RNAi plant expression vector of ABA (Abscisic Acid) 8'-hydroxylase gene and application

10-11-2010 дата публикации
Номер:
CN0101880667A
Принадлежит: Chengdu Institute of Biology of CAS
Контакты:
Номер заявки: 30-10-20101188
Дата заявки: 04-02-2010

[1]

Technical Field

[2]

The invention belongs to the field of plant genetic engineering technologies, relates to a kind of inhibiting the ABA8 [...] -hydroxylase gene expression of plant expression vector RNAi and its use, in particular to based on the barley ABA8 [...] -hydroxylase gene HvABA8   OH-1 [...] double-stranded of the plant expression vector and RNAi anti stachys in the use of gene engineering.

[3]

Background Art

[4]

Panical gemmation (  sprouting Pre-harvest, PHS) or using the mean seed harvester front encountered under cloudy and rainy weather or in a humid environment on the germination. Panical gemmation often occur in wheat, barley, rice and corn main crops, such as, to seriously affect the yield and quality, is a worldwide important agricultural disasters. Panical gemmation the environment and genotype intercation control (Zhang   HF, Lu   RH.Study   on   the   mechanism   of   the   resistance   to   preharvest   sprouting   and   inheritancein   wheat.Acta   Agron   Sin, 1993, 19 (6): 523-530), the factors affecting panical gemmiparous genotype is extremely complex (  ZX Sheng, Yu   SR, Wu   on   resistance   ZS.   Studies   Agic   pre-harvest   Sin   wheatcultivars.Sci   in   sprouting, 1991, 24 (5): 44-50; shaw and. Wheat head germination studies. Beijing, China. The China agriculture Publishing house, 2003), the germination traits have been found by using a plurality of genetic regulation and control of the system, then generated seed dormancy is weak and the high? Amylase activity is the main reason for the seed panical gemmiparous (Biddulph   TB, Plummer   JA, Setter   TL, Mares   DJ.Influence   of   high   temperature   and   terminal   moisture   stresson   dormancy   in   wheat (Triticum   aestivum   l.) .Field   Crops   Res, 2007,103: 139-153). Although it has been found that a plurality of and dormancy-related QTL site, the genetic effect in large degree by the environment or other gene as the impact of each other, it is difficult to effectively used for breeding practice. -resistant the lack of resources is resolved anti stachys breeding crops of the key issues needed.

[5]

Abscisic acid (ABA) is induced and maintain seed embryo germination of dormancy and inhibit an important plant hormone (Gubler   F, MillarAA, Jacobsen   JV.Dormancy   release, ABA   and   pre-harvest   sprouting.Curr   OpinPlant   Biol, 2005, 8 : 183-187; Lefebvre   V, North   H, Frey   A, Sotta   B, Seo   M, Okamoto   M, Nambara   E, Marion-Poll   A.Functional   analysis   of   Arabidopsis   NCED6and   NCED9   genes   indicates   that   ABA   synthesized   in   the   endosperm   is   involved   inthe   induction   of   seed   dormancy.Plant   J, 2006, 45 : 309-319), the latest research shows that, ABA synthetic key mutation of the gene in rice seeds using the content dropping and ABA (Fang   J, Chai   CL, Qian   Q, Chu   CC, Li   CL, Tang   JY, Sun   L, Huang   ZJ, Guo   XL, Sun   CH, Liu   M.Mutations   ofgenes   in   synthesis   of   the   carotenoid   precursors   of   ABA   lead   to   pre-harvestsprouting   and   photo-oxidation   in   rice.Plant   J, 2008, 54 : 177-189). The synthesis of ABA catabolism dynamic balance level of the common regulating plant endogenous ABA, ABA the   8 [...] -hydroxylase (ABA the   8 [...] -hydroxylation) endogenous ABA is the key enzyme for the main metabolic pathway. Studies have shown, which belongs to the cytochrome P450 family ABA8 the CYP707A [...] -hydroxylase gene in Arabidopsis seed germination process with the rapid decline in ABA are closely linked, wherein CYP707A2 adjusting and controlling the seed is considered to be the level of ABA, thereby affecting the state from the dormant to the germination of the seeds of the transformed into important gene. The present has been successively from rice (Yang   SH, Choi   D.Characterization   of   genes   encoding   ABA   8 the [...] -hydroxylase   inethylene-induced   stem   growth   of   deepwater   rice (Oryza   sativa   l.) .Biochem & Biophys   Res   Commun, 2006,350: 685-690), barley (Millar   AA, Jacobsen   JV, Ross   JJ, Helliwell   CA, Poole   AT, Scofield   G, Reid   JB, Gubler   F.Seed   dormancy   and   ABAmetabolism   in   Arabidopsis   and   barley: The   role   of   ABA   8 the [...] -hydroxylase.Plant   J, 2006, 45 (6): 942-954), wheat (Zhang   CL, He   XY, He   ZH, Wang   LH, Xia   XC.Cloningof   TaCYP707A1   gene   that   encodes   ABA   8 the [...] -hydroxylase   in   common   wheat (Triticumaestivum   l.) .Sci   Agic   Sin, 2009, 8 (8): 902-909) CYP707A2 species such as cloning in the homologous gene. Barley ortholog gene HvABA8   OH-1 [...] (gi: 81362265) gene expression spectrum analysis shows that, in the process of swelling of the seed in the gene expression level is significantly higher than that of the seed dormancy not in the dormant seed, with this period of ABA content in seeds corresponding to a significant drop, note HvABA8   [...] OH-1 may be in the process of seed germination a key gene (Millar   AA, Jacobsen   JV, RossJJ, Helliwell   CA, Poole   AT, Scofield   G, Reid   JB, Gubler   F.Seed   dormancy   and   ABAmetabolism   in   Arabidopsis   and   barley: The   role   of   ABA   8 the [...] -hydroxylase.Plant   J, 2006, 45 (6): 942-954). Gene sequence comparison found, the barley ortholog gene HvABA8   [...] OH-1 coding region 1006-1298bp more conservative the passage of, the average similarity in different species 80% left and right, and the rice ortholog gene OSCYP707A5 similarity is as high as 93%.

[6]

Refer to RNA interference in transgenic plants (RNAi) double-stranded RNA induced cognate mRNA degradation, resulting in the specific gene expression or not the phenomenon of very low expression amount. As the plant genome sequencing the completion of the work, and in an increasing number of biological metabolic pathway gene discovery of certain key, animal and plant technology have become RNAi properties of improved and powerful tool for treating disease genes (Wang   MB, Abbott   DC, Waterhouse   PM.A   single   copy   of   a   virus-derived   transgene   encodinghairpin   RNA   gives   immunity   to   barley   yellow   dwarf   virus.Mol   Plant   Pathol, 2000, 1 (6): 347-356; Regina   A, Bird   A, Topping   D, Bowden   S, Freeman   J, Barsby   T, Kosar-Hashemi   B, Li   ZY, Rahman   S, Morell   M. High-amylose   wheat   generated   by   RNAinterference   improves   indices   of   large-bowel   health   in   rats.PNAS, 2006,103: 3546-3551). Selection control of endogenous ABA ABA the main metabolic pathway of the   8 [...] -hydroxylase gene sequence, RNAi construction of highly efficient design of the plant expression vector for transforming plant cells, by means of a specific suppression of endogenous ABA metabolic-related enzyme gene to the expression of endogenous ABA content of the seed, seed embryo enhanced sleep level thus inhibit panical gemmation, it is possible to fundamentally control crop panical gemmation hazards.

[7]

Content of the invention

[8]

The purpose of this invention is to provide a plant ABA the key enzyme in the metabolic pathways of the double-chain RNAi plant expression vector and its use.

[9]

The invention provides a plant expression vector RNAi derived from barley ABA containing the   8 [...] -hydroxylase gene (HvABA8   OH-1 [...]) base sequence (hpRNA) the hairpin RNA expression cassette and selectable marker gene expression cassette. PGlub hpRNA expression cassette containing the seed specific promoter drives ABA the   8 [...] -hydroxylase gene inverted-repeat sequence fragment, from the sequence is 1 of the 5 [...] end section 1   006 nucleotide sequence according to the sequence is 1 to nucleotide arrangement mode 3 the extension end , the length is 293bp the deoxy nucleotide fragment, transcription in a plant cell of a double-stranded RNA hairpin structure. The selected marker gene expression cassette promoter containing pNos, Hygromycin resistance gene hpt and Nos terminator.

[10]

The above expression cassette hpRNA and recombinant expression vector containing the same, including constructing the carrier and in the middle of the marker gene with selective expression vector RNAi, engineering for the scope of protection of the invention.

[11]

RNAi of this invention through the use of the plant expression vector plasmid Ti, direct DNA transformation, micro-injection, agrobacterium-mediated transformation of plants of conventional biological method such as a cell or tissue, in the transformed cells can be formed in double-stranded hpRNA transcription of RNA molecules. HpRNA by seed specific expression of the ABA RNAi can inhibit the   8 [...] -hydroxylase gene expression, reducing the conversion plant metabolism level of ABA, the endogenous ABA content maintained at a certain level, thereby enhancing seed dormancy and anti stachys capacity. The use of the carriers of this invention conversion rice callus was 18 a strain of transgenic rice, seed germination a preliminary indication of the results of the experiment, part of the strains of transgenic rice seed germination rate is obviously reduced. RNAi is caused by the effect of the length of the only 21-23bp double-stranded RNA (dsRNA), is used for constructing the carrier of the barley HvABA8   [...] OH-1 gene fragment and rice, wheat ortholog gene similarity is as high as 93% or more, the length of the carrier can be formed for 293bp of the dsRNA. Therefore, the carrier can be used for converting wheat, barley, rice, and other important gramineae crop, anti stachys in the development of new varieties of transgenic crops with very good application prospects.

[12]

Description of drawings

[13]

Figure 1 is a flow-chart of HvABA8   [...] OH-1 gene fragment RNAi carrier

[14]

Figure 2 for HvABA8   [...] OH-1 gene fragment EcoR RNAi carrier and respectively through double-  I enzyme SpeI/BamH   I/PstI the electropherogram. Figure 1 the recombinant plasmid restriction enzyme, 2 recombinant plasmid for the enzyme, to M DL2000   Maker, for A HvABA8   [...] OH-1 gene fragment the enzyme cuts the chart , the intron map B enzyme.

[15]

Figure 3 is the plasmid map of pABA8   [...] OH-1 carrier spectrum.

[16]

Figure 4 is the PCR identification of transgenic rice. For M DL2000   Maker, 1 is a plasmid positive control, 2 negative control plant is not transformed, 3, 4, 6, 7, 8, 10 are transgenic plant, 5 and 9 as the transgenic female plant.

[17]

Mode of execution

[18]

The following examples of methods, such as used in the conventional method has no special description.

[19]

Embodiment 1   strain, plasmid and obtain of synthesis of PCR primer

[20]

Strains and plasmids

[21]

As the skeleton carrier pGreenII the cloning vector with Hygromycin-resistant gene. Plasmid PBI121, plasmid PBI101 and plasmid PTCK303 to the needs of building a vector pGlub endosperm-specific promoter, terminator NOS and introns. Escherichia coli (Escherichia   coli) strain DH5a, agrobacterium strain is (  tumefacieus Agrobacterim) AGL1.

[22]

PCR primer sequence

[23]

Promoter from a plasmid PBI121 pGlub the endosperm-specific promoter, containing design and SacI site of the restriction enzyme NotI downstream primer

[24]

PgluB-FP: the 5   AAGGAGCTCAGCTAGTATAGCTATCTAGGGTG the   3 [...]

[25]

PgluB-RP: the 5   AAGGCGGCCGCTAGCGGTGGCGTTTGGGTGG the   3 [...].

[26]

To plasmid PBI101 as the template, amplification Nos terminator, design and XhoI restriction enzyme cutting sites containing KpnI primer

[27]

Nos-FP: the 5   AAGCTCGAGGATCGTTCAAACATTTGG the   3 [...]

[28]

Nos-RP: the 5   AAGGGTACCGTAACATAGATGACACCG the   3 [...].

[29]

To plasmid PTCK303 as the template to amplify intron, carried respectively BamH   I site of restriction enzyme SpeI primer and

[30]

Intron-FP: the 5   AAGACTAGTAGATCTGCTAGCGGTAAGTTAC the   3 [...]

[31]

Intron-RP: the 5   AAGGGATCCCTGAAAATCTCGAAACAGCC the   3 [...].

[32]

Reverse transcription of the RNA to barley 1st chain cDNA as the template, amplification HvABA8   [...] OH-1 gene fragment, the forward primer design for restriction enzyme cutting sites XbaI and NotI, the reverse primers with restriction enzyme cutting sites PstI EcoR and   I to.

[33]

OH1CF: the 5   TTGTCTAGAGCGGCCGCCGGGTGATCCAGGAGACGAT the   3 [...]

[34]

OH1CR: the 5   TTGACTAGTCTGCAGAGGTGGTGGCAGAGGACGAG the   3 [...]

[35]

Embodiment 2 the construction of the plant expression vector   RNAi and

[36]

Promoter, terminator PCR amplification of the intron

[37]

To plasmid vector PBI121, PBI101 and PTCK303 as the template, the corresponding restriction enzyme cutting sites are respectively for the upper, downstream primer for PCR amplification, electrophoresis detection of the amplification product, the obtained specific fragment large and small are 1200,250,500bp left and right, and it is expected that the same large and small target fragment.

[38]

HvABA8   OH-1 [...] RT-PCR amplification of the gene fragment

[39]

In barley cDNA as the template for PCR amplification. To amplify the 293bp consistent with the expected size of the gene fragment, the fragment sequence correctly verified by sequencing.

[40]

HvABA8   OH-1 [...] RNAi carrier construction of gene fragments

[41]

The skeleton vector cloning carries the tide ycin resistance selection marker gene (hpt) pGreenII the double-element carrier. According to the restriction enzyme cutting site, is connected with the sequence of: pGlub promoter, Nos terminator, HvABA8   [...] OH-1 gene reverse passage and HvABA8   OH-1 [...] forward fragment of the gene, finally the introns is connected with the upper (Figure 1). Each element after the purification by the agarose gel, is connected with a cloning vector pGreenII, is connected with the product into Escherichia coli DH5a competent cell, the recombinant plasmid by restriction enzyme cutting, with the large and small target fragment (Figure 2), and will re-sequencing verify correct sub-delivers Austria the branch biological Company. The construct containing the correct HvABA8   [...] OH-1 gene fragment is named as pABA8   carrier RNAi [...] OH-1.

[42]

4. Agrobacterium tumefaciens transformed rice and identifying transgenic plant

[43]

The Agrobacterium plasmid into the carrier whose AGL1, and is used for transforming 420 granulata Japonica rice variety 'Japanese harumi' mature seed wounded the embryo recovers , to obtain regenerated plant 52 strain, transplant survival 50 strain. Total DNA as the template, PCR in identifying transgenic plant through the Hygromycin resistance gene, the result shows that 8 strain positive plant is rice.

[44]

Seed germination experiment

[45]

Through transgenic rice F1 seed germination test, screening and obtaining 4 a is obviously lower than the germination of transgenic rice plants, through artificial construct a preliminary indication of the vectors to induce seed embryo dormancy to enhance RNAi, so as to improve the seed anti stachys capacity of it is possible.

[46]

The sequence table 1 : HvABA8   [...] OH-1 gene the sequence

[47]

ATGGGTGCCTTCATCCTCCTCCTCTGCTTGCTCGTGCCGTTGGTGCTCGTGTGCGCCGTCCGCGCCAGGAAGGGCGCCGGCGGGCGGTCGTCGTCGGGCGGCGGCAAGAAGGGCAGGCTGCCGCCGGGGTCCATGGGGTGGCCGTACGTGGGCGAGACCACGCAGCTCTACTCCTCCAAGAACCCCAACGTCTTCTTCGCCAGGAAGCGTAACAAGTACGGGCCCATCTTCAAGACGCACATCCTCGGGTGCCCCTGCGTCATGGTGTCCAGCCCGGAGGCCGCCAAGTTCGTGCTCGTCACGCAGGCGCACCTCTTCAAGCCTACCTTCCCGGCCAGCAAGGAGCGGATGCTGGGCCGCCAGGCCATCTTCTTCCAGCAGGGGGACTACCACACCCACCTCCGCCGTCTCGTCTCCCGCGCCTTCTCCCCCGAGGCCATCCGCGGCTCCGTTTCCTCCATCGAGGCCATCGCCCTCCGCTCCCTCGGCTCATGGGAAGGCCATGAAGTCAACACCTTCCAAGAAATGAAGACTTACGCTCTGAATGTGGCATTGCTGTCCATCTTCGGGGAGGAGGAGATGCAGTACATCGAGGAGCTGAAGCAGTGCTACCTGACGCTGGAGAAGGGGTACAACTCGATGCCGGTGAACCTGCCGGGCACGCTGTTCCACAAGGCCATGAAGGCCCGGAAGCGGCTGGGCGCCATTGTGGCCCACATCATCTCAGCCCGGCGCGAGCGGGAGCGCGGGAGCGACCTCCTGGGCTCCTTCATGGACGGCCGCGAGGCGCTCACCGACGACCAGATCGCCGACAACGCCATCGGCGTCATCTTCGCCGCGCGGGACACCACCGCCAGCGTGCTCACGTGGATGGTCAAGTTCCTCGGCGACAACCCCGCCGTCCTCAAAGCCGTCACCGAAGAGCACGCCGAGATCGCGAGGGAGAAGGCGTTGTCCGGCGAGCCGCTGTCGTGGGCCGACACGCGGCGGATGCGGGTGACGGGCCGGGTGATCCAGGAGACGATGCGGGTGGCGTCCATCCTCTCCTTCACCTTCAGAGAGGCCGTCGAGGACGTGGAGTACCAAGGGTACCTGATCCCCAAGGGCTGGAAAGTGCTTCCCCTGTTCCGGAACATCCACCACAACCCCGACCACTTCCCCTCCCCCGAAAAGTTCGATCCTTCACGATTCGAGGTGGCCCCCAAGCCCAACACGTTCATGCCGTTCGGGAACGGGACCCACTCGTGCCCCGGCAACGAGCTGGCCAAGCTGGAGATGCTCGTCCTCTGCCACCACCTCGCCACCAAGTACAGATGGTCTACCTCCAAGTCCGAGAGCGGCGTGCAGTTCGGCCCCTTCGCCCTGCCCATCAACGGCCTCCCCATGACCTTCACCCGCAAGGCCTGA

[48]

 LISTING SEQUENCE

[49]

<110>Biological research Institute China Academy of Sciences chengdu

[50]

<120>ABA8 the RNAi [...] hydroxylase gene of the plant expression vector and use

[51]

<130>Specification

[52]

<160>9 <170>  PatentIn   version   3.3

[53]

<210>1

[54]

<211>32

[55]

<212>DNA

[56]

<213>Hordeum   bogdanii

[57]

<400>1

[58]

 Tg   ctatctaggg   gctagtatag aaggagctca     32

[59]

<210>2

[60]

<211>31

[61]

<212>DNA

[62]

<213>Hordeum   bogdanii

[63]

<400>2

[64]

 G   cgtttgggtg   ctagcggtgg aaggcggccg     31

[65]

<210>3

[66]

<211>27

[67]

<212>DNA

[68]

<213>Hordeum   bogdanii

[69]

<400>3

[70]

 Catttgg   atcgttcaaa aagctcgagg     27

[71]

<210>4

[72]

<211>27

[73]

<212>DNA

[74]

<213>Hordeum   bogdanii

[75]

<400>4

[76]

 Gacaccg   taacatagat aagggtaccg     27

[77]

<210>5

[78]

<211>31

[79]

<212>DNA

[80]

<213>Hordeum   bogdanii

[81]

<400>5

[82]

 Cggtaagtta   gatctgctag aagactagta   c     31

[83]

<210>6

[84]

<211>29

[85]

<212>DNA

[86]

<213>Hordeum   bogdanii

[87]

<400>6

[88]

   Gaaacagcc   tgaaaatctc aagggatccc     29

[89]

<210>7

[90]

<211>37

[91]

<212>DNA

[92]

<213>Hordeum   bogdanii

[93]

<400>7

[94]

 Agacgat   gtgatccagg   cggccgccgg ttgtctagag     37

[95]

<210>8

[96]

<211>35

[97]

<212>DNA

[98]

<213>Hordeum   bogdanii

[99]

<400>8

[100]

 Gtggcagagg   tgcagaggtg   acgag ttgactagtc     35

[101]

<210>9

[102]

<211>1407

[103]

<212>DNA

[104]

<213>Hordeum   bogdanii

[105]

<400>9

[106]

 Gtgcgccgtc   tcatcctcct   tggtgctcgt   ctcgtgccgt   cctctgcttg atgggtgcct     60

[107]

 Gggcaggctg   agggcgccgg   gcggcaagaa   tcgtcgggcg   cgggcggtcg cgcgccagga     120

[108]

 Ctcctccaag   ccatggggtg   cgcagctcta   ggcgagacca   gccgtacgtg ccgccggggt     180

[109]

 Caagacgcac   tcttcttcgc   ggcccatctt   aacaagtacg   caggaagcgt aaccccaacg     240

[110]

 Cgtgctcgtc   gcccctgcgt   ccgccaagtt   agcccggagg   catggtgtcc atcctcgggt     300

[111]

 Gctgggccgc   acctcttcaa   aggagcggat   ccggccagca   gcctaccttc acgcaggcgc     360

[112]

 Cgtctcccgc   tcttccagca   tccgccgtct   cacacccacc   gggggactac caggccatct     420

[113]

 Cgccctccgc   ccgaggccat   tcgaggccat   gtttcctcca   ccgcggctcc gccttctccc     480

[114]

 Gacttacgct   catgggaagg   aagaaatgaa   aacaccttcc   ccatgaagtc tccctcggct     540

[115]

 Cgaggagctg   catcttcggg   tgcagtacat   cattgctgtc   gaggaggaga ctgaatgtgg     600

[116]

 Cctgccgggc   acctgacgct   tgccggtgaa   tacaactcga   ggagaagggg aagcagtgct     660

[117]

 Ggcccacatc   acaaggccat   gcgccattgt   aagcggctgg   gaaggcccgg acgctgttcc     720

[118]

 Catggacggc   ggcgcgagcg   tgggctcctt   agcgacctcc   ggagcgcggg atctcagccc     780

[119]

 Cttcgccgcg   tcaccgacga   tcggcgtcat   gacaacgcca   ccagatcgcc cgcgaggcgc     840

[120]

 Caaccccgcc   ccgccagcgt   tcctcggcga   atggtcaagt   gctcacgtgg cgggacacca     900

[121]

 Gttgtccggc   ccgtcaccga   gggagaaggc   gagatcgcga   agagcacgcc gtcctcaaag     960

[122]

 Gatccaggag   cgtgggccga   cgggccgggt   atgcgggtga   cacgcggcgg gagccgctgt     1020

[123]

 Ggacgtggag   tggcgtccat   aggccgtcga   accttcagag   cctctccttc acgatgcggg     1080

[124]

 Gaacatccac   acctgatccc   ccctgttccg   aaagtgcttc   caagggctgg taccaagggt     1140

[125]

 Cgaggtggcc   accacttccc   cttcacgatt   aagttcgatc   ctcccccgaa cacaaccccg     1200

[126]

Cccaagccca   cggcaacgag   gccgttcggg   actcgtgccc   aacgggaccc   acacgttcat     1260

[127]

 Cagatggtct   tggagatgct   ccaccaagta   caccacctcg   cgtcctctgc ctggccaagc     1320

[128]

 Caacggcctc   ccgagagcgg   ccctgcccat   ggccccttcg   cgtgcagttc acctccaagt     1380

[129]

 Ggcctga   tcacccgcaa cccatgacct     1407



[1]

The invention belongs to the technical field of plant gene engineering and relates to a hairpin RNA expression cassette based on a barley ABA (Abscisic Acid) 8'-hydroxylase gene (HvABA8 OH-1) sequence, an RNAi plant expression vector and application thereof. The hairpin RNA expression cassette of the barley ABA 8'-hydroxylase gene and the RNAi plant expression vector contain a 1006th nucleotide sequence of a 5' end from a sequence table 1, a reverse repeated deoxynucleotide segment with a length of 293bp and a double-chain RNA molecule capable of transcribing to form a hairpin RNA structure, wherein the nucleotide sequence extends to a 3' end according to a nucleotide arrangement mode of a sequence 1. In the invention, transformed cells are induced to generate RNAi and reduce the endogenous ABA metabolic level so as to enhance the dormancy of transgenic plant seeds. The vector has good application prospect in cultivating new species of pre-harvest sprout resistant transgenic crops.



1. ABA based on barley the   8 [...] -hydroxylase gene HvABA8   [...] OH-1 sequence of hairpin RNA expression cassette, characterized in that the sequence comprising from 1 of the 5 end [...] section 1006 nucleotides sequence according to the sequence 1 to nucleotide arrangement mode 3 the extension end , the length is 293bp deoxy nucleotide fragment inverted repeats.

2. A barley ABA   8 the RNAi [...] -hydroxylase gene of the plant expression vector, including antibiotic resistance selection marker gene, characterized in that containing claim 1 wherein the barley ABA the   8 [...] -hydroxylase gene of hairpin RNA expression cassette.

3. A barley ABA   8 the RNAi [...] -hydroxylase gene of the plant expression vector according to Claim 2, characterized in that the antibiotic resistance selection marker gene hpt for Hygromycin-resistant gene.

4. Barley ABA   8 the RNAi [...] -hydroxylase gene of the plant expression vector as in Claim 1 or 2 or Claim 3, characterized in that the carrier can in the conversion of form hairpin RNA transcription in the cell structure of the double-stranded RNA molecule, generating RNAi induced transformed cells.

5. Containing claim 1 wherein the barley ABA the   8 [...] -hydroxylase gene of hairpin RNA expression cassette recombinant expression vectors, engineered bacteria or transgenic cell line.

6. Claim 1 wherein the barley ABA the   8 [...] -hydroxylase gene of hairpin RNA expression cassette in the use of anti stachys plant.

7. Claim 2 or 3 or 5 wherein the barley ABA the   8 [...] -hydroxylase gene of hairpin RNA expression cassette in the use of anti stachys plant.