae strains. The yield of the desired proteins was still substantially higher than in mammalian cells.

EXAMPLE 11CONSTRUCTION OF pPICZalphaD'ElsH6 AND pPICZalphaE'ElsH6 VECTORS The shuttle vector pPICZalphaE'ElsH6 was constructed starting from the pPICZalphaA vector (Invitrogen; SEQ ID NO : 51, Figure 29). In a first step said vector was adapted in order to enable cloning of the E1 coding sequence directly behind the cleavage site of the KEX2 or STE13 processing proteases, respectively. Therefore pPICZalphaA was digested with SoI and Notl. The digest was separated on a 1% agarose gel and the 3519 kb fragment (major part of vector) was isolated and purified by means of a gel extraction kit (Qiagen).STDC0267 This fragment was then ligated using T4 polymerase (Boehringer) according to the supplier's conditions in presence of specific oligonucleotides yielding pPICZalphaD' (SEQ ID NO : 52, Figure 30) or pPICZalphaE' (SEQ ID NO : 53, Figure 31).

The following oligonucleotides were used: for constructing pPICZalphaD' :8822: 5'-TCGAGAAAAGGGGCCCGAATTCGCATGC-3' (SEQ ID NO : 54); and 8823 : 5'-GGCCGCATGCGAATTCGGGCCCCTTTTC-3' (SEQ ID NO : 55) which yield, after annealing, the linker oligonucleotide: TCGAGAAAAGGGGCCCGAATTCGCATGC (SEQ ID NO : 54)CTTTTCCCCGGGCTTAAGCGTACGCCGG (SEQ ID NO : 55) for constructing pPICZalphaE' 8649 : 5'-TCGAGAAAAGAGAGGCTGAAGCCTGCAGCATATGC-3' (SEQ ID NO: 56) 8650: 5'-GGCCGCATATGCTGCAGGCTTCAGCCTCTCTTTTC-3' (SEQ ID NO : 57) which yield, after annealing, the linker oligonucleotide: .STDC0347 TCGAGAAAAGAGAGGCTGAAGCCTGCAGCATATGC (SEQ ID NO : 56) CTTTTCTCTCCGACTTCGGACGTCGTATACGCCGG (SEQ ID NO : 57)These shuttle vectors pPICZalphaD'and pPICZalphaE'have newly introduced cloning sites directly behind the cleavage site of the respective processing proteases, KEX2 and STE13.

The E1-H6 coding sequence was isolated as a NslllEco52I fragment from pGEMT-ElsH6 (SEQ ID NO : 6, Figure 1). The fragment was purified using a gel extraction kit (Qiagen) after separation of the digest on a 1% agarose gel. The resulting fragment was made blunt-ended (using T4 DNA polymerase) and ligated into either pPICZalphaD'or pPICZalphaE'directly behind the respective processing protease cleavage site.

The ligation mixtures were transformed to E. coli TOP 1 OF'cells and plasmid DNA of several zeocin resistant colonies analyzed by restriction enzyme digestion. Positive clones were withheld and denominated pPICZalphaD'ElsH6 (ICCG3694; SEQ ID NO : 58, Figure 32) and pPICZalphaE'ElsH6 (ICCG3475; SEQ ID NO : 59, Figure 33), respectively.

EXAMPLE 12CONSTRUCTION OF pPICZalphaD'E2sH6 AND pPICZalphaE'E2sH6 VECTORSThe shuttle vectors pPICZalphaD'and pPICZalphaE'were constructed as described inExample 11.

The E2-H6 coding sequence was isolated as a SalIlKpnI fragment from pBSK-E2sH6 (SEQID NO : 45, Figure 23). The fragment was purified with a gel extraction kit (Qiagen) after separation of the digest on a 1% agarose gel. The resulting fragment was made blunt-ended (using T4 DNA polymerase) and ligated into either pPICZalphaD'or pPICZalphaE'directly behind the respective processing protease cleavage site.

The ligation mixture was transformed to E. coli TOP1OF'cellls and the plasmid DNA of several zeocin resistant colonies was analyzed by restriction enzyme digestion. Positive clone were withheld and denominated pPICZalphaD'E2sH6 (ICCG3692; SEQ ID NO : 60, Figure 34) and pPICZalphaE'E2sH6 (ICGG3476; SEQ ID NO : 61, Figure 35), respectively.

EXAMPLE 13TRANSFORMATION OF PICHIA PASTORS AND SELECTION OFTRANSFORMANTSThe P. pastoris shuttle plasmids as described in Examples 11 and 12 were transformed to P. pastors cells according to the supplier's conditions (Invitrogen). An E1-and an E2-producing strain were withheld for further characterization.

The HCV envelope proteins were expressed in P. pastors, a yeast strain well known for the fact that hyperglycosylation is normally absent (Gellissen, G. 2000) and previously used to express dengue virus E protein as GST fusion (Sugrue, R. J. et al. 1997). Remarkably, the resulting P. pasto is-expressed HCV envelope proteins displayed a comparable glycosylation as is observed in wild-type Saccharomyces strains. More specifically, the HCV envelope proteins produced by P. pastoris are hyperglycosylated (based on the molecular weight of the expression products detected in western-blots of proteins isolated from transformed P. pastors cells).

EXAMPLE 14CULTURE CONDITIONS FOR SACCHAROMYCES CEREVISIAE, HANSENULA POLYMORPHA AND PICHI4 PASTORIS SaccAtaromyces cerevisiaeCell bankingOf the selected recombinant clone a master cell bank and working cell bank were prepared.

Cryo-vials were prepared from a mid-exponentially grown shake flask culture (incubation conditions as for fermentation seed cultures, see below). Glycerol was added (50 % final conc.) as a cryoprotectant.

FermentationSeed cultures were started from a cryo-preserved working cell bank vial and grown in 500 mL medium (YNB supplemented with 2 % sucrose, Difco) in a 2 L Erlemneyer shake flasks at 37 C, 200 rpm for 48h.

Fermentations were typically performed in Biostat C tormentors with a working volume of 15L (B. Braun Int., Melsungen, Germany). The fermentation medium contained 1% YeastExtract, 2% Peptone and 2 % sucrose as carbon source. Poly-ethylene glycol was used as antifoam agent.

Temperature, pH and dissolved oxygen were typically controlled during the fermentation, applicable set-points are summarised in Table 1. Dissolved oxygen was cascade controlled by agitation/aeration. pH was controlled by addition of NaOH (0.5 M) or H3PO4 solution (8.5 %).

Table 1. Typical parameter settings for S. cerevisiae fermentationsEMI71.1 Parameter <SEP> set-point<tb> Temperature <SEP> 33-37 <SEP> C<tb> pH <SEP> 4. <SEP> 2-5.0<tb> DO <SEP> (growth <SEP> phase) <SEP> 10-40 <SEP> % <SEP> air <SEP> saturation<tb> DO <SEP> (induction) <SEP> 0-5 <SEP> %<tb> aeration <SEP> 0.5-1.8 <SEP> vim*<tb> agitation <SEP> 150-900 <SEP> rpm<tb> * volume replacement per minuteThe fermentation was started by the addition of 10 % seed-culture. During the growth phase the sucrose concentration was monitored off-line by HPLC analysis (Polysphere ColumnOAKC Merck).

During the growth phase the dissolved oxygen was controlled by cascade control (agitation/aeration). After complete metabolisation of sucrose the heterologous protein production was driven by the endogenous produced ethanol supplemented with stepwise addition of EtOH in order to maintain the concentration at approximately 0.5 % (off-line HPLC analysis, polyspher OAKC column) During this induction phase the dissolved oxygen was controlled below 5% air-saturation, by manual adjustment of airflow rate and agitator speed.

Typically the fermentation was harvested 48 to 72 h post induction by concentration via tangential flow filtration followed by centrifugation of the concentrated cell suspension to obtain cell pellets. If not analyzed immediately, cell pellets were stored at-70 C.

Hansenula polymorpha Cell bankingOf the selected recombinant clone a master cell bank and working cell bank were prepared. Cryo-vials were prepared from a mid-exponentially grown shake flask culture (incubation conditions as for fermentation seed cultures, see below). Glycerol was added (50 % final conc.) as a cryoprotectant.

FermentationSeed cultures were started from a cryo-preserved (-70 C) working cell bank vial and grown in 500 mL medium (YPD, Difco) in a 2 L Erlenmeyer shake flasks at 37 C, 200 rpm for 48h.

Fermentations were typically performed in Biostat C fermentors with a working volume of 15L (B. Braun Int., Melsungen, Germany). The fermentation medium contained 1% YeastExtract, 2% Peptone and 1% glycerol as carbon source. Poly-ethylene glycol was used as antifoam agent.

Temperature, pH, air-in and dissolved oxygen were typically controlled during the fermentation, applicable set-points are summarised in Table 2. Dissolved oxygen was controlled by agitation. pH was controlled by addition of NaOH (0.5 M) or H3P04 solution (8.5 %).

Table 2. Typical parameter settings for H. polymorpha fermentationsEMI72.1 Parameter <SEP> set-point<tb> Temperature <SEP> 30-40 <SEP> C<tb> pH <SEP> 4. <SEP> 2-5.0<tb> DO <SEP> 10-40 <SEP> % <SEP> air <SEP> saturation<tb> aeration <SEP> 0.5-1.8 <SEP> vvm*<tb> agitation <SEP> 150-900 <SEP> rpm<tb> * volume replacement per minuteThe fermentation was started by the addition of 10 % seed-culture. During the growth phase the glycerol concentration was monitored off-line (Polysphere Column OAKC Merck) and 24 h after complete glycerol consumption 1% methanol was added in order to induce the heterologous protein expression.STDC0267 The fermentation was harvested 24 h post induction by concentration via tangential flow filtration followed by centrifugation of the concentrated cell suspension to obtain cell pellets. If not analyzed immediately, cell pellets were stored at<RTI ID=73.1>70 C.

Picliia pastoris</RTI> Small scale protein production experiments with recombinant Pichia pastors were set up in shake flask cultures. Seed cultures were grown overnight in YPD medium (Difco). Initial medium pH was corrected to 4.5. Shake flasks were incubated on a rotary shaker at 200-250 rpm, 37 C.

The small scale production was typically performed at 500 mL scale in 2 L shake flasks and were started with a 10 % inoculation in expression medium, containing 1% Yeast extract, 2 %Peptone (both Difco), and 2 % glycerol as carbon source. Incubation conditions were as for the seed culture. Induction was started by addition of 1 % MeOH approximately 72 h after inoculation. The cells were collected 24 h post induction by centrifugation. If not analyzed immediately, cell pellets were stored at-70 C.

EXAMPLE 15LEADER PEPTIDE REMOVAL FROM MFa-El-H6 AND MFa-E2-H6 PROTEINSEXPRESSED IN SELECTED YEAST CELLSThe expression products in Halisenula polymorphe and a Saccharomyces cerevisiae glycosylation minus strain of the HCV El and E2 protein constructs with the a-mating factor (aMF) leader sequence of S. cerevisiae were further analyzed.STDC0783 Since both genotype lb HCVEls (aa 192-326) and HCV E2s (aa 383-673 extended by the VIEGR (SEQ ID NO : 69)sequence) were expressed as C-terminal his-tagged (H6, HHHHHH, SEQ ID NO : 63; saidHCV proteins are furtheron in this Example denoted as aMF-El-H6 and aMF-E2-H6) proteins, a rapid and efficient purification of the expressed products after guanidinium chloride (GuHCl)-solubilization of the yeast cells was performed on Ni-IDA (Niiminodiacetic acid). In brief, cell pellets were resuspended in 50 mM phosphate, 6M GuHCl, pH 7.4 (9 vol/g cells). Proteins were sulfonated overnight at room temperature (RT) in the presence of 320 mM (4% w/v) sodium sulfite and 65 mM (2% w/v) sodium tetrathionate.STDC0877 The lysate was cleared after a freeze-thaw cycle by centrifugation (10.000 g, 30 min, 4 C) andEmpigen (Albright & Wilson, UK) and imidazole were added to the supernatant to final concentrations of 1% (w/v) and 20 mM, respectively. The sample was filtrated (0.22 jj-M) and loaded on a Ni-IDA Sepharose FF column, which was equilibrated with 50 mM phosphate, 6M GuHCl, 1% Empigen (buffer A) supplemented with 20 mM imidazole. The column was washed sequentially with buffer A containing 20 mM and 50 mM imidazole, respectively, till absorbance at 280 nm reached baseline level. The his-tagged products were eluted by applying buffer D, 50 mM phosphate, 6M GuHCl, 0.2 % (for El) or 1 % (for E2) Empigen, 200 mM imidazole.STDC0151 The eluted materials were analyzed by SDS-PAGE and western-blot using a specific monoclonal antibodies directed against E1 (IGH201), or E2 (IGH212).

The El-products were immediately analyzed by Edman degradation.

Since at this stage, SDS-PAGE revealed already a very complex picture of protein bands forHCV E2, a further fractionation by size exclusion chromatography was performed. The NiIDA eluate was concentrated by ultrafiltration (MWCO 10 kDa, centriplus, Amicon,Millipore) and loaded on Superdex G200 (10/30 or 16/60; Pharmacia) in PBS, 1% Empigen or PBS, 3% Empigen. Elution fractions, containing E2 products, with a Mr between-80 kDa and-45 kDa, i. e. fractions 17-23 of the elution profile in Figure 37 based on the migration onSDS-PAGE (Figure 38), were pooled and alkylated (incubation with 10 mM DTT 3h at RT followed by incubation with 30 mM iodo-acetamide for 3 hours at RT). Samples for aminoterminal sequencing were treated with Endo H (Roche Biochemicals) or left untreated.STDC0200 The glycosylated and deglycosylated E2 products were blotted on PVDF-membranes for aminoterminal sequencing. An amido-black stained blot of glycosylated and deglycosylated E2 is shown in Figure 39.

The sequencing of both E1 and E2 purified products lead to the disappointing observation that removal of the signal sequence from the HCV envelope proteins is occurring only partially (see Table 3). In addition, the majority of the side products (degradation products and products still containing the leader sequence or part thereof) are glycosylated. This glycosylation resides even in part on the non-cleaved fragment of the signal sequence which contains also an N-glycosylation site. These sites can be mutated in order to result in less glycosylated side products. However, even more problematic is the finding that some alternatively cleaved products have only 1 to 4 amino acids difference compared to the desired intact envelope protein.STDC0544 Consequently, purification of the correctly processed product is virtually impossible due to the lack of sufficiently discriminating biochemical characteristics between the different expression products. Several of the degradation products may be a result of a Kex-2 like cleavage (e. g. the cleavage observed after aa 196 of El which is a cleavage after an arginine), which is also required for the cleavage of the a-mating factor leader and which can thus not be blocked without disturbing this essential process.

A high E1 producing clone derived from transformation of S. cerevisiae IYCC155 with pSYlYIG7Els (SEQ ID NO : 50 ; Figure 28) was compared with a high producing clone derived from transformation of S. cerevisiae IYCC155 with pSYlaMFElsH6aYIGIEls (SEQID NO : 44; Figure 22). The intracellular expression of the El protein was evaluated after 2 up to 7 days after induction, and this by means of Western-blot using the El specific monoclonal antibody (IGH 201). As can be judged from Figure 40, maximal expression was observed after 2 days for both strains but the expression patterns for both strains are completely different.STDC0178 Expression with the a-mating factor leader results in a very complex pattern of bands, which is a consequence from the fact that the processing of the leader is not efficient.

This leads to several expression products with a different amino-terminus and of which some are modified by 1 to 5 N-glycosylations. However, for the E1 expressed with the CL leader a limited number of distinct bands is visible which reflects the high level of correct CL leader removal and the fact that only this correctly processed material may be modified by Nglycosylation (1 to 5 chains), as observed for HanseTZUla-derived E1 expressed with the sameCL leader (see Example 16).

The hybridoma cell line producting the monoclonal antibody directed against E1 (IGH201) was deposited on March 12,1998 under the conditions of the Budapest Treaty at theEuropean Collection of Cell Cultures, Centre for Applied Microbiology & Research,Salisbury, Wiltshire SP4 OJG, UK, and has the accession number ECACC 98031216. The monoclonal antibody directed against E2 (IGH212) has been described as antibody 12D11F2 in Example 7.4 by Maertens et al. in W096/04385.

Table 3. Identification of N-termini of aMF-El-H6 and aMF-E2-H6 proteins expressed in S. cerevisiae or H. polymo7pha. Based on the N-tenninal sequencing the amount of N-termini of the mature E1-H6 and E2-H6 proteins could be estimated ("mature"indicating correct removal of the aMF signal sequence). The total amount of protein products was calculated as pmol of protein based on the intensity of the peaks recovered by Edman degradation.

Subsequently, for each specific protein (i. e. for each'detected N-terminus') the mol % versus the total was estimated.EMI76.1 <tb>

<SEP> Yeast <SEP> aMF-E1-H6 <SEP> aMF-E2-VIEGR-H6<tb> <SEP> S. <SEP> cerevisiae <SEP> Experiment <SEP> 1 <SEP> :<tb> <SEP> 16% <SEP> of <SEP> proteins <SEP> still <SEP> containing<tb> <SEP> aMF <SEP> sequences<tb> <SEP> - <SEP> 18% <SEP> of <SEP> proteins <SEP> cleaved<tb> <SEP> between <SEP> aa <SEP> 195 <SEP> and <SEP> 196 <SEP> of <SEP> E1<tb> <SEP> 66% <SEP> of <SEP> proteins <SEP> with <SEP> correctly<tb> <SEP> removed <SEP> aMF<tb> <SEP> Experiment <SEP> 2/<tb> <SEP> 18% <SEP> of <SEP> proteins <SEP> still <SEP> containing<tb> <SEP> aMF <SEP> sequences<tb> <SEP> 33% <SEP> of <SEP> proteins <SEP> cleaved<tb> <SEP> between <SEP> aa <SEP> 195 <SEP> and <SEP> 196 <SEP> of <SEP> E1<tb> <SEP> 8% <SEP> of <SEP> other <SEP> proteins <SEP> other <SEP> E <SEP> I<tb> <SEP> cleavage <SEP> products<tb> <SEP> 44% <SEP> of <SEP> proteins <SEP> with <SEP>

correctly<tb> <SEP> removed <SEP> aMF<tb> H. <SEP> polymorpha <SEP> - <SEP> 64% <SEP> of <SEP> proteins <SEP> still <SEP> containing-75% <SEP> of <SEP> proteins <SEP> still<tb> <SEP> aMF <SEP> sequences <SEP> containing <SEP> aMF <SEP> sequences<tb> <SEP> 6% <SEP> of <SEP> proteins <SEP> cleaved <SEP> between-25% <SEP> of <SEP> proteins <SEP> with<tb> <SEP> aa <SEP> 192 <SEP> and <SEP> 193 <SEP> of <SEP> E1 <SEP> correctly <SEP> removed <SEP> aMF<tb> <SEP> 30% <SEP> of <SEP> proteins <SEP> with <SEP> correctly<tb> <SEP> removed <SEP> aMF<tb> EXAMPLE 16EXPRESSION OF AN El CONSTRUCT IN YEAST SUITABLE FOR LARGE SCALEPRODUCTION AND PURIFICATION Several other leader sequences were used to replace the S.STDC0742 cerevisiae aMF leader peptide including CHH (leader sequence of Carcinus marnas hyperglycemic hormone), Amyl (leader sequence of amylase from S. occidentalis), Gaaml (leader sequence of glucoamylase from S. occidentalis), Phy5 (leader sequence from fungal phytase), phol (leader sequence from acid phosphatase from Pichia pastors) and CL (leader of avian lysozyme C, 1,4-beta-Nacetylmuramidase C) and linked to E1-H6 (i. e. E1 with C-terminal his-tag). All constructs were expressed in Hansenula polymorpha and each of the resulting cell lysates was subjected to western blot analysis.STDC0424 This allowed already to conclude that the extent of removal of the leader or signal sequence or peptide was extremely low, except for the construct wherein CL is used as leader peptide. This was confirmed for the CHH-E1-H6 construct by Edmandegradation of Ni-IDA purified material: no correctly cleaved product could be detected although several different sequences were recovered (see Table 4).

Table 4. Identification of N-termini of CHH-E1-H6 proteins expressed in H. polymorpha, based on N-terminal amino acid sequencing of different protein bands after separation bySDS-PAGE and blotting to a PVDF membrane.EMI77.1 <tb>

Molecular <SEP> size <SEP> Identified <SEP> N-termini<tb> 45 <SEP> kD <SEP> starts <SEP> at <SEP> amino <SEP> acid <SEP> 27 <SEP> of <SEP> CHH <SEP> leader <SEP> = <SEP> only <SEP> pre-sequence <SEP> cleaved, <SEP> pro<tb> <SEP> sequence <SEP> still <SEP> attached<tb> 26 <SEP> kD-partially <SEP> starts <SEP> at <SEP> amino <SEP> acid <SEP> 1 <SEP> of <SEP> CHH <SEP> leader <SEP> = <SEP> no <SEP> removal <SEP> of <SEP> pre<tb> <SEP> pro-sequence<tb> <SEP> - <SEP> partially <SEP> starts <SEP> at <SEP> amino <SEP> acid <SEP> 9 <SEP> of <SEP> CHH <SEP> leader <SEP> = <SEP> product <SEP> of<tb> <SEP> alternative <SEP> translation <SEP> starting <SEP> at <SEP> second <SEP> AUG <SEP> codon<tb> 24 <SEP> kD-partially <SEP> starts <SEP> at <SEP> amino <SEP> acid <SEP> 1 <SEP> of <SEP> CHH <SEP> leader <SEP> = <SEP> no <SEP> removal <SEP> of <SEP> pre<tb> <SEP> pro-sequence<tb>

<SEP> - <SEP> partially <SEP> starts <SEP> at <SEP> amino <SEP> acid <SEP> 9 <SEP> of <SEP> CHH <SEP> leader <SEP> = <SEP> product <SEP> of<tb> <SEP> alternative <SEP> translation <SEP> starting <SEP> at <SEP> second <SEP> AUG <SEP> codon<tb> As mentioned already, the western-blots of the cell lysates revealed a pattern of E1 specific protein bands, indicative for a higher degree of correct removal of the CL leader peptide. This is surprising since this leader is not derived from a yeast. Amino acid sequencing by Edman degradation of GuHCl solubilized and Ni-IDA purified material indeed confirmed that 84% of the El proteins is correctly cleaved and the material is essentially free of degradation products.STDC0863 Still 16% of non-processed material is present but since this material is nonglycosylated it can be easily removed from the mixture allowing specific enrichment of correctly cleaved and glycosylated E1. Such a method for enrichment may be an affinity chromatography on lectins, other alternatives are also given in Example 19. Alternatively, the higher hydrophobic character of the non-glycosylated material may be used to select and optimize other enrichment procedures. The correct removal of the CL leader peptide from the CL-E1-H6 protein was further confirmed by mass spectrometry which also confirmed that up to 4 out of the 5 N-glycosylation sites of genotype lb Els can be occupied, whereby the sequence NNSS (amino acids 233 to 236; SEQ ID NO : 73) are considered to be a single Nglycosylation site.

EXAMPLE 17PURIFICATION AND BIOCHEMICAL CHARACTERIZATION OF THE HCV E2PROTEIN EXPRESSED IN HANSENULA POLYMORPHA FROM THE CL-E2-H6 ENCODING CONSTRUCTThe efficiency of removal of the CL leader peptide from CL-E2-VIEGR-H6 (further in thisExample denoted as"CL-E2-H6") protein expressed in Hansenula poZomo7pha was analyzed.

Since the HCV E2s (aa 383-673) was expressed as a his-tagged protein, a rapid and efficient purification of the expressed protein after GuHCI-solubilization of collected cells was performed on Ni-IDA. In brief, cell pellets were resuspended in 30 mM phosphate, 6 M GuHCl, pH 7.2 (9 mL buffer/g cells). The protein was sulfonated overnight at room temperature in the presence of 320 mM (4% w/v) sodium sulfite and 65 mM (2% w/v) sodium tetrathionate. The lysate was cleared after a freeze-thaw cycle by centrifugation (10.000 g, 30 min, 4 C). Empigen BB (Albright & Wilson) and imidazole were added to a final concentration of 1% (w/v) and 20 mM, respectively. All further. chromatographic steps were executed on an Akta FPLC workstation (Pharmacia).STDC0889 The sample was filtrated through a 0.22 urn pore size membrane (cellulose acetate) and loaded on a Ni-IDA column (ChelatingSepharose FF loaded with Ni2+, Pharmacia), which was equilibrated with 50 mM phosphate, 6M GuHCl, 1 % Empigen BB, pH 7.2 (buffer A) supplemented with 20 mM imidazole. The column was washed sequentially with buffer A containing 20 mM and 50 mM imidazole, respectively, till the absorbance at 280 nm reached the baseline level. The his-tagged products were eluted by applying buffer D, 50 mM phosphate, 6 M GuHCl, 0.2 % Empigen BB (pH 7.2), 200 mM imidazole. The purified materials were analysed by SDS-PAGE and western blot using a specific monoclonal antibody directed against E2 (IGH212) (Figure 41).STDC0840 TheIMAC-purified E2-H6 protein was also subjected to N-terminal sequencing by Edman degradation. Thereto proteins were treated with N-glycosidase F (Roche) (0.2 U/llg E2,1 h incubation at 37 C in PBS/3% empigen BB) or left untreated. The glycosylated and deglycosylated E2-H6 proteins were subjected to SDS-PAGE and blotted on a PVDFmembrane for amino acid sequencing (analysis was performed on a PROCISETM 492 protein sequencer, Applied Biosystems). Since at this stage, SDS-PAGE revealed some degradation products, a further fractionation by size exclusion chromatography was performed. Hereto, the Ni-IDA eluate was concentrated by ultrafiltration (MWCO 10 kDa, centriplus, Amicon,Millipore) and loaded on a Superdex G200 (Pharmacia) in PBS, 1% Empigen BB.STDC0775 Elution fractions, containing mainly intact E2s related products with a Mr between-30 kDa and-70 kDa based on the migration on SDS-PAGE, were pooled and eventually alkylated (incubation with 5 mM DTT for 30 minutes at 37 C, followed by incubation with 20 mM iodoacetamide for 30 minutes at 37 C). The possible presence of degradation products after IMAC purification can thus be overcome by a further fractionation of the intact product by means of size exclusion chromatography. An unexpectedly good result was obtained. Based on the Nterminal sequencing the amount of E2 product from which the CL leader peptide is removed could be estimated.STDC0259 The total amount of protein products is calculated as pmol of protein based on the intensity of the peaks recovered by Edman degradation. Subsequently, for each specific protein (i. e. for each'detected N-terminus') the mol % versus the total is estimated.

In the current experiment, only the correct N-terminus of E2-H6 was detected and other variants of E2-H6 lacking amino acid of the E2 protein or containing N-terminal amino acids not comprised in the E2 protein were absent. In conclusion, the E2-H6 protein expressed byH. polynzorpha as CL-E2-H6 protein was isolated without any further in vitro processing as a > 95 % correctly cleaved protein. This is in sharp contrast with the fidelity of leader peptide removal by H. poly7no7pha of the aMF-E2-H6 protein to the E2-H6 protein, which was estimated to occur in 25 % of the isolated proteins (see Table 3).

EXAMPLE 18 PURIFICATION AND BIOCHEMICAL CHARACTERIZATION OF THE HCV E1PROTEIN EXPRESSED IN HANSENULA POLYMORPHA FROM THE CL-H6-K-El ENCODING CONSTRUCT AND IN VITRO PROCESSING OF H6-CONTAINING PROTEINSThe efficiency of removal of the CL leader peptide from the CL-H6-K-E1 protein expressed in H. polymofpha was analyzed, as well as the efficiency of subsequent in vitro processing in order to remove the H6 (his-tag)-adaptor peptide and the Endo Lys-C processing site. Since the HCV Els (aa 192-326) was expressed as a N-terminal His-K-tagged protein CL-H6-K-E1, a rapid and efficient purification could be performed as described in Example 17.STDC0673 The elution profile of the IMAC-chromatographic purification of H6-K-El (and possibly residual CL-H6K-E1) proteins is shown in Figure 42. After SDS-PAGE and silver staining of the gel and western-blot analysis using a specific monoclonal antibody directed against El (IGH201) (Figure 43), the elution fractions (63-69) containing the recombinant Els products were pooled ('IMAC pool') and subjected to an overnight Endoproteinase Lys-C (Roche) treatment (enzyme/substrate ratio of 1/50 (w/w), 37 C) in order to remove the H6-K-fusion tail.

Removal of non-processed fusion product was performed by a negative IMAC chromatography step on a Ni-IDA column whereby Endo-Lys-C-processed proteins are collected in the flow-through fraction. Hereto the Endoproteinase Lys-C digested protein sample was applied on a Ni-IDA column after a 10-fold dilution with 10 mM NaH2P04. 3H20, 1 % (v/v) Empigen B, pH 7.2 (buffer B) followed by washing with buffer B till the absorbance at 280 nm reached the baseline level. The flow through was collected in different fractions (1-40) that were screened for the presence of Els-products (Figure 44).STDC0573 The fractions (7-28), containing intact E1 from which the N-terminal H6-K (and possibly residual CL-H6K) tail is removed (with a Mr between-15 kDa and-30 kDa based on the migration on SDSPAGE followed by silver staining or western blot analysis using a specific monoclonal antibody directed against E1 (IGH201), were pooled and alkylated (incubation with 5 mMDTT for 30 minutes at 37 C, followed by incubation with 20 mM iodoacetamide for 30 minutes at 37 C).

This material was subjected to N-terminal sequencing (Edman degradation). Hereto, protein samples were treated with N-glycosidase F (Roche) (0.2U/g E1, lh incubation at 37 C inPBS/3% empigen BB) or left untreated. The glycosylated and deglycosylated E1 proteins were then separated by SDS-PAGE and blotted on a PVDF-membrane for further analysis byEdman degradation (analysis was performed on a PROCISETM 492 protein sequencer,Applied Biosystems). Based on the N-terminal sequencing the amount of correctly processedE1 product could be estimated (processing includes correct cleavage of the H6-K-sequence).

The total amount of protein products is calculated as pmol of protein based on the intensity of the peaks recovered by Edman degradation. Subsequently, for each specific protein (i. e. for each'detected N-terminus') the mol % versus the total is estimated. In the current experiment, only the correct N-terminus of E1 was detected and not the N-termini of other processing variants of H6-K-E1. Based thereon, in vitro processing by Endo Lys-C of the H6-K-E1 El (and possibly residual CL-H6-K-E1) protein to the E1 protein was estimated to occur with a fidelity of more than 95 %.

EXAMPLE 19SPECIFIC REMOVAL OF LOW-GLYCOSYLATED FORMS OF HCV El BYHEPARINIn order to find specific purification steps for HCV envelope proteins from yeast cells binding with heparin was evaluated. Heparin is known to bind to several viruses and consequently binding to the HCV envelope has already been suggested (Garson, J. A. et al. 1999). In order to analyze this potential binding, heparin was biotinylated and interaction with HCV El analyzed in microtiterplates coated with either sulfonated HCV E1 from H. polymofpha, alkylated HCV El from H. polymorpha (both produced as described in Example 16) and alkylated HCV E1 from a culture of mammalian cells transfected with a vaccinia expression vector.STDC0723 Surprisingly, a strong binding could only be observed with sulfonated HCV E1 fromH. polymorpha, while binding with HCV E1 from mammalian cell culture was completely absent. By means of western-blot we could show that this binding was specific for the lower molecular weight bands of the HCV E1 protein mixture (Figure 45), corresponding to lowglycosylated mature HCV Els. Figure 45 also reveals that sulfonation is not essential for heparin binding since upon removal of this sulfonation binding is still observed for the low molecular weight E1 (lane 4). Alternatively, alkylation is reducing this binding substantially, however, this may be caused by the specific alkylation agent (iodo-acetamide) used in this example.STDC0296 This finding further demonstrated the industrial applicability of the CL-HCVenvelope expression cassettes for yeast since we specifically can enrich HCV E1 preparations towards a preparation with HCV El proteins with a higher degree of glycosylation (i. e. more glycosylation sites occupied).

EXAMPLE 20FORMATION AND ANALYSIS OF VIRUS-LIKE PARTICLES (VLPs) Conversion of the HCV E1 and E2 envelope proteins expressed in H. polymorpha (Examples 16 to 18) to VLPs was done essentially as described by Depla et al. in W099/67285 and byBosman et al. in WO01/30815. Briefly, after cultivation of the transformed H. polymorpha cells during which the HCV envelope proteins were expressed, cells were harvested, lysed in GuHCl and sulphonated as described in Example 17. His-tagged proteins were subsequently purified by IMAC and concentrated by ultrafiltration as described in Example 17.

VLP-formation of HCV envelope proteins with sulphonated Cys-thiol groupsThe concentrated HCV envelope proteins sulphonated during the isolation procedure were not subjected to a reducing treatment and loaded on a size-exclusion chromatograpy column (Superdex G200, Pharmacia) equilibrated with PBS, 1 % (v/v) Empigen. The eluted fractions were analyzed by SDS-PAGE and western blotting. The fractions with a relative Mr-29-15 kD (based on SDS-PAGE migration) were pooled, concentrated and loaded on SuperdexG200, equilibrated with PBS, 3% (w/v) betain, to enforce virus like particle formation (VLP).

The fractions were pooled, concentrated and desalted to PBS, 0.5% (w/v) betain.

VLP-formation of HCV envelope proteins with irreversibly modified Cys-thiol groupsThe concentrated HCV envelope proteins sulphonated during the isolation procedure were subjected to a reducing treatment (incubation in the presence of 5 mM DTT in PBS) to convert the sulphonated Cys-thiol groups to free Cys-thiol groups. Irreversible Cys-thiol modification was performed by (i) incubation for 30 min in the presence of 20 mM iodoacetamide, or by (ii) incubation for 30 min in the presence of 5 mM N-ethylmaleimide (NEM) and 15 mM biotin-N-ethylmaleimide. The proteins were subsequently loaded on a size-exclusion chromatograpy column (Superdex G200, Pharmacia) equilibrated with PBS, 1 % (v/v) Empigen in case of iodoacetamide-blocking, or with PBS, 0.2 % CHAPS in case of blocking with NEM and biotin-NEM.STDC0501 The eluted fractions were analyzed by SDS-PAGE andWestern blotting. The fractions with a relative Mr ?29-?15 kD (based on SDS-PAGE migration) were pooled, concentrated and, to force virus-like particle formation, loaded on aSuperdex G200 column equilibrated with PBS, 3% (w/v) betain. The fractions were pooled, concentrated and desalted to PBS, 0.5% (w/v) betain in case of iodoacetamide-blocking, or with PBS, 0.05 % CHAPS in case of blocking with NEM and biotin-NEM.

VLP-formation of HCV envelope proteins with reversibly modified Cys-thiol groupsThe concentrated HCV envelope proteins sulphonated during the isolation procedure were subjected to a reducing treatment (incubation in the presence of 5 mM DTT in PBS) to convert the sulphonated Cys-thiol groups to free Cys-thiol groups. Reversible Cys-thiol modification was performed by incubation for 30 min in the presence of dithiodipyridine (DTDP), dithiocarbamate (DTC) or cysteine. The proteins were subsequently loaded on a size-exclusion chromatograpy column (Superdex G200, Pharmacia) equilibrated with PBS, 1 % (v/v) Empigen. The eluted fractions were analyzed by SDS-PAGE and Western blotting.

The fractions with a relative Mr ?29-?15 kD (based on SDS-PAGE migration) were pooled, concentrated and loaded on Superdex G200, equilibrated with PBS, 3% (w/v) betain, to enforce virus like particle formation (VLP). The fractions were pooled, concentrated and desalted to PBS, 0.5% (w/v) betain.

The elution profiles of size-exclusion chromatography in PBS, 3% (w/v) betain to obtainVLPs of H. polymo7pha-expressed E2-H6 are shown in Figure 46 (sulphonated) and Figure 47 (alkylated with iodoacetamide).

The elution profiles of size-exclusion chromatography in PBS, 3% (w/v) betain to obtainVLPs of Z. polymo7pha-expressed E1 are shown in Figure 48 (sulphonated) and Figure 49 (alkylated with iodoacetamide). The resulting VLPs were analyzed by SDS-PAGE and western blotting as shown in Figure 50.

Size-analysis of VLPs formed by H. polyniorpha-expressed HCV envelope proteinsThe VLP particle size was determined by Dynamic Light Scattering. For the light-scattering experiments, a particle-size analyzer (Model Zetasizer 1000 HS, Malvern Instruments Ltd., Malvern, Worcester UK) was used which was controlled by photon correlation spectroscopy (PCS) software. Photon correlation spectroscopy or dynamic light scattering (DLS) is an optical method that measures brownian motion and relates this to the size of particles. Light from a continuous, visible laser beam is directed through an ensemble of macromolecules or particles in suspension and moving under brownian motion. Some of the laser light is scattered by the particles and this scattered light is measured by a photomultiplier.

Fluctuations in the intensity of scattered light are converted into electrical pulses which are fed into a correlator. This generates the autocorrelation function which is passed to a computer where the appropriate data analysis is performed. The laser used was a 10 mW monochromatic coherent He-Ne laser with a fixed wavelength of 633 nm. For each sample, three to six consecutive measurements were taken.

The results of these experiments are summarized in Table 5.

Table 5. Results of dynamic light scattering analysis on the indicated VLP-compositions of HCV envelope proteins expressed by H. polymorpha. The VLP particle sizes are given as mean diameter of the particles.EMI84.1 <tb>

Cys-thiol <SEP> modification <SEP> El-H6 <SEP> E2-VIEGR-H6 <SEP> El<tb> sulphonation <SEP> 25-45 <SEP> nm <SEP> 20 <SEP> nm <SEP> 20-26 <SEP> nm<tb> alkylation <SEP> 23-56 <SEP> nm <SEP> 20-56 <SEP> nm <SEP> 21-25 <SEP> nm<tb> (iodoacetamide)<tb> The observation that sulphonated HCV E1 derived from H. polymorpha still forms particles with a size in the same range as alkylated HCV E1 from Hansenula is surprising. Such an effect was not expected since the high (up to 8 Cys-thiol groups can be modified on HCV E1) net increase of negative charges as a consequence of sulphonation should induce an ionic repulsion between the subunits.STDC0269 The other reversible cysteine modifying agents tested also allowed particle formation, the HCV El produced in this way, however, proved to be less stable than the sulphonated material, resulting in disulfide-based aggregation of the HCV El.

In order to use these other reversible blockers, further optimization of the conditions is required.

EXAMPLE 21ANTIGENIC EQUIVALENCE OF HANSENULA-PRODUCED HCV E1-H6 AND HCV El PRODUCED BY VACCINIA-INFECTED MAMMALIAN CELLSThe reactivity of Hansenula-produced HCV E1-H6 with sera from HCV chronic carriers was compared to the reactivity of HCV E1 produced by HCV-recombinant vaccinia virus-infected mammalian cells as described by Depla et al. in WO 99/67285. Both HCV-E1 preparations tested consisted of VLP's wherein the HCV El proteins were alkylated with NEM and biotin NEM. The reactivities of both HCV El VLP-preparations with sera from HCV chronic carriers was determined by ELISA. The results are summarized in Table 6.STDC0248 As can be derived from Table 6, no differences in reactivity were noted between HCV E1 expressed in HCVrecombinant vaccinia virus-infected mammalian cells and HCV E1 expressed in H. polymoypha. STDCDBPG0636*Table 6. Antigenicity of El produced in a mammalian cell culture or produced in H. polymorpha were evaluated on a panel of sera from human HCV chronic carriers. For this purpose biotinylated E1 was bound to streptavidin coated ELISA plates. Thereafter human sera were added at a 1/20 dilution and bound immunoglobulins from the sera bound to El were detected with a rabbit-anti-human IgG-Fc specific secondary antibody labeled with peroxidase. Results are expressed as OD-values. The average values are the averages of theOD-values of all serum samples tested.EMI85.1 <tb>

<SEP> Hansenula <SEP> mammalian <SEP> Hansenula <SEP> mammalian<tb> Serum <SEP> Serum<tb> 17766 <SEP> 1. <SEP> 218 <SEP> 1. <SEP> 159 <SEP> 55337 <SEP> 1. <SEP> 591 <SEP> 1. <SEP> 416<tb> 17767 <SEP> 1. <SEP> 513 <SEP> 1. <SEP> 363 <SEP> 55348 <SEP> 1. <SEP> 392 <SEP> 1. <SEP> 261<tb> 17777 <SEP> 0. <SEP> 806 <SEP> 0. <SEP> 626 <SEP> 55340 <SEP> 1. <SEP> 202 <SEP> 0. <SEP> 959<tb> 17784 <SEP> 1. <SEP> 592 <SEP> 1. <SEP> 527 <SEP> 55342 <SEP> 1. <SEP> 599 <SEP> 1. <SEP> 477<tb> 17785 <SEP> 1. <SEP> 508 <SEP> 1. <SEP> 439 <SEP> 55345-1. <SEP> 266 <SEP> 1. <SEP> 428<tb> 17794 <SEP> 1. <SEP> 724 <SEP> 1. <SEP> 597 <SEP> 55349 <SEP> 1. <SEP> 329 <SEP> 1. <SEP> 137<tb> 17798 <SEP> 1. <SEP> 132 <SEP> 0. <SEP> 989 <SEP> 55350 <SEP> 1. <SEP> 486 <SEP> 1. <SEP> 422<tb> 17801 <SEP> 1. <SEP> 636 <SEP> 1. <SEP> 504 <SEP> 55352 <SEP> 0. <SEP> 722 <SEP> 1.STDC0725 <SEP> 329<tb> 17805ToO55353HxT'L<tb> 7805 <SEP> 1. <SEP> 053 <SEP> 0. <SEP> 944 <SEP> 55353 <SEP> 1. <SEP> 065 <SEP> 1. <SEP> 157<tb> 17810 <SEP> 1.134 <SEP> 0.999 <SEP> 55354 <SEP> 1.118 <SEP> 1. <SEP> 092<tb> 17819 <SEP> 1. <SEP> 404 <SEP> 1. <SEP> 24 <SEP> 55355 <SEP> 0. <SEP> 754 <SEP> 0. <SEP> 677<tb> 17820 <SEP> 1. <SEP> 308 <SEP> 1. <SEP> 4 <SEP> 55362 <SEP> 1. <SEP> 43 <SEP> 1. <SEP> 349<tb> 17826 <SEP> 1. <SEP> 163 <SEP> 1. <SEP> 009 <SEP> 55365 <SEP> 1. <SEP> 612 <SEP> 1. <SEP> 608<tb> 17827 <SEP> 1. <SEP> 668 <SEP> 1. <SEP> 652 <SEP> 55368 <SEP> 0. <SEP> 972 <SEP> 0. <SEP> 959<tb> 17849 <SEP> 1. <SEP> 595 <SEP> 1317 <SEP> 55369 <SEP> 1. <SEP> 506 <SEP> 1. <SEP> 377<tb> 55333 <SEP> 1.217 <SEP> 1.STDC0602 <SEP> 168 <SEP> <tb> EXAMPLE 22IMMUNOGENIC EQUIVALENCE OF HANSENULA-PRODUCED HCV El-H6 ANDHCV El PRODUCED BY VACCINIA-INFECTED MAMMALIAN CELLSThe immunogenecity of Hansenula-produced HCV E1-H6 was compared to the immunogenecity of HCV El produced by HCV-recombinant vaccinia virus-infected mammalian cells as described by Depla et al. in W099/67285. Both HCV-E1 preparations tested consisted of VLP's wherein the HCV El proteins were alkylated with iodoacetamide.

Both VLP preparations were formulated with alum and injected in Balb/c mice (3 intramuscular/subcutaneous injections with a three week interval between each and each consisting of 5 llg E1 in 125 gel containing 0.13% Alhydrogel, Superfos, Denmark). Mice were bled ten days after the third immunization.

Results of this experiment are shown in Figure 51. For the top part of Figure 51, antibodies raised following immunization with VLPs of E1 produced in mammalian cells were determined. Antibody titers were determined by ELISA (see Example 21) wherein either El produced in mammalian cells ("M") or Hansenula-produced E1 ("H") were coated directly on the ELISA solid support whereafter the ELISA plates were blocked with casein. For the bottom part of Figure 51, antibodies raised following immunization with VLPs of Hansenula- produced E1 were determined. Antibody titers were determined by ELISA (see Example 21) wherein either E1 produced in mammalian cells ("M") or Hansenula-produced E1 ("H") were coated directly on the ELISA solid support whereafter the ELISA plates were blocked with casein.

The antibody titers determined were end point titers. The end point titer is determined as the dilution of serum resulting in an OD (as determined by ELISA) equal to two times the mean of the background of the assay.

Figure 51 shows that no significant differences were observed between the immunogenic properties of both El-compositions and that the determined antibody titers are independent of the antigen used in the ELISA to perform the end point titration.

The yeast-derived HCV E1 induced upon vaccination a protective response similar to the protective response obtained upon vaccination with alkylated HCV E1 derived from mammalian cell culture. The latter response was able to prevent chronic evolution of HCV after an acute infection.

EXAMPLE 23ANTIGENIC AND IMMUNOGENIC PROFILE OF HANSENULA-PRODUCED HCV E1-H6 WHICH IS SULPHONATEDThe reactivity of Haizsenula-produced HCV E1-H6 with sera from HCV chronic carriers was compared to the reactivity of HCV E1 produced by HCV-recombinant vaccinia virus-infected mammalian cells as described by Depla et al. in W099/67285. Both HCV-E1 preparations tested consisted of VLP's wherein the Hansenula-produced HCV E1 proteins were sulphonated and the HCV E1 produced by mammalian cells was alkylated. The results are given in Table 7. Although the overall (average) reactivity was identical, some major differences were noted for individual sera.STDC0152 This implies that the sulphonated material presents at least some of its epitopes in a way different from alkylated HCV E1.

The immunogenecity of Hansenula-produced HCV E1-H6 which was sulphonated was compared to the immunogenecity of Hansenula-produced HCV E1-H6 which was alkylated.

Both HCV-E1 preparations tested consisted of VLP's. Both VLP preparations were formulated with alum and injected in Balb/c mice (3 intramuscular/subcutaneous injections with a three week interval between each and each consisting of 5 ug El in 125 jj. l containing 0.13% Alhydrogel, Superfos, Denmark). Mice were bled ten days after the third immunization.

Antibody titers were determined similarly as described in Example 22. Surprisingly, immunization with sulphonated material resulted in higher antibody titers, regardless of the antigen used in ELISA to assess these titers (Figure 51; top panel: titration of antibodies raised against alkylated E1 ; bottom panel: titration of antibodies raised against sulphonatedE1 ;"A" : alkylated El coated on ELISA plate ;"S" : sulphonated El coated on ELISA plate).However, in this experiment individual titers are different dependent on the antigen used for analysis which confirms the observation noted with sera from HCV patients. Consequently,HCV E1 wherein the cysteine thiol-gorups are modified in a reversible way may be more immunogenic and thus have an increased potency as a vaccine protecting against HCV (chronic infection).STDC0123 In addition thereto, induction of a response to neo-epitopes induced by irrreversible blocking is less likely to occur.

Table 7. Antigenicity of alkylated E1 (produced in mammalian cell culture) or sulphonated E1-H6 (produced in H. polyno7pha) was evaluated on a panel of sera from human HCV chronic carriers ("patient sera") and a panel of control sera ("blood donor sera"). To this purpose E1 was bound to ELISA plates, after which the plates were further saturated with casein. Human sera were added at a 1/20 dilution and bound immunoglobulins were detected with a rabbit-anti-human IgG-Fc specific secondary antibody labeled with peroxidase. Results are expressed as OD-values.STDC0686 The average values are the averages of the OD-values of all serum samples tested. patient seraEMI88.1 <tb> <SEP> Hansenula <SEP> mammalian<tb> sernr<tb> 17766 <SEP> 0. <SEP> 646 <SEP> 0. <SEP> 333<tb> 17777 <SEP> 0.46 <SEP> 0.447<tb> 17785 <SEP> 0.74 <SEP> 0.417<tb> 17794 <SEP> 1.446 <SEP> 1.487<tb> 17801 <SEP> 0.71 <SEP> 0.902<tb> 17819 <SEP> 0. <SEP> 312 <SEP> 0.539<tb> 17827 <SEP> 1.596 <SEP> 1.576<tb> 17849 <SEP> 0.586 <SEP> 0.964<tb> 55333 <SEP> 0.69 <SEP> 0.534<tb> 55338 <SEP> 0.461 <SEP> 0.233<tb> 55340 <SEP> 0.106 <SEP> 0.084<tb> 55345 <SEP> 1.474 <SEP> 1.258<tb> 55352 <SEP> 1.008 <SEP> 0.668<tb> 55355 <SEP> 0.453 <SEP> 0.444<tb> 55362 <SEP> 0.STDC0888 <SEP> 362 <SEP> 0.717<tb> 55369 <SEP> 0.24 <SEP> 0.452<tb> <SEP> , <SEP> w <SEP> I <SEP> 1 <SEP> I <SEP> '<tb> blood donor seraEMI88.2 <tb> <SEP> Hansenula <SEP> mammalian<tb> sernr<tb> F500 <SEP> 0. <SEP> 055 <SEP> 0. <SEP> 054<tb> F504 <SEP> 0.05 <SEP> 0.05<tb> F508 <SEP> 0.05 <SEP> 0.054<tb> F510 <SEP> 0.05 <SEP> 0.058<tb> F511 <SEP> 0.05 <SEP> 0.051<tb> F512 <SEP> 0.051 <SEP> 0.057<tb> F513 <SEP> 0.051 <SEP> 0.052<tb> F527 <SEP> 0.057 <SEP> 0.054<tb> <SEP> I <SEP> I <SEP> I <SEP> I <SEP> <tb> EXAMPLE 24IDENTICAL ANTIGENIC REACTIVITY OF HANSENULA-PRODUCED HCV El- H6 AND HCV E1 PRODUCED BY VACCINIA-INFECTED MAMMALIAN CELLSWITH SERA FROM VACCINATED CHIMPANZEESThe reactivities of the El produced by HCV-recombinant vaccinia virus-infected mammalian cells and the E1-H6

produced by Hansenula (both alkylated) with sera from vaccinated chimpanzees and with monoclonal antibodies were compared. Thereto, said E1 proteins were coated directly to ELISA plates followed by saturation of the plates with casein. The end point titers of antibodies binding the E1 proteins coated to the ELISA plates was determined for chimpanzee sera and for specific murine monoclonal antibodies, all obtained from animals immunized with El produced by mammalian cells. End point titer determination was done as described in Example 22. The murine monoclonal antibodies used were IGH201 (seeExample 15), IGH198 (IGH198 = 23C12 in Maertens et al. in W096/04385), IGH203 (IGH203 = 15G6 in Maertens et al. in W096/04385) and IGH202 (IGH202 = 3F3 inMaertens et al. in W099/50301).

As can be derived from Figure 53, the reactivities of 7 different chimpanzee are identical when tested with E1 protein produced by either Hansenula or mammalian cells. The reactivities of the monoclonal antibodies against HCV E1 are also almost equal. Two of the chimpanzees (Yoran and Marti) were involved in a prophylactic vaccine study and were able to clear an acute infection upon challenge while a control animal did not clear the infection.

The five other chimpanzees (Ton, Phil, Marcel, Peggy, Femma) were involved in therapeutic vaccination studies and showed a reduction in liver damage, as measured by ALT in serum and/or histological activity index on liver biopsy, upon the HCV E1 immunizations.

The results obtained in this experiment are clearly different from the findings of Mustilli and coworkers (Mustilli, A. C. et al. 1999) who expressed the HCV E2 protein both in Sacchaf o7nyces cerevisiae and Kluyveromyces lactis. The purified yeast-produced E2 was, however, different from the HCV E2 produced by mammalian (CHO) cells in that a lower reactivity was observed with sera from chimpanzees immunized with HCV E2 produced by mammalian cells while reactivity with monoclonal antibodies was higher for the yeastproduced HCV E2.

EXAMPLE 25 GLYCOPROFILING OF HCV El BY FLUOROPHORE-ASSISTED CARBOHYDRATE ELECTROPHORESIS (FACE)The glycosylation profiles were compared of Hansenula-produced HCV El and HCV E1 produced by HCV-recombinant vaccinia virus-infected mammalian cells as described byDepla et al. in W099/67285. This was done by means of fluorophore-assisted carbohydrate electrophoresis (FACE).STDC0887 Thereto, oligosaccharides were released from Els produced by mammalian cells or Hansenula by peptide-N-glycosidase (PNGase F) and labelled withANTS (the E1 proteins were alkylated with iodoacetamide prior to PNGase F digestion).ANTS-labeled oligosaccharides were separated by PAGE on a 21% polyacrylamide gel at a current of 15 mA at 4 C for 2-3 h. From Figure 54, it was concluded that the oligosaccharides on E1 produced by mammalian cells and E1-H6 produced by Hansenula migrate like oligomaltose with a degree of polymerization between 7 and 11 monosaccharides. This indicates that the Hansenula expression system surprisingly leads to an El protein which is not hyperglycosylated and which has sugar chains with a length similar to the sugar chains added to El proteins produced in mammalian cells.

Reference ListAgaphonov, M. O., Beburov, M. Y., Ter Avanesyan, M. D., and Smirnov, V. N. (1995) A disruption-replacement approach for the targeted integration of foreign genes in Hansenula polymorpha. Yeast 11: 1241-1247.

Agaphonov, M. O., Trushkina, P. M., Sohn, J. H., Choi, E. S., Rhee, S. K., and TerAvanesyan, M. D. (1999) Vectors for rapid selection of integrants with different plasmid copy numbers in the yeast Hansenula polymorpha DL1. Yeast 15: 541-551.

Alber, T. and Kawasaki, G. (1982) Nucleotide sequence of the triose phosphate isomerase gene of Saccharomyces cerevisiae. J. Mol Appl. Genet 1: 419-434.

Ammerer, G. (1983) Expression of genes in yeast using the ADCI promoter. MethodsEnzymol. 101: 192-201.

Ballou, L., Hitzeman, R. A., Lewis, M. S., and Ballou, C. E. (1991) Vanadate-resistant yeast mutants are defective in protein glycosylation. Proc. Natl. Acad. Sci. U. S. A 88 : 3209-3212.

Beekman, N. J., Schaaper, W. M., Tesser, G. I., Dalsgaard, K., Kamstrup, S., Langeveld, J. P.,Boshuizen, R. S., and Meloen, R. H. (1997) Synthetic peptide vaccines: palmitoylation of peptide antigens by a thioester bond increases immunogenicity. J. Pept. Res. 50: 357-364.

Burns, J., Butler, J., and Whitesides, G. (1991) Selective reduction of disulfides by Tris (2carboxyethyl) phosphine. J. Org. Chem. 56: 2648-2650.

Cox, H., Mead, D., Sudbery, P., Eland, R. M., Mannazzu, I., and Evans, L. (2000)Constitutive expression of recombinant proteins in the methylotrophic yeast Hansenula polymorpha using the PMA1 promoter. Yeast 16: 1191-1203.

Cregg, J. M. (1999) Expression in the methylotophic yeast Pichia pastors. In Gene expression systems: using nature for the art of expression, J. M. Fernandez and J. P. Hoeffler, eds (SanDiego: Academic Press), pp. 157-191.

Darbre, A. (1986) Practical pfotein cheemistry : a handbook. Whiley & Sons Ltd.

Doms, R. W., Lamb, R. A., Rose, J. K., and Helenius, A. (1993) Folding and assembly of viral membrane proteins. Virology 193: 545-562.

Elble, R. (1992) A simple and efficient procedure for transformation of yeasts. Biotechniques 13: 18-20.

Gailit, J. (1993) Restoring free sulfhydryl groups in synthetic peptides. Anal. Biochem.

214: 334-335.

Garson, J. A., Lubach, D., Passas, J., Whitby, K., and Grant, P. R. (1999) Suramin blocks hepatitis C binding to human hepatoma cells in vitro. J. Med. Virol. 57: 238-242.

Gatzke, R., Weydemann, U., Janowicz, Z. A., and Hollenberg, C. P. (1995) Stable multicopy integration of vector sequences in Hansenula polymorpha. Appl. Microbiol. Biotechnol.

43: 844-849.

Gellissen, G. (2000) Heterologous protein production in methylotrophic yeasts.

Appl. Microbiol. Biotechnol. 54: 741-750.

Grakoui, A., Wychowski, C., Lin, C., Feinstone, S. M., and Rice, C. M. (1993) Expression and identification of hepatitis C virus polyprotein cleavage products. J. Virol. 67: 1385-1395.

Heile, J. M., Fong, Y. L., Rosa, D., Berger, K., Saletti, G., Campagnoli, S., Bensi, G., Capo, S.,Coates, S., Crawford, K., Dong, C., Wininger, M., Baker, G., Cousens, L., Chien, D., Ng, P., Archangel, P., Grandi, G., Houghton, M., and Abrignani, S. (2000) Evaluation of hepatitis C virus glycoprotein E2 for vaccine design: an endoplasmic reticulum-retained recombinant protein is superior to secreted recombinant protein and DNA-based vaccine candidates.

J. Virol. 74: 6885-6892.

Helenius, A. (1994) How N-linked oligosaccharides affect glycoprotein folding in the endoplasmic reticulum. Mol Biol. Cell 5 : 253-265.

Hermanson, G. T. (1996) Bioconjugate techniques. San Diego: Academic Press.

Herscovics, A. and Orlean, P. (1993) Glycoprotein biosynthesis in yeast. FASEB J. 7: 540550.

Hijikata, M., Kato, N., Ootsuyama, Y., Nakagawa, M., and Shimotohno, K. (1991) Gene mapping of the putative structural region of the hepatitis C virus genome by in vitro processing analysis. Proc. Natl. Acad. Sci. U. S. A 88: 5547-5551.

Hitzeman, R. A., Clarke, L., and Carbon, J. (1980) Isolation and characterization of the yeast 3-phosphoglycerokinase gene (PGK) by an immunological screening technique. J. Biol. Chem.

255: 12073-12080.

Hollenberg, C. P. and Gellissen, G. (1997) Production of recombinant proteins by methylotrophic yeasts. Curr. Opin. Biotechnol. 8: 554-560.

Holmgren, A. (1979) Thioredoxin catalyzes the reduction of insulin disulfides by dithiothreitol and dihydrolipoamide. J. Biol. Chem. 254: 9627-9632.

Jayabaskaran, C., Davison, P. F., and Paulus, H. (1987) Facile preparation and some applications of an affinity matrix with a cleavable connector arm containing a disulfide bond.

Prep. Biochem. 17: 121-141.

Julius, D., Brake, A., Blair, L., Kunisawa, R., and Thorner, J. (1984) Isolation of the putative structural gene for the lysine-arginine-cleaving endopeptidase required for processing of yeast prepro-alpha-factor. Cell 37: 1075-1089.

Kalef, E., Walfish, P. G., and Gitler, C. (1993) Arsenical-based affinity chromatography of vicinal dithiol-containing proteins: purification of L1210 leukemia cytoplasmic proteins and the recombinant rat c-erb A beta 1 T3 receptor. Anal. Biochem. 212: 325-334.

Kato, N., Ootsuyama, Y., Tanaka, T., Nakagawa, M., Nakazawa, T., Muraiso, K.,Ohkoshi, S., Hijikata, M., and Shimotohno, K. (1992) Marked sequence diversity in the putative envelope proteins of hepatitis C viruses. Virus Res. 22: 107-123.

Kawasaki, G. and Fraenkel, D. G. (1982) Cloning of yeast glycolysis genes by complementation. Biochem. Biophys. Res. Commun. 108: 1107-1122.

Klebe, R. J., Harriss, J. V., Sharp, Z. D., and Douglas, M. G. (1983) A general method for polyethylene-glycol-induced genetic transformation of bacteria and yeast. Gene 25: 333-341.

Kumar, N., Kella, D., and Kinsella, J. E. (1985) A method for the controlled cleavage of disulfide bonds in proteins in the absence of denaturants. J. Biochem. Biophys. Methods 11: 251-263.

Kumar, N., Kella, D., and Kinsella, J. E. (1986) Anomalous effects of denaturants on sulfitolysis of protein disulfide bonds. Int. J. Peptide Prot. Res. 28: 586-592.

Maertens, G. and Stuyver, L. (1997) Genotypes and genetic variation of hepatitis C virus. InThe molecular medicine of viral hepatitis, T. J. Harrison and A. J. Zuckerman, eds John Wiley & Sons), pp. 183-233.

Major, M. E. and Feinstone, S. M. (1997) The molecular virology of hepatitis C. Hepatology 25: 1527-1538.

Mustilli, A. C., Izzo, E., Houghton, M., and Galeotti, C. L. (1999) Comparison of secretion of a hepatitis C virus glycoprotein in Saccharomyces cerevisiae and Kluyveromyces lactis.

Res. Microbiol. 150: 179-187.

Nagai, K. and Thogersen, H. C. (1984) Generation of beta-globin by sequence-specific proteolysis of a hybrid protein produced in Escherichia coli. Nature 309: 810-812.

Nielsen, P. E. (2001) Targeting double stranded DNA with peptide nucleic acid (PNA). CurrMed Chem 8 : 545-550.

Okabayashi, K., Nakagawa, Y., Hayasuke, N., Ohi, H., Miura, M., Ishida, Y., Shimizu, M.,Murakami, K., Hirabayashi, K., Minamino, H., and. (1991) Secretory expression of the human serum albumin gene in the yeast, Saccharomyces cerevisiae. J. Biochem. (Tokyo) 110: 103-110.

Orum, H. and Wengel, J. (2001) Locked nucleic acids: a promising molecular family for gene-function analysis and antisense drug development. Curr Opin. Mol. Ther. 3: 239-243.

Padgett, K. A. and Sorge, J. A. (1996) Creating seamless junctions independent of restriction sites in PCR cloning. Gene 168: 31-35.

Pedersen, J., Lauritzen, C., Madsen, M. T., and Weis, D. S. (1999) Removal of N-terminal polyhistidine tags from recombinant proteins using engineered aminopeptidases. ProteinExpr. Purif. 15: 389-400. Pomroy, N. C. and Deber, C. M. (1998) Solubilization of hydrophobic peptides by reversible cysteine PEGylation. Biochem. Biophys. Res. Commun. 245: 618-621.

Raymond, C. K. (1999) Recombinant protein expression in Pichia methanolica. In Gene expression systems: using nature for the art of expression, J. M. Fernandez and J. P. Hoeffler, eds (San Diego: Academic Press), pp. 193-209.

Rein, A., Ott, D. E., Mirro, J., Arthur, L. O., Rice, W., and Henderson, L. E. (1996)Inactivation of murine leukemia virus by compounds that react with the zinc finger in the viral nucleocapsid protein. J. Virol. 70: 4966-4972.

Roggenkamp, R., Hansen, H., Eckart, M., Janowicz, Z., and. Hollenberg, C. P. (1986)Transformation of the methylotrophic yeast Hansenula polymorpha by autonomous replication and integration vectors. Mol Gen Genet 202: 302-308.

Rosa, D., Campagnoli, S., Moretto, C., Guenzi, E., Cousens, L., Chin, M., Dong, C., Weiner, A. J., Lau, J. Y., Choo, Q. L., Chien, D., Pileri, P., Houghton, M., and Abrignani, S.

(1996) A quantitative test to estimate neutralizing antibodies to the hepatitis C virus: cytofluorimetric assessment of envelope glycoprotein 2 binding to target cells.

Proc. Natl. Acad. Sci. U. S. A 93: 1759-1763.

Rose, J. K. and Doms, R. W. (1988) Regulation of protein export from the endoplasmic reticulum. Annu. Rev. Cell Biol. 4: 257-288.

Russell, D. W., Smith, M., Williamson, V. M., and Young, E. T. (1983) Nucleotide sequence of the yeast alcohol dehydrogenase II gene. J. Biol. Chem. 258: 2674-2682.

Russell, P. R. (1983) Evolutionary divergence of the mRNA transcription initiation mechanism in yeast. Nature 301: 167-169.

Russell, P. R. (1985) Transcription of the triose-phosphate-isomerase gene ofSchizosaccharomyces pombe initiates from a start point different from that in Saccharomyces cerevisiae. Gene 40: 125-130.

Russell, P. R. and Hall, B. D. (1983) The primary structure of the alcohol dehydrogenase gene from the fission yeast Schizosaccharomyces pombe. J. Biol. Chem. 258: 143-149.

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning : A Laborato7Ov Manual. Cold Spring Harbor Laboratory Press.

Singh, R. and Kats, L. (1995) Catalysis of reduction of disulfide by selenol. Anal. Biochem.

232: 86-91.

Sohn, J. H., Choi, E. S., Kang, H. A., Rhee, J. S., and Rhee, S. K. (1999) A family of telomereassociated autonomously replicating sequences and their functions in targeted recombination in Hansenula polymorpha DL-1. J. Bacteriol. 181: 1005-1013.

Stevens, R. C. (2000) Design of high-throughput methods of protein production for structural biology. Structure. Fold. Des 8: R177-R185.

Stuyver, L., van Arnhem, W., Wyseur, A., Hernandez, F., Delaporte, E., and Maertens, G.

(1994) Classification of hepatitis C viruses based on phylogenetic analysis of the envelope 1 and nonstructural 5B regions and identification of five additional subtypes.

Proc. Natl. Acad. Sci. U. S. A 91: 10134-10138.

Sugrue, R. J., Cui, T., Xu, Q., Fu, J., and Chan, Y. C. (1997) The production of recombinant dengue virus E protein using Escherichia coli and Pichia pastoris. J. Virol. Methods 69: 159169.

Thakur, M. L., DeFulvio, J., Richard, M. D., and Park, C. H. (1991) Technetium-99m labeled monoclonal antibodies: evaluation of reducing agents. Int. J. Rad. Appl. Instrum. B 18: 227-233.

Vingerhoeds, M. H., Haisma, H. J., Belliot, S. O., Smit, R. H., Crommelin, D. J., and Storm, G.

(1996) Immunoliposomes as enzyme-carriers (immuno-enzymosomes) for antibody-directed enzyme prodrug therapy (ADEPT): optimization of prodrug activating capacity. Pharm. Res.

13: 604-610.

Wahlestedt, C., Salmi, P., Good, L., Kela, J., Johnsson, T., Hokfelt, T., Broberger, C., Porreca, F., Lai, J., Ren, K., Ossipov, M., Koshkin, A., Jakobsen, N., Skouv, J., Oerum, H., Jacobsen, M. H., and Wengel, J. (2000) Potent and nontoxic antisense oligonucleotides containing locked nucleic acids. Proc Natl Acad Sci U S A 97: 5633-5638. Weydemann, U., Keup, P., Piontek, M., Strasser, A. W., Schweden, J., Gellissen, G., and Janowicz, Z. A. (1995) High-level secretion of hirudin by Hansenula polymorpha--authentic processing of three different preprohirudins. Appl. Microbiol. Biotechnol. 44: 377-385.