MODULAR DNA ASSEMBLY SYSTEM
This invention generally relates to a modular and hierarchical DNA assembly platform for synthetic biology termed MIDAS (for Modular Idempotent DNA Assembly System), methods of using this system to precisely assemble multiple DNA fragments in a single reaction using a standardised assembly design, and method of reconstructing biosynthetic pathways for subsequent production of at least one indole diterpene. A central requirement of synthetic biology is the ability to dissect biological systems into basic, reusable parts or modules, and to reorganise and reassemble those parts, in a standardised way, to produce novel genetic modules, interacting proteins, control circuits, metabolic pathways and high value products. In recent years, numerous enabling technologies have emerged to address these requirements at the genetic level. Most of these technologies fall into four broad categories, each offering powerful features, as well as limitations: (i) techniques which utilise site-specific recombinases to assemble DNA molecules together, (ii) techniques based on the in vitro assembly of DNA molecules containing overlapping sequences, (iii) in vivo techniques that utilise cellular, recombination-based mechanisms to assemble DNA molecules bearing homologous sequences, and (iv) techniques based on restriction enzymes. Site-specific recombination systems, such as those based on bacteriophages λ (1) or P1 (2, 3), or combinations thereof (4, 5), can be used for efficient, high-throughput construction of multigene assemblies. However, due to the presence of recombination site sequence scars, site-specific recombination-based techniques do not readily lend themselves to modular design for the combinatorial assembly of genes from simpler parts. Techniques that achieve in vitro assembly using DNA sequence overlaps, such as overlap extension PCR (6), Gibson assembly (7), In-Fusion (8, 9) and other ligation-independent cloning methods (10, 11), can efficiently assemble multiple fragments together in a single reaction and, because they are largely sequence independent (i.e., do not rely on specific sequences such as restriction enzyme recognition sites), produce scarless (seamless) assemblies. However, these techniques do not easily lend themselves to modularity, since new primer sets need to be designed every time a new fragment is introduced or the assembly order is changed. In vivo assembly methods, which utilise cellular homologous recombination machinery to assemble together multiple DNA fragments bearing overlapping terminal sequences, have been developed for Traditional approaches using conventional (Type IIP) restriction enzymes for arranging DNA fragments (e.g., genes) in tandem in one vector suffer from the problem that, as the number of DNA fragments increase, the available restriction enzymes become limiting, and cloning becomes increasingly complex. Approaches using rare-cutting restriction enzymes (19, 20) or isocaudomers (21) have had some success in assembling multiple genes in a single vector, but do not offer a truly flexible or modular assembly system that is also (theoretically) capable of indefinite growth. In an effort to overcome this limitation, and to standardise the assembly process, a set of design rules termed the BioBrick standard was developed (22), wherein the idea of idempotency—where a reaction performed on a component produces a new structure, yet leaves that structure unchanged with respect to its ability to participate in further reactions—was proposed in the context of DNA assembly. Nevertheless, the presence of restriction site scars can be problematic for these techniques, particularly when assembling genes from smaller fragments. More recently, modular DNA assembly techniques based on Golden Gate cloning (23) have been described. Golden Gate cloning utilises the ability of Type IIS restriction enzymes, which recognise non-palindromic sequences and cleave at one side of the recognition site, to seamlessly join multiple DNA fragments together in a single (one-pot) reaction. Techniques such as GoldenBraid (24, 25), the topologically equivalent TNT-Cloning (26), MoClo (27, 28), and the plasmid assembly system described by Binder et al (29), have used the idea of idempotency to extend the principles of Golden Gate cloning, thereby permitting modular and combinatorial assembly of genes from libraries of smaller fragments, and the subsequent assembly of multiple genes together in a single plasmid. In these systems, the direction of assembly is imposed by the compatibility of Type IIS overhangs on neighbouring fragments and vector ends. Thus, at the level of multigene assembly (i.e., assembly of multiple genes in a single vector), only one direction of assembly is possible, and growth of the multigene plasmid (i.e., addition of further genes) can only take place in one direction (i.e., is unidirectional). Whilst this might not be an issue for some projects, there are, however, circumstances in which these unidirectional modular assembly systems (UMASs) impose limitations on the type of multigene plasmids that can be produced, or the ease with which they can be constructed. An example where the unidirectional nature of multigene assembly inherent to the previously described UMASs imposes limitations, is when constructing multigene assemblies for testing expression of genes intended to be integrated by homologous recombination into the chromosome of an expression host. In this example, the genes of interest need to be placed between flanking left and right homology arms (which mediate the homologous recombination process). In the previously described UMASs this can only be achieved in two ways, either:
Another example of the shortcomings of unidirectional assembly is that the unidirectional nature of multigene assembly inherent to UMASs limits the speed and ease with which many of these positional permutations can be constructed. Thus, although (unidirectional) Golden Gate-based modular assembly techniques are useful for constructing certain types of multigene assemblies, they do not offer a completely flexible approach to assembly. Consequently, there is a need in the art for alternative DNA assembly systems that will provide the user with flexibility in constructing designer polynucleotides and gene assemblies. Accordingly it is an object of the invention to go at least some way towards addressing the deficiencies in the prior art in providing a modular DNA assembly system that allows for the construction of multigene assemblies bi-directionally and/or that will at least provide the public with a useful choice. In this specification where reference has been made to patent specifications, other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents is not to be construed as an admission that such documents, or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art. In one aspect the present invention relates to a vector set comprising at least two shuttle vectors, V1 and V2,
In another aspect the present invention relates to a vector set comprising at least three shuttle vectors,
In another aspect the present invention relates to a vector set comprising at least two shuttle vectors, wherein
In another aspect the present invention relates to a set of eight shuttle vectors, each shuttle vector comprising a first marker (M1) and six restriction sites,
In another aspect the invention relates to a method of making a vector set comprising at least two shuttle vectors comprising combining at least one V1 shuttle vector or first shuttle vector of the invention with at least one V2 shuttle vector or second shuttle vector of the invention. In another aspect the invention relates to a method of making a multigene construct comprising at least two transcription units (TU), the method comprising
In another aspect, the invention relates to a set of vectors comprising
Various embodiments of the different aspects of the invention as discussed above are also set out below in the detailed description of the invention, but the invention is not limited thereto. Other aspects of the invention may become apparent from the following description which is given by way of example only and with reference to the accompanying drawings. The invention will now be described with reference to the figures in the accompanying drawings. The term “comprising” as used in this specification and claims means “consisting at least in part of”; that is to say when interpreting statements in this specification and claims which include “comprising”, the features prefaced by this term in each statement all need to be present but other features can also be present. Related terms such as “comprise” and “comprised” are to be interpreted in similar manner. The term “consisting essentially of” as used herein means the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. The term “consisting of” as used herein means the specified materials or steps of the claimed invention, excluding any element, step, or ingredient not specified in the claim. The terms “recognition site” and “restriction site” are used interchangeably herein and mean the nucleic acid sequence or sequences of a polynucleotide that define the binding site on the polynucleotide for a given restriction enzyme. The term “a pair of restriction sites” and grammatically equivalent phrases means that the two restriction sites in the pair are the same; i.e., both restriction sites in the pair are restriction sites for the same restriction enzyme. As used herein, a “divergent orientation” of a pair of restriction sites means that cleavage of the polynucleotide comprising the restriction sites occurs on the outside of the nucleic acid sequences that define the pair of restriction sites, and not between the pair. Conversely, a “convergent orientation” of a pair of restriction sites, and similar grammatical constructions means that cleavage of the polynucleotide comprising the restriction sites occurs to the inside of the nucleic acid sequences that define the pair of restriction sites. As used herein, when a polynucleotide or nucleic acid sequence is “flanked” by restriction sites, that polynucleotide or nucleic acid sequence comprises a given restriction site to the 5′ and a given restriction site to the 3′ and no other restriction sites between the given sites. The phrase “are removed” with reference to a recognition or restriction site that is removed from a cloning cassette or destination vector as described herein means that the ligation of a cloning cassette into another cloning cassette or destination vector results in a cloning cassette or destination vector that does not contain the nucleotide residues of the recognition or restriction site. The term “genetic construct” refers to a polynucleotide molecule, usually double-stranded DNA, which has been conjugated to another polynucleotide molecule. In one non-limiting example a genetic construct is made by inserting a first polynucleotide molecule into a second polynucleotide molecule, for example by restriction/ligation as known in the art. In some embodiments, a genetic construct comprises a single polynucleotide module, at least two polynucleotide modules, or a series of multiple polynucleotide modules assembled into a single contiguous polynucleotide molecule (also referred to herein as a “multigene construct”), but not limited thereto. A genetic construct may contain the necessary elements that permit transcription of a polynucleotide molecule, and, optionally, for translating the transcript into a polypeptide. A polynucleotide molecule comprised in and/or by the gene construct may be derived from the host cell, or may be derived from a different cell or organism and/or may be a recombinant polynucleotide. Once inside the host cell the genetic construct may become integrated in the host chromosomal DNA. The genetic construct may be linked to a vector. The term “transcription unit” (TU) as used herein refers to a polynucleotide comprising a sequence of nucleotides that code for a single RNA molecule including all the nucleotide sequences necessary for transcription of the single RNA molecule, including a promoter, an RNA-coding sequence, and a terminator, but not limited thereto. The term “transcription unit module” (TUM) as used herein refers to a polynucleotide comprising a sequence of nucleotides that encode a single RNA molecule, or parts thereof; or that encode a protein coding sequence (CDS), or parts thereof; or that encode sequence elements, or parts thereof, that control transcription of that RNA molecule; or that encode sequence elements or parts thereof that control translation of the CDS. Such sequence elements may include, but are not limited to, promoters, untranslated regions (UTRs), terminators, polyadenylation signals, ribosome binding sites, transcriptional enhancers and translational enhancers. The term “multigene construct” as used herein means a genetic construct that is a polynucleotide comprising at least two transcription units. The term “marker” as used herein means a nucleic acid sequence in a polynucleotide that encodes a selectable marker or scorable marker. The term “selectable marker” as used herein refers to a TU, which when introduced into a cell, confers at least one trait on the cell that allows the cell to be selected based on the presence or absence of that trait. In one embodiment the cell is selected based on survival under conditions that kill cells not comprising the at least one selectable marker. The term “scorable marker” as used herein refers to a TU, which when introduced into a cell, confers at least one trait on the cell that allows the cell to be scored based on the presence or absence of that trait. In one embodiment the cell comprising the TU is scored by identifying the cell phenotypically from a plurality of cells. The term “genetic element” as used herein refers to any polynucleotide sequence that is not a TU or does not form part of a TU. Such polynucleotide sequences may include, but are not limited to origins of replication for plasmids and viruses, centromeres, telomeres, repeat sequences, sequences used for homologous recombination, site-specific recombination sequences, and sequences controlling DNA transfer between organisms. The term “source vector” as used herein refers to a vector into which polynucleotide sequences of interest can be cloned. In some embodiments the polynucleotide sequences are TUs, TUMs and/or genetic elements as described herein. In some embodiments a source vector is selected from the group consisting of plasmids, bacterial artificial chromosomes (BACs), phage artificial chromosomes (PACs), yeast artificial chromosomes (YACs), bacteriophage, phagemids, and cosmids. In some embodiments, a source vector comprising a polynucleotide sequence of interest is termed an entry clone. In some embodiments the entry clone can serve as a shuttle or destination vector for receiving further polynucleotide sequences. The term “shuttle vector” as used herein refers to a vector into which polynucleotide sequences of interest can be cloned and from which they can be manipulated. In some embodiments the polynucleotide sequences are TUs, TUMs and/or genetic elements as described herein. In some embodiments a shuttle vector is selected from the group consisting of plasmids, bacterial artificial chromosomes (BACs), bacteriophage P1-derived artificial chromosomes (PACs), yeast artificial chromosomes (YACs), bacteriophage, phagemids, and cosmids. In some embodiments, a shuttle vector comprising a polynucleotide sequence of interest can serve as a destination vector for receiving further polynucleotide sequences. The term “destination vector” as used herein refers to a vector into which polynucleotide sequences of interest can be cloned. In some embodiments the polynucleotide sequences are TUs, TUMs and/or genetic elements as described herein. In some embodiments a destination vector is selected from the group consisting of plasmids, bacterial artificial chromosomes (BACs), bacteriophage P1-derived artificial chromosomes (PACs), yeast artificial chromosomes (YACs), bacteriophage, phagemids, and cosmids. In some embodiments, a destination vector comprising a polynucleotide sequence of interest is an entry clone. In some embodiments the entry clone can serve as a destination vector for receiving further polynucleotide sequences. The term “vector” as used herein refers to any type of polynucleotide molecule that may be used to manipulate genetic material so that it can be amplified, replicated, manipulated, partially replicated, modified and/or expressed, but not limited thereto. In some embodiments a vector may be used to transport a polynucleotide comprised in that vector into a cell or organism. The term “polynucleotide(s),” as used herein, means a single or double-stranded deoxyribonucleotide or ribonucleotide polymer of any length, and include as non-limiting examples, coding and non-coding sequences of a gene, sense and antisense sequences, exons, introns, genomic DNA, cDNA, pre-mRNA, mRNA, rRNA, siRNA, miRNA, tRNA, ribozymes, recombinant polynucleotides, isolated and purified naturally occurring DNA or RNA sequences, synthetic RNA and DNA sequences, nucleic acid probes, primers, fragments, genetic constructs, vectors and modified polynucleotides. Reference to nucleic acids, nucleic acid molecules, nucleotide sequences and polynucleotide sequences is to be similarly understood. The term “gene” as used herein refers to gene the biologic unit of heredity, self-reproducing and located at a definite position (locus) on a particular chromosome. In one embodiment the particular chromosome is a eukaryotic or bacterial chromosome. The term bacterial chromosome is used interchangeably herein with the term bacterial genome. The term “gene cluster” as used herein refers to a group of genes located closely together on the same chromosome whose products play a coordinated role in a specific aspect of cellular primary or secondary metabolism. The terms “under conditions wherein the . . . enzyme is active” and “under conditions wherein the . . . enzymes are active”, and grammatical variations thereof when used in reference to enzyme activity mean that the enzyme will perform it's expected function; e.g., a restriction endonuclease will cleave a nucleic acid at an appropriate restriction site, and a DNA ligase will covalently join two polynucleotides together. The term “coding region” or “open reading frame” (ORF) refers to the sense strand of a genomic DNA sequence or a cDNA sequence that is capable of producing a transcription product and/or a polypeptide under the control of appropriate regulatory sequences. The coding sequence is identified by the presence of a 5′ translation start codon and a 3′ translation stop codon. When inserted into a genetic construct or an expression cassette, a “coding sequence” is capable of being expressed when it is operably linked to promoter and terminator sequences and/or other regulatory elements. “Operably-linked” means that the sequence to be expressed is placed under the control of regulatory elements. “Regulatory elements” as used herein refers to any nucleic acid sequence element that controls or influences the expression of a polynucleotide insert from a vector, genetic construct or expression cassette and includes promoters, transcription control sequences, translation control sequences, origins of replication, tissue-specific regulatory elements, temporal regulatory elements, enhancers, polyadenylation signals, repressors and terminators. Regulatory elements can be “homologous” or “heterologous” to the polynucleotide insert to be expressed from a genetic construct, expression cassette or vector as described herein. When a genetic construct, expression cassette or vector as described herein is present in a cell, a regulatory element can be “endogenous”, “exogenous”, “naturally occurring” and/or “non-naturally occurring” with respect to cell. The term “noncoding region” refers to untranslated sequences that are upstream of the translational start site and downstream of the translational stop site. These sequences are also referred to respectively as the 5′ UTR and the 3′ UTR. These regions include elements required for transcription initiation and termination and for regulation of translation efficiency. Terminators are sequences, which terminate transcription, and are found in the 3′ untranslated ends of genes downstream of the translated sequence. Terminators are important determinants of mRNA stability and in some cases have been found to have spatial regulatory functions. The term “promoter” refers to nontranscribed cis-regulatory elements upstream of the coding region that regulate the transcription of a polynucleotide sequence. Promoters comprise cis-initiator elements which specify the transcription initiation site and conserved boxes. In one non-limiting example, bacterial promoters may comprise a “Pribnow box” (also known as the −10 region), and other motifs that are bound by transcription factors and promote transcription. Promoters can be homologous or heterologous with respect to polynucleotide sequence to be expressed. When the polynucleotide sequence is to be expressed in a cell, a promoter may be an endogenous or exogenous promoter. Promoters can be constitutive promoters, inducible promoters or regulatable promoters as known in the art. “Homologous” as used herein with reference to polynucleotide regulatory elements, means a polynucleotide regulatory element that is a native and naturally-occurring polynucleotide regulatory element. A homologous polynucleotide regulatory element may be operably linked to a polynucleotide of interest such that the polynucleotide of interest can be expressed from a, vector, genetic construct or expression cassette according to the invention. “Heterologous” as used herein with reference to polynucleotide regulatory elements, means a polynucleotide regulatory element that is not a native and naturally-occurring polynucleotide regulatory element. A heterologous polynucleotide regulatory element is not normally associated with the coding sequence to which it is operably linked. A heterologous regulatory element may be operably linked to a polynucleotide of interest such that the polynucleotide of interest can be expressed from a, vector, genetic construct or expression cassette according to the invention. Such promoters may include promoters normally associated with other genes, ORFs or coding regions, and/or promoters isolated from any other bacterial, viral, eukaryotic, or mammalian cell. A “functional fragment” of a polypeptide is a subsequence of the polypeptide that performs a function that is required for the biological activity or binding of that polypeptide and/or provides the three dimensional structure of the polypeptide. The term may refer to a polypeptide, an aggregate of a polypeptide such as a dimer or other multimer, a fusion polypeptide, a polypeptide fragment, a polypeptide variant, or functional polypeptide derivative thereof that is capable of performing the polypeptide activity. “Isolated” as used herein with reference to polynucleotide or polypeptide sequences describes a sequence that has been removed from its natural cellular environment. An isolated molecule may be obtained by any method or combination of methods as known and used in the art, including biochemical, recombinant, and synthetic techniques. The polynucleotide or polypeptide sequences may be prepared by at least one purification step. “Isolated” when used herein in reference to a cell or host cell describes to a cell or host cell that has been obtained or removed from an organism or from its natural environment and is subsequently maintained in a laboratory environment as known in the art. The term encompasses single cells, per se, as well as cells or host cells comprised in a cell culture and can include a single cell or single host cell. The term “recombinant” refers to a polynucleotide sequence that is removed from sequences that surround it in its natural context and/or is recombined with sequences that are not present in its natural context. A “recombinant” polypeptide sequence is produced by translation from a “recombinant” polynucleotide sequence. As used herein, the term “variant” refers to polynucleotide or polypeptide sequences different from the specifically identified sequences, wherein one or more nucleotides or amino acid residues is deleted, substituted, or added. Variants may be naturally occurring allelic variants, or non-naturally occurring variants. Variants may be from the same or from other species and may encompass homologues, paralogues and orthologues. In certain embodiments, variants of the polypeptides useful in the invention have biological activities that are the same or similar to those of a corresponding wild type molecule; i.e., the parent polypeptides or polynucleotides. In certain embodiments, variants of the polypeptides described herein have biological activities that are similar, or that are substantially similar to their corresponding wild type molecules. In certain embodiments the similarities are similar activity and/or binding specificity. In certain embodiments, variants of polypeptides described herein have biological activities that differ from their corresponding wild type molecules. In certain embodiments the differences are altered activity and/or binding specificity. The term “variant” with reference to polynucleotides and polypeptides encompasses all forms of polynucleotides and polypeptides as defined herein. The terms “modulate(s) expression”, “modulated expression” and “modulating expression” of a polynucleotide or polypeptide, are intended to encompass the situation where genomic DNA corresponding to a polynucleotide to be expressed according to the invention is modified thus leading to modulated expression of a polynucleotide or polypeptide of the invention. Modification of the genomic DNA may be through genetic transformation or other methods known in the art for inducing mutations. The “modulated expression” can be related to an increase or decrease in the amount of messenger RNA and/or polypeptide produced and may also result in an increase or decrease in the activity of a polypeptide due to alterations in the sequence of a polynucleotide and polypeptide produced. The terms “modulate(s) activity”, “modulated activity” and “modulating activity” of a polynucleotide or polypeptide, are intended to encompass the situation where genomic DNA corresponding to a polynucleotide to be expressed according to the invention is modified thus leading to modulated expression of a polynucleotide or modulated expression or activity of polypeptide of the invention. Modification of the genomic DNA may be through genetic transformation or other methods known in the art for inducing mutations. The “modulated activity” can be related to an increase or decrease in the amount of messenger RNA and/or polypeptide produced and may also result in an increase or decrease in the functional activity of a polypeptide due to alterations in the sequence of a polynucleotide and polypeptide produced. The term “source vector” means a pML1 vector as described herein. Source vectors are also termed level one vectors herein. The term “shuttle vector” means a pML2 vector as described herein. Source vectors are also termed level two vectors herein. The term “destination vector” means a pML3 vector as described herein. Source vectors are also termed level three vectors herein. The term “MIDAS cassette” as used herein means the region of a vector according to the invention that comprises at least six restriction enzyme recognition sites: 5′-1-2-3-4-5-6-3′, where sites 1 and 6 are the same as each other, sites 4 and 5 are the same as each other, and sites 1 and 6 are different from sites 4 and 5. In one embodiment sites 2 and 3 are the same as each other. In one embodiment, sites 2 and 3 are different from each other. In some embodiments the MIDAS cassette comprises a marker (M) positioned between 2 and 3 or between 4 and 5, or both. The term “B” vector as used herein means that in a vector according to the invention the entire MIDAS cassette has flanking convergent restriction sites and nested within is a polynucleotide encoded marker flanked by divergent restriction sites. The term “W” vector as used herein means that in a vector according to the invention, the configuration of restriction sites is inverted relative to the “B” vector, and there is no polynucleotide encoded marker. The restriction sites flanking the MIDAS cassette in the “B” and “W” vectors are different from the restriction sites flanking the polynucleotide encoded marker. The term “vector set” as used herein means that the vectors in the vector set are designed to be used together in a cloning system to make a multigene construct where a nucleic acid sequence of interest added into the multigene construct can be added to the 5′ or the 3′ of a nucleic acid sequence of interest already present in a polynucleotide, and in either a forward or a reverse orientation relative to the direction of transcription of the added nucleic acid sequence into the multigene construct. The term “a biosynthetic pathway” and grammatical variations thereof as used herein mean(s) a group of genes which when expressed together, provide the full complement of gene products required to carry out the biochemical transformations of a substrate molecule to the final product molecule after which the pathway is named. A naturally occurring biosynthetic pathway is one where the complement of genes is found naturally occurring within an organism. An artificial biosynthetic pathway will also contain the full complement of genes required to carry out the biochemical transformation of the pathway, but the construct from which the genes are expressed may be artificially created, or the genes themselves may be a mosaic of genes from different sources, for example, which do not occur naturally together in a single organism, all providing the full complement of gene products required to produce the biochemical transformation of the named pathway. By way of example, an indole diterpene biosynthetic pathway may be constructed as described herein using the full complement of genes from a single organism that are required to produce indole diterpene. In some embodiments the entire pathway may be reconstructed in a destination vector for expression in a permissive host as described herein using the methods of the invention as described herein. In some embodiments the permissive host is a fungal host. Alternatively a part of an indole diterpene biosynthetic pathway may be reconstructed as described herein for expression in a permissive host to produce a destination vector comprising at least one, preferably two, preferably three, preferably four, preferably five, preferably six or more genes to be expressed following the methods of the invention as described herein. It is intended that reference to a range of numbers disclosed herein (for example 1 to 10) also incorporates reference to all related numbers within that range (for example, 1, 1.1, 2, 3, 3.9, 4, 5, 6, 6.5, 7, 8, 9 and 10) and also any range of rational numbers within that range (for example 2 to 8, 1.5 to 5.5 and 3.1 to 4.7) and, therefore, all sub-ranges of all ranges expressly disclosed herein are expressly disclosed. These are only examples of what is specifically intended and all possible combinations of numerical values between the lowest value and the highest value enumerated are to be considered to be expressly stated in this application in a similar manner. Constructing and modifying metabolic pathways for expression in heterologous systems requires that a skilled worker be able to assemble genes (i.e., transcription units (TUs)) of interest from basic functional and reusable parts (including promoters, coding sequences (CDS), transcriptional terminators, tags, 3′ and 5′ untranslated regions (UTRs), but not limited thereto). The skilled worker should then be able to take the constructed genes of interest and assemble them together to produce functional multigene constructs that, when introduced into an expression host of choice, will produce desired proteins, pathways and/or products. In the context of heterologous expression, the ability to rapidly trial different combinations of basic gene parts (e.g., promoters, coding sequences (CDS), transcriptional terminators, tags, 3′ and 5′ untranslated regions (UTRs), but not limited thereto) and different combinations of genes (e.g., TUs) using a simple set of design rules is a highly desirable feature of any enabling technology for synthetic biology. Accordingly, disclosed herein is a modular DNA cloning system, termed MIDAS (for Modular Idempotent DNA Assembly System) that provides the skilled worker with a new and inventive system and method for assembling genes and for producing multigene expression constructs. MIDAS makes use of restriction ligation cloning (23) (i.e., the efficient and seamless assembly of DNA fragments using Type IIS restriction enzymes) for the ordered and hierarchical assembly of multigene expression constructs from basic standardised parts or modules. Since these basic standardized parts or modules are physically stored (in the pML1 vector), they form readily accessible libraries, from which more complex structures (transcription units and multigene plasmids) can be assembled. In the work described herein, the inventors have used MIDAS to construct a series of multigene plasmids from basic transcription unit modules (TUMs). The most complex plasmid produced in this work (pSK79) was assembled from 21 different TUMs (seven genes (also termed “transcription units” (TU) herein), each composed of three basic modules). They show that this plasmid, when transformed into a The basic principles described for MIDAS Level-1 (module cloning) and Level-2 (TU assembly) are similar to those described for certain Golden Gate-based modular assembly techniques (24-27, 29). However, it is at the stage of multigene assembly (Level-3 in MIDAS) that the techniques effectively diverge from one another. The inventor's surprising approach to multigene assembly is based on the novel and inventive design of various plasmids used at the earlier levels, conferring distinct advantages to the user over other known modular assembly techniques. The vector set described herein comprises of a suite of vectors designed to give maximum user control over the construction of transcription units (TUs) from basic modular parts, as well as full user control of TU order and orientation, and control of the direction of assembly of TUs in a multigene construct. This level of control is derived from the modular format, the relative configurations of the Type IIS restriction sites, and the hierarchical nature of assembly, and provides distinct and unexpected advantages over other types of gene assembly protocols. The modular assembly system described in this specification overcomes the unidirectional limitations of the previously described modular assembly techniques, by providing bi-directional control of the addition of genes into the multigene assembly (i.e., control of the position of each gene with respect to the other genes in the assembly), in addition to full user control of the order of addition of each gene in the multigene assembly and full user control of the relative orientation (direction of transcription) of each gene in the multigene assembly. MIDAS Design Overview The inventors have developed the vector set described herein (termed the MIDAS system to take advantage of the ability of Type IIS restriction enzymes to seamlessly join multiple DNA fragments together in a single reaction. Through the appropriate choice of these user-defined overhangs, and the appropriate orientation of the Type IIS sites flanking each of the DNA fragments, multiple fragments can be assembled into a vector in an ordered (directional) fashion using a one-pot restriction-ligation reaction. The vector typically contains a marker (usually the lacZα scorable marker for blue/white screening) flanked by two divergently oriented recognition sites for a Type IIS enzyme; these elements, collectively called the ‘cloning cassette’, are replaced by the insert during the assembly reaction. In one non-limiting example, MIDAS makes use of three Type IIS restriction enzymes, AarI, BsaI and BsmBI, which generate user-defined 4 bp overhangs upon cleavage. The assembly of genes and multigene constructs using MIDAS is a hierarchical process. At the first level (MIDAS Level-1), functional modules (such as promoters, CDS, transcriptional terminators, tags, untranslated regions (UTRs), transcriptional enhancers) are cloned into the Level-1 source vector (pML1) using BsmBI-mediated restriction-ligation reactions, where they form libraries of reusable, sequence-verified parts. The complementary design of the modules and source vector ensures that, once cloned into pML1, these modules can be released from the vector by digestion with BsaI. At the second level (Level-2), compatible sets of the sequence-verified Level-1 modules are released from pML1 and assembled into a Level-2 shuttle vector (pML2) using a BsaI-mediated restriction/ligation reaction, leading to creation of a Level-2 plasmid containing a eukaryotic transcription unit (TU). Once again, the design rules ensure that each assembled TU can be released from the pML2 vector—this time by digestion either with AarI or BsmBI (depending on the pML2 vector in which the TU was assembled). At Level-3, the TUs that were assembled at Level-2 are released from the pML2 plasmids and are sequentially assembled together in a Level-3 destination vector (pML3), using either AarI- or BsmBI-mediated restriction-ligation reactions, to form functional multigene constructs, which can then be transformed into the desired expression host. The following description of the MIDAS system in accordance with the invention is provided by way of non-limiting example. The reader will appreciate that modifications, variations and/or improvements of the system as described below may be made in accordance with the inventive concept embodied in the present disclosure. Such modifications, variations and/or improvements are contemplated herein and as is appreciated by the skilled worker, form part of the present invention. Level-1: Module Cloning In one embodiment, level-1, functional transcription unit modules (TUMs) are generated as a PCR product. In another embodiment level-1 TUMs are made by direct polynucleotide synthesis. In one embodiment, TUMs are cloned into the Level-1 source vector (pML1) by BsmBI-mediated restriction/ligation. To allow TUMs produced by PCR to be cloned into a pML1 vector, PCR primers are designed so that each amplified TUM is flanked by two convergent BsmBI restriction sites, BsmBI[CTCG] andBsmBI. Upon restriction enzyme cleavage, these convergent restriction sites generate sticky ends that are compatible with those of the BsmBI sites present in the pML1 source vector. TUMs produced by direct synthesis are designed and produced with flanking convergent BsmBI sites, BsmBI[CTCG] andBsmBI, which upon restriction enzyme cleavage, generate sticky ends that are compatible with those of the BsmBI sites present in the pML1 source vector. Thus, the cloning cassette present in pML1 consists of two divergent BsmBI sites flanking a lacZα selectable marker: 5′-[CTCG]BsmBI-lacZa-BsmBI[AGAC]-3′ ( To enable subsequent (Level-2) assembly of full-length TUs, each TUM is designed to be flanked by four module-specific nucleotides (NNNN) at the 5′ end, and four module-specific nucleotides (NNNN) at the 3′ end. In certain embodiments the four module specific nucleotides at the 5′ and 3′ ends included in a TUM that is produced by direct synthesis, whereas in certain embodiments they are included in a TUM that is produced by PCR, by design as part of the PCR primer sequences. The complementary design of the flanking regions of each TUM and the pML1 vector ensures that when each TUM is cloned into pML1 using the BsmBI-mediated restriction/ligation reaction, each TUM becomes flanked by convergent BsaI recognition sites. Thus, when the module is released from pML1 during subsequent (i.e., Level-2) BsaI-mediated assembly of the full-length TU, the module-specific nucleotides (NNNN and NNNN) become the BsaI-specific 4 bp overhangs. In one embodiment, the overall structure of each module in the PCR product (or synthetic polynucleotide) takes the form: 5′-BsmBI[CTCG]NNNN-TUM-NNNNtg[AGAC]BsmBI-3′ ( As each TUM is defined by its flanking four nucleotides, these module-specific bases effectively form an address system for each TUM and they determine its position and orientation within the assembled TU. The developers of several related polynucleotide assembly techniques, MoClo and GoldenBraid2.0, have already worked in concert to develop a common syntax or set of standard addresses for plant expression (referred to as ‘fusion sites’ in the MoClo system and ‘barcodes’ in GoldenBraid2.0) for a wide variety of TUMs to facilitate part exchangeability (30). This standard is also adopted here for MIDAS-based assembly of TUs for expression in filamentous fungi ( Thus, in one non-limiting example, for filamentous fungal expression, a ProUTR module (comprising a promoter, 5′ untranslated region (UTR) and ATG initiation codon) comprises GGAG as the module-specific 5′ nucleotides, and AATG as the module-specific 3′ nucleotides (i.e., 5′-GGAG-ProUTR-AATG-3′), with the translation initiation codon underlined. Similarly, a coding sequence (CDS) module would be flanked by AATG and GCTT (i.e., 5′-AATG-CDS-GCTT-3′), while a UTRterm module (consisting of a 3′UTR and a 3′ non-transcribed region, including the polyadenylation signal) would have the form 5′-GCTT-UTRterm-CGCT-3′. Considerations for the design of PCR primers for amplifying these three types of TUM are shown in TABLE 5. Following the BsmBI-mediated assembly of TUMs in pML1, reactions are transformed into an At MIDAS Level-1, it is important that all internal recognition sites for AarI, BsaI and BsmBI are masked or eliminated from the TUMs. The process of masking or removal of such sites—referred to as “domestication”—can be achieved by; (i) excluding these sites when ordering the sequences from a gene synthesis company, (ii) directed mutagenesis, or (iii) using masking oligonucleotides that form triplexes with the target DNA, thereby preventing restriction enzyme cleavage (26). In the same way that Type IIS enzymes have previously been utilised for mutagenesis (31) and for Golden Gate domestication purposes (23, 32), domesticated MIDAS modules were prepared by PCR using primers (referred to as domestication primers) that overlap the internal Type IIS restriction site and which contain a single nucleotide mismatch that destroys the site. Because the PCR products are designed to be assembled together in MIDAS using a BsmBI-mediated Golden Gate reaction to form the full-length domesticated TUM in pML1, it is important that the MIDAS domestication primers be designed with BsmBI restriction sites that generate compatible overhangs at their 5′ ends. Level-2: TU Assembly At Level-2, compatible sets of cloned and sequence-verified Level-1 TUMs are assembled into a pML2 shuttle vector using a BsaI-mediated restriction/ligation reaction, leading to creation of a Level-2 plasmid (pML2 entry clone) containing a complete (i.e., full-length) transcription unit (TU). In one embodiment, the cloned and sequenced Level-1 TUMs are selected from the group consisting of ProUTR, CDS and UTRterm modules and combinations thereof. The module address standard described herein ensures that the assembly of a TU proceeds in an ordered, directional fashion, with the 3′ end of one module being compatible with the 5′ end of the next module. The module-specific bases GGAG, located at the 5′ end of ProUTR modules, and CGCT, at the 3′ end of UTRterm modules, are compatible with the overhangs generated by BsaI digestion of the pML2 shuttle vectors, and these bases therefore define the outermost cloning boundaries of a Level-2 assembly. In one embodiment of MIDAS, there are eight Level-2 (pML2) shuttle vectors into which a TU can be assembled, the choice of which depends on (i) the desired order of TU assembly, (ii) the desired direction in which TUs are added to the multigene construct and (iii) the desired TU orientation in the multigene construct produced at Level-3. In one embodiment the eight pML2 vectors are distinguished from one another by the arrangement of specific nucleic acid sequence features that are central to the operation of MIDAS. These nucleic acid sequence features, collectively called the MIDAS cassette ( In one embodiment, the cloning cassettes in all eight pML2 vectors comprise a mutant In one embodiment the eight pML2 vectors comprise four “B” vectors and four “W” vectors. The designation of a vector as “B” or “W” depends on the presence or absence, respectively, of a selectable marker, preferably a lacZα selectable marker, in the MIDAS cassette (see Described herein are four “B” pML2 vectors (indicated by the “B” in the plasmid name) and four “W” pML2 vectors (indicated by the “W” in the plasmid name). The “B” and “W” vectors also differ in the relative configuration of the AarI and BsmBI restriction sites in their MIDAS cassettes. “B” vectors comprise a MIDAS cassette flanked by convergent BsmBI sites, further comprising a nested lacZα selectable marker between the BsmBI sites, the lacZα selectable marker being flanked by divergent AarI sites. “W” vectors comprise a MIDAS cassette flanked by convergent AarI sites, further comprising two nested, divergent BsmBI sites. There is no lacZα selectable marker in the “W” vectors. The lacZα selectable marker is not used for blue/white screening during the Level-2 assembly of TUs, but is reserved for use at Level-3. However, the choice of “B” or “W” vector determines the order in which a TU is added to a gene construct at Level-3 and so must be made during Level-2 assembly of TUs. Likewise, the Type IIS restriction sites, preferably the AarI and BsmBI sites, are not used for Level-2 assembly of TUs; instead these sites are employed during the Level-3 assembly of the gene constructs. These considerations are discussed further below, under the Level-3 description. The orientation (direction of transcription) of each TU can be freely defined by assembling each TU in either a pML2 “Forward” vector (indicated by “F” in the plasmid name) or a pML2 “Reverse” vector (indicated by “R” in the plasmid name). The pML2 “Reverse” vectors have their Type IIS restriction sites, preferably BsaI recognition sites switched relative to the BsaI fusion sites in the pML2 “Forward” vectors. Thus, pML2 “Forward” vectors have their pheS-based cloning cassette oriented 5′-[GGAG]BsaI-pheS-BsaI[CGCT]-3′ (so that the direction of transcription of pheS is the same as the direction of transcription of the KanRgene in the pML2 plasmid), while the pML2 “Reverse” vectors have their BsaI recognition sites switched: 5′-[AGCG]BsaI-pheS-BsaI[CTCC]-3′, (so that the direction of transcription of pheS is opposite to the direction of transcription of the KanRgene in the pML2 plasmid), where the arrowhead indicates the direction of transcription of the mutant pheS selectable marker. In contrast to the cloned Level-1 modules, the pML2 shuttle vectors confer antibiotic kanamycin resistance, allowing efficient counter selection against Level-1 module backbones, while the mutant pheS selectable marker provides powerful negative selection against any parental pML2 shuttle plasmids when For simplicity, the description of MIDAS provided herein has focussed on the assembly of transcription units (TUs) from basic, functional transcription unit modules (TUMs) such as promoters, CDSs and terminators. However, in some circumstances, for example where one is not interested in testing the effect of different promoter and/or terminator combinations on gene expression, one may not wish to assemble a TU from individual TUMs. For example, some researchers may wish to use a resistance marker cassette (RC) that is already well-characterised for use in their expression host—i.e., has well-characterised promoter, CDS and terminator. In these cases, the full-length TU could be amplified as a complete unit using primers containing the external-most module-specific bases of the MIDAS system, ready for cloning into pML1 (i.e., the PCR product would have the form: 5′-BsmBI[CTCG]GGAG-ProUTR-CDS-UTRterm-CGCTtg[AGAC]BsmBI-3′) (CGCTtgAGAC=SEQ ID NO: 1). Alternatively, the full-length TU could be made by direct synthesis as a complete unit ready for cloning into pML1 (i.e., the direct synthesis product would have the form: 5′-BsmBI[CTCG]GGAG-ProUTR-CDS-UTRterm-CGCTtg[AGAC]BsmBI-3′) [SEQ ID NO: 1]. In the same fashion, MIDAS can be applied to the cloning and assembly of genetic elements (GEs) which do not form the basis of TUs. In some embodiments, GEs may include origins of replication (e.g. the yeast 2p replication origin) for propagation of plasmids, T-DNA left and right borders for In both the cases described above, once a RC or GE is cloned into a pML1 vector, the RC or GE may be moved into a Level-2 vector by BsaI-mediated restriction-ligation assembly as described herein. Level-3: Assembly of Multigene Constructs At MIDAS Level-3, TUs and GEs comprised in pML2 plasmids as described herein are sequentially inserted by binary assembly into a Level-3 destination vector (pML3) to form a multigene construct. Assembly of multigene constructs at Level-3 employs an inventive, relative configuration of the AarI and BsmBI restriction sites in the MIDAS cassettes located in the “B” and “W” pML2 vectors. Without wishing to be bound by theory the inventors believe that the nested and inverted configuration of these restriction sites in the “W” vectors as compared to the “B” vectors defines at least some of the novel and inventive features of the MIDAS multigene assembly process. In one non-limiting embodiment of the “B” vectors, the entire MIDAS cassette has flanking convergent BsmBI sites and nested within is a lacZα gene flanked by divergent AarI sites. In one non-limiting embodiment of the “W” vectors, the enzyme configuration is inverted (the entire MIDAS cassette has flanking convergent AarI sites and nested within are two divergent BsmBI sites) and there is no lacZα gene. As illustrated in The cloning cassette found in the Level-3 destination vector, pML3, consists of a lacZα gene flanked by divergent AarI sites:AarI-lacZa-AarI[CGTA], so the MIDAS Level-3 assembly is initiated (i.e., the first TU or GE is added) using an AarI-mediated restriction-ligation reaction between pML3 and a TU (or GE) that has been assembled into a pML2 “W” shuttle vector ( In its simplest configuration, MIDAS can achieve multigene assembly using only two pML2 shuttle vectors: one “W” vector and one “B” vector ( Firstly, and as described earlier, the order of addition of each TU to the growing multigene construct is governed by the choice of “W” or “B” pML2 shuttle vector into which the TUs are assembled. Secondly, and as described previously when discussing the Level-2 features, the orientation (direction of transcription) of a TU can be freely defined by the choice of “Forward” or “Reverse” pML2 vector into which the TU is assembled. Extending MIDAS to include the option of assembling TUs in either orientation expands the vector suite to four pML2 plasmids (see Thirdly, the polarity of multigene assembly (i.e., the direction in which new TUs are added to the growing multigene assembly) can also be freely defined—in this case by assembling TUs in pML2 shuttle vectors of either “plus” (+) or “minus” (−) polarity ( If, however, entry clones of both polarity (i.e., both pML2(+) and pML2(−)) are used to build the multigene construct, MIDAS has the ability to control the direction in which new TUs (or GEs) are added to the Level-3 assembly ( Described herein is MIDAS cloning performed using Accordingly in a first aspect the present invention relates to a vector set comprising at least two shuttle vectors, V1 and V2,
In one embodiment, when V1 is V1.1(+) or V1.3(+), V2 is V2.2(−) or V2.4(−). In one embodiment, when V1 is V1.2(−) or V1.4(−), V2 is V2.1(+) or V2.3(+). In one embodiment the vector set consists essentially of the at least two shuttle vectors. In one embodiment A1, A2, B1, B2, C1 and C2 comprise at least four, preferably six, Type IIS restriction sites. In one embodiment the Type IIS restriction sites are selected from the group consisting of BsaI, AarI, BsmBI, AcuI, AlwI, BaeI, BbsI, BbvI, BccI, BceAI, BcgI, BciVI, BcoDI, BfuAI, BmrI, BpmI, BpuEI, BsaXI, BseRI, BsgI, BsmAI, BsmFI, BsmI, BspCNI, BspMI, BspQI, BsrDI, BsrI, BtgZI, BtsCI, BtsI, BtsIMutI, CspCI, EarI, EciI, FauI, FokI, HgaI, HphI, HpyAV, MboII, MlyI, MmeI, MnlI, NmeAIII, PleI, SapI, SfaNI sites. In one embodiment A1 and A2 are AarI restriction sites. In one embodiment B1 and B2 are BsaI restriction sites. In one embodiment C1 and C2 are BsmBI restriction sites. In one embodiment the vector set further comprises a source vector. In one embodiment the vector set further comprises a destination vector. In one embodiment the destination vector comprises a pair of restriction sites that are the same as A1 and A2 or as C1 and C2. In one embodiment the destination vector comprises a marker (DM) flanked by the pair of restriction sites. Preferably DM is the same as M2 in the V2 shuttle vectors. In one embodiment the destination vector does not comprise a DM. In one embodiment the vector set comprises at least four, preferably at least five, preferably at least six, preferably at least seven, preferably eight different shuttle vectors. In one embodiment the vector set consists essentially of at least four, preferably at least five, preferably at least six, preferably at least seven, preferably eight different shuttle vectors. In one embodiment the vector set comprises at least four shuttle vectors as follows:
In one embodiment the vector set comprises at least five shuttle vectors as follows:
wherein each of (d), (e), (f) and (g) comprises at least one (−) vector and at least one (+) vector. In one embodiment the vector set comprises at least six shuttle vectors as follows:
In one embodiment the vector set comprises at least seven shuttle vectors as follows:
In one embodiment the vector set comprises V1.1(+), V1.2(−), V1.3(+), V1.4(−), V2.1(+), V2.2(−), V2.3(+) and V2.4(−). In one embodiment the vector set consists essentially of V1.1(+), V1.2(−), V1.3(+), V1.4(−), V2.1(+), V2.2(−), V2.3(+) and V2.4(−). In one embodiment the shuttle vector is a vector selected from the group consisting of plasmids, bacteriophage, phagemids, cosmids, fosmids, bacterial artificial chromosomes, yeast artificial chromosomes, and phage artificial chromosomes. In one embodiment the shuttle vector is a plasmid. In one embodiment M1 is a scorable marker or a selectable marker. Preferably M1 is a selectable marker. In one embodiment the selectable marker is a polynucleotide encoding for antibiotic resistance. In one embodiment the antibiotic resistance is resistance to an antibiotic selected from the group consisting of kanamycin, chloramphenicol, tetracycline, streptomycin, spectinomycin, ampicillin, carbenicillin, nalidixic acid, amphotericin B, erythromycin, gentamycin, neomycin, nystatin. In one embodiment the selectable marker is a gene that encodes a peptide that confers lethality on a cell or organism containing the marker, for example when the gene encoding the peptide is transformed into an appropriate cell, or when the cell or organism is grown under the appropriate conditions. In one embodiment the marker is selected from a group consisting of ccdB, pheS, rpsL, sacB. In one embodiment the marker is a mutant In one embodiment M2 encodes a selectable marker or a scorable marker. In one embodiment the scorable marker is either a fluorescent marker selected from a group consisting of GFP, eGFP, YFP, DsRed, DsRed2, mCherry, or is a bioluminescent marker such as luciferase, or is a chromogenic marker selected from a list consisting of the gene encoding LacZ, β-glucuronidase or β-glucosidase, or the set of genes encoding CrtE, CrtB, CrtI, CrtY and CrtW (collectively called CRed) or encoding napthalene dioxygenase. Preferably the marker is a chromogenic marker, preferably a LacZ marker. In one embodiment V1.1(+) is pML2(+)WF comprising SEQ ID NO: 122. In one embodiment pML2(+)WF consists essentially of SEQ ID NO: 122. In one embodiment V1.2(−) is pML2(−)WR comprising SEQ ID NO: 123. In one embodiment pML2(−)WR consists essentially of SEQ ID NO: 123. In one embodiment V1.3(+) is pML2(+)WR comprising SEQ ID NO: 124. In one embodiment pML2(+)WR consists essentially of SEQ ID NO: 124. In one embodiment V1.4(−) is pML2(−)WF comprising SEQ ID NO: 125. In one embodiment pML2(−)WF consists essentially of SEQ ID NO: 125. In one embodiment V2.1(+) is pML2(+)BF comprising SEQ ID NO: 126. In one embodiment pML2(+)BF consists essentially of SEQ ID NO: 126. In one embodiment V2.2(−) is pML2(−)BR comprising SEQ ID NO: 127. In one embodiment pML2(−)BR consists essentially of SEQ ID NO: 127. In one embodiment V2.3(+) is pML2(+)BR comprising SEQ ID NO: 128. In one embodiment pML2(+)BR consists essentially of SEQ ID NO: 128. In one embodiment V2.4(−) is pML2(−)BF comprising SEQ ID NO: 129. In one embodiment pML2(−)BF consists essentially of SEQ ID NO: 129. In one embodiment A1 and A2 are in a convergent orientation relative to each other in V1.1(+), V1.2(−), V1.3(+) and V1.4(−). In one embodiment A1 and A2 are in a divergent orientation relative to each other in V2.1(+), V2.2(−), V2.3(+) and V2.4(−). In one embodiment C1 and C2 are in a divergent orientation relative to each other in V1.1(+), V1.2(−), V1.3(+) and V1.4(−). In one embodiment C1 and C2 are in a convergent orientation relative to each other in V2.1(+), V2.2(−), V2.3(+) and V2.4(−). In one embodiment the vectors in the vector set are components in a cloning system. In one embodiment the cloning system is useful for making a gene construct comprising at least one transcription unit (TU). In one embodiment the vector set comprises part of a cloning system. In one embodiment the cloning system is useful for making a gene construct comprising at least one TU. In one embodiment V1.1(+), V1.2(−), V1.3(+), V1.4(−), V2.1(+), V2.2(−), V2.3(+) or V2.4(−),
In one embodiment the cloning system is useful for making a gene construct comprising at least one TU. In one embodiment the gene construct is a multigene construct comprising at least two TUs. In one embodiment the multigene construct comprises at least three, preferably at least four, preferably at least five, preferably at least six, preferably at least seven, preferably at least eight, preferably at least nine, preferably at least ten TUs. In one embodiment the multigene construct comprises, consists essentially or consists of at least one, preferably two, preferably three, preferably four, preferably five, preferably six, preferably seven, preferably eight, preferably nine, preferably at least ten TU's from a biosynthetic pathway. In one embodiment the multigene construct comprises, consists essentially or consists of a complete biosynthetic pathway. In one embodiment the biosynthetic pathway is a microbial, preferably fungal biosynthetic pathway. In one embodiment the biosynthetic pathway is an indole diterpene biosynthetic pathway. In one embodiment the indole diterpene biosynthetic pathway comprises, consists essentially of, or consists of at least one, preferably two, preferably three, preferably four genes required for the production of paspaline. In one embodiment the genes required for the production of paspaline comprise at least one of paxG, paxM, paxB and paxC, preferably at least two, preferably at least three, preferably all four of paxG, paxM, paxB and paxC. Preferably the genes required for the production of paspaline are from In one embodiment the indole diterpene biosynthetic pathway comprises, consists essentially of, or consists of at least one, preferably two, preferably three, preferably four, preferably five, preferably six genes required for the production of paxilline. In one embodiment the genes required for the production of paxilline comprise at least one of paxG, paxM, paxB, paxC, paxQ and paxP, preferably at least two, preferably at least three, preferably at least four, preferably at least five, preferably all six of paxG, paxM, paxB, paxC, paxQ and paxP. Preferably the genes required for the production of paxiline are from In one embodiment the biosynthetic is a naturally occurring biosynthetic pathway. In one embodiment the biosynthetic pathway is an artificial biosynthetic pathway. In one embodiment the gene construct and/or multi gene construct is made by cloning a TU from a shuttle vector into the destination vector. In one embodiment the TU is added into the destination vector by cloning into a pair of restriction sites that is the same as a pair of restriction sites on a shuttle vector. In one embodiment the TU is added into the destination vector in either of two directions relative to another transcription unit present in the destination vector. In one embodiment the TU is added into the destination vector in a position 5′ of another transcription unit already present in the destination vector. In one embodiment the TU is added in to the destination vector in a position 3′ of another transcription unit already present in the destination vector. In one embodiment the TU is added in a 5′ to 3′ or 3′ to 5′ orientation in the destination vector. In one embodiment the vector set comprises at least one destination vector, the destination vector comprising a marker comprising flanking restriction sites, wherein the flanking restriction sites are the same as one of the first (A1, A2) or third (C1, C2) pair of restriction sites on the at least two shuttle vectors. In one embodiment the flanking restriction sites are the same as A1 and A2. Preferably A1 and A2 are a pair of Type IIS restriction sites. Preferably A1 and A2 are AarI or BsmBI restriction sites. Preferably B1 and B2 are Type IIS restriction sites. Preferably C1 and C2 are Type IIS restriction sites. Preferably A1, A2, B1 and B2, preferably A1, A2, C1 and C2, preferably B1, B2, C1 and C2, preferably A1, A2, B1, B2, C1 and C2 are Type IIS restriction sites. Preferably the Type IIS restriction sites are selected from the group consisting of BsaI, AarI, BsmBI, AcuI, AlwI, BaeI, BbsI, BbvI, BccI, BceAI, BcgI, BciVI, BcoDI, BfuAI, BmrI, BpmI, BpuEI, BsaXI, BseRI, BsgI, BsmAI, BsmFI, BsmI, BspCNI, BspMI, BspQI, BsrDI, BsrI, BtgZI, BtsCI, BtsI, BtsIMutI, CspCI, EarI, EciI, FauI, FokI, HgaI, HphI, HpyAV, MboII, MlyI, MmeI, MnlI, NmeAIII, PleI, SapI, SfaNI sites. In one embodiment the vector set comprises at least one source vector comprising a polynucleotide sequence encoding at least one marker flanked by two divergent restriction sites. Preferably the divergent restriction sites are Type IIS restriction sites. Preferably the Type IIS restriction sites are selected from the group consisting of BsaI, AarI, BsmBI, AcuI, AlwI, BaeI, BbsI, BbvI, BccI, BceAI, BcgI, BciVI, BcoDI, BfuAI, BmrI, BpmI, BpuEI, BsaXI, BseRI, BsgI, BsmAI, BsmFI, BsmI, BspCNI, BspMI, BspQI, BsrDI, BsrI, BtgZI, BtsCI, BtsI, BtsIMutI, CspCI, EarI, EciI, FauI, FokI, HgaI, HphI, HpyAV, MboII, MlyI, MmeI, MnlI, NmeAIII, PleI, SapI, SfaNI sites. Preferably the Type IIS restriction sites are BsmBI sites. In one embodiment the marker in the at least one destination vector or the at least one source vector, or both is a selectable marker or scorable marker. In one embodiment the marker is selectable marker. In one embodiment the selectable marker is a polynucleotide encoding for antibiotic resistance. In one embodiment the antibiotic resistance is resistance to an antibiotic selected from the group consisting of kanamycin, chloramphenicol, tetracycline, streptomycin, spectinomycin, ampicillin, carbenicillin, nalidixic acid, amphotericin B, erythromycin, gentamycin, neomycin andnystatin. In one embodiment the selectable marker is a gene that encodes a peptide that confers lethality on a cell or organism containing the marker, for example when the gene encoding the peptide is transformed into an appropriate cell, or when the cell or organism is grown under the appropriate conditions. In one embodiment the marker is selected from a group consisting of ccdB, pheS, rpsL, sacB. In one embodiment the marker is a mutant In one embodiment the marker is a scorable marker. In one embodiment the scorable marker is either a fluorescent marker selected from a group consisting of GFP, eGFP, YFP, DsRed, DsRed2, mCherry, or is a bioluminescent marker such as luciferase, or is a chromogenic marker selected from a list consisting of the gene encoding LacZ, β-glucuronidase or β-glucosidase, or the set of genes encoding CrtE, CrtB, CrtI, CrtY and CrtW (collectively called CRed) or encoding napthalene dioxygenase. Preferably the marker is a chromogenic marker, preferably a LacZ marker. In another aspect the present invention relates to a vector set comprising at least three shuttle vectors,
In one embodiment, when the V1 vectors are
In one embodiment, when the at least two V1 vectors are V1.1(+) and V1.3(+), then V2 is V2.2(−) or V2.4(−). In one embodiment, when the at least two V1 vectors are V1.2(−) and V1.4(−), then V2 is V2.1(+) or V2.3(+). In one embodiment the vector set consists essentially of the at least three vectors. Specifically contemplated for this aspect of the invention are the various embodiments of the invention relating to restriction sites A1, A2, B1, B2, C1 and C2, source vectors, shuttle vectors, destination vectors and markers including M1 and M2, as described herein for the first aspect of the invention. In various embodiments specifically contemplated for this aspect of the invention the vector set comprises or consists essentially of the at least four shuttle vectors, at least five shuttle vectors, at least six shuttle vectors, or at least seven shuttle vectors set out in the various combinations (a), (b), (c), (d), (e), (f), (g), (h), (i), (j), (k) and (l) as described herein for the first aspect of the invention. In one embodiment the vector set comprises V1.1(+), V1.2(−), V1.3(+), V1.4(−), V2.1(+), V2.2(−), V2.3(+) and V2.4(−). In one embodiment the vector set consists essentially of V1.1(+), V1.2(−), V1.3(+), V1.4(−), V2.1(+), V2.2(−), V2.3(+) and V2.4(−). In various embodiments specifically contemplated for this aspect of the invention, V1.1(+), V1.2(−), V1.3(+), V1.4(−), V2.1(+), V2.2(−), V2.3(+) and V2.4(−) are pML2(+)WF, pML2(−)WR, pML2(+)WR, pML2(−)WF, pML2(+)BF, pML2(−)BR, pML2(+)BR, and pML2(−)BF respectively comprising or consisting essentially of SEQ ID NO: 122, 123, 124, 125, 126, 127, 128 and 129 as defined for the first aspect of the invention as described herein. In various embodiments specifically contemplated for this aspect of the invention, A1, A2, C1 and C2 are in divergent or convergent orientations relative to each other as described herein for V1.1(+), V1.2(−), V1.3(+), V1.4(−), V2.1(+), V2.2(−), V2.3(+) and V2.4(−) in accordance with the first aspect of the invention. In various embodiments specifically contemplated for this aspect of the invention, the vectors in the vector set are components in a cloning system, or comprise part of a cloning system useful for making a gene and/or multigene construct as described for the first aspect of the invention. In various embodiments specifically contemplated for this aspect of the invention, a gene construct and/or multigene construct is/are as described herein for the first aspect of the invention. Additionally, in various embodiments specifically contemplated for this aspect of the invention, a gene construct and/or multi gene construct is/are made, and a TU is, or multiple TUs are, added into the destination vector as described herein for the first aspect of the invention. In another aspect the present invention relates to a vector set comprising at least three shuttle vectors,
In one embodiment, when the V2 vectors are
In one embodiment, when the at least two V2 vectors are V2.1(+) or V2.3(+), then V1 is V1.2(−) or V1.4(−). In one embodiment, when the at least two V2 vectors are V2.2(−) or V2.4(−), then V1 is V1.1(+) or V1.3(+). In one embodiment the vector set consists essentially of the at least three vectors. Specifically contemplated for this aspect of the invention are the various embodiments of the invention relating to restriction sites A1, A2, B1, B2, C1 and C2, source vectors, shuttle vectors, destination vectors and markers including M1 and M2, as described herein for the first aspect of the invention. In various embodiments specifically contemplated for this aspect of the invention the vector set comprises or consists essentially of the at least four shuttle vectors, at least five shuttle vectors, at least six shuttle vectors, or at least seven shuttle vectors set out in the various combinations (a), (b), (c), (d), (e), (f), (g), (h), (i), (j), (k) and (l) as described herein for the first aspect of the invention. In one embodiment the vector set comprises V1.1(+), V1.2(−), V1.3(+), V1.4(−), V2.1(+), V2.2(−), V2.3(+) and V2.4(−). In one embodiment the vector set consists essentially of V1.1(+), V1.2(−), V1.3(+), V1.4(−), V2.1(+), V2.2(−), V2.3(+) and V2.4(−). In various embodiments specifically contemplated for this aspect of the invention, V1.1(+), V1.2(−), V1.3(+), V1.4(−), V2.1(+), V2.2(−), V2.3(+) and V2.4(−) are pML2(+)WF, pML2(−)WR, pML2(+)WR, pML2(−)WF, pML2(+)BF, pML2(−)BR, pML2(+)BR, and pML2(−)BF respectively comprising or consisting essentially of SEQ ID NO: 122, 123, 124, 125, 126, 127, 128 and 129 as defined for the first aspect of the invention as described herein. In various embodiments specifically contemplated for this aspect of the invention, A1, A2, C1 and C2 are in divergent or convergent orientations relative to each other as described herein for V1.1(+), V1.2(−), V1.3(+), V1.4(−), V2.1(+), V2.2(−), V2.3(+) and V2.4(−) in accordance with the first aspect of the invention. In various embodiments specifically contemplated for this aspect of the invention, the vectors in the vector set are components in a cloning system, or comprise part of a cloning system useful for making a gene and/or multigene construct as described for the first aspect of the invention. In various embodiments specifically contemplated for this aspect of the invention, a gene construct and/or multigene construct is/are as described herein for the first aspect of the invention. Additionally, in various embodiments specifically contemplated for this aspect of the invention, a gene construct and/or multi gene construct is/are made, and a TU is, or multiple TUs are, added into the destination vector as described herein for the first aspect of the invention. In another aspect the present invention relates to a vector set comprising at least two shuttle vectors, wherein
In one embodiment the set comprises at least three shuttle vectors
In one embodiment the set comprises at least four shuttle vectors
In one embodiment the set comprises at least five shuttle vectors
In one embodiment the set comprises at least six shuttle vectors
In one embodiment the set comprises at least seven shuttle vectors,
In one embodiment the set comprises eight shuttle vectors comprising four first shuttle vectors and four second shuttle vectors,
In one embodiment the vector set consists essentially of the eight shuttle vectors. Specifically contemplated for this aspect of the invention are various embodiments of the invention relating to restriction sites, source vectors, shuttle vectors, destination vectors and markers including M1 and M2, as described herein for the first aspect of the invention. In various embodiments specifically contemplated for this aspect of the invention, the first and second vectors in the vector set are components in a cloning system, or comprise part of a cloning system useful for making a gene and/or multigene construct as described for the first aspect of the invention. In various embodiments specifically contemplated for this aspect of the invention, a gene construct and/or multigene construct is/are as described herein for the first aspect of the invention. Additionally, in various embodiments specifically contemplated for this aspect of the invention, a gene construct and/or multi gene construct is/are made, and a TU is, or multiple TUs are, added into the destination vector as described herein for the first aspect of the invention. In another aspect the present invention relates to a set of eight shuttle vectors, each shuttle vector comprising a first marker (M1) and six restriction sites,
In one embodiment M1 or M2 or both are a selectable or scorable marker as described herein for any other aspect of the invention. In one embodiment M2 is located within the first set of restriction sites, preferably between a pair of restriction sites, preferably flanked by the pair of restriction sites. In one embodiment the pair of restriction sites are a pair of Type IIS restriction sites. Preferably the pair of Type IIS restriction sites are selected from the group consisting of BsaI, AarI, BsmBI, AcuI, AlwI, BaeI, BbsI, BbvI, BccI, BceAI, BcgI, BciVI, BcoDI, BfuAI, BmrI, BpmI, BpuEI, BsaXI, BseRI, BsgI, BsmAI, BsmFI, BsmI, BspCNI, BspMI, BspQI, BsrDI, BsrI, BtgZI, BtsCI, BtsI, BtsIMutI, CspCI, EarI, EciI, FauI, FokI, HgaI, HphI, HpyAV, MboII, MlyI, MmeI, MnlI, NmeAIII, PleI, SapI, SfaNI sites. In one embodiment the six restriction sites comprise at least four, preferably six, Type IIS restriction sites. In one embodiment the Type IIS restriction sites are selected from the group consisting of BsaI, AarI, BsmBI, AcuI, AlwI, BaeI, BbsI, BbvI, BccI, BceAI, BcgI, BciVI, BcoDI, BfuAI, BmrI, BpmI, BpuEI, BsaXI, BseRI, BsgI, BsmAI, BsmFI, BsmI, BspCNI, BspMI, BspQI, BsrDI, BsrI, BtgZI, BtsCI, BtsI, BtsIMutI, CspCI, EarI, EciI, FauI, FokI, HgaI, HphI, HpyAV, MboII, MlyI, MmeI, MnlI, NmeAIII, PleI, SapI, SfaNI sites. In various embodiments specifically contemplated for this aspect of the invention, the six restriction sites comprise A1, A2, B1, B2, C1 and C2 wherein A1, A2, B1, B2, C1 and C2 are restriction sites as described herein for any other aspect of the invention. In one embodiment the arrangement of A1, A2, B1, B2, C1 and C2 in at least one, preferably at least two, preferably at least three, preferably at least four, preferably at least five, preferably at least six, preferably at least seven, preferably all eight of the shuttle vectors, including relative to each other, is as described herein for any other aspect of the invention. In one embodiment the arrangement of A1, A2, B1, B2, C1, C2 and the first marker (M1) in at least one, preferably at least two, preferably at least three, preferably at least four, preferably at least five, preferably at least six, preferably at least seven, preferably all eight of the shuttle vectors, including relative to each other, are as described herein for any other aspect of the invention. In one embodiment the two restriction sites in the first set of restriction sites that are the same as each other are in divergent orientation relative to each other. In one embodiment the one restriction sites in the first and second sets that are the same as each other are in a convergent orientation relative to each other. In one embodiment the six restriction sites comprise three pairs of restriction sites, wherein in two pairs of the restriction sites, the restriction sites are in a divergent orientation relative to the other and in one pair of the restriction sites the restriction sites are in a convergent orientation relative to each other. In one embodiment the pair of restriction sites in a convergent orientation flank the two pairs of restriction sites having the divergent orientation. In one embodiment the vector set comprises at least one destination vector, the destination vector comprising either a marker with flanking divergent restriction sites or divergent restriction sites and no marker, wherein the divergent restriction sites are, respectively, the same restriction sites as the one pair of restriction sites that are in a convergent orientation relative to each other in the four V1 shuttle vectors, or the same restriction sites as the one pair of restriction sites that are in a convergent orientation relative to each other in the four V2 shuttle vectors. In one embodiment the vector set comprises at least one destination vector as described herein for any other aspect of the invention. In one embodiment the vector set comprises at least one source vector as described herein for any other aspect of the invention. In various embodiments specifically contemplated for this aspect of the invention the vector set comprises or consists essentially of four V1 vectors and four V2 vectors as described herein for any other aspect of the invention. Preferably the four V1 and four V2 vectors consist of V1.1(+), V1.2(−), V1.3(+), V1.4(−), V2.1(+), V2.2(−), V2.3(+) and V2.4(−). In various embodiments specifically contemplated for this aspect of the invention, the vectors in the vector set are components in a cloning system, or comprise part of a cloning system useful for making a gene and/or multigene construct as described for any other aspect of the invention. In various embodiments specifically contemplated for this aspect of the invention, a gene construct and/or multigene construct is/are as described herein for any other aspect of the invention. Additionally, in various embodiments specifically contemplated for this aspect of the invention, a gene construct and/or multi gene construct is/are made, and a TU is, or multiple TUs are, added into the destination vector as described herein for any other aspect of the invention. In one embodiment the vector set consists essentially of the eight shuttle vectors and the at least one destination vector. In one embodiment the vector set consists essentially of the eight shuttle vectors, the at least one destination vector, and at least one source vector. A skilled worker will appreciate that all embodiments set out herein regarding source, shuttle and destination vectors as described herein for any other aspect of the invention are also embodiments of the invention specifically contemplated for this aspect of the invention. In another aspect the invention relates to a method of making a vector set comprising at least two shuttle vectors comprising combining at least one V1 shuttle vector or first shuttle vector of the invention with at least one V2 shuttle vector or second shuttle vector of the invention. In one embodiment the at least one first or V1 vector is a (−) vector and the at least one second vector or V2 vector is a (+) vector. In one embodiment the at least one first or V1 vector is a (+) vector and the at least one second vector or V2 vector is a (−) vector. In one embodiment the method comprises combining at least two, preferably at least three, preferably four V1 shuttle vectors or first shuttle vectors as described herein with at least two, preferably at least three, preferably four V2 shuttle vectors or second shuttle vectors as described herein. Specifically contemplated as embodiments of this aspect of the invention are V1 shuttle vectors, V2 shuttle vectors, first shuttle vectors and second shuttle vectors, including the types of markers and the types and arrangements of restriction sites, are as described herein for any other aspect of the invention. In one embodiment the method comprises combining at least one destination vector as described herein with the shuttle vectors. In one embodiment the method comprises combining at least one source vector as described herein with the shuttle vectors. In one embodiment the method comprises combining at least one source vector and one destination vector with the shuttle vectors. In various embodiments specifically contemplated for this aspect of the invention the method comprises or consists essentially of combining four V1 vectors and four V2 vectors as described herein for any other aspect of the invention. Preferably the four V1 and four V2 vectors consist of V1.1(+), V1.2(−), V1.3(+), V1.4(−), V2.1(+), V2.2(−), V2.3(+) and V2.4(−). In various embodiments specifically contemplated for this aspect of the invention, the vectors in the vector set are components in a cloning system, or comprise part of a cloning system useful for making a gene and/or multigene construct as described for any other aspect of the invention. In various embodiments specifically contemplated for this aspect of the invention, a gene construct and/or multigene construct is/are as described herein for any other aspect of the invention. Additionally, in various embodiments specifically contemplated for this aspect of the invention, a gene construct and/or multi gene construct is/are made, and a TU is, or multiple TUs are, added into the destination vector as described herein for any other aspect of the invention. In one embodiment the method consists essentially of combining four V1 shuttle vectors or first shuttle vectors as described herein, four V2 shuttle vectors or second shuttle vectors as described herein, and at least one destination vector as described herein. In one embodiment the method consists essentially of combining four V1 shuttle vectors or first shuttle vectors as described herein, four V2 shuttle vectors or second shuttle vectors as described herein, at least one destination vector as described herein, and at least one source vector as described herein. In one embodiment the vector set is comprised in a kit. In another aspect the invention relates to a method of making a multigene construct comprising at least two transcription units (TU), the method comprising:
In one embodiment V3.1 consists essentially of 5′-TU1-C1-C2-3′. In one embodiment V3.2 consists essentially of 5′-C1-C2-TU1-3′, In one embodiment V4.1 consists essentially of 5′-TU1-TU2-A1-M2-A2-3′. In one embodiment V4.2 consists essentially of 5′-TU1-A1-M2-A2-TU2-3′. In one embodiment V4.3 consists essentially of 5′-TU2-A1-M2-A2-TU1-3′. In one embodiment V4.4 consists essentially of 5′-A1-M2-A2-TU2-TU1-3′. In one embodiment, A1 and A2 are removed from the first cloning cassette and the destination vector (V3) when the cloning cassette is cloned into V3 to make V3.1 or V3.2. In one embodiment, C1 and C2 are removed from the second cloning cassette and the destination vector (V3.1 or V3.2) when the second cloning cassette is cloned into V3.1 or V3.2 to make V4.1 or V4.2, or V4.3 or V4.4, respectively. In one embodiment, the method comprises:
wherein A1=A2 and C1=C2. In one embodiment, A1 and A2 are removed from the third cloning cassette and the destination vector when the cloning cassette is cloned into V4.1, V4.2, V4.3 or V4.4. In one embodiment, the method comprises cloning a fourth cloning cassette comprising a fourth transcription unit (TU4) and four restriction sites A1, A2, C1 and C2 arranged in the following order:
In one embodiment, C1 and C2 are removed from the fourth cloning cassette and the destination vector when the cloning cassette is cloned into V5.1, V5.2, V5.3, V5.4, V5.5, V5.6, V5.7 or V5.8. In further embodiments the method comprises adding additional cassettes to various destination vectors as described above for V1.1-V6.15 by cloning an nthcloning cassette comprising an nthTU (TUn) and four restriction sites A1, A2, C1 and C2 arranged either: (i) in a V1 vector as either:
into a destination vector that harbours an even number of TUs and a pair of restriction sites A1 and A2 flanking a second marker (M2), to make a destination vector harbouring an odd number of TUs. In one embodiment, A1 and A2 in (i) are removed from the nthcloning cassette and from the destination vector when the nthcloning cassette is cloned into the destination vector using A1 and A2 to make a new destination vector containing the nthTU. or (ii) in a V2 vector as either:
into a destination vector that harbours an odd number of TUs and a pair of restriction sites C1 and C2, to make a destination vector harbouring an even number of TUs. In one embodiment, C1 and C2 in (ii) are removed from the nthcloning cassette and from the destination vector when the nthcloning cassette is cloned into the destination vector using C1 and C2 to make a new destination vector containing the nthTU. In one embodiment A1, A2, C1 and C2 are Type IIS restriction sites. In one embodiment the Type IIS restriction sites are selected from the group consisting of BsaI, AarI and BsmBI sites. In one embodiment A1 and A2 are AarI restriction sites. In one embodiment C1 and C2 are BsmBI restriction sites. In one embodiment the destination vector is a vector selected from the group consisting of plasmids, bacteriophage, phagemids, cosmids, fosmids, bacterial artificial chromosomes, yeast artificial chromosomes, and phage artificial chromosomes or a combination thereof. In one embodiment the destination vector is a plasmid. In one embodiment M2 encodes a selectable marker or a scorable marker. In one embodiment M2 is a scorable marker. In one embodiment the scorable is a chromogenic marker, preferably a lacZ marker. In one embodiment M2 is a selectable marker. In one embodiment the selectable marker is a polynucleotide encoding for antibiotic resistance. In one embodiment the antibiotic resistance is resistance to an antibiotic selected from the group consisting of kanamycin, chloramphenicol, tetracycline, streptomycin, spectinomycin, ampicillin, carbenicillin, nalidixic acid, amphotericin B, erythromycin, gentamycin, neomycin, and nystatin. In one embodiment M1 is a selectable marker. In one embodiment the selectable marker is a gene that encodes a peptide that confers lethality on a cell or organism containing the marker, for example when the gene encoding the peptide is transformed into an appropriate cell, or when the cell or organism is grown under the appropriate conditions. In one embodiment the marker is selected from a group consisting of ccdB, pheS, rpsL, sacB. In one embodiment the marker is a mutant In one embodiment the multigene construct comprises, consists essentially or consists of at least one, preferably two, preferably three, preferably four, preferably five, preferably six, preferably seven, preferably eight, preferably nine, preferably at least ten TU's from a biosynthetic pathway. In one embodiment the multigene construct comprises, consists essentially or consists of a complete biosynthetic pathway. In one embodiment the biosynthetic pathway is a microbial, preferably fungal biosynthetic pathway. In one embodiment the biosynthetic pathway is an indole diterpene biosynthetic pathway. In one embodiment the indole diterpene biosynthetic pathway is a penitremane pathway, preferably a penitrem A pathway. In one embodiment the pathway is from a fungus, preferably In one embodiment the indole diterpene biosynthetic pathway is a janthitremane pathway, preferably a janthitrem B pathway. In one embodiment the pathway is from a fungus, preferably In one embodiment the indole diterpene biosynthetic pathway is a lolitremane pathway, preferably the lolitrem B biosynthetic pathway, preferably from a fungus, preferably In one embodiment the indole diterpene biosynthetic pathway comprises, consists essentially of, or consists of at least one, preferably two, preferably three, preferably four genes required for the production of paspaline. In one embodiment the genes required for the production of paspaline comprise at least one of paxG, paxM, paxB and paxC, preferably at least two, preferably at least three, preferably all four of paxG, paxM, paxB and paxC. Preferably the genes required for the production of paspaline are from In one embodiment the indole diterpene biosynthetic pathway comprises, consists essentially of, or consists of at least one, preferably two, preferably three, preferably four, preferably five, preferably six genes required for the production of paxilline. In one embodiment the genes required for the production of paxilline comprise at least one of paxG, paxM, paxB, paxC, paxQ and paxP, preferably at least two, preferably at least three, preferably at least four, preferably at least five, preferably all six of paxG, paxM, paxB, paxC, paxQ and paxP. Preferably the genes required for the production of paxiline are from In one embodiment the biosynthetic is a naturally occurring biosynthetic pathway. In one embodiment the biosynthetic pathway is an artificial biosynthetic pathway. In another aspect, the invention relates to a set of vectors comprising:
the at least one destination vector comprising a pair of restriction sites,
In one embodiment the set of vectors consists essentially of (i) and (ii). In one embodiment, restriction of the restriction sites in any one of the vectors in (i) generates nucleotide overhangs of at least one nucleotide, preferably at least two, preferably at least three, preferably at least four nucleotides. In one embodiment, restriction of the restriction sites in the destination vector in (iii) generates nucleotide overhangs of at least one nucleotide, preferably at least two, preferably at least three, preferably at least four nucleotides. In one embodiment the pair of restriction sites in (iii) are Type IIS restriction sites. In one embodiment the Type IIS restriction sites are selected from the group consisting of BsaI, AarI and BsmBI sites. In one embodiment A1 and A2 are AarI restriction sites. In one embodiment C1 and C2 are BsmBI restriction sites. In this specification where reference has been made to patent specifications, other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents is not to be construed as an admission that such documents; or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art. The invention will now be illustrated in a non-limiting way by reference to the following examples. Materials and Methods Molecular Biology Restriction endonucleases were purchased from New England Biolabs (NEB, Ipswich, Mass., USA), except AarI, which was purchased from Thermo Scientific (Thermo Fisher Scientific, Waltham, Mass., USA). T4 DNA Ligase, 10×T4 DNA Ligase buffer and 10 mM ATP were from NEB (Ipswich, Mass., USA). Primers and gBlocks were synthesised by Integrated DNA Technologies (IDT, IA, USA). Other synthetic polynucleotides were synthesised by Epoch Life Science, Inc (Missouri City, Tex., USA). Kits for purification of plasmid DNA and PCR products using spin-column protocols were purchased from Macherey-Nagel (Düren, Germany). Genomic DNA from All PCRs for the construction of the MIDAS source, shuttle and destination vectors and for amplification of MIDAS modules were performed using Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB, Ipswich, Mass., USA). Isopropyl β-D-1-thiogalactopyranoside (IPTG) was purchased from Calbiochem (San Diego, Calif., USA), 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) from PanReac AppliChem (Darmstadt, Germany), and 4-chloro-DL-phenylalanine (4CP) from Sigma (St Louis, Mo., USA). Antibiotics used in this work were; Geneticin® (G418, from Sigma), kanamycin (PanReac AppliChem, Darmstadt, Germany) and spectinomycin (Gold Biotechnology, Olivette, Mo., USA). Bacterial and Fungal Strains Routine growth of Construction of MIDAS Vectors As with the MIDAS modules, all MIDAS source, shuttle and destination vectors were required to be domesticated (i.e. made free of recognition sites for AarI, BsaI and BsmBI). To achieve this, the initial plasmids in the construction of the MIDAS vectors were assembled in a modular fashion by BsaI-mediated assembly of PCR fragments corresponding to specific, functional plasmid structures (e.g., origin of replication, resistance markers, etc.); with the number of PCR fragments depending both on the number of internal Type IIS sites to be removed, and on the number of plasmid structures to be maintained as independent, functional pieces. MIDAS precursor plasmids were constructed in a modular fashion by BsaI-mediated Golden Gate assembly of PCR-generated DNA fragments containing terminal, convergent BsaI recognition sites (see Tables 1, 2 and 3). Typically, 1-2 μL of each purified PCR fragment, 1 μL of BsaI (20 U/μL), 1 μL of T4 DNA Ligase (400 U/μL) and 2 μL of 10×T4 DNA Ligase buffer in a total reaction volume of 20 μL were incubated overnight at 37° C. Construction of Level-1 Source Vector (pML1) The pML1 precursor plasmid was generated using a four-way BsaI-mediated Golden Gate reaction between PCR fragments CV-161, CV-162, CV-74 and CV-152 (Table 1). Following Golden Gate assembly, an aliquot of each reaction was transformed into The 329 bp NcoI-XhoI fragment in the pML1 precursor was replaced, by restriction enzyme digestion and ligation, with the 346 bp NcoI-XhoI fragment of PCR CV-81, which contains a lacZα-based Golden Gate cloning cassette ([CTCG]BsmBI-lacZα-BsmBI[AGAC]). The resultant plasmid is the Level-1 source vector pML1. Construction of Level-2 Shuttle Vectors (pML2 Vectors) A precursor of the pML2 shuttle vectors was generated using a four-way BsaI-mediated Golden Gate reaction between PCR fragments CV-153, CV-154, CV-77 and CV-152 (Table 2). Following Golden Gate assembly, an aliquot of each reaction was transformed into The pML2 precursor was digested with NcoI+XhoI and ligated to gBlocks digested with the same enzymes. The eight gBlocks (Table 4) can be classified into two groups—one group comprising four “W” gBlocks (ML2(+)WF, ML2(+)WR, ML2(−)WF and ML2(−)WR) and a second group composed of four “B” gBlocks (ML2(+)BF, ML2(+)BR, ML2(−)BF or ML2(−)BR). Ligations were transformed into A synthetic polynucleotide sequence encoding the Thr251Ala/Ala294Gly double mutant of the To produce the four “B” Level-2 shuttle vectors, the four “B” gBlock precursor plasmids harbouring the assembled pheS gene from the previous step, were digested with AarI and ligated to BsaI-digested PCR CV-78, resulting in the four“B” Level-2 shuttle vectors: pML2(+)BF, pML2(+)BR, pML2(−)BF and pML2(−)BR. Ligations were transformed into Functionality of the mutant pheS gene in each of the eight pML2 shuttle vectors was confirmed by transforming 0.1 μg of each plasmid into Construction of Level-3 Destination Vector (pML3) Plasmid pML3 was generated using a four-way BsaI-mediated Golden Gate reaction between PCR fragments CV-161, CV-162, CV-79 and CV-152 (Table 3). Following Golden Gate assembly, an aliquot of each reaction was transformed into Protocols for MIDAS Level-1 Module Cloning PCR-amplified modules were purified using spin-column protocols and cloned into the MIDAS Level-1 plasmid, pML1, by BsmBI-mediated Golden Gate assembly. Typically, 1-2 μL (approximately 50-200 ng) of pML1 plasmid DNA from a miniprep was mixed with 1-2 μL of each purified PCR fragment, 1 μL of BsmBI (10 U/μL), 1 μL of T4 DNA Ligase (400 U/μL) and 2 μL of 10×T4 DNA Ligase buffer in a total reaction volume of 20 μL. Reactions were incubated at 37° C. for 1 to 3 hours and an aliquot (typically 2-3 μL) was transformed into 30 μL of Protocols for MIDAS Level-2 TU Assembly Using the modules cloned at Level-1, full-length TUs were assembled into MIDAS Level-2 plasmids by BsaI-mediated Golden Gate assembly. Typically, 40 fmol of pML2 plasmid DNA was mixed with 40 fmol of plasmid DNA of each Level-1 entry clone, 1 μL of BsaI-HF (20 U/μL), 1 μL of T4 DNA Ligase (400 U/μL) and 2 μL of 10×T4 DNA Ligase buffer in a total reaction volume of 20 μL. Reactions were incubated in a DNA Engine PTC-200 Peltier Thermal Cycler (Bio-Rad, Hercules, Calif., USA) using the following parameters: 45 cycles of (2 minutes at 37° C. and 5 minutes at 16° C.), followed by 5 minutes at 50° C. and 10 minutes at 80° C. Reactions were transformed into Protocols for MIDAS Level-3 Multigene Assembly Full-length TUs assembled at Level-2, were used to create multigene assemblies in the Level-3 destination vector by alternating Golden Gate assembly using either AarI (for TUs cloned into pML2 “W” vectors) or BsmBI (for TUs cloned into pML2 “B” vectors). Typically, 40 fmol of Level-3 destination vector plasmid DNA was mixed with 40 fmol of Level-2 entry clone plasmid DNA. For BsmBI-mediated assemblies, 1 μL of BsmBI (10 U/μL), 1 μL of T4 DNA Ligase (400 U/μL) and 2 μL of 10×T4 DNA Ligase buffer, was added to the plasmid DNA in a final reaction volume of 20 μL. As discussed in the main text, two different reaction conditions were tested for AarI-mediated assemblies; (i) conventional Golden Gate reactions performed in T4 DNA Ligase buffer and (ii) reactions performed in AarI restriction enzyme buffer supplemented with ATP. For AarI-mediated reactions performed in T4 DNA Ligase buffer, 1 μL of AarI (2 U/μL), 0.4 μL of 50× oligonucleotide (25 μM, supplied with the enzyme), 1 μL of T4 DNA Ligase (400 U/μL) and 2 μL of T4 DNA Ligase buffer was added to the plasmid DNA, in a final reaction volume of 20 μL. For AarI-mediated reactions carried out in restriction enzyme buffer, 1 μL of AarI (2 U/μL), 0.4 μL of 50× oligonucleotide (25 μM, supplied with the enzyme), 2 μL of 10× Buffer AarI (supplied with the enzyme), 1 μL of T4 DNA Ligase (400 U/μL) and 2 μL of 10 mM ATP was added to the plasmid DNA, in a final reaction volume of 20 μL. All Level-3 reactions (BsmBI- and AarI-mediated) were incubated in a DNA Engine PTC-200 Peltier Thermal Cycler (Bio-Rad) using the following parameters: 45 cycles of (2 minutes at 37° C. and 5 minutes at 16° C.), followed by 5 minutes at 37° C. and 10 minutes at 80° C. Reactions were transformed into Media and Reagents Used for Fungal Work. CDYE (Czapex-Dox/Yeast extract) medium with trace elements was made with deionized water and contained 3.34% (w/v) Czapex-Dox (Oxoid Ltd., Hampshire, England), 0.5% (w/v) yeast extract (Oxoid Ltd., Hampshire, England), and 0.5% (v/v) trace element solution. For agar plates, Select agar (Invitrogen, California, USA) was added to 1.5% (w/v). Trace element solution was made in deionized water and contained 0.004% (w/v) cobalt(II) chloride hexahydrate (Ajax Finechem, Auckland, New Zealand), 0.005% (w/v) copper(II) sulfate pentahydrate (Scharlau, Barcelona, Spain), 0.05% (w/v) iron(II) sulfate heptahydrate (Merck, Darmstadt, Germany), 0.014% (w/v) manganese(II) sulfate tetrahydrate, and 0.05% (w/v) zinc sulfate heptahydrate (Merck, Darmstadt, Germany). The solution was preserved with 1 drop of 12 M hydrochloric acid. Regeneration (RG) medium was made with deionized water and contained 2% (w/v) malt extract (Oxoid Ltd., Hampshire, England), 2% (w/v) D(+)-glucose anhydrous (VWR International BVBA, Leuven, Belgium), 1% (w/v) mycological peptone (Oxoid Ltd., Hampshire, England), and 27.6% sucrose (ECP Ltd. Birkenhead, Auckland, New Zealand). Depending on whether the media was to be used for plates (1.5% RGA) or overlays (0.8% RGA), Select agar (Invitrogen, Carlsbad, Calif., USA) was added to 1.5% or 0.8% (w/v), respectively. Fungal Protocols—Protoplast Preparation The preparation of fungal protoplasts for transformation was according to Yelton et al (34) with modifications. Five 25 mL aliquots of CDYE medium with trace elements, in 100 mL Erlenmeyer flasks, were inoculated with 5×106spores and incubated for 28 hours at 28° C. with shaking (200 rpm). The fermentation broth from all five flasks was filtered through a sterile nappy liner and the combined mycelia were rinsed three times with sterile water and once with OM buffer (10 mM Na2HPO4and 1.2 M MgSO4.7H2O, brought to pH 5.8 with 100 mM NaH2PO4.2H2O). Mycelia were weighed, resuspended in 10 mL of filter-sterilized Lysing Enzymes solution (prepared by resuspending Lysing Enzymes from Fungal Protocols—Transformation of Fungal transformations—modified from Vollmer and Yanosfsky (35) and Oliver et al (36)—were carried out in 1.7 mL micro-centrifuge tubes containing 100 μL (1.25×107) protoplasts, either freshly prepared in STC buffer, or stored in 8% PEG solution (as described above). A solution containing 2 μL of spermidine (50 mM in H2O), 5 μL heparin (5 mg/mL in STC buffer), and 5 μg of plasmid DNA (250 μg/mL) was added to the protoplasts and, following incubation on ice for 30 minutes, 900 μL of 40% PEG solution (40% (w/v) PEG 4000 in STC buffer) was added. The transformation mixture was incubated on ice for a further 15-20 minutes, transferred to 17.5 mL of 0.8% RGA medium (prewarmed to 50° C.) in sterile 50 mL tubes, mixed by inversion, and 3.5 mL aliquots were dispensed onto 1.5% RGA plates. Following overnight incubation at 25° C., 5 mL of 0.8% RGA (containing sufficient geneticin to achieve a final concentration of 150 μg per mL of solid media) was overlaid onto each plate. Plates were incubated for a further 4 days at 25° C. and spores were picked from individual colonies and streaked onto CDYE agar plates supplemented with 150 μg/mL geneticin. Streaked plates were incubated at 25° C. for a further 4 days. Spores from individual colonies were suspended in 50 μL of 0.01% (v/v) triton X-100 and 5×5 μL aliquots of the spore suspension was transferred onto new CDYE agar plates supplemented with 150 μg/mL geneticin. Sporulation plates were incubated at 25° C. for 4 days and spore stocks were prepared as follows. Colony plugs from the sporulation plates were suspended in 2 mL of 0.01% (v/v) triton X-100, and 800 μL of suspended spores were mixed with 200 μL of 50% (w/v) glycerol in a 1.7 mL micro-centrifuge tube. Spore stocks were used to inoculate 50 mL of CDYE media, flash frozen in liquid nitrogen and stored at −80° C. Large Scale Indole Diterpene Purification for NMR Analysis Fungal transformants that produced high levels of novel indole diterpenes were grown in ≥1 litre of CDYE medium with trace elements, as described under “Indole diterpene production and extraction”. Mycelia were pooled into 1 litre Schott bottles containing stir bars. 2-butanone was added and indole diterpenes were extracted overnight with stirring (≥700 rpm). Extracts were filtered through Celite® 545 (3. T. Baker®, Thermo Fisher Scientific, Waltham, Mass., USA) and dry loaded onto silica with rotary evaporation for crude purification by silica column prior to a final purification by semi-preparative HPLC. A 1 mL aliquot of crude extract was injected onto a semi-preparative reversed phase Phenomenex 5 μm C18(2) 100 Å (250×15 mm) column attached to an UltiMate® 3000 Standard LC system (Dionex, Thermo Fisher Scientific, Waltham, Mass., USA) run at a flow rate of 8.00 mL/minute. Multistep gradient methods were optimized for the purification of different sets of indole diterpenes. The purity of each indole diterpene was assessed by LC-MS and the structure was identified by NMR. NMR NMR samples were prepared in deuterated chloroform. Compounds were analysed by standard one-dimensional proton and carbon-13 NMR, two-dimensional correlation spectroscopy (COSY), heteronuclear single quantum correlation (HSQC) spectroscopy, and heteronuclear multiple bond correlation (HMBC) spectroscopy. Indole Diterpene Production and Extraction Fungal transformants were grown in 50 mL of CDYE medium with trace elements for 7 days at 28° C. in shaker cultures (200 rpm), in 250 mL Erlenmeyer flasks capped with cotton wool. Mycelia were isolated from fermentation broths by filtration through nappy liners, transferred to 50 mL centrifuge tubes (Lab Serv®, Thermo Fisher Scientific, Waltham, Mass., USA) and IDTs were extracted by vigorously shaking the mycelia (≥200 rpm) in 2-butanone for ≥45 minutes. Thin-Layer Chromatography The 2-butanone supernatant (containing extracted IDTs) was used for thin-layer chromatography (TLC) analysis on solid phase silica gel 60 aluminium plates (Merck, Darmstadt, Germany). IDTs were chromatographed with 9:1 chloroform:acetonitrile or 9:1 dichloromethane:acetonitrile and visualized with Ehrlich's reagent (1% (w/v) p-dimethylaminobenzaldehyde in 24% (v/v) HCl and 50% ethanol). Liquid Chromatography-Mass Spectrometry Samples were prepared for liquid chromatography-mass spectrometry (LC-MS) from those transformants that tested positive by TLC. Accordingly, a 1 mL sample of the 2-butanone supernatant (containing extracted IDTs) was transferred to a 1.7 mL micro-centrifuge tube and the 2-butanone was evaporated overnight. Contents were resuspended in 100% acetonitrile and filtered through a 0.2 μm membrane into an LC-MS vial. LC-MS samples were chromatographed on a reverse phase Thermo Scientific Accucore 2.6 μm C18 (50×2.1 mm) column attached to an UltiMate® 3000 Standard LC system (Dionex, Thermo Fisher Scientific, Waltham, Mass., USA) run at a flow rate of 0.200 mL/minute and eluted with aqueous solutions of acetonitrile containing 0.01% formic acid using a multistep gradient method (Table 13). Mass spectra were captured through in-line analysis on a maXis™ II quadrupole-time-of-flight mass spectrometer (Bruker, Billerica, Mass., USA). Results Metabolic Pathway Engineering Gene reconstitution experiments using Level-1 Assemblies Transcription unit modules (ProUTR, CDS and UTRterm) were amplified for each of the six pax genes using genomic DNA from The exon/intron structure of each of the pax genes was left unchanged and, where necessary, PCR primers were designed to amplify module fragments for domestication purposes (i.e., removal of internal recognition sites for AarI, BsaI and BsmBI). Domestication primers are listed in Table 7. The amplified full-length modules (and compatible sets of domesticated module fragments) were then cloned, by BsmBI-mediated Golden Gate assembly, into pML1. Reactions were transformed into Level-2 Assemblies At Level-2, TUs for paxG, paxC, paxM, paxB, paxP and paxQ were constructed by BsaI-assembling each pax CDS module with its homologous (i.e., native) ProUTR and UTRterm modules in pML2 shuttle vectors (see Some TUs were assembled in more than one pML2 shuttle vector. For example, a paxM TU was assembled in both pML2(+)WR and pML2(+)BR. Both paxM Level-2 entry plasmids (pSK22 and pRB1) were assembled from the same Level-1 entry clones (pSK4, pSK5 and pSK6). Two paxG TUs were assembled; in one case (plasmid pSK21) a paxG TU was produced by assembling, in pML2(+)BR, the paxGCDSmodule (from plasmid pSK2) with its native promoter (i.e., the paxGProUTRmodule in pSK1) and terminator (paxGUTRterm, pSK3). To demonstrate the versatility of MIDAS for combinatorial assembly, a second paxG TU (plasmid pSK47) was also assembled in pML2(+)BR using the same paxG CDS (paxGCDS, pSK2) and terminator (paxGUTRterm, pSK3), but with expression driven by the heterologous paxB promoter (paxBProUTR, pSK7), and the TU structure in pSK47 is shown as PpaxB-paxG-TpaxG. Three paxC TUs were assembled; in two cases (plasmids pSK59 and pKV29), the paxC TUs were assembled from the same Level-1 plasmids, by combining the paxC CDS (pSK11) with its native promoter (pKV28) and terminator (pSK12), albeit in different pML2 shuttle vectors—pML2(+)WF in the case of pSK59, and pML2(+)BF in the case of pKV29. Once again, to demonstrate the versatility of MIDAS for combinatorial assembly, a third paxC TU (pSK61) was assembled in pML2(+)WF using the same paxC CDS, but using heterologous promoter (the trpCProUTRin pSK17) and terminator (trpCUTRterm, pSK15) modules. To distinguish this paxC TU from the other paxC TUs assembled from native promoters and terminators, the paxC TU structure in pSK61 is shown as PtrpC-paxC-TtrpC. A nptII TU (conferring resistance to Geneticin®) was prepared by assembling the nptIICDSmodule (pSK16) with the trpCProUTR(pSK17) and trpCUTRterm(pSK15) modules in pML2(+)WF, giving rise to the Level-2 entry clone pSK26 (and the TU structure is shown as PtrpC-nptII-TtrpC). After BsaI-mediated assembly, reactions were transformed into Level-3 Assemblies The TUs assembled at Level-2 were used to generate a variety of multigene plasmids at Level-3 (see The numbers of spectinomycin-resistant colonies obtained following transformation of each Level-3 Golden Gate reaction into BsmBI-mediated assemblies were very efficient, with >99% of the colonies obtained being of the desired (blue) colour (Table 12). Two blue colonies from each BsmBI-mediated reaction were selected for plasmid DNA purification and restriction analysis and, of the 12 plasmids analysed, all showed the expected restriction digestion pattern ( For AarI-mediated assemblies, two different restriction-ligation conditions were tested. In the first set of experiments, AarI-mediated Golden Gate reactions were carried out, as usual, in T4 DNA Ligase buffer. The proportion of colonies of the desired colour (white) that were obtained was quite variable, ranging between 64-96% depending on the assembly reaction (Table 12). The high background of blue colonies suggested that AarI has reduced cleavage efficiency in the ligase buffer; indeed, many sites are not completely cleaved by AarI even under standard reaction conditions (39). Therefore, as an alternative approach, AarI assemblies were also performed in the reaction buffer supplied with the AarI restriction enzyme, additionally supplemented with ATP. Under these conditions, the assemblies showed a marked improvement in efficiency (>96% white colonies), and when two white colonies from each reaction were selected for plasmid DNA purification and restriction analysis, a high proportion (9/10) showed the expected restriction digestion pattern ( Fungal Transformations and Analysis of IDT Phenotypes In a series of complementation experiments, a selection of the Level-3 plasmids produced in this work were transformed into Restoration of Paspaline Production in a ΔPAX Deletion Mutant Since genetic reconstitution experiments have shown that complementation using just four genes (paxG, paxM, paxB and paxC) can restore paspaline production in Accordingly, TUs for paxG (pSK21), paxM (pSK22) and paxB (pSK23), each under the control of their native promoters and terminators, were loaded sequentially into pSK33, followed by a paxC TU from either pSK59 (native promoter) or pSK61 (heterologous trpC promoter), to produce pSK64 and pSK63, respectively (see When plasmids pSK64 or pSK63 were transformed into Due to the extensive deletion of the PAX cluster in parental strain PN2250 (CY2), which includes paxP and paxQ, as expected no paxilline was identified in the LC-MS analyses of these transformants (see Restoration of Paxilline Production in a ΔPAX Deletion Mutant Since gene disruption and chemical complementation experiments have shown that paxP and paxQ are required for the biosynthetic conversion of paspaline to paxilline (40), we also tested whether MIDAS-assembled multigene plasmids harbouring paxP and paxQ, in addition to the four core genes (paxGMBC), could restore production of paxilline in Plasmid pSK79 was transformed into Paxilline Production Using Bacterial Artificial Chromosomes (BAC) To demonstrate the principles of MIDAS, the Level-3 destination vector used thus far in this work (i.e., pML3) was designed with the high copy number pMB1 replicon (from pUC19) for ease of handling (i.e., high plasmid yields for restriction digestion and sequencing analysis). Although theoretically capable of indefinite growth, such high copy number, pMB1-based vectors will undoubtedly, at some point, encounter limitations relating to the stability of specific cloned sequences and/or size of insert. To ameliorate these potential issues, a Level-3 destination plasmid based on bacterial artificial chromosomes (BACs) could permit the cloning and stable maintenance of very large assemblies. BAC vectors harbouring an inducible replication element for on-demand control of copy number offer a particularly attractive way of building large metabolic arrays that could be stably maintained in To demonstrate the feasibility of BAC-based multigene assemblies, a Level-3 destination vector (named pML3-BAC) was also constructed, based on pSMART® BAC v2.0 (Lucigen, USA). The pML3-BAC destination vector, and derived multigene assemblies cloned into pML3-BAC, were propagated in The paxilline biosynthetic pathway was assembled into pML3-BAC by sequentially loading the TUs for nptII, paxG, paxC, paxM, paxB, paxP and paxQ ( Plasmid pKV140 was transformed into the Tables 1-15 referenced in this specification are set out below: The vector sets and methods of the invention have industrial application in molecular biology in providing a means to manipulate polynucleotide sequences to form in vitro and heterologous in vivo expression systems for the production of various biochemical molecules. Homologous Recombination in Yeast. A modular and hierarchical DNA assembly platform for synthetic biology is described. This enabling technology, termed MIDAS (for Modular Idempotent DNA Assembly System), can precisely assemble multiple DNA fragments in a single reaction using a standardised assembly design. It can be used to build genes from libraries of sequence-verified, reusable parts and to assemble multiple genes in a single vector. We describe the design and use of MIDAS, and its application in the reconstruction of the metabolic pathway for production of paspaline, a key intermediate in the biosynthesis of a range of indole diterpenes—a class of economically important secondary metabolites produced by several species of filamentous fungi. 1. A vector set comprising at least two shuttle vectors, V1 and V2,
wherein V1 is selected from the group consisting of
V1.1(+)=5′-A1 B1 M1 B2 C1 C2 A2-3′, V1.2(−)=5′-A1 C1 C2 B1 M1 B2 A2-3′, V1.3(+)=5′-A1 B2 M1 B1 C1 C2 A2-3′, and V1.4(−)=5′-A1 C1 C2 B2 M1 B1 A2-3′, and V2 is selected from the group consisting of
V2.1(+)=5′-C1 B1 M1 B2 A1 M2 A2 C2-3′, V2.2(−)=5′-C1 A1 M2 A2 B1 M1 B2 C2-3′, V2.3(+)=5′-C1 B2 M1 B1 A1 M2 A2 C2-3′, and V2.4(−)=5′-C1 A1 M2 A2 B2 M1 B1 C2-3′, wherein M1 is a first marker, M2 is a second marker, and A1, A2, B1, B2, C1 and C2 are restriction enzyme recognition sites, wherein at least A1, A2, C1, and C2 are recognition sites for Type IIS restriction enzymes, wherein A1, B1 and C1 are all different recognition sites, and wherein A1=A2, C1=C2, and B1=B2 or B1≠B2. 2. The vector set of 3. The vector set of 4. The vector set of 5. The vector set of (a) at least two V1 vectors and at least two V2 vectors, (b) at least one V1 vector and at least three V2 vectors, or (c) at least three V1 vectors and at least one V2 vector, wherein each of (a), (b) and (c) comprises at least one (−) vector and at least one (+) vector, comprising at least five shuttle vectors as follows: (d) at least two V1 vectors and at least three V2 vectors, (e) at least three V1 vectors and at least two V2 vectors, (f) four V1 vectors and at least one V2 vector, or (g) at least one V1 vector and four V2 vectors, wherein each of (d), (e), (f) and (g) comprises at least one (−) vector and at least one (+) vector, comprising at least six shuttle vectors as follows: (h) at least three V1 vectors and at least three V2 vectors, (i) four V1 vectors and at least two V2 vectors, (j) at least two V1 vectors and four V2 vectors, wherein each of (i) and (j) comprises at least one (−) vector and at least one (+) vector, comprising at least seven shuttle vectors as follows: (k) at least three V1 vectors and four V2 vectors, (l) four V1 vectors and at least three V2 vectors. 6. The vector set of 7. The vector set of 8. The vector set of 9. The vector set of 10. A method of making a multigene construct comprising at least two transcription units (TU), the method comprising:
(a) cloning a first cloning cassette comprising a first transcription unit (TU1), and four restriction sites A1, A2, C1 and C2 arranged in the following order:
5′-A1-TU1-C1-C2-A2-3′, or 5′-A1-C1-C2-TU1-A2-3′, into a destination vector (V3) comprising a pair of restriction sites A1 and A2 flanking a second marker (M2) to make:
destination vector V3.1 comprising 5′-TU1-C1-C2-3′ or destination vector V3.2 comprising 5′-C1-C2-TU1-3′, (b) cloning a second cloning cassette comprising a second transcription unit (TU2), the second marker (M2), and four restriction sites A1, A2, C1 and C2 arranged in the following order:
5′-C1-TU2-A1-M2-A2-C2-3′, or 5′ C1-A1-M2-A2-TU2-C2-3′, into V3.1 to make destination vector V4.1 comprising 5′-TU1-TU2-A1-M2-A2-3′, or destination vector V4.2 comprising 5′-TU1-A1-M2-A2-TU2-3′, or into V3.2 to make destination vector V4.3 comprising 5′-TU2-A1-M2-A2-TU1-3′, or destination vector V4.4 comprising 5′-A1-M2-A2-TU2-TU1-3′ wherein A1 and C1 are different restriction sites, and wherein A1=A2 and C1=C2. 11. (canceled) 12. (canceled) 13. (canceled) 14. (canceled) 15. (canceled) 16. The method of 17. A vector set comprising at least three shuttle vectors,
wherein at least two of the three vectors are V1 vectors selected from the group consisting of
V1.1(+)=5′-A1 B1 M1 B2 C1 C2 A2-3′, V1.2(−)=5′-A1 C1 C2 B1 M1 B2 A2-3′, V1.3(+)=5′-A1 B2 M1 B1 C1 C2 A2-3′, and V1.4(−)=5′-A1 C1 C2 B2 M1 B1 A2-3′, wherein at least one of the V1 vectors is a (+) vector and another V1 vector is a (−) vector, and wherein at least one of the three vectors is a V2 vector selected from the group consisting of
V2.1(+)=5′-C1 B1 M1 B2 A1 M2 A2 C2-3′, V2.2(−)=5′-C1 A1 M2 A2 B1 M1 B2 C2-3′, V2.3(+)=5′-C1 B2 M1 B1 A1 M2 A2 C2-3′, and V2.4(−)=5′-C1 A1 M2 A2 B2 M1 B1 C2-3′, wherein M1 is a first marker, M2 is a second marker, and A1, A2, B1, B2, C1 and C2 are restriction enzyme recognition sites, wherein at least A1, A2, C1, and C2 are recognition sites for Type IIS restriction enzymes, wherein A1, B1 and C1 are all different restriction sites, and wherein A1=A2, C1=C2, and B1=B2 or B1≠B2. 18. A vector set comprising at least two shuttle vectors, wherein
each shuttle vector comprises a first marker (M1), and at least six restriction sites, wherein at least four of the restriction sites are Type IIS restriction sites, wherein in at least one first shuttle vector, a first four restriction sites are located 3′ or 5′ of M1, at least three of the four being Type IIS restriction sites, and a second two restriction sites are located 3′ or 5′ of M1, at least one of the two being a Type IIS restriction site, and wherein in at least one second shuttle vector, a first four restriction sites are located 3′ or 5′ of M1, at least three of the four being Type IIS restriction sites, and a second two restriction sites are located 5′ or 3′ of M1, at least one of the two being a Type IIS restriction site, wherein the at least one second shuttle vector comprises at least one second marker (M2) flanked by two Type IIS restriction sites, and wherein when the first four restriction sites are located 3′ of M1 in the at least one first or second vector, the second two restriction sites are located 5′ of M1, and the vector is a (+) vector, and when the first four restriction sites are located 5′ of M1 in the at least one first or second vector, the second two restriction sites are located 3′ of M1 and the vector is a (−) vector. 19. A set of eight shuttle vectors, each shuttle vector comprising a first marker (M1) and six restriction sites,
wherein each shuttle vector comprises a first set of four restriction sites positioned on one side of M1 and a second set of two restriction sites positioned on the other side of M1, wherein two of the restriction sites in the first set are the same as each other, the two restriction sites in the second set are different from each other, and at least one of the two restriction sites in the second set is the same as one of the four restriction sites in the first set, and wherein four of the shuttle vectors comprise a second marker (M2), wherein four of the vectors are (+) vectors comprising the first set of restriction sites 3′ of M1, and four of the vectors are (−) vectors comprising the first set of restriction sites 5′ of M1. 20. (canceled) 21. A set of vectors comprising
(i) the V1 shuttle vectors as defined in (ii) the V2 vectors as defined in (iii) at least one destination vector comprising a pair of restriction sites, wherein the pair of restriction sites in (iii) have a divergent orientation relative to each other and are the same as a pair of restriction sites in each of the shuttle vectors in (i), and in each of the shuttle vectors in (ii) wherein the restriction sites in (i) have a convergent orientation relative to each other, and wherein the restriction sites in (ii) have a divergent orientation relative to each other. 22. (canceled) 23. (canceled) 24. (canceled) 25. (canceled) 26. (canceled) 27. The vector set of 28. The vector set of 29. The vector set of 30. The vector set of 31. The vector set of FIELD OF THE INVENTION
BACKGROUND
SUMMARY OF THE INVENTION
BRIEF DESCRIPTION OF THE DRAWINGS
DETAILED DESCRIPTION OF THE INVENTION
Definitions
DETAILED DESCRIPTION
Examples
PCR primers used in the construction of the pML1 source vector. SpecR denotes spectinomycin resistance. Template SEQ PCR name Plasmid (source/ Primer name (length): ID (Size, bp) fragment Fragment description reference) Primer sequence (5′ to 3′) NO. CV-161 BsaI[ACCG]- Bacterial spectinomycin pBB535 cvd2016-01-13a (41-mer): 10 (1125) PaadA-SpecR- resistance gene driven (41) cgctcacggtctcaACCGgacgtcgatatccggatg [GAAT]BsaI by te aadA promoter aaggc cvd2016-01-13b (45-mer): 11 tgaacgaggtctcaATTCttatttgccgactacctt ggtgatctc CV-162 BasI[GAAT]- Bacteriophage f1 origin pET cvd2016-01-13c (55-mer): 12 (591) f1ori- of replication −28a(+) gatgagttggtctcaGAATtaattcatgagcggata [GTGT]BsaI (Novagen) catatttgaatgtatttag cvd2015-11-18d (35-mer): 13 gaggaacggtctccACACtggcgaatgggacgcgc CV-74 BsaI[GTGT]- Wildtype laxZα cvd2015-05-28b (47-mer): 14 (372) lacZα- fragment, driven by the K12 ER2925 ctttccggtctcaGTGTccatggttattaccaggca [GGCA]BsaI lac promoter. (New aagcgccattc England cvd2015-05-28k (54-mer): 15 Biolabs) gacaggtttggtctcgTGCCctcgagcagctggcgc aacgcaattaatgtgagt CV-152 BsaI[GGCA]- Bacterial pMB1 plasmid pUC19 cvd2015-11-18a (39-mer): 16 (1070) pMB1 ori- origin of replication. (Clontech cacattaaggtctctGGCAtcactgcccgctttcca [ACCG]BsaI Labora- gtc tories, cvd2015-11-18b (50-mer): 17 Inc.) tgattaggtctcgCGGTctgtcagaccaagtttact catatatactttag CV-81 NcoI- Fragment containing the cvd2015-05-28d (50-mer): 18 (367) [CTCG]BsmI- pML1 Golden Gate K12 ER2925 cagctttcccatgttCTCGtgagacgttattaccag laxZα-BsmBI cloning cassette, i.e., (New gcaaagcgccattc [AGAC]-XhoI lacZα (driven by the England cvd2015-05-281 (46-mer): 19 lax promoter) flanked Biolabs) tcccgacctcgagGTCTagagacggcgcaacgcaat by divergent BamBI taatgtgagt recognition sites. PCR primers used in the construction of the pML2 shuttle vectors. KanR denotes kanamycin resistance. Template SEQ PCR name Plasmid (source/ Primer name (length): ID (Size, bp) fragment Fragment description reference) Primer sequence (5′ to 3′) NO. CV-153 BsaI[ACCG]- Bacterial kanamycin pET cvd2015-11-18c (40-mer): 20 KanR- resistance gene driven −28a(+) agaagatccggtctccACCGctacggggtctgacgc [TTTG]-BsaI by the kan promoter (Novagen) tcag cvd2015-06-17a (38-mer): 21 gattcgcgggtctccCAAAcgaaatacgcgatcgct gtt BsaI[TTTG]- pET cvd2015-06-17b (37-mer): 22 KANR-f1ori- −28a(+) domestication primer): [GTGT] (Novagen) atcgcgggtctcgTTTGgctcaggcgcaatcacgaa t cvd2015-11-18d (35-mer): 23 gaggaacggtctccACACtggcgaatgggacgcgc CV-77 BsaI[GTGT]- Wild type laxZα cvd2015-05-22b (47-mer): 24 (363) laxZα- fragment, driven by K12 ER2925 ctttccggtctcaGTGTccatggttattaccaggca [GGCA]BsaI the lac promoter. (New aagcgccattc England cvd2015-05-22g (46-mer): 25 Biolabs) cccgacggtctcgTGCCctcgaggcgcaacgcaatt aatgtgagtt CV-152 BsaI[GGCA]- Bacterial pMB1 plasmid pUC19 cvd2015-11-18a (39-mer): 26 (1070) pMB1ori- origin of replication. (Clontech cacattaaggtctctGGCAtcactgcccgctttcca [ACCG]BsaI Labora- gtc tories, cvd2015-11-18b (50-mer): 27 Inc. tgattaggtctcgCGGTctgtcagaccaagtttact catatatactttag CV-78 BsaI[CATT] Wild type lacZα E. coli cvd2015-05-22h (53-mer): 28 (376) AarI-lacZα- fragment, driven by K12 ER2925 agccagcggtctcaCATTgcttgcaggtgttattac AarI[CGTA] the lac promoter. (New caggcaaagcgccattg BsaI England cvd2015-05-22i (52-mer): 29 Biolabs) caggtttcggtctcgTACGgcgggcaggtggcgcaa cgcaattaatgtgagt CV-129 [GGAG]BsaI- Chloramphenicol pBB528 cvd2015-10-20a (45-mer): 30 (140) Pcat acetyltransferase (41) ccacctGGAGagagaccaagctttgatcggcacgta BsaI[TAAA] (cat) promoter agaggttcc cvd2015-10-20b (42-mer): 31 cctttccggtctctTTTAgcttccttagctcctgaa aatctc CV-141 BsaI[TAAA]- PheS negative selection Synthetic cvd1025-10-20c (39-mer): 32 (1029) PheS(T251A/ marker gene agggaaaggtctcaTAAAatgtcacatctcgcagaa A294G) *- (Epoch ctg [CGCT]BsaI Life cvd2015-11-03a (54-mer): 33 Science, tgcctggAGCGagagaccaagcttttattatttaaa Inc.) ctgtttgaggaaacgcag PCR primers used in the construction of the pML3 destination vector. SpecR denotes spectinomycin resistance. Template SEQ PCR name (source/ Primer name (length): ID (Size, bp) Fragment description reference) Primer sequence (5′ to 3′) NO. CV-161 BasI[ACCG]- Bacterial spectino- pBB535 cvd2016-01-13a (41-mer): 34 (1125) PaadA-SpecR- mycin resistance gene (41) cgctcacggtctcaACCGgacgtcgatatccggatg [GAAT]BsaI driven by the aadA aaggc promoter cvd2016-10-13b (45-mer): 35 tgaacgaggtctcaATTCttatttgccgactacctt ggtgatctc CV-162 BsaI[GAAT]- Bacteriophage f1 pET cvd2016-01-13c (55-mer): 36 (591) f1ori- origin of replication −28a(+) gatgagttggtctcaGAATtaattcatgagcggata [GTGT]BsaI (Novegen) catatttgaatgtatttag cvd2015-11-18d (35-mer): 37 gaggaacggtctccACACtggcgaatgggacgcgc CV-79 BsaI[GTGT] Fragment containing cvd2015-05-22d (58-mer): 38 (384) [CATT]AarI- the pML3 Golden Gate K12 ER2925 actccagcggtctcaGTGTCVATTgcttgcaggtgt lacZα- cloning cassette, (New tattaccaggcqaaagcgccattc AarI[CGTA] i.e. lacZα (driven by England cvd2015-05-22j (55-mer): 39 [GGCA]BsaI the lac promoter) Biolabs) cgacaggggtctcgTGCCTACGgcgggcaggtggcg flanked by divergent caacgcaattaatgtgagt Aarl recognition sites. CV-152 BsaI[BBCA]- Bacterial pMB1 pUC19 cvd2015-11-18a (39-mer): 40 (1070) pMB1 ori- plasmid origin of (Clontech cacattaaggtctctGGCAtcactgcccgctttcca [ACCG]BsaI replication. Labora- gtc tories, cvd2015-11-18b (50-mer): 41 Inc.) tgattaggtctcgCGGTctgtcagaccaagtttact catatatactttag gBlock sequences used for the construction of the pML2 shuttle vectors. gBlocks are synthesized as double stranded DNA; only the top strand (5′ to 3′) is shown in the table. gBlock name gBlock sequence (5′ to 3′) SEQ ID NO “W” gBlocks ML2(+)WF gaccccgtaggtgtccatggcacctgcagctcattggagagagaccttaagcttgca 2 gcagcggtctctcgctcattagagacggccggattgcggccgctaaccggccgtctc acgtaatatgcaggtgctcgagggcatcaaat ML2(+)WR gaccccgtaggtgtccatggcacctgcagctcattagcgagagaccttaagcttgca 3 gcagcggtctctctcccattagagacggccggattgcggccgctaaccggccgtctc acgtaatatgcaggtgctcgagggcatcaaat ML2(−)WF gaccccgtaggtgtccatggcacctgcagctcattagagacggccggattgcggccg 4 ctaaccggccgtctcacgtaggagagagaccttaagcttgcagcagcggtctctcgc tcgtaatatgcaggtgctcgagggcatcaaat ML2(−)WR gaccccgtaggtgtccatggcacctgcagctcattagagacggccggattgcggccg 5 ctaaccggccgtctcacgtaagcgagagaccttaagcttgcagcagcggtctctctc ccgtaatatgcaggtgctcgagggcatcaaat “B” gBlocks ML2(+)BF gaccccgtaggtgtccatggcgtctcacattggagagagaccttaagcttgcagcag 6 cggtctctcgctcattatatgcaggtggccggattgcggccgctaaccggccacctg cagctcgtaagagacgctcgagggcatcaaat ML2(+)BR gaccccgtaggtgtccatggcgtctcacattagcgagagaccttaagcttgcagcag 7 cggtctctctcccattatatgcaggtggccggattgcggccgctaaccggccacctg cagctcgtaagagacgctcgagggcatcaaat ML2(−)BF gaccccgtaggtgtccatggcgtctcacattatatgcaggtggccggattgcggccg 8 ctaaccggccacctgcagctcgtaggagagagaccttaagcttgcagcagcggtctc tcgctcgtaagagacgctcgagggcatcaaat ML2(−)BR gaccccgtaggtgtccatggcgtctcacattatatgcaggtggccggattgcggccg 9 ctaaccggccacctgcagctcgtaagcgagagaccttaagcttgcagcagcggtctc tctcccgtaagagacgctcgagggcatcaaat Generalised guidelines for the design of primers for amplification of ProUTR, CDS and UTRterm modules to be cloned into pML1. Generalized features of forward and reverse PCR primers used for amplification of ProUTR, CDS and UTRterm TUMs are listed. The 5′ and 3′ nucleotide-specific bases, which flank each TUM and form the basis of the address system for each of the MIDAS modules, are shown in bold. gBlock name gBlock sequence (5′ to 3′) SEQ ID NO “W” gBlocks ML2(+)WF gaccccgtaggtgtccatggcacctgcagctcattggagagagaccttaagcttgca 2 gcagcggtctctcgctcattagagacggccggattgcggccgctaaccggccgtctc acgtaatatgcaggtgctcgagggcatcaaat ML2(+)WR gaccccgtaggtgtccatggcacctgcagctcattagcgagagaccttaagcttgca 3 gcagcggtctctctcccattagagacggccggattgcggccgctaaccggccgtctc acgtaatatgcaggtgctcgagggcatcaaat ML2(−)WF gaccccgtaggtgtccatggcacctgcagctcattagagacggccggattgcggccg 4 ctaaccggccgtctcacgtaggagagagaccttaagcttgcagcagcggtctctcgc tcgtaatatgcaggtgctcgagggcatcaaat ML2(−)WR gaccccgtaggtgtccatggcacctgcagctcattagagacggccggattgcggccg 5 ctaaccggccgtctcacgtaagcgagagaccttaagcttgcagcagcggtctctctc ccgtaatatgcaggtgctcgagggcatcaaat “B” gBlocks ML2(+)BF gaccccgtaggtgtccatggcgtctcacattggagagagaccttaagcttgcagcag 6 cggtctctcgctcattatatgcaggtggccggattgcggccgctaaccggccacctg cagctcgtaagagacgctcgagggcatcaaat ML2(+)BR gaccccgtaggtgtccatggcgtctcacattagcgagagaccttaagcttgcagcag 7 cggtctctctcccattatatgcaggtggccggattgcggccgctaaccggccacctg cagctcgtaagagacgctcgagggcatcaaat ML2(−)BF gaccccgtaggtgtccatggcgtctcacattatatgcaggtggccggattgcggccg 8 ctaaccggccacctgcagctcgtaggagagagaccttaagcttgcagcagcggtctc tcgctcgtaagagacgctcgagggcatcaaat ML2(−)BR gaccccgtaggtgtccatggcgtctcacattatatgcaggtggccggattgcggccg 9 ctaaccggccacctgcagctcgtaagcgagagaccttaagcttgcagcagcggtctc tctcccgtaagagacgctcgagggcatcaaat Level-3 multigene assemblies are constructed by alternating Golden Gate cloning reactions using TUs assembled in “W” and “B” pML2 vectors. The table shows the cloning steps used to produce a hypothetical multigene construct containing four TUs, with each row depicting the input plasmids (Level-2 entry clone and destination plasmid), the type of Golden Gate reaction used for assembly, the product plasmid and the type of colonies screened. Level-2 Destination Golden Gate Step entry clone plasmid reaction Product plasmid Screen 1 TU1 in a “W” pML2 vector pML3 AarI-mediated pML3:TU1 White colonies 2 TU2 in a “B” pML2 vector pML3:TU1 BsmBI-mediated pML3:TU1:TU2 Blue colonies 3 TU3 in a “W” pML2 vector pML3:TU1:TU2 AarI-mediated pML3:TU1:TU2:TU3 White colonies 4 TU4 in a “B” pML2 vector pML3:TU1:TU2:TU3 BsmBI-mediated pML3:TU1:TU2:TU3:TU4 Blue colonies PCR primers for amplification of transcription unit modules (TUMs). The forward and reverse PCR primers used for amplification of pax gene TUMs and TUMs from other genes used in this study are listed. The names of the primers used to amplify TUM fragments for domestication purposes (i.e. removal of internal sites for AarI, BsaI or BsmBI) are shaded grey. The template for amplification of pax gene TUMs was genomic DNA from ATCC26601 (PN2013) [Accession HM171111]. The PCR products used to produce the trpC ProUTR module, nptII CDS module (conferring resistance to geneticin), and trpCUTRterm module were all amplified from plasmid pII99 (42). The 5′ and 3′ nucleotide-specific bases, which flank each TUM and form the basis of the address system for each of the MIDAS modules, are shown in bold. TUM Primer name Primer Sequence (5′ to 3′) SEQ ID NO. paxGProUTR P paxG F cgatgtacgtctcaCTCGGGAGattcacgacctgtgactagtcaa 48 P paxG R gacctttcgtctctGTCTcaCATTgcgtcgaacttgatgaagttttct 49 paxGCDS paxG frag1 F cgatgtacgtctcaCTCGAATGtcctacatccttgcagaag 50 paxG frag1 R cttctacgtctcgTACTgttctaatcgtgcttggtg 51 paxG frag2 F gcacgacgtctccAGTAcaggtgctagaagatgacgttgac 52 paxG frag2 R aggcgccgtctccACCAatctctttcaatcttgcttgttgga 53 paxG frag3 F gattgacgtctctTGGTgacccccgcgcctt 54 paxG frag3 R gtcgaccgtctctTTCCctagtatattggaagctccccg 55 paxG frag4 F tccaatcgtctcgGGAAaccctaagtcgacttagtgcg 56 paxG frag4 R gacctttcgtctctGTCTcaAAGCttaaactcttcctttctcattagtaggg 57 paxGUTRterm T paxG F cgatgtacgtctcacCTCGGCTTtcaatcgtgctgcatttctctt 58 T paxG R gacctttcgtctctGTCTcaAGCGtcactcccgagcaatattgct 59 paxMProUTR P paxM F cgatgtacgtctcaCTCGGGAGgttgttggcatgggagtaggat 60 p paxM R gacctttcgtctctGTCTcaCATTgtttctgaatcttaaagatacatgaaaagaataaagc 61 paxMCDS paxM frag1 F cgatgtacgtctcaCTCGAATGgaaaaggccgagtttcaag 62 paxM frag1 R tgacaacgtctcgTCCAtcgaataaagcgttgacttgc 63 paxM frag2 F acgcttcgtctcaTGGActcactattgtcacaatccatggaaaag 64 paxM frag2 R gacctttcgtctctGTCTcaAAGCttaaacttgaagaaaataaaacttcagggcac 65 paxMUTRterm T paxM frag1 F cgatgtacgtctcaCTCGGCTTaccattggagcaatttttggttttc 66 T paxM frag1 R gttcgccgtctcgACTCgattgcttgtgggtct 67 T paxM frag2 F acaagccgtctccGAGTccagccagcgaacttg 68 T paxM frag2 R gacctttcgtctctGTCTcaAGCGTtttggcttacttcagtttaactgttTTG 69 paxBProUTR P paxB F cgatgtacgtctcaCTCGGGAGaaggctgtgttggagagaatc 70 P paxB R gacctttcgtctctGTCTcaCATTgtttctaaggttgacgtgggaaaaag 71 paxBCDS paxB F cgatgtacgtctcaCTCGAATGgacggttttgatgtttcccaa 72 paxB R gacctttcgtctctGTCTcaAAGCtcaatttgcttttttcggcccgcttatgc 73 paxBUTRterm T paxB F cgatgtacgtctcaCTCGGCTTtcggcagttgagggtgaaac 74 T paxB R gacctttcgtctctGTCTcaAGCGggttaacaatgaggaacgatgaacag 75 paxCProUTR P paxC F cgatgtacgtctcaCTCGGGAGacaacaaaaagatcagccaatgg 76 P paxC R gacctttcgtctctGTCTcaCATTaaaatgggacctacaccctgaa 77 paxCCDS paxC frag1 F cgatgtacgtctcaCTCGAATGggcgtagcaggga 78 paxC frag1 R cattgacgtctccACGGcgccagacaaggga 79 paxC frag2 F cccttgcgtctcgCCGTgacggagtcaatgggttc 80 paxC frag2 R gacctttcgtctctGTCTcaAAGCtcatgccttcaggtcaagcttc 81 paxCUTRterm T paxC F cgatgtacgtctcaCTCGGCTTttggccttgtgaaatatgggactac 82 T paxC R gacctttcgtctctGTCTcaAGCGatctctgtcatgtcggatatcagat 83 paxPProUTR P paxP F cgatgtacgtctcaCTCGGGAGagggaaatttggaaatagattacactcga 84 P paxP R gacctttcgtctctGTCTcaCATTttctttaggtagttttagttaaatcgaggaaagaga 85 paxPCDS paxP frag1 F cgatgtacgtctcaCTCGAATGgatctatccgatttccacatctc 86 paxP frag1 R ggatagcgtctcaCTCTgtctcaaacttgaagtcatag 87 paxP frag2 F gctttacgtctcaAGAGcacaaggaaagaccgaagaatct 88 paxP frag2 R gacctttcgtctctGTCTcaAAGCttacgcctttgtagcccgac 89 paxPUTRterm T paxP F cgatgtacgtctcaCTCGGCTTatagggatacgttgccggtc 90 T paxP R gacctttcgtctctGTCTcaAGCGgagcatggattacaattttgcgag 91 paxQProUTR P paxQ F cgatgtacgtctcaCTCGGGAGtctctaggatagatctggcctttggt 92 P paxQ R gacctttcgtctctGTCTcaCATTcttgcgatagattctaacgaagg 93 paxQCDS paxQ frag1 F cgatgtacgtctcaCTCGAATGgatttcgtgttatcagccttac 94 paxQ frag1 R gcattgcgtctcaAGAGcgatgaaggagtgcag 95 paxQ frag2 F gcacttcgtctcaCTCTcgaaagttgcaggtaattaactg 96 paxQ frag2 R gcatgacgtctcaACCTgtctcaaagcaaggcagctc 97 paxQ frag3 F cgtcatcgtctcaAGGTgcaagagttgtcgcac 98 paxQ frag3 R gcatgacgtctcaAGGCctcgtcgctagctcaaataaac 99 paxQ frag4 F gcacttcgtctcaGCCTgagtatgtcgagcctctg 100 paxQ frag4 R gacctttcgtctctGTCTcaAAGCtcatgccgagacagactttctg 101 paxQUTRterm T paxQ F cgatgtacgtctcaCTCGGCTTagggaaatttggaaatagattacactc 102 T paxQ R gacctttcgtctctGTCTcaAGCGtctagtttcaaattcgctgggttg 103 trpCProUTR P trpC frag1 F cgatgtacgtctcaCTCGGGAGgaattcatgccagttgttcccag 104 P trpC frag1 R cgatgtacgtctcaGCTTggccgactcgctg 105 P trpC frag2 F cacctttcgtctccAAGCagacgtgaagcaggacgg 106 P trpC frag2 R cgatgtcgtctcgCAGAccattgcacaagcctc 107 P trpC frag3 F gacctttcgtctcgTCTGcgcatggatcgctgc 108 P trpC frag3 R gacctttcgtctctGTCTcaCATTtcgatgcttgggtagaataggtaag 109 trpCUTRterm T trpC frag1 F cgatgtacgtctcaCTCGGCTTgatccacttaacgttactgaaatcatcaaac 110 T trpC frag1 R gacctttcgtctctCTGCttgatctcgtctgccga 111 T trpC frag2 F cgatgtacgtctcaGCAGatcaacggtcgtcaacagacc 112 T trpC frag2 R gacctttcgtctctGTCTcaAGCGtctagaaagaaggattacctctaaacaagtgt 113 nptIICDS nptII F cgatgtacgtctcaCTCGAATGattgaacaagatggattgcacg 114 nptII R gacctttcgtctctGTCTcaAAGCctcagaagaactcgtcaagaaggc 115 Cloning TUMs into pML1. The ratio of white to blue colonies represents the total number of each type of colony obtained per Golden Gate reaction, extrapolated from the numbers of colonies obtained per plate. The columns labelled “Correct by restriction pattern” and “Correct by sequencing” show, respectively, the fraction of analysed clones that were correct as determined by either restriction enzyme analysis or by sequencing of the BsmBI assembly junctions. Number of PCR fragments required to Correct by Plasmid assemble the Ratio % restriction Correct by UM class TUM name TUM in pML1 white:blue white pattern sequencing ProUTR paxGProUTR pSK1 1 8640:853 91.0 2/2 2/2 paxMProUTR pSK4 1 7947:533 93.7 2/2 1/1 paxBProUTR pSK7 1 9653:480 95.3 2/2 1/1 paxCProUTR pKV28 1 5227:320 94.2 2/2 1/1 paxPProUTR pSK75 1 10507:213 98.0 2/2 1/1 paxQProUTR pSK76 1 14240:427 97.1 2/2 1/1 trpCProUTR pSK17 3 2027:453 81.7 2/2 2/2 CDS paxGCDS pSK2 4 1947:507 79.3 2/2 2/2 paxMCDS pSK5 2 3840:1173 76.6 2/2 2/2 paxBCDS pSK8 1 4747:587 89.0 2/2 1/1 paxCCDS pSK11 2 4373:1280 77.4 2/2 1/1 paxPCDS pSK69 2 8267:480 94.5 2/2 1/1 paxQCDS pSK71 4 1520:160 90.5 2/2 1/1 nptllCDS pSK16 1 4800:747 86.5 2/2 2/2 UTRterm paxGUTRterm pSK3 1 6667:427 94.0 2/2 1/1 paxMUTRterm pSK6 2 5973:587 91.1 2/2 2/2 paxBUTRterm pSK9 1 7093:693 91.1 2/2 2/2 paxCUTRterm pSK12 1 9653:1387 87.4 2/2 1/1 paxPUTRterm pSK70 1 12587:213 98.3 2/2 1/1 paxQUTRterm pSK72 1 13172:373 97.2 2/2 1/1 trpCUTRterm pSK15 2 5120:373 93.2 2/2 1/1 Level-1 TUM libraries in pML1. This table represents the information from Table 8 in a form that shows the cloned TUMs categorised into libraries, and shows the 4 nucleotide addresses flanking each TUM. [GGAG] [AATG] [GCTT] [CGCT] ProUTR modules CDS modules UTRterm modules Plasmid Plasmid Plasmid name Description name Description name Description pSK1 paxGProUTR pSK2 paxGCDS pSK3 paxGUTRterm pSK4 paxMProUTR pSK5 paxMCDS pSK6 paxMUTRterm pSK7 paxBProUTR pSK8 paxBCDS pSK9 paxBUTRterm pKV28 paxCProUTR pSK11 paxCCDS pSK12 paxCUTRterm pSK75 paxPProUTR pSK69 paxPCDS pSK70 paxPUTRterm pSK76 paxQProUTR pSK71 paxQCDS pSK72 paxQUTRterm pSK17 trpCProUTR pSK16 nptIICDS pSK15 trpCUTRterm Assembly of TUs in pML2 shuttle vectors. The table shows the Level-1 entry clones and pML2 shuttle vectors used to assemble TUs. The names of the Level-2 entry plasmids produced are shown in the grey shaded column. TUs assembled using the native promoters and terminators are annotated using the name of the CDS they contain; in all other cases, the promoter-CDS-terminator structure of the TU is elaborated. TU orientation is shown by the arrowhead. The column labelled “KanRcfus” represents the total number of kanamycin resistant colonies obtained per Golden Gate reaction, extrapolated from the number of colonies obtained per plate. The columns labelled “Correct by restriction pattern” and “Correct by sequencing” show, respectively, the fraction of analysed clones that were correct as determined by either restriction enzyme analysis or by sequencing of the BsaI assembly junctions. Level-1 entry clones Correct by used for TU assembly pML2 shuttle Level-2 entry clones KanR restriction Correct by TU ProUTR CDS UTRterm vector Name Description cfus pattern sequencing paxG pSK1 pSK2 pSK3 pML2(+)BR pSK21 paxG:pML2(+)BR 3720 2/2 1/1 pSK7 pSK2 pSK3 pML2(+)BR pSK47 (TpaxG-paxG-PpaxB):pML2(+)BR 3880 2/2 1/1 paxM pSK4 pSK5 pSK6 pML2(+)WR pSK22 paxM:pML2(+)WR 3680 2/2 1/1 pML2(+)BR pRB1 paxM:pML2(+)BR 5040 2/2 1/1 paxB pSK7 pSK8 pSK9 pML2(+)BR pSK23 paxB:pML2(+)BR 9400 2/2 1/1 paxC pKV28 pSK11 pSK12 pML2(+)BF pKV29 paxC :pML2(+)BF 7360 2/2 1/1 pKV28 pSK11 pSK12 pML2(+)WF pSK59 paxC :pML2(+)WF 4880 2/2 1/1 pSK17 pSK11 pSK15 pML2(+)WF pSK61 (PtrpC-paxC-TtrpC) :pML2(+)WF 9840 2/2 1/1 paxP pSK75 pSK69 pSK70 pML2(+)BR pSK73 paxP:pML2(+)BR 9400 1/2 1/1 paxQ pSK76 pSK71 pSK72 pML2(+)WR pSK74 paxQ:pML2(+)WR 11200 2/2 1/1 nptll pSK17 pSK16 pSK15 pML2(+)WF pSK26 (PtrpC-nptll-TtrpC) :pML2(+)WF 5440 2/2 1/1 Multigene assemblies. The table shows the Level-2 entry clones and Level-3 destination vectors used to construct the multigene plasmids. The names of the plasmids produced during each cycle of Level-3 assembly are shown in the grey shaded column. TUs are annotated with the name of the CDS they contain. TU orientation is shown by the arrowhead. Golden Plasmid Level-2 entry clone Destination Gate Product Level-3 plasmid size Step Name Description vector reaction Name Description (kb) 1 pSK26 (PtrpC-nptll-TtrpC) :pML2(+)WF pML3 AarI pSK33 pML3:nptll 5.6 2 pSK21 paxG:pML2(+)BR pSK33 BsmBI pSK34 pML3:nptll : paxG 8.2 3 pSK22 paxM:pML2(+)WR pSK34 AarI pSK36 pML3:nptll : paxG: paxM 11.5 4 pSK23 paxB:pML2(+)BR pSK36 BsmBI pSK37 pML3:nptll : paxG: paxM: paxB 14.1 5 pSK59 paxC :pML2(+)WF pSK37 AarI pSK64 pML3:nptll : paxG: paxM: paxBpaxC 16.3 5 pSK61 (PtrpC-paxC-TtrpC) :pML2(+)WF pSK37 AarI pSK63 pML3:nptll : paxG: paxM: paxBpaxC 16.9 6 pSK73 paxP:pML2(+)BR pSK64 BsmBI pSK78 pML3:nptll : paxG: paxM: paxB: 21.1 paxC : paxP 7 pSK74 paxQ:pML2(+)WR pSK78 AarI pSK79 pML3:nptll : paxG: paxM: paxB: 25.2 paxC : paxP: paxQ 2 pRB1 paxM:pML2(+)BR pSK33 BsmBI pRB3 pML3:nptll : paxM 9.4 2 pKV29 paxC :pML2(+)BF pSK33 BsmBI pKV30 pML3:nptll :paxC 8.4 2 pSK47 (TpaxG-paxG-PpaxB):pML2(+)BR pSK33 BsmBI pSK52 pML3:nptll : paxG 8.7 Multigene assembly data. The table presents the efficiencies of assembly of the multigene plasmids shown in Table 11. The first four columns are reproduced from Table 11. BsmBI-mediated assemblies were performed in T4 DNA Ligase buffer, as per conventional Golden Gate reactions. AarI-mediated assembly reactions were performed in either T4 DNA Ligase buffer, or in AarI restriction enzyme buffer supplemented with ATP. The ratio of white to blue colonies represents the total number of each type of colony obtained per Golden Gate reaction, extrapolated from the numbers of colonies obtained per plate, with the column labelled “Colony type (%)” showing the proportion (%) of colonies of the desired colour that were obtained from each Golden Gate reaction. The column labelled “Correct” shows the fraction of analysed clones that were correct as determined by restriction enzyme analysis. Assembly reaction Assembly reaction performed in performed in restriction ligase buffer enzyme buffer + ATP Golden Plasmid Colony Colony Gate Product Level-3 lasmid size Ratio type Ratio type reaction Name Description (kb) White:blue (%) White:blue (%) Correct AarI pSK33 pML3:nptll 5.6 68800:21760 White (76) 94667:533 White (99.4) 2/2 BsmBI pSK34 pML3:nptll : paxG 8.2 0:89600 Blue (100) — — 2/2 AarI pSK36 pML3:nptll : paxG: paxM 11.5 31680:8960 White (78) 74133:2933 White (96.2) 2/2 BsmBI pSK37 pML3:nptll : paxG: paxM: paxB 14.1 533:83200 Blue (99.4) — — 2/2 AarI pSK64 pML3:nptll : paxG: paxM: 16.3 20640:800 White (96.3) 86400:267 White (99.7) 2/2 paxB:paxC AarI pSK63 pML3:nptll : paxG: paxM: 16.9 17600:640 White (96.5) 72800:267 White (99.6) 1/2 paxB:paxC BsmBI pSK78 pML3:nptll : paxG: paxM: paxB: 21.1 0:32267 Blue (100) — — 2/2 paxC : paxP AarI pSK79 pML3:nptll : paxG: paxM: paxB: 25.2 3760:2120 White (64) 29067:267 White (99.1) 2/2 paxC : paxP: paxQ BsmBI pRB3 pML3:nptll : paxM 9.4 533:92267 Blue (99.4) — — 2/2 BsmBI pKV30 pML3:nptll :paxC 8.4 267:78400 Blue (99.7) — — 2/2 BsmBI pSK52 pML3:nptll : paxG 8.7 267:70667 Blue (99.6) — — 2/2 Multistep acetonitrile gradient used for LC-MS analysis of fungal extracts. Time % (v/v) of acetonitrile + (minutes) 0.01% (v/v) formic acid 0 50 1 50 15 70 20 95 25 95 28 50 38 50 1H and13C NMR data of paspaline and paxilline recorded in CDCl3. Paspaline Paxilline Position 1H 13C 1H 13C 1 — — — — 2 3.1 85 3.7 83 3 1.7, 1.4 21 — 198 4 1.3, 1.3 37 5.8 119 4a — 36 — 170 4a-Me 4b 1.4 46 — 76 5 1.6, 1.3 21 1.7, 1.8 33 6 1.8, 1.5 25 1.6, 1.8 21 6a 2.7 49 2.7 49 7 2.5, 2.6 29 2.6, 1.9 27 7a — 116 — 115 7b — 125 — 125 8 7.2 118 7.3 118 9 6.9 119 6.9 119 10 6.9 119 6.9 119 11 7.3 112 7.3 112 11a — 140 — 140 12 — — — — 12a — 151 — 153 12b — 53 — 50 12b-Me 12c — 39 — 43 12c-Me 13 1.6, 1.9 31 1.9, 1.9 26 14 1.8, 1.7 25 2.6, 1.7 28 14a 2.9 85 4.8 73 1′ — 71 — 71 2′ 1 27 1.2 26 3′ 1.1 29 1.2 26 hygromycin and geneticin resistance, respectively. Indole diterpene phenotype Source strain Description Paspaline Paxilline (reference) PN2013 Wild type + + Barry Scott, Massey (=ATCC26601) University (43) PN2250 PN2013/Deletion of entire PAX locus − − Barry Scott, Massey (CY2) (ΔPAX); HygR University (44) PN2257 PN2013/ΔpaxM::PglcA-hph-TtrpC; HygR − − Barry Scott, Massey University (33) INDUSTRIAL APPLICATION
REFERENCES


































