RNAi plant expression vector of ABA (Abscisic Acid) 8'-hydroxylase gene and application
Technical Field The invention belongs to the field of plant genetic engineering technologies, relates to a kind of inhibiting the ABA8 [...] -hydroxylase gene expression of plant expression vector RNAi and its use, in particular to based on the barley ABA8 [...] -hydroxylase gene HvABA8 OH-1 [...] double-stranded of the plant expression vector and RNAi anti stachys in the use of gene engineering. Background Art Panical gemmation ( sprouting Pre-harvest, PHS) or using the mean seed harvester front encountered under cloudy and rainy weather or in a humid environment on the germination. Panical gemmation often occur in wheat, barley, rice and corn main crops, such as, to seriously affect the yield and quality, is a worldwide important agricultural disasters. Panical gemmation the environment and genotype intercation control (Zhang HF, Lu RH.Study on the mechanism of the resistance to preharvest sprouting and inheritancein wheat.Acta Agron Sin, 1993, 19 (6): 523-530), the factors affecting panical gemmiparous genotype is extremely complex ( ZX Sheng, Yu SR, Wu on resistance ZS. Studies Agic pre-harvest Sin wheatcultivars.Sci in sprouting, 1991, 24 (5): 44-50; shaw and. Wheat head germination studies. Beijing, China. The China agriculture Publishing house, 2003), the germination traits have been found by using a plurality of genetic regulation and control of the system, then generated seed dormancy is weak and the high? Amylase activity is the main reason for the seed panical gemmiparous (Biddulph TB, Plummer JA, Setter TL, Mares DJ.Influence of high temperature and terminal moisture stresson dormancy in wheat (Triticum aestivum l.) .Field Crops Res, 2007,103: 139-153). Although it has been found that a plurality of and dormancy-related QTL site, the genetic effect in large degree by the environment or other gene as the impact of each other, it is difficult to effectively used for breeding practice. -resistant the lack of resources is resolved anti stachys breeding crops of the key issues needed. Abscisic acid (ABA) is induced and maintain seed embryo germination of dormancy and inhibit an important plant hormone (Gubler F, MillarAA, Jacobsen JV.Dormancy release, ABA and pre-harvest sprouting.Curr OpinPlant Biol, 2005, 8 : 183-187; Lefebvre V, North H, Frey A, Sotta B, Seo M, Okamoto M, Nambara E, Marion-Poll A.Functional analysis of Arabidopsis NCED6and NCED9 genes indicates that ABA synthesized in the endosperm is involved inthe induction of seed dormancy.Plant J, 2006, 45 : 309-319), the latest research shows that, ABA synthetic key mutation of the gene in rice seeds using the content dropping and ABA (Fang J, Chai CL, Qian Q, Chu CC, Li CL, Tang JY, Sun L, Huang ZJ, Guo XL, Sun CH, Liu M.Mutations ofgenes in synthesis of the carotenoid precursors of ABA lead to pre-harvestsprouting and photo-oxidation in rice.Plant J, 2008, 54 : 177-189). The synthesis of ABA catabolism dynamic balance level of the common regulating plant endogenous ABA, ABA the 8 [...] -hydroxylase (ABA the 8 [...] -hydroxylation) endogenous ABA is the key enzyme for the main metabolic pathway. Studies have shown, which belongs to the cytochrome P450 family ABA8 the CYP707A [...] -hydroxylase gene in Arabidopsis seed germination process with the rapid decline in ABA are closely linked, wherein CYP707A2 adjusting and controlling the seed is considered to be the level of ABA, thereby affecting the state from the dormant to the germination of the seeds of the transformed into important gene. The present has been successively from rice (Yang SH, Choi D.Characterization of genes encoding ABA 8 the [...] -hydroxylase inethylene-induced stem growth of deepwater rice (Oryza sativa l.) .Biochem & Biophys Res Commun, 2006,350: 685-690), barley (Millar AA, Jacobsen JV, Ross JJ, Helliwell CA, Poole AT, Scofield G, Reid JB, Gubler F.Seed dormancy and ABAmetabolism in Arabidopsis and barley: The role of ABA 8 the [...] -hydroxylase.Plant J, 2006, 45 (6): 942-954), wheat (Zhang CL, He XY, He ZH, Wang LH, Xia XC.Cloningof TaCYP707A1 gene that encodes ABA 8 the [...] -hydroxylase in common wheat (Triticumaestivum l.) .Sci Agic Sin, 2009, 8 (8): 902-909) CYP707A2 species such as cloning in the homologous gene. Barley ortholog gene HvABA8 OH-1 [...] (gi: 81362265) gene expression spectrum analysis shows that, in the process of swelling of the seed in the gene expression level is significantly higher than that of the seed dormancy not in the dormant seed, with this period of ABA content in seeds corresponding to a significant drop, note HvABA8 [...] OH-1 may be in the process of seed germination a key gene (Millar AA, Jacobsen JV, RossJJ, Helliwell CA, Poole AT, Scofield G, Reid JB, Gubler F.Seed dormancy and ABAmetabolism in Arabidopsis and barley: The role of ABA 8 the [...] -hydroxylase.Plant J, 2006, 45 (6): 942-954). Gene sequence comparison found, the barley ortholog gene HvABA8 [...] OH-1 coding region 1006-1298bp more conservative the passage of, the average similarity in different species 80% left and right, and the rice ortholog gene OSCYP707A5 similarity is as high as 93%. Refer to RNA interference in transgenic plants (RNAi) double-stranded RNA induced cognate mRNA degradation, resulting in the specific gene expression or not the phenomenon of very low expression amount. As the plant genome sequencing the completion of the work, and in an increasing number of biological metabolic pathway gene discovery of certain key, animal and plant technology have become RNAi properties of improved and powerful tool for treating disease genes (Wang MB, Abbott DC, Waterhouse PM.A single copy of a virus-derived transgene encodinghairpin RNA gives immunity to barley yellow dwarf virus.Mol Plant Pathol, 2000, 1 (6): 347-356; Regina A, Bird A, Topping D, Bowden S, Freeman J, Barsby T, Kosar-Hashemi B, Li ZY, Rahman S, Morell M. High-amylose wheat generated by RNAinterference improves indices of large-bowel health in rats.PNAS, 2006,103: 3546-3551). Selection control of endogenous ABA ABA the main metabolic pathway of the 8 [...] -hydroxylase gene sequence, RNAi construction of highly efficient design of the plant expression vector for transforming plant cells, by means of a specific suppression of endogenous ABA metabolic-related enzyme gene to the expression of endogenous ABA content of the seed, seed embryo enhanced sleep level thus inhibit panical gemmation, it is possible to fundamentally control crop panical gemmation hazards. Content of the invention The purpose of this invention is to provide a plant ABA the key enzyme in the metabolic pathways of the double-chain RNAi plant expression vector and its use. The invention provides a plant expression vector RNAi derived from barley ABA containing the 8 [...] -hydroxylase gene (HvABA8 OH-1 [...]) base sequence (hpRNA) the hairpin RNA expression cassette and selectable marker gene expression cassette. PGlub hpRNA expression cassette containing the seed specific promoter drives ABA the 8 [...] -hydroxylase gene inverted-repeat sequence fragment, from the sequence is 1 of the 5 [...] end section 1 006 nucleotide sequence according to the sequence is 1 to nucleotide arrangement mode 3 the extension end , the length is 293bp the deoxy nucleotide fragment, transcription in a plant cell of a double-stranded RNA hairpin structure. The selected marker gene expression cassette promoter containing pNos, Hygromycin resistance gene hpt and Nos terminator. The above expression cassette hpRNA and recombinant expression vector containing the same, including constructing the carrier and in the middle of the marker gene with selective expression vector RNAi, engineering for the scope of protection of the invention. RNAi of this invention through the use of the plant expression vector plasmid Ti, direct DNA transformation, micro-injection, agrobacterium-mediated transformation of plants of conventional biological method such as a cell or tissue, in the transformed cells can be formed in double-stranded hpRNA transcription of RNA molecules. HpRNA by seed specific expression of the ABA RNAi can inhibit the 8 [...] -hydroxylase gene expression, reducing the conversion plant metabolism level of ABA, the endogenous ABA content maintained at a certain level, thereby enhancing seed dormancy and anti stachys capacity. The use of the carriers of this invention conversion rice callus was 18 a strain of transgenic rice, seed germination a preliminary indication of the results of the experiment, part of the strains of transgenic rice seed germination rate is obviously reduced. RNAi is caused by the effect of the length of the only 21-23bp double-stranded RNA (dsRNA), is used for constructing the carrier of the barley HvABA8 [...] OH-1 gene fragment and rice, wheat ortholog gene similarity is as high as 93% or more, the length of the carrier can be formed for 293bp of the dsRNA. Therefore, the carrier can be used for converting wheat, barley, rice, and other important gramineae crop, anti stachys in the development of new varieties of transgenic crops with very good application prospects. Description of drawings Figure 1 is a flow-chart of HvABA8 [...] OH-1 gene fragment RNAi carrier Figure 2 for HvABA8 [...] OH-1 gene fragment EcoR RNAi carrier and respectively through double- I enzyme SpeI/BamH I/PstI the electropherogram. Figure 1 the recombinant plasmid restriction enzyme, 2 recombinant plasmid for the enzyme, to M DL2000 Maker, for A HvABA8 [...] OH-1 gene fragment the enzyme cuts the chart , the intron map B enzyme. Figure 3 is the plasmid map of pABA8 [...] OH-1 carrier spectrum. Figure 4 is the PCR identification of transgenic rice. For M DL2000 Maker, 1 is a plasmid positive control, 2 negative control plant is not transformed, 3, 4, 6, 7, 8, 10 are transgenic plant, 5 and 9 as the transgenic female plant. Mode of execution The following examples of methods, such as used in the conventional method has no special description. Embodiment 1 strain, plasmid and obtain of synthesis of PCR primer Strains and plasmids As the skeleton carrier pGreenII the cloning vector with Hygromycin-resistant gene. Plasmid PBI121, plasmid PBI101 and plasmid PTCK303 to the needs of building a vector pGlub endosperm-specific promoter, terminator NOS and introns. Escherichia coli (Escherichia coli) strain DH5a, agrobacterium strain is ( tumefacieus Agrobacterim) AGL1. PCR primer sequence Promoter from a plasmid PBI121 pGlub the endosperm-specific promoter, containing design and SacI site of the restriction enzyme NotI downstream primer PgluB-FP: the 5 AAGGAGCTCAGCTAGTATAGCTATCTAGGGTG the 3 [...] PgluB-RP: the 5 AAGGCGGCCGCTAGCGGTGGCGTTTGGGTGG the 3 [...]. To plasmid PBI101 as the template, amplification Nos terminator, design and XhoI restriction enzyme cutting sites containing KpnI primer Nos-FP: the 5 AAGCTCGAGGATCGTTCAAACATTTGG the 3 [...] Nos-RP: the 5 AAGGGTACCGTAACATAGATGACACCG the 3 [...]. To plasmid PTCK303 as the template to amplify intron, carried respectively BamH I site of restriction enzyme SpeI primer and Intron-FP: the 5 AAGACTAGTAGATCTGCTAGCGGTAAGTTAC the 3 [...] Intron-RP: the 5 AAGGGATCCCTGAAAATCTCGAAACAGCC the 3 [...]. Reverse transcription of the RNA to barley 1st chain cDNA as the template, amplification HvABA8 [...] OH-1 gene fragment, the forward primer design for restriction enzyme cutting sites XbaI and NotI, the reverse primers with restriction enzyme cutting sites PstI EcoR and I to. OH1CF: the 5 TTGTCTAGAGCGGCCGCCGGGTGATCCAGGAGACGAT the 3 [...] OH1CR: the 5 TTGACTAGTCTGCAGAGGTGGTGGCAGAGGACGAG the 3 [...] Embodiment 2 the construction of the plant expression vector RNAi and Promoter, terminator PCR amplification of the intron To plasmid vector PBI121, PBI101 and PTCK303 as the template, the corresponding restriction enzyme cutting sites are respectively for the upper, downstream primer for PCR amplification, electrophoresis detection of the amplification product, the obtained specific fragment large and small are 1200,250,500bp left and right, and it is expected that the same large and small target fragment. HvABA8 OH-1 [...] RT-PCR amplification of the gene fragment In barley cDNA as the template for PCR amplification. To amplify the 293bp consistent with the expected size of the gene fragment, the fragment sequence correctly verified by sequencing. HvABA8 OH-1 [...] RNAi carrier construction of gene fragments The skeleton vector cloning carries the tide ycin resistance selection marker gene (hpt) pGreenII the double-element carrier. According to the restriction enzyme cutting site, is connected with the sequence of: pGlub promoter, Nos terminator, HvABA8 [...] OH-1 gene reverse passage and HvABA8 OH-1 [...] forward fragment of the gene, finally the introns is connected with the upper (Figure 1). Each element after the purification by the agarose gel, is connected with a cloning vector pGreenII, is connected with the product into Escherichia coli DH5a competent cell, the recombinant plasmid by restriction enzyme cutting, with the large and small target fragment (Figure 2), and will re-sequencing verify correct sub-delivers Austria the branch biological Company. The construct containing the correct HvABA8 [...] OH-1 gene fragment is named as pABA8 carrier RNAi [...] OH-1. 4. Agrobacterium tumefaciens transformed rice and identifying transgenic plant The Agrobacterium plasmid into the carrier whose AGL1, and is used for transforming 420 granulata Japonica rice variety 'Japanese harumi' mature seed wounded the embryo recovers , to obtain regenerated plant 52 strain, transplant survival 50 strain. Total DNA as the template, PCR in identifying transgenic plant through the Hygromycin resistance gene, the result shows that 8 strain positive plant is rice. Seed germination experiment Through transgenic rice F1 seed germination test, screening and obtaining 4 a is obviously lower than the germination of transgenic rice plants, through artificial construct a preliminary indication of the vectors to induce seed embryo dormancy to enhance RNAi, so as to improve the seed anti stachys capacity of it is possible. The sequence table 1 : HvABA8 [...] OH-1 gene the sequence ATGGGTGCCTTCATCCTCCTCCTCTGCTTGCTCGTGCCGTTGGTGCTCGTGTGCGCCGTCCGCGCCAGGAAGGGCGCCGGCGGGCGGTCGTCGTCGGGCGGCGGCAAGAAGGGCAGGCTGCCGCCGGGGTCCATGGGGTGGCCGTACGTGGGCGAGACCACGCAGCTCTACTCCTCCAAGAACCCCAACGTCTTCTTCGCCAGGAAGCGTAACAAGTACGGGCCCATCTTCAAGACGCACATCCTCGGGTGCCCCTGCGTCATGGTGTCCAGCCCGGAGGCCGCCAAGTTCGTGCTCGTCACGCAGGCGCACCTCTTCAAGCCTACCTTCCCGGCCAGCAAGGAGCGGATGCTGGGCCGCCAGGCCATCTTCTTCCAGCAGGGGGACTACCACACCCACCTCCGCCGTCTCGTCTCCCGCGCCTTCTCCCCCGAGGCCATCCGCGGCTCCGTTTCCTCCATCGAGGCCATCGCCCTCCGCTCCCTCGGCTCATGGGAAGGCCATGAAGTCAACACCTTCCAAGAAATGAAGACTTACGCTCTGAATGTGGCATTGCTGTCCATCTTCGGGGAGGAGGAGATGCAGTACATCGAGGAGCTGAAGCAGTGCTACCTGACGCTGGAGAAGGGGTACAACTCGATGCCGGTGAACCTGCCGGGCACGCTGTTCCACAAGGCCATGAAGGCCCGGAAGCGGCTGGGCGCCATTGTGGCCCACATCATCTCAGCCCGGCGCGAGCGGGAGCGCGGGAGCGACCTCCTGGGCTCCTTCATGGACGGCCGCGAGGCGCTCACCGACGACCAGATCGCCGACAACGCCATCGGCGTCATCTTCGCCGCGCGGGACACCACCGCCAGCGTGCTCACGTGGATGGTCAAGTTCCTCGGCGACAACCCCGCCGTCCTCAAAGCCGTCACCGAAGAGCACGCCGAGATCGCGAGGGAGAAGGCGTTGTCCGGCGAGCCGCTGTCGTGGGCCGACACGCGGCGGATGCGGGTGACGGGCCGGGTGATCCAGGAGACGATGCGGGTGGCGTCCATCCTCTCCTTCACCTTCAGAGAGGCCGTCGAGGACGTGGAGTACCAAGGGTACCTGATCCCCAAGGGCTGGAAAGTGCTTCCCCTGTTCCGGAACATCCACCACAACCCCGACCACTTCCCCTCCCCCGAAAAGTTCGATCCTTCACGATTCGAGGTGGCCCCCAAGCCCAACACGTTCATGCCGTTCGGGAACGGGACCCACTCGTGCCCCGGCAACGAGCTGGCCAAGCTGGAGATGCTCGTCCTCTGCCACCACCTCGCCACCAAGTACAGATGGTCTACCTCCAAGTCCGAGAGCGGCGTGCAGTTCGGCCCCTTCGCCCTGCCCATCAACGGCCTCCCCATGACCTTCACCCGCAAGGCCTGA LISTING SEQUENCE <110>Biological research Institute China Academy of Sciences chengdu <120>ABA8 the RNAi [...] hydroxylase gene of the plant expression vector and use <130>Specification <160>9 <170> PatentIn version 3.3 <210>1 <211>32 <212>DNA <213>Hordeum bogdanii <400>1 Tg ctatctaggg gctagtatag aaggagctca 32 <210>2 <211>31 <212>DNA <213>Hordeum bogdanii <400>2 G cgtttgggtg ctagcggtgg aaggcggccg 31 <210>3 <211>27 <212>DNA <213>Hordeum bogdanii <400>3 Catttgg atcgttcaaa aagctcgagg 27 <210>4 <211>27 <212>DNA <213>Hordeum bogdanii <400>4 Gacaccg taacatagat aagggtaccg 27 <210>5 <211>31 <212>DNA <213>Hordeum bogdanii <400>5 Cggtaagtta gatctgctag aagactagta c 31 <210>6 <211>29 <212>DNA <213>Hordeum bogdanii <400>6 Gaaacagcc tgaaaatctc aagggatccc 29 <210>7 <211>37 <212>DNA <213>Hordeum bogdanii <400>7 Agacgat gtgatccagg cggccgccgg ttgtctagag 37 <210>8 <211>35 <212>DNA <213>Hordeum bogdanii <400>8 Gtggcagagg tgcagaggtg acgag ttgactagtc 35 <210>9 <211>1407 <212>DNA <213>Hordeum bogdanii <400>9 Gtgcgccgtc tcatcctcct tggtgctcgt ctcgtgccgt cctctgcttg atgggtgcct 60 Gggcaggctg agggcgccgg gcggcaagaa tcgtcgggcg cgggcggtcg cgcgccagga 120 Ctcctccaag ccatggggtg cgcagctcta ggcgagacca gccgtacgtg ccgccggggt 180 Caagacgcac tcttcttcgc ggcccatctt aacaagtacg caggaagcgt aaccccaacg 240 Cgtgctcgtc gcccctgcgt ccgccaagtt agcccggagg catggtgtcc atcctcgggt 300 Gctgggccgc acctcttcaa aggagcggat ccggccagca gcctaccttc acgcaggcgc 360 Cgtctcccgc tcttccagca tccgccgtct cacacccacc gggggactac caggccatct 420 Cgccctccgc ccgaggccat tcgaggccat gtttcctcca ccgcggctcc gccttctccc 480 Gacttacgct catgggaagg aagaaatgaa aacaccttcc ccatgaagtc tccctcggct 540 Cgaggagctg catcttcggg tgcagtacat cattgctgtc gaggaggaga ctgaatgtgg 600 Cctgccgggc acctgacgct tgccggtgaa tacaactcga ggagaagggg aagcagtgct 660 Ggcccacatc acaaggccat gcgccattgt aagcggctgg gaaggcccgg acgctgttcc 720 Catggacggc ggcgcgagcg tgggctcctt agcgacctcc ggagcgcggg atctcagccc 780 Cttcgccgcg tcaccgacga tcggcgtcat gacaacgcca ccagatcgcc cgcgaggcgc 840 Caaccccgcc ccgccagcgt tcctcggcga atggtcaagt gctcacgtgg cgggacacca 900 Gttgtccggc ccgtcaccga gggagaaggc gagatcgcga agagcacgcc gtcctcaaag 960 Gatccaggag cgtgggccga cgggccgggt atgcgggtga cacgcggcgg gagccgctgt 1020 Ggacgtggag tggcgtccat aggccgtcga accttcagag cctctccttc acgatgcggg 1080 Gaacatccac acctgatccc ccctgttccg aaagtgcttc caagggctgg taccaagggt 1140 Cgaggtggcc accacttccc cttcacgatt aagttcgatc ctcccccgaa cacaaccccg 1200 Cccaagccca cggcaacgag gccgttcggg actcgtgccc aacgggaccc acacgttcat 1260 Cagatggtct tggagatgct ccaccaagta caccacctcg cgtcctctgc ctggccaagc 1320 Caacggcctc ccgagagcgg ccctgcccat ggccccttcg cgtgcagttc acctccaagt 1380 Ggcctga tcacccgcaa cccatgacct 1407 The invention belongs to the technical field of plant gene engineering and relates to a hairpin RNA expression cassette based on a barley ABA (Abscisic Acid) 8'-hydroxylase gene (HvABA8 OH-1) sequence, an RNAi plant expression vector and application thereof. The hairpin RNA expression cassette of the barley ABA 8'-hydroxylase gene and the RNAi plant expression vector contain a 1006th nucleotide sequence of a 5' end from a sequence table 1, a reverse repeated deoxynucleotide segment with a length of 293bp and a double-chain RNA molecule capable of transcribing to form a hairpin RNA structure, wherein the nucleotide sequence extends to a 3' end according to a nucleotide arrangement mode of a sequence 1. In the invention, transformed cells are induced to generate RNAi and reduce the endogenous ABA metabolic level so as to enhance the dormancy of transgenic plant seeds. The vector has good application prospect in cultivating new species of pre-harvest sprout resistant transgenic crops. 1. ABA based on barley the 8 [...] -hydroxylase gene HvABA8 [...] OH-1 sequence of hairpin RNA expression cassette, characterized in that the sequence comprising from 1 of the 5 end [...] section 1006 nucleotides sequence according to the sequence 1 to nucleotide arrangement mode 3 the extension end , the length is 293bp deoxy nucleotide fragment inverted repeats. 2. A barley ABA 8 the RNAi [...] -hydroxylase gene of the plant expression vector, including antibiotic resistance selection marker gene, characterized in that containing claim 1 wherein the barley ABA the 8 [...] -hydroxylase gene of hairpin RNA expression cassette. 3. A barley ABA 8 the RNAi [...] -hydroxylase gene of the plant expression vector according to Claim 2, characterized in that the antibiotic resistance selection marker gene hpt for Hygromycin-resistant gene. 4. Barley ABA 8 the RNAi [...] -hydroxylase gene of the plant expression vector as in Claim 1 or 2 or Claim 3, characterized in that the carrier can in the conversion of form hairpin RNA transcription in the cell structure of the double-stranded RNA molecule, generating RNAi induced transformed cells. 5. Containing claim 1 wherein the barley ABA the 8 [...] -hydroxylase gene of hairpin RNA expression cassette recombinant expression vectors, engineered bacteria or transgenic cell line. 6. Claim 1 wherein the barley ABA the 8 [...] -hydroxylase gene of hairpin RNA expression cassette in the use of anti stachys plant. 7. Claim 2 or 3 or 5 wherein the barley ABA the 8 [...] -hydroxylase gene of hairpin RNA expression cassette in the use of anti stachys plant.