Rose anthocyanin reductase RrANR gene and encoding protein and application thereof

Technical Field

The invention relates to the field of plant genetic engineering technologies, in particular to a rose anthocyanidin reductase RrANR gene and its coding protein and application, the gene associated with the plant proanthocyandins synthesis.

Background Art

Proanthocyandins (Procyanidins, PAs) is widely existing in waste of a large category name polyphenol apperception compounds (such as lu shuang , 2007). A large number of research found that proanthocyandins is found so far the most strong and effective one of the free radical scavenger, the free radical oxygen scavenging capacity of the natural antioxidant than the commonly used, such as carotenoid, vitamin C and vitamin E all have to be strong, very many, the plant can be protected and not affected by UV of fungal infection, the increase of the content of proanthocyanidin can improve the oxidation resistance of plants (Winkel-Shirley, 2002 ; Dixon, 2005 ; Yuan, 2013). Domestic reports from blackbery, grape, hsue, tea and laricina, extracting proanthocyandins has a different degree peroxidaton (xu Huai� and other, 2008 ; [...] and other, 2012 ; wang Wei and other, 2011 ; jiang Guiquan , 2013 ; Chiang its clock, 2010). Free radical and oxidative stress is a major cause of cardiovascular disease, proanthocyandins can be through strong antioxidant activity, protection of the cardiovascular system. Animal experiment and clinical studies show that, proanthocyandins can be by reducing cholesterol levels, cholesterol deposit on the wall of the blood vessels is reduced, enhancing vascular elastic to reduce the blood pressure (Packeret, 1998). Proanthocyandins anti-tumor efficacy of many study has abroad, confirmed proanthocyandins to various cancer cell has different degrees of inhibition, the skin cancer, oral cancer, liver cancer, lung cancer, pancreatic cancer, gastric cancer, colon cancer, and the like have a certain prevention or treatment of (such as du Xiaofen , 2005). Proanthocyandins anticancer mechanism, mainly due to strong oxidation of the original anthocyanis has the capacity of and scavenging free radical, and carcinogenic-induced phase and promote stage associated with the active oxygen free radical, proanthocyandins can inhibit the induced and inducing cells to cancer cell growth.

Rose (Rosa   rugosa   Thunb.) is Rosaceae rose deciduous clumper shrub, beautiful patterns, aromatic four overflow, the color is bright, the traditional Chinese highly evaluated in a pedigree, known as the "Queen's flower" is called. Rose has important economic value, its petals containing proanthocyanidin of fruits, can be extraction, separation and purification effects anthocyanis, carries on process optimization, make it more scientific, efficient and industrialization, create greater economic benefits help improve the added value of the products, to meet the needs of people development of functional food, health food, nutritional tonic and medicine series of product, make the special resources into economic advantage, its will be further expanded in the future.

Content of the invention

The invention the technical problem to be solved is to provide a kind of rose anthocyanidin reductase (  Reductase Anthocyanidin) RrANR gene, encoding protein and use thereof. The gene associated with the plant proanthocyandins synthesis. The integrity of the translation region of the gene of the cauliflower mosaic virus promoter directly into the general plant after being combined, color change of a transgenic plant, proanthocyandins content are increased, the oxidation resistance of transgenic plants is obviously enhanced.

In order to solve the above technical problem, the invention provides a rose anthocyanidin reductase RrANR gene, the nucleotide sequence is SEQ   No. 1   ID is shown, its length is 1020bp.

Furthermore, obtaining the stated RrANR to gene nucleotide sequence primer:

P1 forward primer: 5 the the [...] -ATGGCCACCCCCCAACCC-3 [...] ;

P2 reverse primer: 5 the the [...] -CTAGCTCTGCAGCTCCCC-3 [...].

The invention also provides a gene RrANR encoded anthocyanidin reductase RrANR, the   ID SEQ   No. 2 on the amino acid sequence represented by the amino acid sequence of the protein of, its length is 339bp.

The invention also provides a recombinant expression vector, comprising claim 1 wherein the prokaryotic expression vector.

Furthermore, the prokaryotic expression vector for genetic transformation vector pCAMBIA2300s.

The invention also provides a recombinant expression vector containing Escherichia coli DH5 α expression strain.

The invention also provides a containing a recombinant host cell of the expression vector, characterized in that the host cell is Agrobacterium tumefaciens EHA105.

The invention also provides the following various one of the improved plant proanthocyandins synthesis and enhance resistance of the application, including:

1) claim 3 or 4 wherein the recombinant expression vector,

2) containing claim 3 or 4 of the recombinant expression vector for Escherichia coli DH10Bac expression strain;

3) containing claim 3 or 4 the recombinant host cell of the expression vector, characterized in that the host cell is Agrobacterium tumefaciens EHA105.

Furthermore, the plant is tobacco.

The invention also provides a method of cultivating the transgenic plant, comprising the following steps:

1) cloning of target gene;

2) plant expression vector construct;

3) receptor genetic transformation;

4) positive identification of transgenic plant;

5) transgenic plant phenotype and physiological analysis.

Furthermore, the positive identification of transgenic plants for the primer pair:

P3 forward primer: 5 the the [...] -TGAAGGGAGCTTCGATGCTGCTA-3 [...] ;

P4 reverse primer: 5 the the [...] -TTTCGTCCGCAATCAAGCCTGTG-3 [...].

The invention can utilize any a can be guided in the exogenous gene in the plant expression vector, by direct DNA transformation, conductance, Agrobacterium tumefaciens-mediated the conventional bio-technical method, such as provided by the present invention encoding gene RrANR introduced into the plant cell or tissue, the conversion of plant tissue and alcoholic beverages. The fragment of the gene of the invention is built into the plant expression vector, the transcription of the front of the initial polynucleotide can be combined with any kind of enhanced promoter or inducible promoter. In order to facilitate to transgenic plant cells or plant to identify and screening, the use of carriers for processing, such as adding the antibiotic resistant marker (such as Kanamycin or Hydromycin, and the like). The transformed host is tobacco, including a plurality of plant, cultivated species of plants of various colors.

The beneficial effects of this invention are:

In the invention the cloning is separated into anthocyanidin reductase gene (RrANR) in tobacco plants, transgenic plant can significantly improve the content of proanthocyanidin, thereby extracting, separating and purifying more proanthocyandins, create greater economic benefits to the added value of the product is improved; and the transformed plants RrANR the resistance of the plant can be enhanced, and in the next step with high content proanthocyandins high inoxidizability transgenic roses the basis of the new variety.

Description of drawings

Figure 1 is the excess pCAMBIA2300sa structure diagram of the plant expression vector of the invention;

Figure 2 is the excess plant expression vector pCAMBIA2300s---RrANR constructing a schematic diagram of the invention;

Figure 3 is a diagram of color contrast and transformation of tobacco early floriation early floriation RrANR gene of tobacco;

Figure: Figure 3A early floriation the control tobacco color; Figure 3B to the invention and of the tobacco early floriation RrANR;

Figure 4 is the situation of RrANR gene expression amount of the map in the transgenic plant;

In the Figure: the tobacco early floriation Col (as transgenic early floriation contrast of the tobacco), # 5, # 9 and # 12 to 3 two transgenic strains;

Figure 5 is the tobacco early floriation picture content of the anthocyanin petals of tobacco and transform compared with the early floriation RrANR gene;

In the Figure: the tobacco early floriation Control (as transgenic early floriation contrast of the tobacco), # 5, # 9 and # 12 to 3 transgenic strain a, *, P respectively and ** *** that < 0.05, P < 0.01 and P < 0.001 level of the difference;

Figure 6 is the tobacco early floriation petal proanthocyandins content graph of contrast and transformation of tobacco early floriation RrANR gene;

In the Figure: the tobacco early floriation Control (as transgenic early floriation contrast of the tobacco), # 5, # 9 and # 12 to 3 two transgenic strains. *, P respectively and ** *** that < 0.05, P < 0.01 and P < 0.001 level of the difference;

Figure 7 for dewatering the front and back has not been to transform a plant and three transgenic strain phenotype;

Figure: Figure 7A for dewatering and blue tetrazolium (NBT) nitrogen to the superoxide anion dyeing;

Figure 7B to dehydration treatment after the determination of the conductivity ; *, P respectively and ** *** that < 0.05, P < 0.01 and P < 0.001 level difference of; the tobacco early floriation Control (as transgenic early floriation contrast of the tobacco), # 5, # 9 and # 12 to 3 two transgenic strains.

Figure 8 have not been transformed to hydrogen peroxide treatment plant and three transgenic strain phenotype;

Figure: Figure 8A after the hydrogen peroxide treatment to two amino benzidine (DAB) dyeing hydrogen peroxide; Figure 8B to hydrogen peroxide treated malonialdehyde content determination. *, P respectively and ** *** that < 0.05, P < 0.01 and P < 0.001 level difference of; the tobacco early floriation Control (as transgenic early floriation contrast of the tobacco), # 5, # 9 and # 12 to 3 two transgenic strains.

Mode of execution

In order to better explain the invention, the following combining specific further clarify the embodiment of the main content of the present invention, however, the content of this invention is not only limited to the following embodiment.

Example 1 separation cloning RrANR gene

The early stage of the present invention rose abundant flower (also known as "pingyin a", http://tc.cctv.com/20100412/103621 .shtml, poong flower rose breeding literature has been published, see: lu Chuan Run (pingyin rose research Institute), rose new variety- abundant flower rose and cultivation technique, Shandong forestry technology, 2007, 5:77; Huazhong agricultural University horticulturae forestry institute horticultural plant biology florally practice teaching base from Shandong province of introducing a rose pingyin pingyin County Institute) flowers during the period of the different way sequencing (way sequencing by shenzhen launching gene technology limited finish), in the way the sequencing result design specific primer:

P1 forward primer: 5 the the [...] -ATGGCCACCCCCCAACCC-3 [...] ,

P2 reverse primer: 5 the the [...] -CTAGCTCTGCAGCTCCCC-3 [...] ;

Of the sequence 1-1020bp from the rose variety 'poong flower' (i.e. poong flower rose) petal cDNA by reverse transcription of RNA obtained from amplification, amplified fragment such as SEQ   No. 1   ID is shown in:

The specific steps are as follows: specific steps are:

1, by a commonly used method for the CTAB (reference: "plant genetic engineering", wang Guanlin , editor-in-chief fang Hong Jun) from the rose variety 'poong flower' petal total RNA is extracted, the specific steps are as follows:

1) to a centrifuge tube by adding CTAB (cetyl trimethyl ammonium bromide) extraction buffer solution (2% (W/V) CTAB, NaCl   1.4mol/L, EDTA (ethylene diamine tetra-acetic acid) 20mmol/L, Tris   Cl   100mmol/L, 2% (W/V) pvp) and 10% of the β-mercaptoethanol, in preheating the water bath;

2) the rose petals liquid nitrogen for cooling and grinding, the addition of the extracting liquid, mixing, the 65 [...] water bath 10 minutes;

3) adding equal volume of chloroform: isoamyl alcohol (volume ratio 24:1) mixed solution, mixing is reversed, for 10 min, under 4 °C 12000g centrifugal 10 min;

4) taking, repeat step 3);

5) the cleaning, the final concentration of added 2mol/L the LiCl, ice-bath 10-12 hours, 12000g, 4 the centrifugal [...] 15 minutes, absorbing, with 75% ethanol wash and precipitate two, an amount of soluble DEPC (depc acid diethyl ester) for use in process water;

6) in order to from the rose variety 'poong flower' petal total RNA is extracted as the template, using reverse transcriptase (buys valuable from bioengineer Dairen limited) then the reverse transcription to synthesize cDNA 1st chain, the reaction condition is the: the 65 [...] 5 min, 42 °C 50 min, 70 °C 10 min;

7) according to the sequence in transcription sequencing specific primer design:

P1 forward primer: 5 the the [...] -ATGGCCACCCCCCAACCC-3 [...] ,

P2 reverse primer: 5 the the [...] -CTAGCTCTGCAGCTCCCC-3 [...] ;

RrANR from the rose variety 'poong flower' petal cDNA obtained by reverse transcription of the RNA amplification out in;

The reaction conditions are:

94 the pre-denaturation [...] 4 min; the 94 [...] 30 sec, 60 °C 30 sec, 72 °C 1 min, 37 a circulation; 72 the extending [...] 10 min. The amplified PCR product to be interfaced with the 18-T carrier (buys valuable from bioengineer Dairen limited), screening positive cloning and sequencing, obtain the desired full-length genes. The clone is named 18-RrANR plasmid.

Embodiment 2RrANR gene overexpression vector construction, transformation

In order to better clarify the function of this gene, the expression in tobacco, from to verify that the phenotype of the transgenic plant. Specific steps are:

First, the embodiment 1 is in the positive clone 18-RrANR plasmid used for enzyme BamH   I and double SalI, fragment recycling purpose; at the same time, a method of using the same enzyme double-tobacco mosaic virus promoter 35S genetic transformation carrier pCAMBIA2300s (the genetic transformation vector from the Wuhan Huazhong agricultural University of crop genetic improved state key laboratory construction and a). The enzyme, the enzyme comprising the gene RrANR of fragments and enzyme pCAMBIA2300s (Figure 1) is connected with the carrier as the reaction, DH5 α transform Escherichia coli (Escherichia coli strain buys valuable from bioengineer Dairen Company limited). Positive clones by screening enzyme, to obtain transformation vector, named pCAMBIA2300s-RrANR.

The tobacco by Agrobacterium tumefaciens mediated genetic transformation method in the tobacco introduced into the early floriation, after infection, co-culture, at the same time screening with Kanamycin and Hydromycin-resistant transformed seedling, through the root, the conventional steps of training seedlings, obtain transgenic plant.

Genetic transformation the main steps and application reagent is as described below:

(1) reagent and solution abbrebytion

The culture medium used in this invention is the acronym of the plant hormone expressed as follows: 6-BA (6-BenzylaminoPurine, 6-benzylaminopurine); NAA (Naphthalene   acetic   acid, naphthalene acetic acid); Kan (Kanamycin, Kanamycin); Cef (Cefotaxime, cephalosporin ycin); Hyg (Hygromycin, Hydromycin)

(2) used for early floriation culture medium formulation for genetic transformation of tobacco

Table 1 lists the various of the present invention and its consumption of the component of the culture medium.

Table 1 design early floriation and tobacco transformation culture medium

Notes: 1/2MS, refer to the preparation of culture medium MS:   F.Skoog.Physiol.Plant   T.and Murashige, 1962, 15 : 473-497 reported method.

Table 1 in the Kan (Kanamycin, Kanamycin), Cef (Cefotaxime, cephalosporin ycin), Hyg (Hygromycin, Hydromycin), using 0.45 the method for filtering   m sterilizing, in the above-mentioned subject to Kan, Hyg, other than the regular culture medium Cef component 121 the high-pressure steam sterilization [...] 20 min the rear, to be culture medium cooling to 50-60 the when [...] , adding the superclean workbench.

(1) the agrobacterium-mediated genetic transformation step

1) culture of agrobacterium

First of all, corresponding to the resistance selection in a solid lb medium (10 g/l protono + 5 g/l yeast extract + 10 g/l sodium chloride agar + Kan100mg/L + 1.5 g/l) pre-culture Agrobacterium tumefaciens EHA10548 hours, the culture temperature is 28 the [...] ; picking preincubation nuon single colony, the corresponding inoculated in lb culture medium of the liquid resistance selection (10 g/l protono + 5 g/l   yeast extract + 10 g/l nacl + Kan100mg/L) in, for the 28 [...] 200rpm cradle culture sleepovers, to bacterial liquid concentration OD₆₀₀ value is about 0.6.

2) leaf disc transformation method

A. No vaccine cut tobacco early floriation the upper part of the tender complete unfolding of the blade, the blade into 0.8 cm ˉ 0.8 cm small size, into a sterile beaker;

B. The prepared bacterial liquid is poured into the beaker, gently rock the beaker. Soak in the liquid 10 min;

C. In the step b is taken out of the blade, for transfer to dry on the filter paper good fungus ; then placed in culture as described above on the co-culture of three days dark culture, the culture temperature is 28 the [...] ;

D. Three days later, into the blade as shown in table 1 on selective culture of the bud, alternately light and dark culture (illumination intensity 1000-1500lx, illumination time: 16h/d, dark time: 8h/d) culturing the, Kan and to the screening of the bud resistance Hyg differentiation, culture temperature is 28 the [...] ;

E. After the formation of the bud resistance, will cut off the same, to concentrate on selective culture as stated above, alternatively the illumination and dark culture (illumination intensity 1000-1500lx, illumination time: 16h/d, dark time: 8h/d) culturing the, Kan and Hyg-resistant seedlings of the screening, the culture temperature is 28 the [...] ;

F. The resistance obtained by screening into the seedling rooting selective culture as described above on the root thereof, alternately the illumination and dark culture (illumination intensity 1000-1500lx, illumination time: 16h/d, dark time: 8h/d) the culture, the culture temperature is 28 the [...].

2) transplantation

Transgenic early floriation wash off the residual of the tobacco plant culture medium, will have good seedling root into the greenhouse, at the same time one week in the first instance to maintain the moisture wet.

To obtain a total of 20 of strain PCR detection result is positive to the plasmid pCAMBIA2300s-RrANR the T₀ generation of transgenic tobacco.

Embodiment 3: RrANR gene transgenic T₀ generation in the field is observed with the phenotype of RT-PCR detection

Transgenic early floriation and tobacco plant shimoji after transplanting, until the florescence, the transgenic early floriation pattern of the tobacco with the unconverted early floriation compare patterns of the tobacco, tobacco of the gene transfer was found RrANR change of colors of: tobacco early floriation there is no conversion of the color patterns (Figure 3A); rotary RrANR gene of tobacco early floriation color into white (Figure 3B).

In order to verify the transgenic tobacco early floriation whether the pattern of the change of the gene-related RrANR, the device adopts the common RT-PCR method part of the transgenic early floriation RrANR gene expression in tobacco plants carrying out the detection (results see Figure 3). Specific steps are as follows:

Using TRIZOL reagent (buys valuable from bioengineer Dairen limited) from transgenic tobacco 1-6 of the strain of the total RNA is extracted (extraction method according to the above-mentioned operation of TRIZOL reagent specification), using reverse transcriptase (buys valuable from bioengineer Dairen limited) then the reverse transcription to synthesize cDNA 1st chain,

The reaction condition is the 65 the [...] 5 min, 42 °C 50 min, 70 °C 10 min.

EF1 α with the reported gene specialty obtained by reverse transcription of the cDNA to detect and concentration is adjusted, according to the gene EF1 α specialty a pair of primers is designed according to the sequence of:

P5 forward primer: 5 the the [...] -TGGTTGTGACTTTTGGTCCCA-3 [...] ,

P6 reverse primer: 5 the- [...] ACAAACCCACGCTTGAGATCC)-3 the [...] ; for PCR detection, the reaction condition is the: 94 the pre-denaturation [...] 4 min; the 94 [...] 30 sec, 60 °C 30 sec, 72 °C 30 sec, 28 a circulation; 72 the extending [...] 10 min. The test result as shown in Figure 3, the home early floriation gene EIF and transgenic tobacco can be early floriation tureet in the tobacco, and the brightness is consistent.

Furthermore, under RrFLS1 gene sequence, in the 3 a pair of primers [...] end of the:

P3 forward primer: 5 the the [...] -TGAAGGGAGCTTCGATGCTGCTA-3 [...] ,

P4 reverse primer: 5 the the [...] -TTTCGTCCGCAATCAAGCCTGTG-3 [...] ;

On detecting RT-PCR, the reaction condition is the: 94 the pre-denaturation [...] 4 min; the 94 [...] 30 sec, 60 °C 30 sec, 72 °C 1 min, 35 cycles; 72 the extending [...] 10 min. Test results show that, 3 strain transgenic tobacco RrANR is detected in the expression of the gene, the result as shown in Figure 3. Figure 3 shows in:1: early floriation is no conversion of the results of PCR amplification of the tobacco, 2-4:to turn into plasmid pCAMBIA2300s-RrANR of the tobacco transgenic early floriation PCR amplification results.

Embodiment 4 to early floriation RrANR smoke prarie anthocyanis extracting and measuring

Accurate weighing 0.4g blade and the petals, adding 3 ml extract (acetone ︰ water ︰ glacial acetic acid = 70 [...][...] 29.5 0.5, volume ratio) under the conditions of the water bath 35 the ultrasonic [...] 1h, every during 20 min rotary shaker to shake for 2 min. 12000rpm centrifugal 10 min, taking to the new centrifuge tube, and then respectively by chloroform and hexane extraction 2 times, then the aperture 0.45 the nylon microporous filter   m, stored in the -40 the in refrigerator [...]. Using NanoDrop2000C spectrum system to carry out quantitative analysis, 50 the adding   L 200 the cinnamaldehyde to dimethylamino   L (DMACA; Sigma-Aldrich, MO, USA) (0.1% DMACA, 90% reagent-grade   ethanol, 10% HCl), in 640 nm every under 1 min one, continuous measuring 10 min, the maximum value of the reading, the 3 repeated, averaginged. Proanthocyandins content using standard (+)-catechin (Sigma-Aldrich, MO, USA) quantitative.

Embodiment 5 to early floriation RrANR tobacco anthocyanis extracting and measuring

Accurate weighing 0.5g blade and the petals, adding 2.5 ml extract (methyl alcohol ︰ salt acid ︰ water = 70 [...][...] 0.1 29.9, volume ratio) under the dark condition 4 the leaching [...] 24h, every during 6h rotary shaker to shake for 1 min. 12000rpm centrifugal 10 min, taking to the new centrifuge tube, the aperture for the 0.22   m after the nylon microporous filter, the stored in the -40 in refrigerator [...] , used for other flavonoids with cyanine glucoside HPLC-DAD analysis. Liquid phase system using Shimadzu qualitative, including: LC-20AT type binary gradient pump used, SIL-20AC automatic sampler, CTO-20AC chromatographic column temperature control box, SPD-20AC detector, work station LC-Solution; chromatographic column in Japan, Tosoh TSK   gel production of   ODS-80Ts   QA reversed phase silica gel column (4.6 mm × 250 mm, particle size 5 the  m, Tosoh, Japan).

Analysis conditions: flow rate 0.8 ml subsidence min-1, column temperature 35 the [...] , the injection volume is 10 the  L, 200-800nm within the range of wavelength scanning absorption spectrum. Mobile phase composition: A phase, 10% formic acid-ultra-pure water (volume ratio); B phase, acetonitrile. Analysis time 35 min. The gradient elution program is:0 min, 90% A, 10% B; 20 min, 70% A, 30% B; 25 min, 90% A, 10% B.

Use method HPLC-DAD, respectively for 520 nm cyanine glucoside detection in flower petals. Respectively calculated using standard semiquantify method with respect to the standard substance contained in the dried cyanine glucoside and xanthein the content of the (μg · g-1FW) (Wang   et   al. , 2001). The use of the standard cyanine glucoside Shanghai tauto biotechnology limited production of Cyanidin -3 the glucoside [...] (cyanidin-3-O-glucoside, Cy3G).

Embodiment 6 to tobacco early floriation RrANR measuring antioxidant capacity

In order to better clarify the function of this gene, the applicant applies, # 5, # 9 and # 12 identified as RT-PCR semiquantify for three ultra-expression system, the three system and is compared with the (Control) carrying out dehydration and H₂ O₂ processing. Specific steps are: first each is takes 45 days old transgenic seedling culture dish, is provided with a natural dewatering 90 minutes, not back and forth to transform a plant and three transgenic strain accumulation of active oxygen analysis of the tissue chemical dyeing, respectively using diaminobenzidine (DAB) and nitrogen blue tetrazolium (NBT) to H₂ O₂ and O₂ accumulation analysis (according to the extent and depth of dyeing); and determine the last time point (dehydration 90 minutes) the conductivity of the content of (MDA) malonialdehyde and; at the same time, the growth of about 45d into the round hole of the tobacco seedling immersion 2% H₂ O₂ solution, processing 2d, the H₂ O have not been transformed before and after processing plant and three transgenic strain accumulation of active oxygen analysis of the tissue chemical dyeing, to using diaminobenzidine (DAB) H₂ O₂ accumulation analysis (according to the extent and depth of dyeing); and determine malonialdehyde (MDA) content and chlorophyll content.

(1) the organization of NBT DAB and chemical staining analysis step

The O₂^- detection, blades soaked in 1 mg   ml^-1 NBT solution (PH7.8 phosphate buffer) in 1-2h the blades are obvious phenotype (blade blue). H₂ O₂ detection, blades soaked in 1 mg   ml^-1 pH7.8 DAB working solution of the phosphate buffer (pH7.8), light dyeing 8 hours, has obvious phenotype decolorize (brown), then with anhydrous ethanol is removed completely after the green the blade, the water washing;

(2) malonialdehyde (MDA) content determination step

Taking 0.2g blade by adding 2 ml   5% TCA (trichloroacetic acid) concussion mixing, 12000rpm centrifugal 5 min taking adding 0.67% TBA (β-thio-barbituric acid) 2 ml   100 degrees boiling 30 min apply supernatant after cooling, respectively in the 450 nm   532 nm   600 nm absorbance measurement, the formula for calculating the content of MDA (umol/l)=6.45 * (A532-A600)-0.56 * A450;

(3) the relative conductivity of the determination step

Blade is is collected and placed in 25 ml deionized water 50 ml centrifuge tube, the cradle in the rotary shaker at room temperature in 2 hours the initial conductivity (C1) with the conductivity meter (STARTER-3C, Shanghai, China) to be measured. Sample in 100 the boiled water to cook [...] 10 min to the maximum of the ion in the cell leakage, when it is cooled to the room temperature measuring its conductivity to C2, the relative conductivity to the calculation formula of (C %) 100 * C1/C2.

Other non-detailed description of the prior art, the parts are. Although the above embodiment of the present invention detailed description of the, but it is only a portion of the embodiment of the present invention, embodiment of, but not all, people can also according to this embodiment is obtained without creativity on the premise that in other embodiments, these embodiments belonging to the scope of protection of this invention.