Удаляемый пластичный состав, пропускающий ультразвуковые волны, для имитации живых тканей в макетах

Изобретение относится к медицине, в частности к удаляемому пластичному составу, который пропускает ультразвуковые волны, для имитации живых тканей в макетах. Данный пластичный состав включает следующее компоненты: бикарбонат натрия, крахмал, вода дистиллированная, ароматизатор, консерванты, краситель, которые используются в заявленных количествах. Осуществление изобретения позволяет достоверно моделировать живые ткани в макетах, в том числе в виде сохраняющих форму объектов, включая и объемные, которые также можно наполнять жидкостями. Кроме того, возможно проведение объективной оценки правильности выполнения манипуляций с хирургическими и/или диагностическими инструментами обучающегося на макетах органов, в том числе под УЗИ-контролем. 3 з.п. ф-лы, 13 ил., 1 табл., 3 пр.

ABSORBABLE PATCH IMPLANT, PROCEDURE FOR ITS PRODUCTION AND USE

HÄMOKOMPATIBLES KOMPOSITMATERIAL AND ITS PRODUCTION PROCESS

POLYMER/CCERAMIC(S) COMPOUND MATERIALS FOR USE IN MEDICINE PRODUCTS

Vorverbundene mehrschichtige Folie zur Abdeckung einer Knochendefektstelle

The invention relates to a preliminarily bonded multilayer film (1) for covering a bone defect site (2), in particular in the region of a jaw bone, the film (1) comprising at least one shaping molding layer (3) for molding the film (1) onto the bone defect site (2) and at least one cover layer (4, 4a, 4b) for covering the bone defect site (2), the molding layer (3) and the at least one cover layer (4, 4a, 4b) being substantially completely resorbable.

GUIDANCE CATHETER WITH AN SLIDINGABLE INTERIOR COATING

Biocompatible, expansile material and stent

Medical devices containing shape memory polymer compositions

The present invention relates at least in part to surgical devices which comprise a shape 5 memory polymer material composition. Particularly, although not exclusively, the present invention relates to a fixation device e.g. an anchor device e.g. a suture anchor which comprises a shape memory material. Included in the present invention are anchor devices e.g. suture anchors which are formed entirely of a shape memory polymer material. Embodiments of the present invention comprise hybrid suture anchors, particularly suture .0 anchors which are formed from a shape memory polymer material and a non-shape memory material. Methods of securing an anchor in a bone or tissue are also included in the present invention.

POLYMERIC COATINGS AND METHODS FOR CELL ATTACHMENT

The invention provides cell-adherent polymeric coatings for articles, the coating including a synthetic, non-biodegradable polymer having a plurality of pendent amine groups, wherein the polymer is covalently immobilized on the article via latent reactive groups. The invention also provides methods for the long-term attachment of cells using the polymeric coatings.

MEDICAL DEVICES

Endoprostheses including composites, and methods of making the endoprosthesis, are disclosed. The composites include at least a first material and a second material having different chemical compositions from each other.

AMINO ACID-BASED POLY(ESTER UREA) POLYMER MESH FOR HERNIA AND OTHER SOFT TISSUE APPLICATIONS

In one or more embodiments, the present invention is directed to a implantable polymer mesh for use in hernia and other soft tissue repair made using amino acid based poly(ester urea) (PEU) polymers. In some embodiments, the implantable polymer mesh is made using linear or branched L-valine based PEUs and displays mechanical properties similar to poly(propylene) (PP), but with significantly less fibrous capsule formation. In some embodiments, the implantable polymer mesh is made using L-valine-co-L-phenylalanine PEUs. In some embodiments, the implantable polymer mesh is made using these PEUs in a composite with an extracellular matrix (ECM). In various embodiments, these amino acid-based PEU materials can be formed into implantable polymer mesh having a conventional size and shape by a wide variety of techniques including conventional compression molding, vacuum molding, blade coating, flow coating, and/or solvent casting.

LAMINATE

The purpose of the present invention is to provide a laminate that enables improvement in ease of use when the laminate is attached to an adhesion object, and that is also able to inhibit variation in solubility of a water-soluble material layer. Provided by the present invention is a laminate having: a biodegradable material layer that contains an aliphatic polyester portion and has a thickness of 10-500 nm; and a water-soluble material layer that is disposed on at least one surface of the biodegradable material layer, wherein the water-soluble material layer is formed by stacking, from the side closer to the biodegradable material layer, a first layer that contains a water-soluble polymer (a) and has a thickness of 1-20 µm, a fiber structure that contains a water-soluble polymer (b) and has a thickness of 10 µm to 100 mm, and a second layer that contains a water-soluble polymer (c) and has a thickness of 1-20 µm.

MORPHOLOGY PROFILES FOR CONTROL OF AGENT RELEASE RATES FROM POLYMER MATRICES

The present disclosure teaches methods of controlling the release rate of agents from a polymeric matrix that include designing and creating a predetermined initial morphology (IM) profile in a polymeric matrix. The teachings indicate, inter alia, that control over the release rate of agents can provide for an improved control over the administration of agents as well as have an effect upon the mechanical integrity and absorption rate of the polymeric matrix.

GUIDE CATHETER WITH LUBRICIOUS INNER LINER

A catheter shaft is disclosed utilizing perfluoroalkoxy polytetrafluoroethylene (PFA) as a lubricious inner lumen for which to aid the advancement of additional medical devices. PFA possesses adequate lubricity while requiring no special fabricating techniques. Thus, PFA may be processed by conventional melt-extrusion techniques, as well as by injection, compression, rotational transfer, and blow molding processes; optimizing the manufacturability of the lubricious inner lumen. Additionally, the catheter shaft includes portions of the outer tubular member modified through an ablation process. The ablation process selectively removes extruded polymeric material around and between the contours of a braided support layer. In one illustrative embodiment, a portion of the outer layer of the catheter is removed by laser ablation and then refilled by polymeric inserts having various flexibility characteristics.

Monolithic biocompatible implantable laminated materials

Metal foils, wires, and seamless tubes with increased mechanical strength are provided. As opposed to wrought materials that are made of a single metal or alloy, these materials are made of two or more layers forming a laminate structure. Laminate structures are known to increase mechanical strength of sheet materials such as wood and paper products and are used in the area of thin films to increase film hardness, as well as toughness. Laminate metal foils have not been used or developed because the standard metal forming technologies, such as rolling and extrusion, for example, do not lend themselves to the production of laminate structures. Vacuum deposition technologies can be developed to yield laminate metal structures with improved mechanical properties. In addition, laminate structures can be designed to provide special qualities by including layers that have special properties such as superelasticity, shape memory, radio-opacity, corrosion resistance etc. Examples of articles which ...

GUIDE CATHETER WITH LUBRICIOUS INNER LINER

Surgical drape fabric

A moisture vapour transmitting, water impermeable drape fabric which comprises an absorbent layer and a porous layer bonded together by a pressure sensitive adhesive which prevents the passage of bacteria between the two layers and methods for the production thereof and sterile surgical drapes and gowns made therefrom are described.

MEDICAL DEVICES WITH POLYMER/INORGANIC SUBSTRATE COMPOSITES

Improved medical device have an inorganic substrate and a polymer covering at least a portion of the substrate, in which the polymer forms a structure substantially different form the structure of the substrate. Other medical devices include a flexible composite component with an inorganic substrate and a polymer covering at least over a portion of the substrate. The flexible composite component can be bent, at least, about 100 degrees without extending the material beyond its elastic limit. Corresponding methods include applying a polymer onto an inorganic substrate, such that the polymer does not conform to the shape of the substrate.

КОЛЛАГЕНОВЫЙ МАТРИКС ИЛИ ГРАНУЛИРОВАННАЯ СМЕСЬ КОСТНОЗАМЕЩАЮЩЕГО МАТЕРИАЛА

Группа изобретений относится к коллагеновому матриксу для применения в качестве костнозамещающего материала, содержащему коллаген и частицы двухфазного костнозамещающего материала - кальций фосфат/гидроксиапатит (КФ/ГАП), включающего спеченное ядро КФ и замкнутый эпитаксически выращенный слой нанокристаллического ГАП, осажденный на внешней поверхности спеченного ядра КФ, в результате чего эпитаксически выращенные нанокристаллы имеют тот же размер и морфологию, что и костный минерал человека, при этом замкнутый эпитаксически выращенный слой нанокристаллического ГАП, осажденный на внешней поверхности спеченного ядра КФ, имеет однородную шероховатую внешнюю поверхность, включающую плоские кристаллические пластинки, при этом коллагеновый матрикс содержит 60-97 мас.% костнозамещающего материала и 3-40 мас.% коллагена, также относится к способу получения коллагенового матрикса для применения в качестве мастики, включающему диспергирование коллагеновых волокон нативного коллагена с природными ...

Способ моделирования хронической тромбоэмболической легочной гипертензии у крупных животных

Изобретение относится к экспериментальной медицине, а именно кардиологии, пульмонологии. С помощью диагностического катетера выполняют селективную артериографию с введением рентгеноконтрастного препарата в целевые - нижнедолевые и среднедолевые - легочные артерии, кровоснабжающие ткани правого и левого легких. Затем через ранее установленный диагностический катетер вводят микрокатетер и выполняют эмболизацию целевых артерий путем введения неадгезионной рентгеноконтрастной полимерной композиции под контролем рентгеноскопии. Выполняют диагностическое зондировании через каждые две недели в течение трех месяцев. Способ позволяет создать модель хронической тромбоэмболической легочной гипертензии (ХТЛГ), имеющей все функциональные и гистологические признаки, характерные для ХТЛГ у человека. 7 ил., 1 пр.

КОМПОЗИЦИЯ ДЛЯ ЭМБОЛИЗАЦИИ И ГИПЕРТЕРМИИ СОСУДИСТЫХ ОПУХОЛЕЙ

Изобретение относится к медицине, касается новых эмболизирующих средств и раскрывает композицию для эмболизации сосудистых опухолей с последующей гипертермией. Композиция состоит из диметилвинилполисилоксана, олигодиметилсилоксана, олигогидридсилоксана, катализатора и магнитных частиц, при этом она дополнительно содержит 1,3,5,7-тетравинил-1,3,5,7-тетраметилциклотетрасилоксан, в качестве магнитных частиц - наночастицы магнетита, а в качестве катализатора - платина [0]-винилсодержащий комплекс. Использование данной композиции улучшает условия эмболизации сосудов, приводит к надежной остановке кровоснабжения опухолевой ткани и возможности использовать термотерапию опухоли. Композиция может быть использована при лечении онкологических больных методом внутриорганной локальной артериальной окклюзии сосудов опухолей. 1 з.п. ф-лы.

МАТЕРИАЛ ДЛЯ ПРЕДОТВРАЩЕНИЯ ПОЯВЛЕНИЯ СПАЕК

АНТИТРОМБОТИЧЕСКИЙ МЕДИЦИНСКИЙ МАТЕРИАЛ С ПРИМЕНЕНИЕМ НИКЕЛЬ-ТИТАНОВОГО СПЛАВА

КОМПЕНСАТОР ТОЛЩИНЫ ТКАНИ, СОДЕРЖАЩИЙ КОНТРОЛИРУЕМОЕ ВЫСВОБОЖДЕНИЕ И РАСШИРЕНИЕ

... 1. Компенсатор толщины ткани, содержащий:первый слой, содержащий первый биосовместимый материал, герметично охваченный водонепроницаемым материалом; ивторой слой, содержащий второй биосовместимый материал, содержащий по меньшей мере одну капсулу;причем первый биосовместимый материал расширяется при контакте с текучей средой.2. Компенсатор толщины ткани по п. 1, содержащий третий слой, содержащий третий биосовместимый материал, причем первый слой расположен между вторым слоем и третьим слоем.3. Компенсатор толщины ткани по п. 2, в котором каждый из первого слоя и второго слоя содержит контактирующую с тканью поверхность.4. Компенсатор толщины ткани по п. 2 или 3, в котором первый биосовместимый материал, второй биосовместимый материал и третий биосовместимый материал независимо выбраны из альбумина, альгината, углевода, казеина, целлюлозы, хитина, хитозана, коллагена, крови, декстрана, эластина, фибрина, фибриногена, желатина, гепарина, гиалуроновой кислоты, кератина, белка, сыворотки, крахмала ...

Verfahren zur Herstellung einer mehrschichtigen Folie

The invention relates to a method for producing a multilayer film (1) for covering a bone defect site (2). The film (1) comprises at least one substantially completely bioresorbable covering layer (4, 4a, 4b), and the at least one covering layer (4, 4a, 4b) is placed on a thermally deformable and substantially completely bioresorbable molding layer (3). The at least one covering layer (4, 4a, 4b) is connected to the molding layer (3) thermally and/or mechanically, preferably in a compressed manner, wherein - mandrel-like protrusions (20) are arranged on the molding layer (3), the protrusions (20) being pressed into the at least one covering layer (4, 4a, 4b) by the placement of the at least one covering layer (4, 4a, 4b) on the molding layer (3) and/or pushed through the at least one covering layer (4, 4a, 4b), and/or - substantially completely bioresorbable connection devices (21), preferably rivets or pins, are pushed through the molding layer (3) and the at least one covering layer ( ...

BIODEGRADIERBARE SURGICAL IMPLANTS

Enclosure

An enclosure of an active implantable device comprises a composite material which comprises a first layer of a polyetheretherketone film, a second layer of polyetheretherketone film (8) and, sandwiched between, a third layer comprising titanium. The arrangement may be provided in various embodiments such as comprising housing halves (70,72) and a lid (74), each being made of the three layers described. In one embodiment, a communications window may be provided which has a thinner layer of titanium, to facilitate communications between the outside and electrical components positioned within the enclosure.

SELF-SUPPORTING LAMINATED FILMS, STRUCTURAL MATERIALS AND MEDICAL DEVICES

Metal foils, wires, and seamless tubes with increased mechanical strength are provided. As opposed to wrought materials that are made of a single metal or alloy, these materials are made of two or more layers forming a laminate structure. Laminate structures are known to increase mechanical strength of sheet materials such as wood and paper products and are used in the area of thin films to increase film hardness, as well as toughness. Laminate metal foils have not been used or developed because the standard metal forming technologies, such as rolling and extrusion, for example, do not lend themselves to the production of laminate structures. Vacuum deposition technologies can be developed to yield laminate metal structures with improved mechanical properties. In addition, laminate structures can be designed to provide special qualities by including layers that have special properties such as superelasticity, shape memory, radio-opacity, corrosion resistance etc. Examples of articles which ...

POLYMER COATING FOR MEDICAL DEVICES

Coatings are provided in which surfaces may be activated by covalently bonding a combination of silane derivatives (A) to the metal surface, covalently bonding a lactone polymer (B) to the silane derivative by in situ ring opening polymerization, and depositing at least one layer of a polyester (C) on the bonded lactone polymer. Biologically active agents or therapeutic compounds may be deposited with any of the polyester layers. Such coated surfaces may be useful in medical devices, in particular stents.

BIOABSORBABLE FIBERS AND REINFORCED COMPOSITES PRODUCED THEREFROM

This invention relates to bioabsorbable fibers, comprising a semicrystalline fiber-forming core polymer and an amorphous sheath polymer, wherein the core polymer and sheath polymer are separately melt extruded and connected to one another through an adhesive bond. The present invention also relates to reinforced composites of the bioabsorbable fibers, and to devices comprising the reinforced composites. The devices are suitable for in vivo implantation. Some embodiments of the present devices can also support high loads, making then useful for fracture fixation and spinal fusion. The invention also relates to methods of making the various materials of the invention.

적층체

... 본 발명은 피착체로의 부착 시의 취급성을 개선시켜 수용성 재료의 층의 용해성의 불균형을 억제하는 것이 가능한 적층체를 제공하는 것을 목적으로 하고 있다. 본 발명은 지방족 폴리에스테르를 포함하는 두께가 10~500㎚인 생분해성 재료의 층과, 상기 생분해성 재료의 층의 적어도 편면에 배치된 수용성 재료의 층을 갖고, 상기 수용성 재료의 층은 상기 생분해성 재료의 층에 가까운 쪽으로부터 순서대로 수용성 폴리머(a)를 포함하는 두께가 1~20㎛인 제 1 층, 수용성 폴리머(b)를 포함하는 두께가 10㎛~10㎜인 섬유 구조체, 수용성 폴리머(c)를 포함하는 두께가 1~20㎛인 제 2 층이 적층되어 구성되어 있는 적층체를 제공한다.

COMPOSITE IMPLANT

A composite interbody vertebral implant (10) for facilitating fusion of adjacent vertebrae. The implant includes a first endplate (12) of a porous metal material and a second endplate (14) of a porous metal material which are configured to allow bone in-growth. The implant also includes a polymeric body (16) positioned between and bonded to the first and second endplates (12,14) such that polymeric material of the polymeric body (16) is impregnated into pores of the first and second endplates to bond the components together. The implant include a cavity (26) extending through the composite implant (10) configured to receive bone growth material to facilitate fusion between a first vertebra and a second vertebra.

ELECTRODE SENSOR KIT, ELECTRODE ASSEMBLY, AND TOPICAL PREPARATION FOR ESTABLISHING ELECTRICAL CONTACT WITH SKIN, USE THEREOF, AND METHOD OF ELECTRO-IMPEDANCE TOMOGRAPHY (EIT) IMAGING USING THESE

An electrode sensor kit for establishing electrical contact with skin (2) comprises at least one contact element (3) and a preparation (4) comprising a mixture of water and at least one lipid for enhancing electrical contact properties between said contact element (3) and the skin (2), wherein said mixture forms an emulsion, in particular a water-in-oil or an oil-in- water emulsion, having a conductivity of less than 3 mS/ cm (milli-siemens per centimetre), preferably less than 2 mS/cm and most preferably less than 1 mS/ cm. An electrode assembly (1) for electrical impedance tomography which comprises said kit is characterized in that (a) said at least one contact element (3) forms an electrode or sensor plate, and (b) said at least one contact element (3) comprises a layer of said preparation (4). In an electro impedance tomography (EIT) imaging method above electrode sensor kit or electrode assembly is used for performing bio-signal measurements wherein said preparation (4) and said at ...

MEDICAL DEVICE WITH POROUS SURFACE CONTAINING BIOERODABLE BIOACTIVE COMPOSITES

An implantable medical device includes a porous surface with a composite material located within the pores that includes a bioerodable material in combination with a bioactive agent. The composite material is adapted to erode upon exposure to the body of a patient, thus releasing the bioactive agent into the patient, whereas the porous surface remains on the device. In one embodiment, the composite material includes micro- or nano-particles that are deposited within the pores. In a further embodiment, the porous surface is an electrolessly electrochemically deposited material. Certain tie layer and other surface modification aspects are described to enhance various aspects of the bioactive composite surface. The bioactive composite surface is of particular benefit when provided on an endolumenal stent assembly in a manner adapted to elute anti-restenosis or anti-thrombosis agents or combinations thereof.

BIOABSORBABLE STENT

МЕДИЦИНСКИЕ УСТРОЙСТВА, СОДЕРЖАЩИЕ ПОЛИМЕРНЫЕ КОМПОЗИЦИИ С ПАМЯТЬЮ ФОРМЫ

Изобретение относится к области медицины, а именно к лигатурному якорному фиксатору для закрепления в полости в кости, содержащему один или более желобков на по меньшей мере одной своей наружной поверхности и полимер с памятью формы (ППФ), который способен к радиальному расширению при активации так, что лигатурный якорный фиксатор расширяется радиально по меньшей мере на участке своей длины, причем желобок(ки) имеет такой размер, чтобы принимать лигатуру. Изобретение обеспечивает повышение прочности фиксации. 15 з.п. ф-лы, 15 пр., 5 табл., 48 ил.

КОМПОЗИЦИОННЫЙ ГЕМОСОВМЕСТИМЫЙ МАТЕРИАЛ И СПОСОБ ЕГО ПОЛУЧЕНИЯ

Изобретение относится к медицине. Описанный гемосовместимый материал включает в себя прочный и непроницаемый синтетический субстрат, к которому приклеивается биологическая ткань посредством составляющего вещества указанного субстрата, диспергированного в растворителе. 2 н. и 4 з.п. ф-лы.

MEDICAL INSTRUMENTS WITH POLYMER/INORGANIC SUBSTRATE GROUP

Vorverbundene mehrschichtige Folie zur Abdeckung einer Knochendefektstelle

The invention relates to a preliminarily bonded multilayer film (1) for covering a bone defect site (2), in particular in the region of a jaw bone, the film (1) comprising at least one shaping molding layer (3) for molding the film (1) onto the bone defect site (2) and at least one cover layer (4, 4a, 4b) for covering the bone defect site (2), the molding layer (3) and the at least one cover layer (4, 4a, 4b) being substantially completely resorbable.

POLYMERIC/CERAMIC COMPOSITE MATERIALS FOR USE IN MEDICAL DEVICES

POLYMER-CERAMIC COMPOSITE AND METHOD

Methods and devices are shown for a composite material that is easily app lied to a surface such as a bone defect in need of filling or reinforcement, etc. The composite material provides good mechanical properties such as com pressive strength upon curing in the presence of water. Selected materials a nd methods as described are further bioabsorbable with absorption rates that are controllable to provide desired morphology over time. In selected embod iments a pharmaceutical agent further provides benefits such as bone growth, infection resistance, pain management, etc.

DRUG DELIVERY SYSTEM AND METHOD OF MANUFACTURING THEREOF

Medical devices implanted or otherwise used in a mammal are made less prone to trigger adverse reactions by use of gas cluster ion-beam (GCIB) surface modification adhere various drug molecules directly into or onto the surface of medical devices, and optionally building adhered drug layers upon the first adhered layer to obtain a desired drug elution profile. This is accomplished without the need for a polymer or any other binding agent to retain the drug.

DRUG DELIVERY SYSTEM AND METHOD OF MANUFACTURING THEREOF

Medical devices implanted or otherwise used in a mammal are made less prone to trigger adverse reactions by use of gas cluster ion-beam (GCIB) surface modification adhere various drug molecules directly into or onto the surface of medical devices, and optionally building adhered drug layers upon the first adhered layer to obtain a desired drug elution profile. This is accomplished without the need for a polymer or any other binding agent to retain the drug.

코일 색전술용 충전 물질과 그 제조장치 및 제조방법

... 본 발명은 충전 밀도가 우수하여 적은 양으로도 높은 혈류 차단 효과를 발휘할 수 있는 새로운 구조의 코일 색전술용 충전 물질과 그 제조장치 및 제조방법을 제공하기 위한 것이다. 본 발명에 따른 코일 색전술용 충전 물질은, 코일 색전술에 이용되는 코일 색전술용 충전 물질에 있어서, 인체의 동맥에 삽입될 수 있는 크기의 금속 와이어와, 다수의 고분자 나노섬유로 이루어져 금속 와이어를 둘러싸는 고분자 나노섬유 매트를 포함한다. 본 발명에 따른 코일 색전술용 충전 물질은 뇌동맥류 내부로의 주입 및 충전 시 적은 양으로 높은 충전 밀도를 달성할 수 있다. 따라서 종래의 금속 코일에 비해 충전 밀도가 우수하여 적은 양으로도 높은 혈류 차단 효과를 발휘할 수 있다.

SELF-SUPPORTING LAMINATED FILMS, STRUCTURAL MATERIALS AND MEDICAL DEVICES

Metal foils, wires, and seamless tubes with increased mechanical strength are provided. As opposed to wrought materials that are made of a single metal or alloy, these materials are made of two or more layers forming a laminate structure. Laminate structures are known to increase mechanical strength of sheet materials such as wood and paper products and are used in the area of thin films to increase film hardness, as well as toughness. Laminate metal foils have not been used or developed because the standard metal forming technologies, such as rolling and extrusion, for example, do not lend themselves to the production of laminate structures. Vacuum deposition technologies can be developed to yield laminate metal structures with improved mechanical properties. In addition, laminate structures can be designed to provide special qualities by including layers that have special properties such as superelasticity, shape memory, radio-opacity, corrosion resistance etc. Examples of articles which ...

LAMINATED MATERIAL USED FOR MEDICAL LUBRICATING MEMBER, MEDICAL LUBRICATING MEMBER, AND MEDICAL DEVICE

Provided are a laminated material used for a medical lubricating member, including a base material a, and a layer b which is disposed on the base material a and contains a polymer having a polysiloxane structure, in which the polymer contains an acrylic acid component, an acrylic acid ester component, an acrylamide component, and/or a styrene component as a constituent component, and the polymer contains a hydroxy group, a carboxy group, an amino group, an isocyanate group, an oxazoline ring, an epoxy group, a vinyl group, an ethynyl group, a sulfanyl group, an azide group, a trialkoxysilyl group, and/or an acid anhydride structure in a molecule; a medical lubricating member formed of this laminated material; and a medical device using this medical lubricating member.

ANTIBACTERIAL BIOMEDICAL IMPLANTS AND ASSOCIATED MATERIALS, APPARATUS, AND METHODS

Methods for improving the antibacterial characteristics of biomedical implants and related implants manufactured according to such methods. In some implementations, a biomedical implant comprising a silicon nitride ceramic material may be subjected to a surface roughening treatment so as to increase a surface roughness of at least a portion of the biomedical implant to a roughness profile having an arithmetic average of at least about 500 nm Ra. In some implementations, a coating may be applied to a biomedical implant. Such a coating may comprise a silicon nitride ceramic material, and may be applied instead of, or in addition to, the surface roughening treatment process. 1. A method for improving the antibacterial characteristics of a biomedical implant , the method comprising the steps of:providing a biomedical implant comprising a poly-ether-ether-ketone (PEEK) and/or titanium substrate material; andapplying a coating of a silicon nitride material on the biomedical implant by chemical vapor deposition (CVD), physical vapor deposition (PVD), plasma spraying, electro-deposition, electrophoretic deposition, slurry coating, or high-temperature diffusion, wherein the silicon nitride coating has a thickness of 1 μm to 125 μm.2. The method of claim 1 , wherein the silicon nitride material is selected from α-SiN claim 1 , β-SiN claim 1 , β-SiYAlON claim 1 , and combinations thereof.3. The method of claim 2 , wherein the silicon nitride material is β-SiYAlON.4. The method of claim 1 , wherein the coated biomedical implant has increased bacterial resistance as compared to the substrate material alone.5. The method of claim 1 , wherein the biomedical implant comprises an intervertebral spinal implant.6. The method of claim 1 , wherein the biomedical implant comprises PEEK.7. The method of claim 1 , wherein the biomedical implant comprises PEEK and a SiYAlON coating.8. The method of claim 1 , wherein the biomedical implant comprises titanium.9. The method of claim 1 , ...

METAL MATERIAL FOR MEDICAL DEVICE, MANUFACTURING METHOD FOR METAL MATERIAL FOR MEDICAL DEVICE, AND MEDICAL DEVICE

The present disclosure provides a metal material for a medical device, the metal material including a metal layer, and a diamond-like carbon layer provided on the metal layer and containing fluorine and silicon.

Аппарат внешней фиксации

Полезная модель относится к медицине, конкретно - к травматологии и ортопедии. Используется для лечения переломов и деформаций костей.Сущность полезной модели заключается в совокупности существенных признаков, достаточной для достижения искомого технического результата, состоящего в профилактике развития аллергической реакции на фиксирующие кость спицы и костные винты при использовании аппарата внешней фиксации.Сущность заявляемого устройства состоит в том, что аппарат внешней фиксации имеет кольца, штанги и фиксаторы, в которых крепятся спицы и костные винты, имеющие покрытие из смеси нитридов титана и гафния. Это покрытие является «оболочкой» спицы или костного винта, ограждающей кость пациента от воздействия металла (из которого изготовлена спица). Оно имеет биоинертные свойства и предупреждает развитие аллергии и реакции отторжения. 3 ил.

Способ получения композиционного материала "Ti-Nb-Ta-Zr - полигликолидлактид с введенным лекарственным препаратом"

Изобретение относится к способу получения композиционного материала «Ti-Nb-Ta-Zr полигликолидлактид с введенным лекарственным препаратом» для кава-фильтров, применяемых в эндоваскулярной профилактике тромбоэмболии легочной артерии, и может быть использовано в медицине. Предложенный способ включает растворение полимера в хлороформе, добавление лекарственного средства, окунание проволоки из сплава TiNbTaZr в полученный раствор и сушку покрытия в течение 2-х суток на воздухе при 37°С в термостате и отличается тем, что для растворения используется Поли(гликолид-D,L-лактида) с соотношением 30/70 молекулярной массой от 45 до 180 кДа из расчета от 2 до 10 г на 200 мл хлороформа, в качестве лекарственного средства используются пуролаза или стрептокиназа с концентрацией от 1 до 5% вес. Предложен новый эффективный способ получения композиционного материала на основе проволоки TiNbTaZr с поверхностным полимерным слоем, содержащим лекарственный препарат, для кава-фильтров, применяемых в эндоваскулярной ...

Magnetresonanzkompatible Implantate aus einer Gold-Kupfer Legierung

Resorbierbares Patch-Implantat, Verfahren zu seiner Herstellung und Verwendung

Die Erfindung bezieht sich auf das Gebiet der Medizin, der Chemie, der Textiltechnik und der Verfahrenstechnik und betrifft resorbierbare Patch-Implantate, ein Verfahren zu ihrer Herstellung und ihre Verwendung in der Medizin. DOLLAR A Die Aufgabe der Erfindung besteht darin, ein Patch-Implantat aus Poly(3-hydroxybuttersäure) und/oder ihren Blends und/oder ihren Copolyestern mit neuen Eigenschaften bezüglich Funktionalität und veränderter Degradationskinetik anzugeben. DOLLAR A Gelöst wird die Aufgabe durch ein resorbierbares Patch-Implantat aus strukturierten textilen Flächengebilden oder Folien und strukturierten textilen Flächengebilden aus Poy(3-hydroxybuttersäure) und/oder ihren Blends und/oder ihren Copolyestern. DOLLAR A Die Aufgabe wird weiterhin gelöst durch ein Verfahren bei dem aus Poly(3-hydroxybuttersäure) und/oder ihren Blends und/oder ihren Copolyestern textile Flächengebilde und Folien hergestellt und anschließend auf chemischem und/oder physikalischem Wege an ihren Kontaktflächen ...

Releasing different drugs from a stent after implantation comprises releasing an immediate-action drug in a rapid process and releasing a sustained-action drug in a long-term process

Releasing different drugs from a stent after implantation into a human or animal body comprises releasing an immediate-action drug (D2) in a rapid process and releasing a sustained-action drug (D1) in a long-term process. An independent claim is also included for a stent for implantation into a lumen in a human or animal body, comprising a sustained-action drug (D1) releasably held in a base layer and an immediate-action drug (D2) releasably held in an additional drug layer, where D1 is released over a longer period than D2. ACTIVITY : Vulnerary; Vasotropic; Anticoagulant; Antiinflammatory; Cytostatic; Immunosuppressant. MECHANISM OF ACTION : Integrin Antagonist; Thrombocyte Aggregation Inhibitor; Migration Inhibitor; Prolyl Hydroxylase Inhibitor; Protease C Inhibitor.

Enclosure

MEDICAL DEVICES

Verfahren zur Herstellung einer mehrschichtigen Folie

The invention relates to a method for producing a multilayer film (1) for covering a bone defect site (2). The film (1) comprises at least one substantially completely bioresorbable covering layer (4, 4a, 4b), and the at least one covering layer (4, 4a, 4b) is placed on a thermally deformable and substantially completely bioresorbable molding layer (3). The at least one covering layer (4, 4a, 4b) is connected to the molding layer (3) thermally and/or mechanically, preferably in a compressed manner, wherein - mandrel-like protrusions (20) are arranged on the molding layer (3), the protrusions (20) being pressed into the at least one covering layer (4, 4a, 4b) by the placement of the at least one covering layer (4, 4a, 4b) on the molding layer (3) and/or pushed through the at least one covering layer (4, 4a, 4b), and/or - substantially completely bioresorbable connection devices (21), preferably rivets or pins, are pushed through the molding layer (3) and the at least one covering layer ( ...

Biocompatible coated implant

POLYMER COATING FOR MEDICAL DEVICES

Coatings are provided in which surfaces may be activated by covalently bo nding a combination ofsilane derivatives (A) to the metal surface, covalentl y bonding a lactone polymer (B) to the silane derivative by in situ ring ope ning polymerization, and depositing at least one layer of a polyester (C) on the bonded lactone polymer. Biologically active agents or therapeutic compo unds may be deposited with any of the polyester layers. Such coated surfaces may be useful in medical devices, in particular stents.

A LAMINATE WITH A BIODEGRADABLE LAYER

The purpose of the present invention is to provide a laminate that enables improvement in ease of use when the laminate is attached to an adhesion object, and that is also able to inhibit variation in solubility of a water-soluble material layer. Provided by the present invention is a laminate having: a biodegradable material layer that contains an aliphatic polyester portion and has a thickness of 10-500 nm; and a water-soluble material layer that is disposed on at least one surface of the biodegradable material layer, wherein the water-soluble material layer is formed by stacking, from the side closer to the biodegradable material layer, a first layer that contains a water-soluble polymer (a) and has a thickness of 1-20 µm, a fiber structure that contains a water-soluble polymer (b) and has a thickness of 10 µm to 100 mm, and a second layer that contains a water-soluble polymer (c) and has a thickness of 1-20 µm.

COMPOSITE LUMEN WITH REINFORCING TEXTILE AND MATRIX

A composite hollow lumen and a method for producing the lumen are provided. The lumen includes a tubular textile formed of yarns having a first tensile strength and a matrix material in which the tubular textile is embedded to form a conduit having a bore and a sidewall substantially impermeable to liquid. The matrix material has a second tensile strength that is lower than the first tensile strength. The method for producing a composite lumen includes selecting yarns having a first tensile strength, selecting an elastomeric matrix material having a second tensile strength that is lower that the first tensile strength, forming a tubular textile of the yarns, and embedding the tubular textile in the matrix material to form a conduit having a bore and conduit walls that are substantially impermeable to liquid. The elastomeric matrix material is a biodegradable or bioresorbable polyester.

CONTROLLED RESORPTION OF MEDICAL IMPLANTS

The resorption of a medical implant can be controlled with the use of particles embedded in a resorbable bulk material forming the implant or portion thereof. The implant can be removed from a body of a mammal by natural biological mechanisms after use. The resorption of the implant can involve swelling and/or hydrolyzing of the particles within the implant upon contact with a body fluid such that porosity and flow of fluid within the bulk material of the implant is increased. Resorption of the implant may also involve the use of particles with magnetic properties embedded within the implant such that an applied magnetic field causes the particles to vibrate within the bulk material thereby increasing the porosity and thus the flow of fluid, hence facilitating resorption of the implant. The resorption rate of the implant can be controlled by modulating swelling, hydrolysis, or movement of the embedded particles.

Progenitor endothelial cell capturing with a drug eluting implantable medical device

A medical device for implantation into vessels or luminal structures within the body is provided, which stimulates positive blood vessel remodeling. The medical device, such as a stent and a synthetic graft, is coated with a pharmaceutical composition consisting of a controlled-release matrix and one or more pharmaceutical substances for direct delivery of drugs to surrounding tissues. The coating on the medical device further comprises a ligand such as a peptide, an antibody or a small molecule for capturing progenitor endothelial cells in the blood contacting surface of the device for restoring an endothelium at the site of injury. In particular, the drug-coated stents are for use, for example, in balloon angioplasty procedures for preventing or inhibiting restenosis.

Crosslinked silane coating for medical devices

Coatings are provided in which surfaces may be activated by covalently bonding a combination of silane derivatives (A) to the metal surface, covalently bonding a lactone polymer (B) to the silane derivative by in situ ring opening polymerization, and depositing at least one layer of a polyester (C) on the bonded lactone polymer. Biologically active agents or therapeutic compounds may be deposited with any of the polyester layers. Such coated surfaces may be useful in medical devices, in particular stents.

MEDICAL DEVICES CONTAINING SHAPE MEMORY POLYMER COMPOSITIONS

The present invention relates at least in part to surgical devices which comprise a shape memory polymer material composition. Particularly, although not exclusively, the present invention relates to a fixation device e.g. an anchor device e.g. a suture anchor which comprises a shape memory material. Included in the present invention are anchor devices e.g. suture anchors which are formed entirely of a shape memory polymer material. Embodiments of the present invention comprise hybrid suture anchors, particularly suture anchors which are formed from a shape memory polymer material and a non-shape memory material. Methods of securing an anchor in a bone or tissue are also included in the present invention.

COATING FILM AND ARTICLE WITH COATING FILM FORMED ON SURFACE

A coating film has a surfactant having a hydrophobic group or a lipophilic group and a hydrophilic group, and a film having holes on a surface thereof capable of carrying the surfactant. The surfactant has the lipophilic group of 5 or more carbon atoms and does not evaporate at room temperature. The film is a porous film. A porosity of the porous film is 5% or more and 60% or less. The surfactant is an abietic acid-based compound. Alternatively, the surfactant is chlorhexidine. A hole diameter of the holes is greater than 10 times as large as a size of a virus.

КОМПЕНСАТОР ТОЛЩИНЫ ТКАНИ, СОДЕРЖАЩИЙ КОНТРОЛИРУЕМОЕ ВЫСВОБОЖДЕНИЕ И РАСШИРЕНИЕ

Группа изобретений относится к области медицины, а именно - хирургии. Компенсатор толщины ткани содержит первый слой, включающий первый биосовместимый материал, герметично охваченный водонепроницаемым материалом, и второй слой, включающий второй биосовместимый материал, содержащий по меньшей мере одну капсулу. При этом первый биосовместимый материал контактирует с текучей средой при разрыве водонепроницаемого материала и расширяется при контакте с текучей средой. Группа изобретений относится также к упору сшивающего устройства и кассете со скобами для сшивающего устройства, содержащим указанный компенсатор толщины ткани. Группа изобретений обеспечивает возможность компенсировать более тонкую и/или более толстую ткань, а также позволяет применять сжимающее давление к ткани независимо от толщины ткани, захваченной хирургическим инструментом. 3 н. и 9 з.п. ф-лы, 211 ил.

СПОСОБ ПОЛУЧЕНИЯ НАНОСТРУКТУРИРОВАННОГО КОМПОЗИЦИОННОГО ЭЛЕКТРОПРОВОДЯЩЕГО ПОКРЫТИЯ

Изобретение относится к области биомедицинской техники. Описан способ получения наноструктурированного композиционного электропроводящего покрытия, включающий нанесение ультрадисперсионной суспензии из карбоксиметилцеллюлозы и углеродных нанотрубок на подложку, затем суспензию облучают лазером до полного высыхания в непрерывном режиме длиной волны генерации 0,81-1,06 мкм, интенсивностью облучения 0,1-2 Вт/см, время облучения 10-100 с, и высохший материал подвергают термообработке путем его отжига в воздухе при температурах 40-150°С в течение 30 мин. Достигается повышение удельной электропроводности покрытия более чем в 50 раз при совместном проведении воздействия лазерного излучения и термической обработки. 1 табл., 1 пр.

МЕДИЦИНСКИЕ УСТРОЙСТВА, СОДЕРЖАЩИЕ ПОЛИМЕРНЫЕ КОМПОЗИЦИИ С ПАМЯТЬЮ ФОРМЫ

... 1. Фиксирующее устройство для закрепления самого фиксирующего устройства и/или сопряженного устройства в полости, при этом фиксирующее устройство включает полимер с памятью формы (ППФ), причем ППФ способен к радиальному расширению при активации таким образом, что фиксирующее устройство расширяется радиально на расстояние, по меньшей мере сопоставимое с собственной длиной.2. Фиксирующее устройство по п. 1, отличающееся тем, что оно выбирается из спицы, винта, стержня, штифта, пластины, якоря и клина.3. Фиксирующее устройство по п. 2, отличающееся тем, что оно представляет собой лигатурный якорный фиксатор и служит для фиксации в полости в кости.4. Фиксирующее устройство по п. 3, отличающееся тем, что оно способно расширяться в радиальном направлении и сокращаться в продольном направлении и/или изменять свою геометрическую форму при активации ППФ-материала.5. Фиксирующее устройство по п. 3, отличающееся тем, что лигатурный якорный фиксатор включает корпус якоря, имеющий дистальную часть и ...

Medical devices containing shape memory polymer compositions

The present invention relates at least in part to surgical devices whichcomprise a shape memory polymer material composition. Particularly, although not exclusively, the present invention relates to a fixation device e.g. an anchor device e.g. a suture anchor which comprises a shape memory material. Included in the present invention are anchor devices e.g. suture anchors which are formed entirely of a shape memory polymer material. Embodiments of the present invention comprise hybrid suture anchors, particularly suture anchors which are formed from a shape memory polymer material and a non-shape memory material. Methods of securing an anchor in a bone or tissue are also included in the present invention.

Laminate

SURGICAL PLATE

... - Plaque chirurgicale implantable dans l'organisme. - Selon l'invention, la plaque est composée d'un ensemble multicouches comprenant un polymère fluoré (1) et une couche textile (2) assemblés à l'aide d'une couche de polymère (3) à base de silicone. - Applications : patch neurologiques, plaques d'éventration, plaques de hernies, etc.

BIOMEDICAL IMPLANTABLE MATERIALS

The invention relates to the incorporation of bone-growth reactive compounds and anti-infection agents upon the surface of an implantable polymeric material to enhance the biological properties of the resultant multifunctional composite material. To this end, supercritical carbon dioxide was used to plasticise the surface of the polymer and permit the incorporation of bone-bonding compounds and anti-microbial compounds to the structure of the implants. Nanodiamond particles and a Tea Tree Oil- derived compound, terpinen-4-ol, were used to enhance the bone bonding and antimicrobial properties of the implants, respectively.

SELF-SUPPORTING LAMINATED FILMS, STRUCTURAL MATERIALS AND MEDICAL DEVICES MANUFACTURED THEREFROM AND METHODS OF MAKING SAME

Metal foils, wires, and seamless tubes with increased mechanical strength are provided. As opposed to wrought materials that are made of a single metal or alloy, these materials are made of two or more layers forming a laminate structure. Laminate structures are known to increase mechanical strength of sheet materials such as wood and paper products and are used in the area of thin films to increase film hardness, as well as toughness. Laminate metal foils have not been used or developed because the standard metal forming technologies, such as rolling and extrusion, for example, do not lend themselves to the production of laminate structures. Vacuum deposition technologies can be developed to yield laminate metal structures with improved mechanical properties. In addition, laminate structures can be designed to provide special qualities by including layers that have special properties such as superelasticity, shape memory, radio-opacity, corrosion resistance etc. Examples of articles which ...

MEDICAL DEVICES WITH POLYMER/INORGANIC SUBSTRATE COMPOSITES

Improved medical device have an inorganic substrate and a polymer covering at least a portion of the substrate, in which the polymer forms a structure substantially different form the structure of the substrate. Other medical devices include a flexible composite component with an inorganic substrate and a polymer covering at least over a portion of the substrate. The flexible composite component can be bent, at least, about 100 degrees without extending the material beyond its elastic limit. Corresponding methods include applying a polymer onto an inorganic substrate, such that the polymer does not conform to the shape of the substrate.

BIOABSORBABLE STENT WITH RADIOPAQUE LAYER AND METHOD OF FABRICATION

Embodiments of a stent and methods of fabricating the same with a bioabsorbable radiopaque layer are disclosed.

Self-supporting laminated films, structural materials and medical devices manufactured therefrom and methods of making same

Metal foils, wires, and seamless tubes with increased mechanical strength are provided. As opposed to wrought materials that are made of a single metal or alloy, these materials are made of two or more layers forming a laminate structure. Laminate structures are known to increase mechanical strength of sheet materials such as wood and paper products and are used in the area of thin films to increase film hardness, as well as toughness. Laminate metal foils have not been used or developed because the standard metal forming technologies, such as rolling and extrusion, for example, do not lend themselves to the production of laminate structures.

PROCESS FOR COATING A BIOMEDICAL IMPLANT WITH A BIOCOMPATIBLE POLYMER AND A BIOMEDICAL IMPLANT THEREFROM

The present invention disclosed a process to coat the surface of flexible polymeric implant with biocompatible polymer such that the coating does not crack when the implant is subjected to mechanical forces such as tension, torsion or bending while retaining the inherent properties of the coated polymer. 1. A process for obtaining an implant with a biocompatible polymer coating , said process comprising:(a) dipping the implant in a solution of biocompatible polymer to obtain an implant with a dip coating; and 'wherein, fibres of the biocompatible polymer are partially embedded into the dip coating, and said coating remains intact/independent of cracks/tears even after application of mechanical forces selected from the group consisting of bending, tensile stress, compression, and torsion.', '(b) immediately electrospinning the same polymer onto the implant with dip coating of step (a) to obtain an implant with a biocompatible polymer coating;'}2. The process as claimed in claim 1 , wherein said biocompatible polymer is selected from the group consisting of silk fibroin claim 1 , polylactic acid (PLA) claim 1 , poly ε-caprolactone (PCL) claim 1 , and collagen.3. The process as claimed in claim 2 , wherein said biocompatible polymer is silk fibroin.4. The process as claimed in claim 1 , wherein said implant is made up of a material selected from the group consisting of metal claim 1 , polymer claim 1 , ceramic claim 1 , and composites thereof.5. The process as claimed in claim 3 , wherein said metal is titanium.6. The process as claimed in claim 3 , wherein said polymer is polydimethylsiloxane (PDMS) or polyethylene.7. The process as claimed in claim 3 , wherein said ceramic is hydroxyapatite.8. The process as claimed in claim 1 , wherein said implant is selected from the group consisting of breast implant claim 1 , ocular implant claim 1 , cardiovascular stent claim 1 , and catheter tube.9. The process as claimed in claim 1 , wherein said implant is in a form selected ...

Симулятор кожи и способ его изготовления

Группа изобретений относится к средствам обучения в медицине. Симулятор кожи человека для отработки хирургических навыков содержит соединенные друг с другом параллельные слои, внутренний из которых выполнен из силикона, имитирует мышечную ткань и используется в качестве основания, промежуточный имитирует подкожно-жировую клетчатку, а покрытие имитирует кожный покров. Покрытие состоит из двух слоев, внешний из которых имитирует эпидермис и выполнен из двухкомпонентного силикона на основе платины твердостью 5-10А по Шору, а внутренний имитирует дерму и выполнен из силикона твердостью 0-5А по Шору. Промежуточный слой, имитирующий подкожно-жировую клетчатку, изготовлен из смеси желатина, взятого в количестве из диапазона 5-10 мас. %, глицерина в количестве из диапазона 85-90 мас. % и воды дистиллированной в количестве из диапазона 3,5-5 %, составляя 100 %. Внутренний слой, имитирующий мышечную ткань, выполнен из силикона твердостью 10А по Шору. Раскрыт способ изготовления симулятора кожи человека ...

A method of making biodegradable polymeric implants

Polymer coating for medical devices

Antithrombotic medical material using nickel titanium alloy

MEDICAL ADHESIVES

Improved medical device have an inorganic substrate and a polymer covering at least a portion of the substrate, in which the polymer forms a structure substantially different form the structure of the substrate. Other medical devices include a flexible composite component with an inorganic substrate and a polymer covering at least over a portion of the substrate. The flexible composite component can be bent, at least, about 100 degrees without extending the material beyond its elastic limit. Corresponding methods include applying a polymer onto an inorganic substrate, such that the polymer does not conform to the shape of the substrate.

IMPLANT FOR NON-LUMINAL AREA

A non-luminal area implant with improved corrosion resistance, and a manufacturing method thereof are provided. (1) A magnesium alloy surface having a prescribed shape is fluorinated to form a fluorinated layer and a parylene layer is formed on the fluorinated layer to form this non-luminal area implant, which, on the magnesium alloy surface, has (a) a magnesium fluoride layer and (b) a parylene layer. (2) In a manufacturing method of this non-luminal area implant, (a) a magnesium alloy surface having an arbitrary shape is fluorinated to form a magnesium fluoride layer, and thereafter, (b) a para-xylylene resin is vapor deposited on the magnesium fluoride layer to form the parylene layer.

SURFACE-MODIFIED MAGNESIUM ALLOY

Provided are: a magnesium alloy of which the surface is modified so as to improve the corrosion resistance of the magnesium alloy; and a method for manufacturing the magnesium alloy. (1) A surface-modified magnesium alloy comprising a magnesium alloy having an arbitrary shape, a magnesium fluoride layer formed by fluorinating the surface of the magnesium alloy, and diamond-like carbon layer formed on the magnesium fluoride layer. (2) A method for manufacturing a surface-modified magnesium alloy, the method comprising: fluorinating the surface of a magnesium alloy having an arbitrary shape to form a magnesium fluoride layer on the surface of the magnesium alloy; placing the magnesium alloy having the magnesium fluoride layer formed thereon in a high-frequency plasma CVD device; and introducing a raw material gas containing carbon into the device to form diamond-like carbon layer on the magnesium fluoride layer.

ANTITHROMBOTIC MEDICAL MATERIAL USING NICKEL TITANIUM ALLOY

The purpose of the present invention is to provide a medical material using a nickel titanium alloy which reduces the thickness of a polymer electrolyte while supporting an antithrombotic compound in an amount sufficient to create a therapeutic effect. The present invention provides a medical material wherein a nickel titanium alloy has a porous surface and allows a polymer electrolyte to infiltrate the pores, thereby reducing the thickness of the polymer electrolyte exposed at the surface of the nickel titanium alloy and supporting a sufficient amount of an antithrombotic compound as a result of the contribution of the infiltrated polymer electrolyte.

DRUG DELIVERY SYSTEM AND METHOD OF MANUFACTURING THEREOF

Medical devices implanted or otherwise used in a mammal are made less prone to trigger adverse reactions by use of gas cluster ion-beam (GCIB) surface modification adhere various drug molecules directly into or onto the surface of medical devices, and optionally building adhered drug layers upon the first adhered layer to obtain a desired drug elution profile. This is accomplished without the need for a polymer or any other binding agent to retain the drug.

INTERNAL CLAMP FOR SURGICAL PROCEDURES

One aspect of the present invention relates to a method of occluding a vascular site in a mammal, comprising the step of introducing into the vasculature of a mammal at or proximal to a surgical site, a composition comprising at least one optionally purified inverse thermosensitive polymer, wherein said inverse thermosensitive polymer gels in said vasculature, thereby temporarily occluding a vascular site of said mammal, wherein said temporarily occluded vasculature site is kept in a substantially cylindrical shape.

IMPLANTABLE BIOCOMPATIBLE DEVICES AND METHODS FOR THEIR MANUFACTURE

Implantable biocompatible devices such as synthetic prosthetic heart valves are disclosed. The trileaflet aortic heart valve design has three valve leaflets supported on a frame. The leaflets are made up of a number of layers, each layer being formed by drying a layer of polymer solution in a preferred shape, different to the preferred shape of other layers. This allows the valve to have different configurations in which one or more of the layers are in a minimal stress configuration. This can provide the leaflets with improved flexibility. Furthermore, a partially open valve configuration is described, providing the valve with upstream bulge portions in the sub-commissural regions of the valve, allowing improved opening and washout of the valve. Still further, a method of manufacturing the valve is disclosed, in which a layer of the valve is distended in order to apply a layer of porous material by electrostatic spinning.

Surgical patch

Flexible surgical plate especially neurosurgical plate or retention plate e.g. for eventrations or inguinal hernias A flexible surgical plate comprises an exterior textile or extruded grid layer coated with a non-adherent surface. A flexible multilayer surgical plate, with a biological tissue adhesion promoting surface and a non-adherent surface, comprises an exterior layer of a woven, knitted or nonwoven macro-porous textile or an extruded grid (excluding uniform perforated material) coated with a non-adherent surface. An Independent claim is also included for production of a flexible surgical plate by (a) preparing a solution of 600 g/l silicone dispersed in 1,1,1-trichloroethane; (b) dipping a glass and Teflon (RTM) composite sheet in the solution to obtain a continuous 300 mu silicone film; (c) applying the sheet onto a textile; and (d) curing the silicone at 150 degrees C before or after removal of the composite sheet to leave the silicone film on the textile.

Device for introducing catheter into human or animal vessel for use in nuclear spin tomography has metal wire front section and main section of plastics inert to magnetic resonance

Device for introducing a catheter into human or animal vessels for use in nuclear spin tomography consists of a metal wire front section and a main section of plastics inert to MR (magnetic resonance).

Medical guide wire suitable for nuclear spin tomography, has one or more electrically non-conductive cables embedded in plastics that encloses guide wire

The guide wire is enclosed in a plastics in which one or more electrically non-conductive cables (5) are embedded. Typically, the guide wire is 1.20 m long, with a metal core (3) at the distal end, e.g. made of nickel titanium. The main part, which is 1.10 m long comprises an electrically non-conductive core, e.g. made of glass fiber.

Non-thrombogenic implantable devices

Self-supporting laminated films, structural materials and medical devices manufactured therefrom and methods of making same

Medical devices containing shape memory polymer compositions

The present invention relates at least in part to surgical devices whichcomprise a shape memory polymer material composition. Particularly, although not exclusively, the present invention relates to a fixation device e.g. an anchor device e.g. a suture anchor which comprises a shape memory material. Included in the present invention are anchor devices e.g. suture anchors which are formed entirely of a shape memory polymer material. Embodiments of the present invention comprise hybrid suture anchors, particularly suture anchors which are formed from a shape memory polymer material and a non-shape memory material. Methods of securing an anchor in a bone or tissue are also included in the present invention.

Amino acid-based poly(ester urea) polymer mesh for hernia and other soft tissue applications

In one or more embodiments, the present invention is directed to a implantable polymer mesh for use in hernia and other soft tissue repair made using amino acid based poly(ester urea) (PEU) polymers. In some embodiments, the implantable polymer mesh is made using linear or branched ...

GUIDE CATHETER WITH LUBRICIOUS INNER LINER

BIOCOMPATIBLE ARTICLE

The invention relates to an object, especially an implant, comprising a substrate which is at least partially coated with at least one layer and on which a substance containing protein, peptide and/or saccharide is at least partially deposited. The layer directly adjacent to the substance contains at least one metal selected among titanium, zirconium and hafnium or contains a compound thereof having one or more non-metals and/or semiconductors, or an alloy thereof with one or more other metals, and said layer is deposited using a vacuum coating method. The invention also relates to a method for producing the object, during which the layer is deposited on the substrate under vacuum, and relates to the use of said object.

COMPOSITE HEMOCOMPATIBLE MATERIAL AND METHOD FOR ITS PRODUCTION

Selon l'invention, le matériau hémocompatible comporte un substrat synthétique, résistant et étanche, auquel adhère un tissu biologique grâce à une dispersion de la matière constitutive dudit substrat dans un solvant.

Orthopaedic splinting system

A composite material in the form of a linear structure having a width, a length and a thickness, comprising a composite material with a first component formed by a polymer and a second component formed by a reinforcing material, wherein the first component comprises a thermoplastic polymer selected from the group of biodegradable polymers and mixtures thereof, and the second component comprises a woody material derived from platy or granular wood particles. The composite material being formable at a temperature of about 50 to 70° C. and it can be used as a blank for an orthopedic splint.

Method of producing composite materials

The invention relates to a method for making light-weight dimensionally stable wood-thermoplastic composite material composed of wood chips and a thermoplastic polycaprolactone. The manufacturing process of composite material comprising the steps of compounding virgin materials with single-screw extruder and production of uniform homogeneous plate-like composite with calendering apparatus. The calendering process comprises of several cycles, folding, cooling and reheating steps. During the gentle manufacturing process fragile wood chips maintain their 3-D structural properties in polymer matrix resulting light, mechanically strong wood-plastic composite.

Heterogeneous Yarns For Surgical Articles

Heterogeneous yarns containing strands of dissimilar materials are useful in forming surgical device.

Methods for fabricating polymer-bioceramic composite implantable medical devices

Methods relating to polymer-bioceramic composite implantable medical devices are disclosed.

Biodegradable Drug Eluting stent Pattern

In embodiment, pattern for polymeric radially expandable implantable medical devices such as stents for implantation into a bodily lumen are disclosed.

Drug delivery system and method of manufacturing thereof

In one embodiment, a drug delivery system and method provide a member including a combination of a drug substance and a polymer or other material, and an encapsulating layer formed in an outer surface of the member by gas cluster ion beam irradiation of the outer surface of the member, which encapsulating layer is adapted to determine one or more characteristics of the drug delivery system.

Method of making polymer-bioceramic composite implantable medical devices

Methods and devices relating to polymer-bioceramic composite implantable medical devices are disclosed.

Modified starch material of biocompatible hemostasis

A modified starch material for biocompatible hemostasis, biocompatible adhesion prevention, tissue healing promotion, absorbable surgical wound sealing and tissue bonding, when applied as a biocompatible modified starch to the tissue of animals. The modified starch material produces hemostasis, reduces bleeding of the wound, extravasation of blood and tissue exudation, preserves the wound surface or the wound in relative wetness or dryness, inhibits the growth of bacteria and inflammatory response, minimizes tissue inflammation, and relieves patient pain. Any excess modified starch not involved in hemostatic activity is readily dissolved and rinsed away through saline irrigation during operation. After treatment of surgical wounds, combat wounds, trauma and emergency wounds, the modified starch hemostatic material is rapidly absorbed by the body without the complications associated with gauze and bandage removal.

Bioabsorbable polymer, non-bioabsorbable metal composite stents

Biocompatible materials may be configured into any number of implantable medical devices including intraluminal stents. The biocompatible material may comprise metallic and non-metallic materials in hybrid structures. In one such structure, a device may be fabricated with one or more elements having an inner metallic frame that is not degradable with an outer shell formed from a polymeric material that is biodegradable by extrusion blow molding. Additionally, therapeutic agents may be incorporated into the microstructure or the bulk material.

IMPLANTABLE POLYMERIC DEVICE FOR SUSTAINED RELEASE OF BUPRENORPHINE

The present invention provides compositions, methods, and kits for treatment of opiate addiction and pain. The invention provides a biocompatible nonerodible polymeric device which releases buprenorphine continuously with generally linear release kinetics for extended periods of time. Buprenorphine is released through pores that open to the surface of the polymeric matrix in which it is encapsulated. The device may be administered subcutaneously to an individual in need of continuous treatment with buprenorphine. 155-. (canceled)56. A method for treating opioid addiction in a human in need thereof , the method comprising subcutaneously implanting into the human at least one implantable device comprising buprenorphine and a polymer matrix , wherein the buprenorphine is released from the implantable device at a rate that results in a therapeutically-effective plasma level in the human of about 0.1 ng/ml to about 70 ng/ml.57. The method of claim 56 , wherein the plasma level of buprenorphine ranges from 0.1 ng/ml to 0.5 ng/ml.58. The method of claim 56 , wherein the plasma level of buprenorphine ranges from 4 ng/ml to 70 ng/ml.59. The method of claim 56 , wherein the rate of buprenorphine release is associated with the porosity of the polymer matrix.60. The method of claim 56 , wherein the polymer is non-erodable.61. The method of claim 56 , wherein the polymer comprises ethylene vinyl acetate.62. The method of claim 56 , wherein the device releases a therapeutically effective level of buprenorphine for at least 3 months.63. The method of claim 56 , wherein the buprenorphine is a pharmaceutically-acceptable salt.64. The method of claim 56 , wherein the buprenorphine is buprenorphine hydrochloride.66. The device of claim 65 , wherein the rate of release is associated with a porosity of the polymer matrix.67. The device of claim 65 , wherein the device further comprises a hydrophobic coating.68. The device of claim 65 , wherein the polymer comprises ethylene vinyl ...

Articles Including Expanded Polytetrafluoroethylene Membranes with Serpentine Fibrils and Having a Discontinuous Fluoropolymer Layer Thereon

Articles comprising an expanded polytetrafluoroethylene membrane having serpentine fibrils and having a discontinuous coating of a fluoropolymer thereon are provided. The fluoropolymer may be located at least partially in the pores of the expanded fluoropolymer membrane. In exemplary embodiments, the fluoropolymer is fluorinated ethylene propylene. The application of a tensile force at least partially straightens the serpentine fibrils, thereby elongating the article. The expanded polytetrafluoroethylene membrane may include a microstructure of substantially only fibrils. The articles can be elongated to a predetermined point at which further elongation is inhibited by a dramatic increase in stiffness. In one embodiment, the articles are used to form a covered stent device that requires little force to distend in the radial direction to a first diameter but is highly resistant to further distension to a second diameter (stop point). A large increase in diameter can advantageously be achieved prior to reaching the stop point.

Wound care system and bacteridical methods and devices

A variety of article and systems including wound care systems, methods for making the wound care systems, bactericidal, and methods for treating wounds using these systems are disclosed. The wound care systems may include a first material comprising one or more fibers or porous media. The one or more fibers or porous media may be coated with a second material that is capable of inhibiting the growth of bacteria and killing the bacteria to render the wound care system sterile, increasing the absorbency of the first material, or both upon exposure to light. The first material may be cotton, or any suitable fibrous material, the second material may be TiO 2 , and the light may be UV or visible light. A variety of methods including ALD may be used to coat the first material.

Biodegradable ocular implant

The present invention relates to a biodegradable ocular implant for sustained drug delivery, comprising a first layer comprising a first biodegradable polymer, wherein the first layer contains a drug dispersed or dissolved therein. A multi-layered biodegradable ocular implant is also disclosed.

Bioactive Scaffold for Therapeutic and Adhesion Prevention Applications

A device for inhibiting adhesion of apposing human body tissue layers includes a scaffold having a designated mean pore size, relative density, and degradation half-life. The scaffold may be operably positioned between apposing tissue layers, such as proximate adhesiogenic layers at a wound site, so as to permit remesothelialization of the tissue without formation of fibrous adhesions. The scaffold device of the invention inhibits adhesion formation by promoting contractile cell migration away from the wound site for a predetermined period of time. The invention further relates to device and methods for promoting internal tissue regeneration, and for provision and/or dispensation of therapeutic and/or diagnostic agents in vivo.

Rod shaped body and medical device

The present invention relates to a medical device. In particular, the present invention concerns a medical device which can be detected by means of magnetic resonance imaging (MRI).

PROGENITOR ENDOTHELIAL CELL CAPTURING WITH A DRUG ELUTING IMPLANTABLE MEDICAL DEVICE

A medical device for implantation into vessels or luminal structures within the body is provided, which stimulates positive blood vessel remodeling. The medical device, such as a stent and a synthetic graft, is coated with a pharmaceutical composition consisting of a controlled-release matrix and one or more pharmaceutical substances for direct delivery of drugs to surrounding tissues. The coating on the medical device further comprises a ligand such as a peptide, an antibody or a small molecule for capturing progenitor endothelial cells in the blood contacting surface of the device for restoring an endothelium at the site of injury. In particular, the drug-coated stents are for use, for example, in balloon angioplasty procedures for preventing or inhibiting restenosis. 1. An implantable medical device having a luminal surface and a coating; wherein the coating comprises one or more layers of a non-polymer matrix; one or more pharmaceutical substances , and a ligand attached to said matrix and configured to capture circulating progenitor cells on the luminal surface of said device after implantation of said medical device into a patient.2. The implantable medical device of claim 1 , wherein the medical device is a stent claim 1 , a vascular graft claim 1 , a synthetic graft claim 1 , a heart valve claim 1 , a catheter claim 1 , a vascular prosthetic filter claim 1 , a pacemaker claim 1 , a pacemaker lead claim 1 , a defibrillator claim 1 , a patent foramen ovate (PFO) septal closure device claim 1 , a vascular clip claim 1 , a vascular aneurysm occluder claim 1 , a hemodialysis graft claim 1 , a hemodialysis catheter claim 1 , an atrioventricular shunt claim 1 , an aortic aneurysm graft device or components claim 1 , a venous valve claim 1 , a sensor claim 1 , a suture claim 1 , a vascular anastomosis clip claim 1 , an indwelling venous or arterial catheter claim 1 , a vascular sheath and a drug delivery port.3. The implantable medical device of claim 1 , wherein ...

Resorbable Bioceramic Compositions of Poly-4-Hydroxybutyrate and Copolymers

Compositions for making implants comprising high levels of resorbable bioceramics have been developed. These compositions comprise P4HB and copolymers thereof filled with bioceramics, and can be prepared with high levels of bioceramic without the compositions becoming too brittle for the intended application. A preferred embodiment comprises P4HB filled with β-TCP. 1. A biocompatible composition comprising poly-4-hydroxybutyrate polymer or copolymer thereof , wherein the poly-4-hydroxybutyrate polymer or copolymer has a weight average molecular weight between 1 ,000 and 800 ,000 Da , and a resorbable bioceramic comprising up to 70% by weight or 50% by volume of the composition.2. The composition of wherein the bioceramic is α-tricalcium phosphate (TCP) claim 1 , β-TCP claim 1 , a combination of α- and β-TCP claim 1 , biphasic calcium phosphate (BCP) claim 1 , hydroxylapatite claim 1 , calcium sulfate claim 1 , calcium carbonate claim 1 , or a calcium phosphate salt-based bioceramic.3. The composition of wherein the composition comprises a blend of one or more polymers with poly-4-hydroxybutyrate polymer or copolymer thereof.4. The composition of wherein the polymers are resorbable.5. The composition of wherein the one or more polymers are derived from glycolic acid claim 4 , glycolide claim 4 , lactic acid claim 4 , lactide claim 4 , p-dioxanone claim 4 , trimethylene carbonate claim 4 , or ε-caprolactone monomers.6. The composition of wherein the polymer is poly-L-lactic acid or poly-DL-lactic acid.7. A medical device comprising a biocompatible composition of claim 1 , wherein the poly-4-hydroxybutyrate polymer or copolymer thereof has a weight average molecular weight between 1 claim 1 ,000 and 800 claim 1 ,000 Da claim 1 , and a resorbable bioceramic comprising up to 70% by weight or 50% by volume of the composition.8. The device of wherein the device is formed by injection molding of the composition claim 7 , extrusion of the composition claim 7 , or by ...

PATCH AND PATCH PREPARATION

The invention provides a patch and a patch preparation having an adhesive layer with a high adhesive force, wherein the hydrophobic adhesive layer does not bloom even when an organic fluid component having high polarity is contained therein. The patch contains a support and an adhesive layer on at least one surface of the support, wherein the adhesive layer contains a synthetic rubber having a viscosity average molecular weight of 500,000-1,600,000, an organic fluid component having high polarity, a tackifier, and magnesium aluminometasilicate. In the patch preparation, the above-mentioned adhesive layer further contains a drug. 1. A patch comprising a support and an adhesive layer on at least one surface of the support , wherein the adhesive layer comprises a synthetic rubber having a viscosity average molecular weight of 500 ,000-1 ,600 ,000 , an organic fluid component having high polarity , a tackifier , and magnesium aluminometasilicate.2. The patch according to claim 1 , wherein the organic fluid component having high polarity has an angle within the range of 20°-80° as calculated by the following formula using an inorganic value and an organic value in an organic conceptual diagram:{'br': None, 'sup': '−1', 'Angle [°]=arctan (organic value/inorganic value)×(180/π)'}3. The patch according to claim 1 , further comprising an organic fluid component having low polarity which shows lower polarity than the organic fluid component having high polarity.4. The patch according to claim 3 , wherein the organic fluid component having low polarity has an angle within the range of 0°-19° as calculated by the following formula and using an inorganic value and an organic value in an organic conceptual diagram:{'br': None, 'sup': '−1', 'Angle [°]=arctan (organic value/inorganic value)×(180/π)'}5. The patch according to claim 3 , wherein the total content of the organic fluid component having high polarity and the organic fluid component having low polarity in the adhesive ...

Method of making polymer-bioceramic composite implantable medical devices

Methods and devices relating to polymer-bioceramic composite implantable medical devices are disclosed.

SILK FIBROIN-BASED MICRONEEDLES AND METHODS OF MAKING THE SAME

A microneedle or microneedle device includes a microneedle body extending from a base to a penetrating tip formed from a silk fibroin based material, which is easy to fabricate and highly biocompatible. The microneedle device can include one or more microneedles mounted to a substrate. The silk fibroin can include active agents to be transported into or across biological barriers such as skin, tissue and cell membranes. The silk fibroin microneedles can be fully or partially biodegradable and/or bioerodible. The silk fibroin is highly stable, affords room temperature storage and is implantable. The silk fibroin structure can be modulated to control the rate of active agent delivery. 1. A microneedle comprising silk fibroin , wherein said microneedle has a base and a penetrating tip , the tip having a dimension ranging from about 50 nm to about 50 μm.2. (canceled)3. The microneedle of claim 1 , further comprising at least one active agent.4. The microneedle of claim 3 , wherein the active agent is selected from the group consisting of proteins claim 3 , peptides claim 3 , antigens claim 3 , immunogens claim 3 , vaccines claim 3 , antibodies or portions thereof claim 3 , antibody-like molecules claim 3 , enzymes claim 3 , nucleic acids claim 3 , siRNA claim 3 , shRNA claim 3 , aptamers claim 3 , viruses claim 3 , bacteria claim 3 , small molecules claim 3 , cells claim 3 , hormones claim 3 , antibiotics claim 3 , therapeutic agents claim 3 , diagnostic agents claim 3 , and any combinations thereof.5. (canceled)6. The microneedle of claim 3 , wherein the active agent retains at least about 30% of its original bioactivity when the microneedle is maintained for at least about 24 hours at a temperature of about room temperature to about 37° C.7. (canceled)8. (canceled)9. (canceled)10. (canceled)11. The microneedle of claim 1 , further comprising one or more biodegradable polymers.12. The microneedle of claim 1 , wherein the microneedle is adapted to degrade at a ...

Bioabsorbable scaffolds made from composites

Bioabsorbable scaffolds made at least in part of a poly(L-lactide)-based composite are disclosed. The composite includes poly(4-hydroxybutyrate) or poly(L-lactide)-b-polycaprolactone block copolymer, which increases the fracture toughness or fracture resistance of the scaffold. The composite can further include bioceramic particles, L-lactide monomer, or both dispersed throughout the composite. The bioceramic particles improve the radial strength and stiffness of the scaffold. The L-lactide monomer is used to control the absorption rate of the scaffold.

COMPOSITE ABSORBABLE/BIODEGRADABLE RINGS FOR CONTROLLED DRUG DELIVERY

A fiber-reinforced composite ring for the controlled release of at least one bioactive agent includes a biocompatible matrix reinforced with absorbable/biodegradable fibers capable of providing the mechanical properties needed for inserting and maintaining the ring in a body cavity for a desired period of time. Such ring system as can be used for the intravaginal, intraperitoneal, and subcutaneous delivery of at least one bioactive agent, including those used as contraceptives, antimicrobial agents, and/or antiviral agents, as well as those for the treatment of cancer. 1. A fiber-reinforced composite ring for the controlled release of at least one bioactive agent comprising a biocompatible matrix reinforced with absorbable/biodegradable fibers capable of providing the mechanical properties needed for inserting and maintaining said ring in a body cavity for a desired period of time. This application is a continuation of U.S. Ser. No. 10/860,677 filed Jun. 3, 2004, which is hereby incorporated by reference in its entirety.This invention deals with a fiber-reinforced composite ring system for the controlled release of one or more bioactive agent(s) at the desired biological sites, which may entail intravaginal, intraperitoneal, and subcutaneous administration of such agent(s). The composite ring system is designed to modulate the bioactive agent(s) release profile as well as the mechanical property of the ring, in part or totally through the controlled degradation of the absorbable components of the composite system.The subject of drug delivery in general was reviewed by McCulloch and Shalaby [Tailored Polymeric Materials for Controlled Delivery Systems, ACS Symposium Series, Vol. 709 (1998)]. Part of this review pertained to the specific subject of intravaginal delivery which was discussed in a separate chapter (Chapter 2), and excerpts therefrom are included in the background information on the clinical effectiveness and attributes of intravaginal drug delivery noted ...

Collagen scaffolds, medical implants with same and methods of use

The subject invention concerns non-degradable three dimensional porous collagen scaffolds and coatings. These scaffolds can be prepared around sensors for implantation into a body. A specific embodiment of the invention concerns implantable glucose sensors. Sensors comprising a collagen scaffold of the invention have improved biocompatibility by minimizing tissue reactions while stimulating angiogenesis. The subject invention also concerns methods for preparing collagen scaffolds of the invention. The subject invention also concerns sensors that have a collagen scaffold of the invention around the exterior of the sensor.

Biocompatible compositions and methods of manufacture

This disclosure describes, in one aspect, a method that generally includes combining a silica precursor and a biocompatible polymer under conditions effective for the silica precursor and the biocompatible polymer to form a gel, at least partially dehydrating the gel, and rehydrating the gel. This disclosure also describes a corneal implant prepared by any embodiment of the general method described herein.

SINGLE-CRYSTAL APATITE NANOWIRES SHEATHED IN GRAPHITIC SHELLS AND SYNTHESIS METHOD THEREOF

Heterogeneous nanowires having a core-shell structure consisting of single-crystal apatite as the core and graphitic layers as the shell and a synthesis method thereof are provided. More specifically, provided is a method capable of producing large amounts of heterogeneous nanowires, composed of graphitic shells and apatite cores, in a reproducible manner, by preparing a substrate including an element corresponding to X of X(YO)Z is a chemical formula for apatite, adding to the substrate a gaseous source containing an element corresponding to Y of the chemical formula, adding thereto a gaseous carbon source, and allowing these reactants to react under optimized synthesis conditions using chemical vapor deposition (CVD), and to a method capable of freely controlling the structure and size of the heterogeneous nanowires and also to heterogeneous nanowires synthesized thereby. 1. Single-crystal apatite nanowires sheathed in graphitic shells , synthesized by i) introducing into a reactor either a material including an element corresponding to X of X(YO)(Z) , which is a chemical formula for apatite , or a substrate containing the material , ii) maintaining the inside of the reactor in a vacuum and supplying a carrier gas to the reactor , iii) increasing the temperature of the reactor to synthesis temperature , iv) supplying reactant gases comprising carbon and phosphorus sources to the reactor and allowing the reactant gases to react with the material or substrate introduced into the reactor in step i) , and v) cooling the reactor to room temperature in a carrier gas atmosphere ,wherein the nanowires have a diameter of 5-20 nm and a length of 100 nm to 5 μm, in which the graphitic shells have a thickness of 0.34-2 nm, and the apatite cores comprise 99-100% of the inner cavity of the graphitic shells.2. The single-crystal apatite nanowires of claim 1 , wherein the substrate includes one or more selected from the group consisting of Ca claim 1 , K claim 1 , Na claim 1 , Sr ...

ELECTRODE SENSOR KIT, ELECTRODE ASSEMBLY, AND TOPICAL PREPARATION FOR ESTABLISHING ELECTRICAL CONTACT WITH SKIN, USE THEREOF, AND METHOD OF ELECTRO-IMPEDANCE TOMOGRAPHY (EIT) IMAGING USING THESE

An electrode sensor kit for establishing electrical contact with skin comprises at least one contact element and a preparation comprising a mixture of water and at least one lipid for enhancing electrical contact properties between said contact element and the skin, wherein said mixture forms an emulsion, in particular a water-in-oil or an oil-in-water emulsion, having a conductivity of less than 3 mS/cm. An electrode assembly for electrical impedance tomography which comprises said kit is characterized in that (a) said at least one contact element forms an electrode or sensor plate, and (b) said at least one contact element comprises a layer of said preparation. 133-. (canceled)34. An electrode sensor kit for establishing electrical contact with skin , comprising:at least one contact element connectable to an analytical instrument;a preparation comprising a mixture of water and at least one lipid for enhancing electrical contact properties between said contact element and skin, the mixture forming an emulsion having a conductivity of less than 1 mS/cm.35. The electrode sensor kit of claim 34 , wherein the preparation further comprises at least an active ingredient selected from the group consisting of hygroscopic substances claim 34 , hydrophilic substances claim 34 , saccharides or polysaccharide claim 34 , polyacrylates claim 34 , panthenol or D-panthenol claim 34 , allantoin claim 34 , aloe vera claim 34 , glycosaminoglycans claim 34 , anionic nonsulfated glycosaminoglycans claim 34 , algae or alginic acid claim 34 , amino acids or proteins claim 34 , and hyaluronic acid or salt.36. The electrode sensor kit of claim 34 , wherein the preparation further comprises at least one alcohol.37. The electrode sensor kit of claim 36 , wherein the at least one alcohol is selected from the group consisting of mono- claim 36 , di- claim 36 , tri- claim 36 , and polyhydroxy alcohols claim 36 , glycerol claim 36 , sorbitol and propylene glycol.38. The electrode sensor kit of ...

POLYMERIC MARKER WITH HIGH RADIOPACITY FOR USE IN MEDICAL DEVICES

High radiopacity is achieved in a polymeric marker by combining a polymeric resin, a powdered radiopaque agent having uniformly shaped particles of a specific particle size distribution and a wetting agent. The method to produce the marker calls for the blending and pelletization of these materials followed by extrusion onto support beading. The resulting supported tubing is subsequently cut to length with the beading still in place. After ejection of the beading remnant the marker is slipped into place on the device to be marked and attached by melt bonding. Marking of a guidewire allows lesions to be measured while the marking of balloon catheters allow the balloon to be properly positioned relative to a lesion. 117-. (canceled)18. A method of radiopaquely marking a medical device , comprising:providing a flexible polymeric radiopaque marker containing greater than 30 volume percent radiopaque particles, wherein such particles have an average diameter of at least 2 microns and a maximum diameter of about 20 microns;accurately positioning said marker on said medical device; andmelt bonding said marker in place.19. The method of claim 18 , further comprising disposing a length of heat shrink tubing about said accurately positioned marker and heating said tubing.20. The method of claim 18 , wherein said radiopaque particles comprise tungsten.21. The method of claim 18 , wherein said medical device comprises a balloon catheter and said marker is positioned on an inner member disposed within an expandable balloon.22. The method of claim 18 , wherein said medical device comprises a guidewire.23. The method of claim 22 , wherein a plurality of said markers are bonded to said guidewire.24. The method of claim 23 , wherein said markers are equally spaced relative to one another so as to function as a ruler under fluoroscopic inspection.25. The method of claim 23 , wherein said guidewire includes a radiopaque feature and wherein said markers are each spaced a preselected ...

SELF-SUPPORTING LAMINATED FILMS, STRUCTURAL MATERIALS AND MEDICAL DEVICES MANUFACTURED THEREFROM AND METHODS OF MAKING SAME

Metal foils, wires, and seamless tubes with increased mechanical strength are provided. As opposed to wrought materials that are made of a single metal or alloy, these materials are made of two or more layers forming a laminate structure. Laminate structures are known to increase mechanical strength of sheet materials such as wood and paper products and are used in the area of thin films to increase film hardness, as well as toughness. Laminate metal foils have not been used or developed because the standard metal forming technologies, such as rolling and extrusion, for example, do not lend themselves to the production of laminate structures. 1. An implantable medical material comprising a self-supporting monolithic structure composed of a plurality of layers of at least one biocompatible metal material , at least one of the plurality of layers consisting of a radiopaque biocompatible material.2. The implantable medical material according to claim 1 , wherein the biocompatible metal material is selected from the group consisting of titanium claim 1 , vanadium claim 1 , aluminum claim 1 , nickel claim 1 , tantalum claim 1 , zirconium claim 1 , chromium claim 1 , silver claim 1 , gold claim 1 , silicon claim 1 , magnesium claim 1 , niobium claim 1 , scandium claim 1 , platinum claim 1 , cobalt claim 1 , palladium claim 1 , manganese claim 1 , molybdenum and alloys thereof claim 1 , zirconium-titanium-tantalum alloys claim 1 , nitinol claim 1 , and stainless steel.3. The implantable medical material according to claim 1 , wherein the plurality of layers further comprise an interface region between adjacent pairs of plurality of layers claim 1 , wherein the interface region is characterized by a local concentration of grain boundaries that is higher than a local concentration of grain boundaries within the biocompatible metal materials of the plurality of layers.4. The implantable medical material according to claim 3 , wherein the interface region further comprises a ...

RADIOPAQUE AND ECHOGENIC COATINGS FOR MEDICAL DEVICES

The present invention discloses methods for producing coatings for medical devices that are both echogenic and radiopaque. 1. A medical device comprising a coating for improving ultrasound visibility , wherein the coating comprises radiopaque materials dispersed within a polymer matrix.2. A medical device of claim 1 , wherein the polymer matrix includes polyurethanes.3. A medical device of claim 1 , wherein the polymer matrix includes polycarbonate-based urethanes.4. A medical device of claim 1 , wherein the polymer includes silicones.5. A medical device of claim 1 , wherein the radiopaque materials include bismuth subcarbonate.6. A medical device of claim 1 , wherein the radiopaque materials include bismuth oxide.7. A medical device of claim 1 , wherein the radiopaque materials include bismuth oxychloride.8. A medical device of claim 1 , wherein the radiopaque materials include barium sulfate.9. A medical device of claim 1 , wherein the coating is prepared by dipping the substrate in the coating solution containing the matrix and the radiopaque materials.10. A medical device of claim 9 , wherein the coating solution contains 0.1-20% (weight to volume) of the combined matrix and radiopaque materials.11. A medical device of claim 9 , wherein the solvent is either tetrahydrofuran claim 9 , dimethylacetamide claim 9 , or a mixture of both.12. A medical device of claim 9 , wherein a multiple dipping process is used to obtain the coating. This application claims priority of U.S. Provisional Patent Application No. 62/630,334, filed Feb. 14, 2018, the entire contents of which are incorporated by reference herein.The present invention discloses methods for producing coatings for medical devices that are both echogenic and radiopaque.Ultrasound has been widely used to guide needle, catheter and guidewire placement and for vascular access, nerve blockade, drainage of pleural or ascitic fluid collections and percutaneous tracheostomy. Ultrasound allows identification of the ...

METHODS AND COMPOSITIONS FOR MANAGING VASCULAR CONDITIONS

This disclosure relates to methods and compositions for managing vascular conditions by targeting microRNA. In certain embodiments, the disclosure relates to antisense, RNA interference, and blocking oligonucleotide therapeutic compositions and uses related thereto. 1. A composition comprising an isolated nucleobase polymer that binds miR-663 (SEQ ID NO: 1) CCUUCCGGCGUCCCAGGCGGGGCGCCGCGGGACCGCCCUCGUGUCUGUGGCG GUGGGAUCCCGCGGCCGUGUUUUCCUGGUGGCCCGGCCAUG wherein the nucleobase polymer binds sufficiently to prevent translation of tissue inhibitor of metalloproteinase 3 in vivo.2. The composition of claim 1 , wherein the nucleobase polymer is a nucleic acid or nucleic acid mimetic that hybridizes to miR-663 (SEQ ID NO: 1).32. The composition of - claims 1 , wherein the nucleobase polymer comprises monomers of phosphodiester claims 1 , phosphorothioate claims 1 , methylphosphonate claims 1 , phosphorodiamidate claims 1 , piperazine phosphorodiamidate claims 1 , ribose claims 1 , 2′-O-methy ribose claims 1 , 2′-O-methoxyethyl ribose claims 1 , 2′-fluororibose claims 1 , deoxyribose claims 1 , 1-(hydroxymethyl)-2 claims 1 ,5-dioxabicyclo[2.2.1]heptan-7-ol claims 1 , P-(2-(hydroxymethyl)morpholino)-N claims 1 ,N-dimethylphosphonamidate claims 1 , morpholin-2-ylmethanol claims 1 , (2-(hydroxymethyl)morpholino) (piperazin-1-yl)phosphinate claims 1 , or peptide nucleic acids and combinations thereof.43. The composition of - claims 1 , wherein the nucleobase polymer is 3′ or 5′ terminally conjugated to a hydrocarbon claims 1 , polyethylene glycol claims 1 , saccharide claims 1 , polysaccharide claims 1 , cell penetrating peptide claims 1 , or combinations thereof.5. The composition of claim 4 , wherein the cells penetrating peptide is a positively charged peptide claim 4 , arginine-rich peptide claim 4 , oligoarginine peptide (7-12) claim 4 , or octa-arginine (R8).65. The composition of - claims 1 , wherein the nucleobase polymer comprises 8 claims 1 , 9 claims 1 , 10 claims 1 , ...

COMPOSITE IMPLANT

A composite interbody vertebral implant for facilitating fusion of adjacent vertebrae. The implant includes a first endplate of a porous metal material and a second endplate of a porous metal material which are configured to allow bone in-growth. The implant also includes a polymeric body positioned between and bonded to the first and second endplates such that polymeric material of the polymeric body is impregnated into pores of the first and second endplates to bond the components together. The implant may include a cavity extending through the composite implant configured to receive bone growth material to facilitate fusion between a first vertebra and a second vertebra. 1. A composite vertebral implant for positioning between adjacent vertebrae , the composite vertebral implant comprising:a ring-like thermoplastic polymeric body having an inner surface and an inner shelf portion, the inner shelf portion having a first ledge surface and a second ledge surface;a first ring-like porous member having a plurality of pores formed therein, the first ring-like porous member having a first surface on a first side of the first ring-like porous member;a second ring-like porous member having a plurality of pores formed therein, the second ring-like porous member having a first surface on a first side of the second ring-like porous member;wherein the first surface of the first-ring like porous member is configured to contact the first ledge surface of the inner shelf portion of the ring-like polymeric body; andwherein the first surface of the second ring-like porous member is configured to contact the second ledge surface of the inner shelf portion of the ring-like polymeric body.2. The composite vertebral implant of claim 1 , wherein the plurality of the pores proximate the first surface of the first ring-like porous member are mechanically connected to a portion of the thermoplastic material proximate the first ledge surface of the inner shelf portion of the ring-like ...

ELECTRODE SENSOR KIT, ELECTRODE ASSEMBLY, AND TOPICAL PREPARATION FOR ESTABLISHING ELECTRICAL CONTACT WITH SKIN, USE THEREOF, AND METHOD OF ELECTRO-IMPEDANCE TOMOGRAPHY (EIT) IMAGING USING THESE

An electrode sensor kit for establishing electrical contact with skin comprises at least one contact element and a preparation comprising a mixture of water and at least one lipid for enhancing electrical contact properties between said contact element and the skin, wherein said mixture forms an emulsion, in particular a water-in-oil or an oil-in-water emulsion, having a conductivity of less than 3 mS/cm. An electrode assembly for electrical impedance tomography which comprises said kit is characterized in that (a) said at least one contact element forms an electrode or sensor plate, and (b) said at least one contact element comprises a layer of said preparation. 133-. (canceled)34. A method of using an electrode sensor for performing biosignal measurements , comprisingapplying at least one contact element connectable to an analytical instrument and a preparation to skin of a test person, the preparation comprising a mixture of water and at least one lipid forming an emulsion having a conductivity of less than 1 mS/cm for enhancing electrical contact properties between the at least one contact element and the skin of the test person, the preparation interposed between the skin of the test person and the at least one contact element.35. The method of claim 34 , further comprising lining up in succession a plurality of contact elements with each contact element spaced apart a distance of 0.5 cm to 10 cm from an adjacent contact element.36. The method of claim 34 , further comprising performing biosignal measurements selected from the group consisting of an EIT-measurement claim 34 , a heart-rate-measurement or an ECG-measurement.37. The method of claim 34 , further comprising forming the mixture into an oil-in-water or water-in-oil emulsion.38. The method of claim 34 , further comprising selecting the preparation with at least one additive selected from a group of functional additives consisting of hyaluronic acid or salt claim 34 , hygroscopic substances claim 34 , ...

POLYMERIC FILMS CONTAINING NANOPARTICLES ENDOWED WITH PHOTO-THERMAL EFFECT AND APPLICATION THEREOF AS THERMAL PATCHES

The present invention relates to thin polymeric films containing nanoparticles with tunable absorption in the visible and near infrared (NIR) region. When these films are irradiated with NIR sources, they show a pronounced photo-thermal effect. Said effect allows a localized temperature increase, which can be controlled both spatially and temporally. Once the irradiation source has been turned off, the temperature returns within a few seconds to the initial value and then raises again as soon as the film is irradiated again. These films can be used as reusable medical devices, with a controllable and reproducible heating profile, in particular thermal or heating patches. 1. Polymeric film containing nanoparticles , said nanoparticles being provided with a photo-thermal effect , which can be induced by irradiation with wavelength between 0.4 μm and 1.2 μm.2. Polymeric film according to claim 1 , wherein said nanoparticles are contained in the film or in part thereof claim 1 , at a concentration between 0.005 and 0.1 nanoparticles/μm.3. Polymeric film according to claim 1 , having thickness between 30 and 200 μm.4. Polymeric film according to claim 1 , wherein said nanoparticles have size between 5 and 100 nm.5. Polymeric film according to claim 1 , wherein said nanoparticles are selected from the group consisting of Gold Nanostars claim 1 , pegylated Gold Nanostars claim 1 , Prussian Blue nanoparticles and mixtures thereof.6. Polymeric film according to claim 1 , having specific absorption rate in the range of 30 [kW/g]≤SAR≤300 [kW/g].7. Polymeric film according to claim 6 , wherein said specific adsorption rate remains substantially constant during a working cycle comprising at least 40 irradiations.8. Polymeric film according to claim 1 , wherein the photo-thermal effect is obtained within 5 s from the beginning of said irradiation and ends within 10 s from the end of said irradiation.9. Polymeric film according to claim 1 , containing a polymer selected from the ...

STIFF AND STRONG HYDROGELS, PRODUCTION METHOD AND USES THEREOF

The present disclosure relates to the development of hydrogels with extreme stiffness and high-strength. In particular, an hydrogel comprising poly(2-hydroxyethyl methacrylate) and graphene material with a specific oxidation degree. The hydrogels of the present disclosure may be used in medicine, veterinary or cosmetic, namely as scaffold, cartilage, intervertebral disc and blood contact device such as: catheters, vascular grafts, heart valves, stents, artificial kidneys, artificial lungs, ventricular assist devices or drug delivery system. Uses in other areas can be envisaged, like in soft robotics, packaging, sealing and sensors. 1. A hydrogel comprising poly(2-hydroxyethyl methacrylate) and at least 1%-5% (w/v) of graphene material , wherein the oxidation degree of the graphene material is between 30-25 (oxygen atomic percentage) ,wherein the multi-layer graphene oxide comprises 2-25 layers, andwherein the lateral size of graphene material varies between 1-4 μm.2. (canceled)3. The hydrogel according to wherein the graphene material is incorporated in the hydrogel.4. (canceled)5. (canceled)6. The hydrogel according to wherein the hydrogel comprises at least 2% (w/v) of graphene material.7. (canceled)8. The hydrogel according to claim 1 , wherein the multi-layer graphene oxide comprises 3-15 layers.9. The hydrogel according to wherein the multi-layer graphene oxide comprises 3-12 layers.10. (canceled)11. The hydrogel according to wherein the lateral size of graphene material varies between 2-4 μm.12. The hydrogel according to further comprising a crosslinking agent.13. The hydrogel according to claim 12 , wherein the amount of crosslinking agent varies between 0-10% (w/w).14. The hydrogel according to wherein the graphene material is obtained by the modified Hummers' method in the case of oxidized graphene material.15. The hydrogel according to claim 3 , wherein the incorporated graphene material is in powder or in a water dispersion.16. The hydrogel according to ...

IRON-BASED ABSORBABLE AND IMPLANTABLE MEDICAL DEVICE AND MANUFACTURING METHOD THEREOF

Provided are an iron-based absorbable and implantable medical device and manufacturing method thereof. The iron-based absorbable and implantable medical device () comprises a substrate (), a degradable polymer layer (), and an anionic surfactant layer () located between the substrate () and the degradable polymer layer (). The anionic surfactant, by using the hydrophobicity thereof, can form a hydrophobic barrier layer in a solution to isolate a surface of the iron-based substrate () from a body fluid environment, thereby avoiding direct contact with an acidic environment resulting from degradation of the degradable polymer layer () at the initial and early stages of implantation, thus preventing severe local corrosion of the iron-based substrate (). 1. An iron-based absorbable and implantable medical device , comprising a substrate and a degradable polymer layer , wherein the implantable medical device further comprises an anionic surfactant layer , with the anionic surfactant layer located between the substrate and the degradable polymer layer.2. The iron-based absorbable and implantable medical device according to claim 1 , wherein the anionic surfactant layer is connected to the substrate by chemical adsorption.3. The iron-based absorbable and implantable medical device according to claim 1 , wherein the anionic surfactant in the anionic surfactant layer comprises a hydrophilic group and hydrophobic chain claim 1 , wherein the hydrophilic group is a polar hydrophilic group claim 1 , and the hydrophobic chain is a non-polar hydrophobic chain.4. The iron-based absorbable and implantable medical device according to claim 3 , wherein the hydrophilic group is selected from at least one of carboxylic acid group claim 3 , sulfate group and sulfonate group.5. The iron-based absorbable and implantable medical device according to claim 3 , wherein the hydrophobic chain comprises a hydrocarbon chain claim 3 , the hydrocarbon chain comprising at least 8 carbon atoms.6. The ...

MEDICAL DEVICE

The disclosed medical device has high visibility on non-woven fabric having a color such as green, blue, or the like, excellent identifiability from other medical devices having a color such as green, blue, or the like, and high surface smoothness. The medical device comprises an elongated body and a resin layer for covering at least a proximal portion of the elongated body, in which the resin layer has a first layer which includes a first fluororesin, titanium oxide, and a dispersant, and a second layer which is formed on the first layer and includes a second fluororesin. The content of the titanium oxide is 30% by weight or more relative to the solid content of the first layer, and an acid value of the dispersant is 20 to 90 mg/KOH. 1. A medical device possessing a proximal-most end , the medical device comprising:an elongated body possessing a distal-most end, a proximal-most end and a distal portion extending from the distal-most end of the elongated body towards the proximal-most end of the elongated body;a first resin layer covering the proximal portion of the elongated body and not covering the distal portion of the elongated body, the first resin layer having a composition that includes a first fluororesin, titanium oxide, and a polymer dispersant that facilitates dispersion of the titanium oxide in the first fluororesin;a second resin layer covering the first resin layer and not covering the distal portion of the elongated body, the second resin layer having a composition that includes a second fluororesin;a content of the titanium oxide in the first resin layer is 30% by weight or more relative to a solid content of the first layer to color so that the proximal part of the medical device is colored, is visible against a colored fabric used in an operating room and is identifiable from other medical devices that are colored; andthe polymer dispersant possessing an acid value that is 20 to 90 mgKOH/g to inhibit reduction of dispersion of the titanium oxide ...

TECHNIQUES TO IMPROVE POLYURETHANE MEMBRANES FOR IMPLANTABLE GLUCOSE SENSORS

The invention provides an implantable membrane for regulating the transport of analytes therethrough that includes a matrix including a first polymer; and a second polymer dispersed throughout the matrix, wherein the second polymer forms a network of microdomains which when hydrated are not observable using photomicroscopy at 400× magnification or less. In one aspect, the homogeneous membrane of the present invention has hydrophilic domains dispersed substantially throughout a hydrophobic matrix to provide an optimum balance between oxygen and glucose transport to an electrochemical glucose sensor. 1. (canceled)2. An implantable device for measuring an analyte m a biological fluid , comprising:an implantable sensor comprising an electrochemically reactive surface; anda membrane disposed over at least a portion of the electrochemically reactive surface, wherein the membrane comprises a domain comprising a first polymer and a second polymer, wherein the first polymer is polyurethane, wherein the second polymer comprises at least one hydrophilic component, wherein at least a portion of the hydrophilic component of the second polymer forms in the domain hydrophilic segments along which the analyte diffuses.3. The implantable device of claim 2 , wherein the second polymer comprises polyethylene oxide.4. The implantable device of claim 3 , wherein polyethylene oxide comprises about 20% by weight of the second polymer.5. The implantable device of claim 3 , wherein the polyethylene oxide has an average molecular weight from 200 to 3 claim 3 ,000 Daltons.6. The implantable device of claim 2 , wherein the hydrophilic segments comprise a network of microdomains.7. The implantable device of claim 6 , wherein the microdomains are not photomicroscopically observable when hydrated at 400× magnification or less.8. The implantable device of claim 6 , wherein the network of are substantially dispersed throughout the matrix.9. The implantable device of claim 2 , wherein the membrane ...

Adhesion prevention agent comprising injectable thermosensitive wood based-oxidized cellulose nanofiber

The present invention provides a method for preparing an injectable thermosensitive hydrogel for preventing adhesion including mixing methyl cellulose, polyethylene glycol, oxidized cellulose nanofibers and carboxymethyl cellulose. The injectable thermosensitive hydrogel for preventing adhesion is a sol at a low temperature and induces rapid gelation upon in vivo implantation due to thermosensitivity. In addition, the hydrogel can be rapidly changed into physical hydrogel without separate additives or chemical reaction during in vivo condition. In addition, the injectable thermosensitive hydrogel for preventing adhesion exhibits excellent biodegradability and biocompatibility, has no cytotoxicity, inhibits in vitro migration of rat bone marrow mesenchymal stem cells (rBMSCs), and exhibits anti-adhesion efficacy in a rat model of sidewall defect-cecum abrasion in vivo, thus being useful as an effective anti-adhesive agent. 1. A method for preparing an injectable thermosensitive hydrogel for preventing adhesion comprising:mixing methyl cellulose, polyethylene glycol, oxidized cellulose nanofibers and carboxymethyl cellulose;adding water to the resulting mixture, followed by heating, to prepare a mix solution; andcooling and stirring the solution to prepare an injectable thermosensitive hydrogel for preventing adhesion.2. The method according to claim 1 , wherein the injectable thermosensitive hydrogel shows a sol-gel transition depending on temperature.3. The method according to claim 1 , wherein the injectable thermosensitive hydrogel is gelled in vivo.4. The method according to claim 1 , wherein oxidized cellulose nanofibers are derived from wood.5. The method according to claim 1 , wherein the methyl cellulose claim 1 , the polyethylene glycol claim 1 , the oxidized cellulose nanofibers and the carboxymethyl cellulose are mixed in a weight ratio of 1 to 3:1:0 to 1:0 to 1.6. The method according to claim 1 , wherein the methyl cellulose claim 1 , the polyethylene ...

DEVICE AND METHOD FOR PREVENTING STENOSIS AT AN ANASTOMOSIS SITE

The present invention relates to treating or preventing stenosis at an anastomosis site. In one embodiment, the present invention is a stent is curved along the longitudinal axis for placement in and adjacent to the graft orifice. In a further embodiment, the stent is drug coated to allow delivery of antivasculoproliferative drugs directly to the vicinity of the graft orifice. In a further embodiment, the stent is expandable by use of an external wire. In another embodiment, the present invention is a kit comprising the specially configured stent together with a sleeve comprising a biocompatible matrix material and a pharmaceutical agent, wherein the sleeve is applied to the external surface of the vessel or graft, resulting in extravascular delivery of a pharmaceutical agent. Methods for treating or preventing stenosis at an anastomosis site by applying the extravascular sleeve and the intravascular stent are also provided. 1109-. (canceled)110. A method for preventing stenosis of a vein , a graft , an artery , a vessel , and an anastomotic orifice at an anastomosis site having an extravascular surface , comprising the steps of:a. Providing a stent comprising a structure defining an essentially tubular body having a tubular wall with a longitudinal axis and a circumferential diameter, the structure being expandable from a contracted configuration to an expanded configuration, wherein the stent is beveled at the edge and curved along the longitudinal axis for placement in the anastomosis site;b. Providing a sleeve comprising a biocompatible matrix material imbibed with a therapeutic agent;c. Applying the sleeve to the extravascular surface of the anastomosis site; andd. Inserting the stent into the vein and the anastomotic orifice of the anastomosis site.111. The method of claim 110 , wherein the therapeutic agent is rapamycin.112. The method of claim 110 , wherein the therapeutic agent is an analogue of rapamycin.113. The method of claim 110 , wherein the ...

HEMOSTATIC COMPOSITIONS AND METHODS OF MAKING AND USING SAME

The disclosure pertains to hemostatic compositions comprising a plurality of nonwoven fibers disposed in a rapidly soluble solid matrix and methods of making and using the same. The compositions may also comprise one or more therapeutic agents. 1. A hemostatic composition comprising: a plurality of nonwoven fibers; a rapidly soluble solid matrix; and one or more therapeutic agents. This application is a continuation of U.S. application Ser. No. 12/872,308, filed Aug. 31, 2010.Heart and vascular disease are major problems in the United States and throughout the world. Conditions such as atherosclerosis result in blood vessels becoming blocked or narrowed. This blockage can result in lack of oxygenation of the heart, which has significant consequences because the heart muscle must be well oxygenated in order to maintain its blood pumping action.Occluded, stenotic, or narrowed blood vessels may be treated with a number of relatively non-invasive medical procedures including percutaneous transluminal angioplasty (PTA), percutaneous transluminal coronary angioplasty (PTCA), and atherectomy. Angioplasty techniques typically involve the use of a balloon catheter. The balloon catheter is advanced over a guidewire such that the balloon is positioned adjacent a stenotic lesion. The balloon is then inflated and the restriction of the vessel is opened. During an atherectomy procedure, the stenotic lesion may be mechanically cut away from the blood vessel wall using an atherectomy catheter.The non-invasive medical procedures identified above typically gain access to the vasculature through an opening formed in the femoral artery. For obvious reasons, once the procedure is completed the opening in the femoral artery will need to be closed. This may include applying direct pressure at the wound site. Alternatively, a device may be used to assist in the closing of the artery.A wide variety of medical devices have been developed for medical use, for example, use in non-invasive ...

Microstructured soft tissue graft

The present disclosure comprises micropatterned fabric, meshes, textiles, and implantable devices which may include having one substrate including a mesh, a second substrate having a microstructured surface, and a fibrous layer disposed therebetween. The fibrous layer comprises a plurality of randomly oriented fibers. The devices having the microstructured surface may include a plurality of first level microfeatures and a plurality of second level microfeatures wherein the plurality of second level microfeatures are disposed hierarchically the first level microfeatures. Also disclosed are methods for making such micropatterned fabric, meshes, textiles, and implantable devices

POLYMERIC TUBES WITH CONTROLLED ORIENTATION

Methods for preparing oriented polymer tubes, such as biodegradable polymer tubes suitable for in vivo use, are provided herein. The disclosed methods provide alternatives to the typical extrusion/expansion methods by which oriented polymeric tubes for such uses are commonly produced. Advantageously, the disclosed methods can provide more homogeneous molecular orientation of crystallizable polymers within the tube walls, which can endow such polymeric tubes with enhanced strength (e.g., resistance to compression) and toughness. 134-. (canceled)35. A multilayered tube , comprising:at least one stretched polymeric material layer; andat least one adhesive material layer,wherein:the at least one stretched polymeric material layer exhibits at least partial molecular orientation;the at least one stretched polymeric material layer and the adhesive material layer are comprised in different layers of the tube;the at least one stretched polymeric material layer comprises at least one crystallizable biodegradable polymeric material; andthe multilayer tube has an orientation profile that is substantially consistent throughout a wall of the multilayered tube.36. The multilayered tube of claim 35 , wherein the at least one stretched polymeric material layer is obtained based at least in part on stretching at least one polymeric material in a manner that increases the at least one polymeric material in a first direction.37. The multilayered tube of claim 36 , wherein the stretching comprises a planar stretching.38. The multilayered tube of claim 36 , wherein the at least one polymeric material is stretched at least ten percent of a maximum stretch ratio corresponding to the at least one polymeric material.39. The multilayered tube of claim 36 , wherein the at least one polymeric material is stretched at least twenty percent of a maximum stretch ratio respectively corresponding to the at least one polymeric material.40. The multilayered tube of claim 35 , wherein:the at least one ...

DEVICES AND COMPOSITIONS AND METHODS OF USE THEREOF

Embodiments of the disclosure relate to devices (e.g., patches, plugs, beams, plates, screws, rods, granules, spacers, cages, discs, tape devices, or other shape determined by the geometry or anatomy of the site of application) and methods of use thereof. 8. The device of any one of - , wherein the device is in the form of a patch , plug , beam , plate , screw , rod , granule , spacer , cage , disc , tape device , or other shape determined by the geometry or anatomy of the site of application.9. The device of any one of - , wherein the three dimensional fiber network material is in the form of a two or three-dimensional grid , lattice , mesh , mat , weave , braid , cloth , fabric , felt , web , open cell foam , sponge , sheet , membrane , cage , or gel.10. The device of any one of - , wherein mean diameter of the three dimensional fiber network material is from about 25 nanometers to about 500 nanometers.11. The device of any one of - , wherein mean diameter of the three dimensional fiber network material is from about 100 micrometers to about 500 micrometers.12. The device of any one of - , wherein mean diameter of the three dimensional fiber network material is from about 1 millimeter to about 5 millimeters.13. The device of any one of - , wherein the three dimensional fiber network comprises a substantially biocompatible or substantially bioresorbable component.14. The device of claim 13 , wherein the biocompatible or bioresorbable component comprises poly(L-lactide) claim 13 , poly(D claim 13 ,L-lactide) claim 13 , poly(glycolide) claim 13 , poly(ε-caprolactone) claim 13 , poly(carbonate) claim 13 , poly(ethylene) claim 13 , poly(teramethylglycolic-acid) claim 13 , poly(dioxanone) claim 13 , poly(hydroxybutyrate) claim 13 , poly(hydroxyvalerate) claim 13 , poly(L-lactide-co-glycolide) claim 13 , poly(glycolide-co-trimethylene-carbonate) claim 13 , poly(glycolide-co-caprolactone) claim 13 , poly(glycolide-co-dioxanone-co-trimethylene-carbonate) claim 13 , poly( ...

Coated Endovascular Intrasaccular Occlusion Device

An endovascular treatment mesh device for closing outpouchings by affixing at least one amorphous hydrogel layer expandable in vivo to any or all surfaces of an expandable body comprising at least one material adapted to close said outpouching in the body. The treatment mesh further includes a telescoping center-support bar disposed therein, the center-support bar having at least two telescoping elements that act as reinforcing extension elements to minimize the risk of collapse. Hydrogel is affixed to the surface of the telescoping elements to inhibit retraction. An embodiment wherein the treatment mesh device is a stent. 1. An endovascular treatment mesh device for closing outpouchings by affixing at least one amorphous hydrogel layer expandable in vivo to any or all surfaces of an expandable body , comprising at least one material adapted to close said outpouching in the body further including a reinforcing extension element ,wherein said reinforcing extension element minimizes risk of collapse, andwherein said reinforcing extension element is a telescoping center-support bar having at least two telescoping elements disposed within said treatment mesh, and wherein said hydrogel affixed to the surface of said at least two telescoping elements inhibits retraction.2. The device of claim 1 , wherein said hydrogel is further deployed upon the inner surface of said endovascular treatment mesh device.3. The device of claim 1 , wherein said hydrogel is impregnated with at least one pharmaceutical compound.4. The device according to claim 3 , for wherein said at least one pharmaceutical compound is configured to be released into the blood at a prescribed dose over a prescribed time.5. The device of claim 1 , wherein said hydrogel is coated upon any surface that is configured to be exposed to blood or a lumen wall of the device.6. The device according to claim 1 , wherein said hydrogel is deployed upon said endovascular treatment mesh device and expands to occlude the ...

COMPOSITE STENT

A biodegradable and/or bioabsorbable composite stent includes a bioabsorbable ceramic material coated with a biodegradable polymeric material. 113.-. (canceled)14. A composite stent comprising:a first layer of bioremovable polymer that is substantially free or completely free of bioremovable ceramic material;a second layer of bioremovable polymer that includes flakes and fibers of bioremovable ceramic material embedded therein;wherein the first and second layers are formed into a composite stent.15. The composite stent of claim 14 , wherein the bioremovable ceramic material includes tricalcium phosphate.16. The composite stent of claim 14 , wherein the bioremovable polymer includes polylactide claim 14 , polyglycolide claim 14 , polycaprolactone claim 14 , and/or copolymers thereof.17. The composite stent of claim 14 , wherein the bioremovable ceramic material includes bioactive glass.18. A composite stent comprising:bioremovable polymer;a plurality of flakes of bioremovable ceramic material included in the bioremovable polymer, the flake having a length and thickness defining an aspect ratio; anda plurality of fibers of bioremovable ceramic material included in the bioremovable polymer;wherein the composite stent has a helical shape; andwherein the composite stent is resilient and resilient properties of the stent cause it to move from a contracted configuration to an expanded configuration.19. A composite stent comprising a plurality of flakes of bioremovable ceramic material embedded in bioremovable polymer claim 14 , the flakes having a length and a thickness defining an aspect ratio claim 14 , a plurality of fibers of bioremovable ceramic material embedded in bioremovable polymer claim 14 , and wherein the bioremovable polymer forms a bioremovable stent.20. The composite stent of claim 19 , wherein at least substantially all of the plurality of bioremovable ceramic fibers are positioned substantially parallel to each other.21. The composite stent of claim 19 , ...

BIOCOMPATIBLE AND BIODEGRADABLE GRADIENT LAYER SYSTEM FOR REGENERATIVE MEDICINE AND FOR TISSUE SUPPORT

The present invention is directed to a biocompatible and preferably biodegradable gradient layer system comprising at least one set of layers comprising a biocompatible and preferably biodegradable cross-linked polymer and at least one biocompatible and preferably biodegradable support layer, wherein a gradient is preferably formed with respect to the mechanical and/or physical properties of one or more layers of the at least one set of layers comprising a biocompatible and biodegradable cross-linked polymer and/or the at least one biocompatible and preferably biodegradable support layer. The at least one support layer preferably comprises a biocompatible and preferably biodegradable meltable polymer and/or a biocompatible and incorporable material. This biocompatible and preferably biodegradable gradient layer system may be used as a biomaterial for regenerative medicine, particularly as a wound dressing or for tissue support. The present invention also provides means utilizing said inventive gradient layer system and methods for producing same. 1. Biocompatible gradient layer system comprising(a) at least one set of layers, comprising fibers of a biocompatible and biodegradable cross-linked polymer,(b) and at least one biocompatible support layer,wherein a gradient is formed by altering the diameter of the polymeric fibers within the at least one set of layers of the inventive gradient layer system, wherein the diameter of the polymeric fibers of the at least one set of layers is between about 1 nm to about 500 μm.2. (canceled)3. Gradient layer system according to claim 1 , wherein the fiber diameter increases or decreases from about 0.0001 μm-to about 2 μm per μm height of the set of layers either within the at least one set of layers or between several sets of layers of the gradient layer system.4. (canceled)5. Gradient layer system according to claim 1 , wherein the biocompatible and biodegradable cross-linked polymer is selected from collagen claim 1 , gelatin ...

Coated orthodontic crimpable auxiliary and method for making the same

An orthodontic crimpable auxiliary, having all or portions of a surface of the crimpable auxiliary configured to contact an archwire after crimping coated with diamond particles in a metal matrix. The metal matrix can be nickel.

THERAPEUTIC VIRAL MICROPARTICLES FOR PROMOTING STENT BIOFUNCTIONALITY AND WOUND HEALING IN VERTEBRATE INDIVIDUALS

The present disclosure provides viral microparticles comprising genetically-engineered baculoviruses (at least partially) embedded in a polymeric matrix for the local delivery of therapeutic nucleic acid molecules to the cells of a vertebrate individual (optionally in combination with a medical implant such as vascular stent platform). The viral microparticles are especially useful for promoting the healing of a wound as well as the repair of a blood vessel and prevent pathological scarring. Also provided herein are processes for making the viral microparticles, pharmaceutical compositions comprising viral microparticles as well as supports comprising the viral microparticles for the locating the viral microparticles in a wound or in the vicinity of a wound. 1. A viral microparticle for the delivery of a recombinant therapeutic nucleic acid molecule to the cells of a vertebrate individual , said viral microparticle comprising:(i) a matrix of biocompatible biodegradable polymers; and(ii) a genetically-engineered baculovirus having a viral genome comprising the recombinant therapeutic nucleic acid molecule,wherein the genetically-engineered baculovirus cannot replicate in the cells of the vertebrate individual.2. The viral microparticle of claim 1 , wherein:(a) the biocompatible biodegradable polymer comprises a polyester; or(b) the viral microparticle of (a), wherein the polyester comprises a poly(lactic-co-glycolic acid).3. (canceled)4. The viral microparticle of claim 1 , wherein the genetically-engineered baculovirus:(a) is from the genera nucleopolyhedrovirus;(b) is a multicapsid virus;{'i': 'Autographa californica', '(c) is from the subtype multicapsid nucleopolyhedrovirus (AcMNPV); or'}(d) is at least partially embedded in the matrix.57.-. (canceled)8. The viral microparticle of claim 1 , wherein:(a) the recombinant nucleic acid molecule encodes a growth factor;(b) the viral microparticle of (a), wherein the growth factor is an angiogenic growth factor; or(c) ...

Bioabsorbable ,oriented, deformable fixation material and plate

A bioabsorbable surgical osteosynthesis plate operable to be secured by at least one fastener through at least one fastener opening formed in the plate to a bone. The plate includes a flat section having first and second surfaces defining a main plane of the plate. The plate includes a polymer material that is oriented multiaxially and is substantially rigid and substantially deformable at a first thermochemical state. In the multiaxially oriented structure of the plate the polymer material is arranged according to at least three different orientation axes along the main plane of the plate as a result of solid state drawing of the plate. The polymer material of the plate has isotropic mechanical tear properties in different directions along the main plane of the plate.

BIO-ABSORBABLE COMPOSITE MATERIALS CONTAINING MAGNESIUM AND MAGNESIUM ALLOYS AS WELL AS IMPLANTS MADE OF SAID COMPOSITES

The invention relates to a composite material that comprises at least one magnesium component, whereby the magnesium component consists of pure magnesium or a magnesium-calcium alloy or a magnesium-calcium-X alloy, whereby X is another biodegradable element. The composite material also contains at least one organic anti-infective agent having a solubility in water at room temperature of less than 10 grams per liter. 1. Composite material comprising at least one magnesium component made of magnesium or a magnesium alloy , and at least one organic anti-infective agent , whereby the solubility of the anti-infective agent in water at room temperature is less than 10 grams per liter.2. Composite material according to claim 1 , wherein the magnesium component consists of pure magnesium or a magnesium-calcium alloy or a magnesium-calcium-X alloy having a calcium content in the range of 1 ppm to 16.2% by weight claim 1 , whereby X is another biodegradable element.3. Composite material according to claim 2 , wherein the magnesium component is a magnesium-calcium alloy having a calcium content of 0.1 to 1.0% by weight.4. Composite material according to claim 1 , wherein the total content of biologically questionable impurity elements of the magnesium component is less than 50 ppm.5. Composite material according to claim 1 , wherein the solubility of the anti-infective agent at 25° C. is <2 g/L of water.6. Composite material according to claim 1 , wherein the anti-infective agent comprises at least one antibiotic selected from the group of aminoglycoside antibiotics claim 1 , lincosamide antibiotics claim 1 , glycopeptide antibiotics claim 1 , polymyxin antibiotics claim 1 , and oxazolidinone antibiotics.7. Composite material according to claim 6 , wherein the antibiotic is a fatty acid salt of the aminoglycoside antibiotics.8. Composite material according to claim 1 , wherein the anti-infective agent comprises at least one antiseptic selected from the group consisting of ...

Implant

The present invention relates to an implant comprising at least two layers made of fibers and bioactive material arranged between said at least two layers, the bioactive material being selected from the group consisting of bioactive glass, hydroxyapatite, tricalciumphosphate and mixtures thereof. In the implant, at least one of the layers is at least mainly formed of a mesh, which is made of glass fibers having a diameter of 3-100 μm, and wherein the mesh size is selected such that the bioactive material is retained within the implant. In addition, the layers are embedded in a matrix made of a resin selected from the group consisting of polyesters, epoxies, acrylates and mixtures thereof, and the layers are attached to each other along the contour of the implant.

NANODIAMOND ELECTROSURGICAL COATING

A coating for an electrosurgical electrode to reduce the potential for sticking of tissue. The coating is an elastomer containing a plurality of diamond particles having an average diameter of between diameter of 0.5 and 500 nanometers and that comprise between 0.1 and 25 percent by weight of the coating. The coating may be formed by reducing a silicone dispersion with xylene, adding the plurality of diamond particles, and agglomerating the plurality of diamond particles through sonification and then applied to the device. The coasting may also be formed by reducing a silicone dispersion with xylene, adding the plurality of diamond particles, and agglomerating the plurality of diamond particles through sonification, and then applied to the device by plasma enhanced vapor deposition. 1. A coating for an electrosurgical electrode , comprising:an elastomer; anda plurality of diamond particles embedded in the elastomer, wherein the plurality of diamond particles have an average diameter of between diameter of 0.5 and 500 nanometers.2. The coating of claim 1 , wherein the plurality of diamond particles have an average diameter of between 3 and 10 nanometers.3. The coating of claim 2 , wherein the plurality of diamond particles comprise between 0.1 and 25 percent by weight of the coating.4. The coating of claim 3 , wherein the plurality of diamond particles comprise ten percent by weight of the coating.5. The coating of claim 4 , wherein the elastomer comprises silicone.6. A method of reducing the likelihood of tissue sticking to a medical device claim 4 , comprising the steps of:preparing a coating containing a plurality of diamond particles; andcoating at least a portion of the electrosurgical device with the coating.7. The method of claim 6 , wherein the plurality of diamond particles have an average diameter of between 3 and 10 nanometers.8. The method of claim 7 , wherein the plurality of diamond particles comprise between 0.1 and 25 percent by weight of the coating. ...

IN-VIVO BIODEGRADABLE MEDICAL IMPLANT COMPRISING A MICROSTRUCTURE ENGINEERED METALLIC MATERIAL

In-vivo biodegradable medical implants, containing at least in part at least partially fine-grained metallic materials provide a strong, tough, stiff and lightweight implant. The in-vivo biodegradable implants are used in a number of stent applications, for fracture fixation, sutures and the like. The in-vivo biodegradable medical implants enable the reduction of implant size and weight and consequently result in reducing the release of implant degradation products into the body. 114-. (canceled)15. A biodegradable medical implant comprising(a) between 0 to 95% by weight or volume of a biodegradable polymeric material;(b) a biodegradable metallic material comprising between 5 and 100% by weight or volume of Fe and/or Zn, wherein between 5 and 100% by weight or volume of-the biodegradable metallic material comprises at least one microstructure selected from the group consisting of an amorphous microstructure, a crystalline microstructure with an average grain size range between 2 nm and 500 nm, and a crystalline microstructure with an average grain size range between 500 nm and 1,000 nm; andsaid biodegradable medical implant having a maximum in vivo total dissolution time of 120 months.16. The biodegradable medical implant according to claim 15 , wherein said biodegradable metallic material comprises at least one alloying addition selected from the group consisting of alkali metals claim 15 , alkaline earth metals claim 15 , Al claim 15 , B claim 15 , C claim 15 , Cu claim 15 , Co claim 15 , H claim 15 , Mo claim 15 , Mn claim 15 , Nb claim 15 , O claim 15 , P claim 15 , S claim 15 , Se claim 15 , Si claim 15 , Ta claim 15 , Ti claim 15 , V claim 15 , and Zr.17. The biodegradable medical implant according to claim 15 , wherein when said biodegradable metallic material comprises the crystalline microstructure claim 15 , said crystalline microstructure comprises at least one property selected from the group consisting of a uniform grain size claim 15 , a graded grain ...

DISINFECTION METHOD AND APPARATUS

Photosensitizers are incorporated into articles, such a personal protective equipment. A method of applying continuous and consistent light includes fitting the articles with light sources and optical fibers to apply light to the areas of the articles incorporated with the photosensitizers. Photosensitizers can be applied to articles by various applicators in either a gel or solution. A gel can be particularly effective when used on hydrophobic surfaces. Photodynamic reactor systems can be used to determine the effective doses of photosensitizers and the light dosimetry which can then be applied for use with the articles. 1. An article that is worn on a person , comprising:a material forming a part of the article that covers a body part, the material is configured to provide protection from microbes; andone or more photosensitizers are incorporated over an area of the material, wherein the one or more photosensitizers generate singlet oxygen by absorbing light of a particular waveband to provide protection from microbes in combination with the material.2. The article of claim 1 , is a personal protective equipment article selected from a mask claim 1 , a glove claim 1 , and a gown.3. The article of claim 1 , further comprising one or more light source incorporated into the article claim 1 , wherein the light source emits a waveband of light absorbed by the one or more photosensitizers.4. The article of claim 3 , wherein the one or more light source includes a lens configured to direct the light onto the area of the material incorporated with the one or more photosensitizers.5. The article of claim 3 , further comprising one or more optical fiber that abuts the light source claim 3 , wherein the optical fiber is an edge-emitting optical light fiber claim 3 , and the edge-emitting optical light fiber emits light over the area of the material incorporated with the one or more photosensitizers.6. The article of claim 3 , further comprising a second light source ...

BONE STABILIZATION DEVICE AND METHOD OF PRODUCTION

The present disclosure discloses a bone stabilization device (also referred to as a bone tape), which includes a composite flexible construct including a rigidifiable biocompatible sheet structure having first and second opposed surfaces. A biocompatible cement is located on the first surface. In use the composite flexible construct is applied to a bone with the cement contacted directly to the bone. The cement is made of a material that, once adhered to the bone, is curable to mechanically and/or ionically bond to the sheet structure and to chemically bond to the bone to achieve a permanent bond. The bone tape allows simultaneous alignment and stabilization of multiple articulated fragments for successful 3D reconstruction of shattered bones. Initial flexibility and translucency provided by the bone tape can facilitate the temporary stabilization and alignment adjustment of multiple fragments, prior to permanent rigid bonding. 1. A bone tape , comprising: a flexible rigidifiable biocompatible sheet structure having first and second opposed surfaces,', 'a biocompatible cement located on said first surface,, 'a composite flexible construct including'}said cement being made of a material that, once said first surface is adhered to bone, forms a permanent bond, andwherein the bone tape has flexibility to allow for alignment and stabilization of multiple bone fragments prior to the flexible rigidifiable biocompatible sheet structure being rigidized, and when rigid, acts to hold the bone fragments fixed with respect to each other.2. (canceled)3. The bone tape according to wherein a main constituent of said biocompatible sheet structure is a biodegradable and/or bioresorbable polymer material and said polymer material is comprised of a polymer containing repeating groups which include any one or a combination of amides claim 1 , peptides claim 1 , urethanes claim 1 , esters claim 1 , carbonates claim 1 , anhydrides claim 1 , ethers claim 1 , and sulphonamides.49-. ( ...

METHODS OF USING WATER-SOLUBLE INORGANIC COMPOUNDS FOR IMPLANTS

A method for controlling generation of biologically desirable voids in a composition placed in proximity to bone or other tissue in a patient by selecting at least one water-soluble inorganic material having a desired particle size and solubility, and mixing the water-soluble inorganic material with at least one poorly-water-soluble or biodegradable matrix material. The matrix material, after it is mixed with the water-soluble inorganic material, is placed into the patient in proximity to tissue so that the water-soluble inorganic material dissolves at a predetermined rate to generate biologically desirable voids in the matrix material into which bone or other tissue can then grow. 1162-. (canceled)163. An implant suitable for placement in a patient , comprising:an implant component having an outer surface;a poorly-water-soluble matrix material having a physically continuous interconnected matrix as a porous structure disposed on at least a portion of the outer surface of the implant component and defining interstices within the porous structure; andwater-soluble inorganic material blended within and attached within at least some of the interstices of the porous structure such that, when the implant is placed in proximity of tissue, the water-soluble inorganic material dissolves at a predetermined rate to generate biological desirable voids within said interstices into which tissue can grow to assist fixation of the implant within the patient.164. The implant according to wherein the poorly-water-soluble implant material includes metallic claim 163 , ceramic claim 163 , or polymeric material.165. The implant according to wherein the implant is a fixation device selected from the group including an external fixator pin claim 163 , a bone screw claim 163 , an artificial joint or an interbody spinal fusion device.166. The implant according to wherein the ceramic material includes at least one of hydroxyapatite claim 164 , tricalcium phosphate or biphasic calcium ...

LOCAL THERMAL ACTUATION OF MATERIAL SURFACES VIA MICRO- AND NANOWIRE HEATING FOR THE PREVENTION OF CELLULAR ATTACHMENT AND BIOLOGICAL FOULING

The invention relates in various embodiments to a composite useful as e.g. a medical implant device, and a method of treating fouling, including biofouling as may occur on an implant. The composite comprises a matrix phase and a patterned phase that comprises an energetically activatable wire intermixed with the matrix phase, the wire when energetically activated, which includes thermal activation, causes modification of at least a portion of the matrix phase to treat fouling that might otherwise occur. The method of treating biofouling may be practiced on a patent while the medical implant of the invention is in situ. 1. A composite comprising:a matrix phase; anda patterned phase comprising an energetically activatable wire intermixed with the matrix phase, the wire when energetically activated causing modification of the matrix phase to treat fouling of the composite.2. The composite of wherein the matrix phase comprises a polymer.3. The composite of wherein the polymer comprises a polyester claim 2 , a polyurethane claim 2 , a polyamide claim 2 , a polyamide block copolymer claim 2 , a polyolefin claim 2 , a silicone; a latex; a polyvinyl chloride claim 2 , a polyimide claim 2 , a polyetheretherketone claim 2 , and combinations thereof.4. The composite of wherein the polymer comprises a fluoropolymer claim 3 , a polycarbonate-based polyurethane claim 3 , a polyether-based polyurethane claim 3 , a polyester-based polyurethane claim 3 , nylon claim 3 , a nylon block copolymer; high-density polyethylene (HDPE) claim 3 , and combinations thereof.5. The composite of wherein the composite is a catheter claim 1 , shunt claim 1 , artificial joint claim 1 , dental implant claim 1 , or cosmetic implant.6. The composite of wherein the patterned phase of the energetically activatable wire comprises at least one nanowire or microwire or combinations thereof comprised of a metal or metal oxide selected from the group consisting of gold claim 1 , silver claim 1 , copper claim 1 ...

IMPLANTABLE POLYMERIC DEVICE FOR SUSTAINED RELEASE OF BUPRENORPHINE

The present invention provides compositions, methods, and kits for treatment of opiate addiction and pain. The invention provides a biocompatible nonerodible polymeric device which releases buprenorphine continuously with generally linear release kinetics for extended periods of time. Buprenorphine is released through pores that open to the surface of the polymeric matrix in which it is encapsulated. The device may be administered subcutaneously to an individual in need of continuous treatment with buprenorphine. 128-. (canceled)29. A method for treatment of pain , comprising administering at least one implantable device subcutaneously , said implantable device comprising buprenorphine and a biocompatible , nonerodible polymeric matrix , wherein said buprenorphine is encapsulated within said matrix ,wherein said at least one implantable devices continuously releases buprenorphine in vivo over a sustained period of time through pores that open to the surface of said matrix at a steady state rate of about 0.1 to about 5 mg per day.30. A method according to claim 29 , wherein said at least one implantable device comprises a multiplicity of individual implantable devices claim 29 , and wherein the combination of said implantable devices continuously releases buprenorphine in vivo over a sustained period of time at a steady state rate of about 0.1 to about 5 mg per day.31. A method according to claim 29 , wherein each of said at least one implantable devices is subcutaneously implanted at a site selected from the group consisting of the upper arm claim 29 , the back claim 29 , and the abdomen.32. A method according to claim 29 , wherein each of said at least one implantable devices comprises EVA.33. A method according to claim 32 , wherein each of said at least one implantable devices comprises about 10 to about 85% buprenorphine.34. A method according to claim 29 , wherein said sustained period of time is at least about 3 months.35. (canceled)36. A kit for use in ...

BIODEGRADABLE POLYMER WITH ENHANCED PHYSICAL PROPERTIES INCLUDING STEREOCOMPLEX ORGANIC FILLER AND METHOD FOR PRODUCING THE SAME

Disclosed is a biodegradable polymer whose physical properties are improved by the presence of a stereocomplex organic filler. According to exemplary embodiments, the biodegradable polymer including a stereocomplex organic filler can find application in various fields, including biodegradable materials and medical materials, where conventional biodegradable polymers are difficult to use due to their inherent problems such as poor heat resistance and low strength. Also disclosed is a method for producing the biodegradable polymer. 12-. (canceled)3. The biodegradable polymer according to claim 8 , wherein the stereocomplex organic filler (A) is prepared by a melting or supercritical fluid process.4. The biodegradable polymer according to claim 8 , wherein the ratio of the content of the poly-L-lactic acid to that of the poly-D-lactic acid is from 2:8 to 8:2.5. The biodegradable polymer according to claim 8 , wherein the stereocomplex organic filler (A) is present in an amount of 0.1 to 5 parts by weight claim 8 , based on 100 parts by weight of the matrix polymer (B).6. The biodegradable polymer according to claim 8 , wherein the stereocomplex organic filler (A) has a size of 0.1 to 250 μm.7. The biodegradable polymer according to claim 8 , wherein the stereocomplex organic filler (A) has a molecular weight of 3 claim 8 ,000 to 500 claim 8 ,000.8. A biodegradable polymer comprising (A) a stereocomplex organic filler and (B) a matrix polymer claim 8 , wherein the stereocomplex organic filter (A) is a poly-L-lactic acid/poly-D-lactic acid composite and further comprises claim 8 , per 100 parts by weight thereof claim 8 , 0.1 to 50 parts by weight of one or more homopolymers selected from the group consisting of polyglycolide claim 8 , polycarbonate and polyethylene terephthalate claim 8 , or a copolymer of the homopolymers; and wherein the matrix polymer (B) is selected from the group consisting of poly-L-lactic acid (PLLA) claim 8 , poly(lactic acid-co-glycolic acid)( ...

MEDICAL IMPLANT

An IM nail is positioned within a medullary canal and secured in position by bone screws. The nail includes bores which engage insert assemblies and engage the screws. Each insert assembly is in two parts. Part includes a head and a narrower neck; and similarly, part includes a head and a narrower neck. A bore extends through the assembly from one side to the other. Part of the assembly is engaged with a nail by insertion into the nail via mouth; and part is engaged with the nail by insertion into the nail via mouth. When in position the parts abut one another and define bore which can receive screws. The nail is made from a polyetheretherketone (PEEK)/carbon fibre composite. Parts of the insert assemblies are produced separately from the nail. They may be produced by injection moulding a polymeric composition comprising PEEK and barium sulphate. 1. A medical implant , the implant comprising a body which comprises a thermoplastic polymer and at least 10 wt % of a fibrous filler , wherein said body includes a first opening for engagement with a fixing means for fixing the body in position in a human or animal body , wherein said implant includes a protection means which is associated with (e.g. engages) said opening , wherein said protection means comprises a thermoplastic polymer and includes no more than 5 wt % of fibres which have a length of greater than 3 mm.2. An implant according to claim 1 , wherein said implant comprises an assembly for stabilising a bone in a human or animal body.3. An implant according to claim 1 , wherein said implant is selected from an intra-medullary nail assembly and a bone plate assembly.4. Any implant according to claim 1 , wherein said protection means includes at least 70 wt % of a first polymeric material and at least 4 wt % of a radiopaque material.6. An implant according to claim 5 , wherein t=1 and v=0.7. An implant according to claim 5 , wherein said first polymeric material includes at least 90 mol% of repeat units of ...

Methods for fabricating polymer-bioceramic composite implantable medical devices

Methods relating to polymer-bioceramic composite implantable medical devices are disclosed.

Polymeric composite materials with antimicrobial and biodegradable properties and uses thereof

A composite material for the production of a medical device having an antiseptic action includes a matrix of alginate in which the complex of iodopovidone is dispersed. The composite material is used particularly for the production of films, micro-capsules, and suture threads with iodine controlled release.

ABRADABLE THERAPEUTIC COATINGS AND DEVICES INCLUDING SUCH COATINGS

A method of reducing surgical site infection (SSI), using a coated medical device having a tissue penetrating surface and an abradable coating on the medical device comprising at least one antimicrobial agent in the coating. 1. A coated medical device , comprising:a tissue penetrating surface; andan abradable coating on the medical device comprising at least one antimicrobial agent in the coating.2. The coated medical device of claim 1 , wherein the abradable coating is a biocompatible polymer and the antimicrobial agent is incorporated with the biocompatible polymer.3. The coated medical device of claim 1 , wherein the biocompatible polymer is not crosslinked and is disposed on the medical device as a sacrificial coating claim 1 , which is subject to depositing on and/or in a tissue upon penetrating the tissue.4. The coated medical device of claim 1 , wherein the abradable coating is coated on only a portion of the medical device.5. The coated medical device of claim 1 , wherein the antimicrobial agent is selected from the group consisting of halogenated hydroxyl ethers claim 1 , acyloxydiphenyl ethers claim 1 , chlorhexidine claim 1 , polyhexamethylene biguanide (PHMB) claim 1 , octenidine claim 1 , silver and combinations thereof.6. The coated medical device of claim 1 , wherein the antimicrobial agent is triclosan.7. The coated medical device of claim 1 , wherein the medical device is a suture needle with an attached suture material.8. The coated medical device of claim 7 , wherein the abradable coating is coated on only a portion of the suture needle.9. The coated medical device of claim 1 , wherein the medical device is a trocar.10. The coated medical device of claim 9 , wherein the abradable coating is coated on only a tissue penetrating portion of the trocar.11. The coated medical device of claim 1 , wherein the biocompatible polymer has an average molecular weight claim 1 , Mw claim 1 , selected to result in abradability of said coating upon passing through ...

FIBER-HYDROGEL COMPOSITE SURGICAL MESHES FOR TISSUE REPAIR

The presently disclosed composition and methods are provided for a hydrogel or nanofiber-hydrogel composite integrated with a surgical scaffold or mesh. A surgical scaffold device comprised of laminar composite is disclosed for the purpose of reducing foreign body response, managing tissue-materials interface, and improving the integration of the surgical mesh with the surrounding tissue of a subject. 153-. (canceled)54. A method for manufacturing a surgical scaffold device comprising a laminar scaffold complex , the method comprising the steps of:a. mixing a hydrogel material with the polymeric fibers in the presence of an effective amount of a crosslinking moiety to form the scaffold complex, wherein at least a portion of the polymeric fibers are cross-linked to the hydrogel material,b. providing the scaffold complex comprising polymeric fibers oriented to comprise a plurality of pores,c. configuring the scaffold complex in a geometry suitable for implantation in an organ or tissue selected from skin, fascia, pleura, dura, pericardium, paratenon, periosteum, perineurium, blood vessel wall, and lymphatic wall; and whereby a surgical scaffold device is manufactured,', 'wherein the polymeric fibers comprise functional groups, wherein the surface density of the functional groups is from about 10 nmole/mg of fibers to about 160 nmole/mg of the fibers,', 'wherein the polymeric fibers comprise a mean diameter of from about 100 nm to about 8000 nm and a mean length of less than about 500 micrometers., 'd. configuring the scaffold complex as a sheet having a first dimension and a second dimension independently at least five times as great in length as a third dimension;'}55. The method of claim 54 , wherein the hydrogel material comprises a hyaluronic acid claim 54 , a functionalized hyaluronic acid claim 54 , a derivative thereof claim 54 , or a combination thereof and the polymeric fibers comprises a polycaprolactone claim 54 , a functionalized polycaprolactone claim 54 ...

CELL ADHESIVE MATERIAL

A cell adhesive substrate comprising a substratum, on a surface of which a peptide group is immobilized, wherein the peptide group comprises a peptide containing 40% or more and 75% or less of one or two or more of basic amino acid residues selected from the group consisting of lysine, arginine and histidine and 25% or more of one or two or more of hydrophobic amino acid residues selected from the group consisting of leucine, isoleucine, glycine, alanine, valine, phenylalanine, proline, tryptophan and methionine. There is provided a cell adhesive substrate that is unlikely to cause an immune reaction and can maintain a cell adhesion effect for a long time. 1. A cell adhesive substrate comprising a substratum , on a surface of which a peptide group is immobilized , wherein the peptide group comprises a peptide containing 40% or more and 75% or less of one or two or more of basic amino acid residues selected from the group consisting of lysine , arginine and histidine and 25% or more of one or two or more of hydrophobic amino acid residues selected from the group consisting of leucine , isoleucine , glycine , alanine , valine , phenylalanine , proline , tryptophan and methionine.2. The cell adhesive substrate according to claim 1 , wherein the peptide group consists of peptides without an ordered amino acid sequence.3. The cell adhesive substrate according to claim 1 , wherein the peptide group is a set of peptides consisting of the basic amino acid residues and the hydrophobic amino acid residues.4. The cell adhesive substrate according to claim 1 , wherein the peptide group contains 40% or more and 75% or less of lysine or arginine residues claim 1 , and contains 25% or more of any of phenylalanine claim 1 , leucine and valine residues.5. The cell adhesive substrate according to claim 1 , wherein an immobilization density of the peptide group on the surface of the substratum is 0.040 μg/cmor more.6. The cell adhesive substrate according to claim 1 , wherein the ...

Electrophoretically Deposited Strontium Fluoride Nanoparticle/Polymer Coatings For Medical Implants

The present disclosure provides for co-electrophoretic deposition (co-EPD) of organo-functionalized strontium fluoride nanoparticles (SrF) with a hydrophobic polymer in the presence of non-aqueous aprotic solvents. The co-EPD procedure can be employed to form a coating or self-supporting film for application to a metal implant. 1. A method for forming a SrFnanoparticle/polymer coating or self-supporting film on a metallic substrate comprising:{'sub': '2', 'sup': '2+', '(a) supplying nanoparticles of SrFcapable of providing Sr ions wherein said particles have a largest linear dimension of 20 nm to 10.0 μm and a thickness of 1 nm to 200 nm wherein said particles have a zeta potential of −20 to −30 mV;'}{'sup': 2+', '2+, '(b) supplying a hydrophobic polymer containing functionality capable of associating with said Sr ions and forming an ionic association between said hydrophobic polymer and said Sr ions;'}{'sub': 2', '2, '(c) placing said SrFnanoparticles associated with said hydrophobic polymer in an aprotic solvent and applying a potential and depositing a coating or self-supporting film containing SrFparticles associated with said hydrophobic polymer on a metallic substrate.'}2. The method of wherein the SrFnanoparticles have a largest linear dimension of 20 nm to 2.0 μm.3. The method of wherein said SrFnanoparticles associated with said hydrophobic polymer has a zeta potential of −20 to −30 mV.4. The method of wherein said hydrophobic polymer comprises the structure CH(CH)-A where n has a value of 5-50 and A is selected from a carboxylic acid group claim 1 , thiol group claim 1 , hydroxyl group claim 1 , or ester group.5. The method of wherein said hydrophobic polymer comprises polylactic acid.6. The method of wherein said hydrophobic polymer comprises polyglycolic acid.7. The method of wherein said hydrophobic polymer comprises poly(lactic-co-glycolic acid).10. The method of wherein the carboxylic acid groups are converted to amide groups.11. The method of wherein ...

Laser Markable Medical Devices

Medical devices comprise a polymeric body comprising: a base polymeric formulation comprising at least a polymer or co-polymer of propylene; and an additive comprising a copolymer having a polypropylene backbone and hybrid micromolecule side-chains based on organo-functional silanes (PP-g-XSiOA) in the presence of a co-agent, for example, difunctional metallic diacrylate monomers, where “X” is an organic group or an organo-functional group, and “A” is a metal, an inorganic oxide, an inorganic hydroxide, or any other inorganic material. X may be derived from a compound selected from the group consisting of epoxy, amino, acrylate, methacryloxy, and vinyl; and A is selected from the group consisting of: silicon, (Si), aluminum (Al), iron (Fe), titanium (Ti), silver (Ag), zinc (Zn), nickel (Ni), calcium (Ca), copper (Cu), tin (Sn); oxides thereof; hydroxides thereof; and mixtures of the foregoing. Optionally, inorganic fillers may be included. The medical devices are laser markable. 1. A medical device comprising: a base polymeric formulation comprising at least a polymer or co-polymer of propylene; and', 'an additive comprising a copolymer having a polypropylene backbone and hybrid micromolecule side-chains based on organo-functional silanes (PP-g-XSiOA), where “X” is an organic group or an organo-functional group; and “A” is a metal, an inorganic oxide, an inorganic hydroxide, or any other inorganic material;', 'the PP-g-XSiOA being in a blend with the base polymeric formulation in an amount in the range of about 0.01 to about 20.0% by weight of the blend; and, 'a polymeric body comprisingone or more laser-engraved markings in a surface of the polymeric body.2. The medical device of claim 1 , wherein the polymeric body further comprises a filler component selected from the group consisting of: TiO claim 1 , carbon black claim 1 , graphene claim 1 , antimony doped TiO claim 1 , Al(OH) claim 1 , Al(OH)xHO claim 1 , and mixed metal oxides.3. The medical device of claim 2 ...

ABSORBABLE, PERMEABILITY-MODULATED BARRIER COMPOSITES AND APPLICATIONS THEREOF

Absorbable barrier composites are designed for modulated gas and water permeability depending on clinical use and are formed of at least two physicochemically distinct components, one of which is a film adjoined to a knitted mesh and/or electrostatically spun, non-woven fabric. Depending on the physicochemical properties of the barrier composite, it can be used in neurological and urinogenital surgical procedures as well as tissue engineering and/or as physical barriers to prevent adhesion formation following several types of surgical procedures. 2. The composite of wherein the synthetic absorbable polymer of the first component comprises a polyaxial copolyester derived from at least two monomers selected from the group consisting of glycolide claim 1 , lactide claim 1 , ε-caprolactone claim 1 , trimethylene carbonate claim 1 , p-dioxanone claim 1 , 1 claim 1 ,5-dioxepan-2-one and a morpholinedione.3. The composite of wherein the synthetic absorbable polymer of the first component comprises a polyether ester derived from a polyether-glycol that is grafted with at least one monomer selected from the group consisting of glycolide claim 1 , lactide claim 1 , ε-caprolactone claim 1 , trimethylene carbonate claim 1 , p-dioxanone claim 1 , 1 claim 1 ,5-dioxepan-2-one and a morpholinedione.4. The composite of wherein the synthetic absorbable polymer of the first component comprises a polyether-ester-urethane derived from a polyether-glycol that is grafted with at least one monomer selected from the group consisting of glycolide claim 1 , lactide claim 1 , ε-caprolactone claim 1 , trimethylene carbonate claim 1 , p-dioxanone claim 1 , 1 claim 1 ,5-dioxepan-2-one and a morpholinedione claim 1 , to form a polyether ester glycol claim 1 , where the polyether ester glycol is interconnected by urethane linkages formed through the reaction of said polyether ester glycol with an aliphatic diisocyanate.5. The composite of wherein the flexible film has a thickness of less than 500 ...

DURAL SEALING SYSTEM

The present invention refers to a dural sealing system () comprising an implant (), joined to a guiding thread (); a transfer device (), provided with a grip portion () and a hollow portion (), said hollow portion () terminating, at a first end, in a nozzle () that can be coupled to an epidural needle (), said hollow portion () also terminating in a second end fitted with an entry region (); and an introductory device () comprising a tube () with a hollow interior section, provided with a first free end and a second closed end, attached to a stop (). 1100. A dural sealing system () comprising:{'b': 10', '20', '1, 'An implant () joined to a guiding thread () of diameter D;'}{'b': 30', '30', '30', '2', '30', '30', '200', '3', '30', '30, 'i': a', 'b', 'b', 'c', 'b', 'd, 'A transfer device () provided with a grip portion () and a portion () of hollow longitudinal section of diameter D, said hollow portion () terminating, at a first end, in a nozzle () that can be coupled to an epidural needle () of internal diameter D, said hollow portion () also terminating in a second end provided with an entry region (); and'}{'b': 70', '70', '5', '3', '70', '4', '1', '70, 'i': a', 'a', 'b, 'An introductory device () comprising a tube () of diameter D, less than D, the tube () having an interior hollow section of diameter D, greater than D, and being provided with a first free end and a second end attached to a stop ().'}210070702003030ab. The dural sealing system () according to claim 1 , characterized in that the length of the tube () of the introductory device () is equal to claim 1 , or between 1 and 2 mm greater than claim 1 , the sum of the lengths of the epidural needle () and the portion () of hollow longitudinal section of the transfer device ().3100309070. The dural sealing system () according to claim 1 , characterized in that the transfer device () also comprises means for blocking () the introductory device ().4100308030b. The dural sealing system () according to claim 1 ...

Silk Fibroin Tracheal Stent

Bioresorbable silk fibroin tracheal stents can be designed and engineered to maintain a tracheal opening. A tracheal stent will maintain a tracheal opening for a period while tissue structure and function is restored. Bioresorbable silk fibroin tracheal stents programmably degrade without negative biological or clinical outcomes. Bioresorbable silk fibroin tracheal stents do not need to be removed following tracheal restoration. Bioresorbable biopolymer tracheal stents can be internally or externally deployed. Bioresorbable biopolymer tracheal stents, for example can be internally or externally deployed in a patient. Such stents may be affixed to function as a splint with tunable mechanically properties to treat, for example, a patient with severe airway collapse. 1. A stent having a substantially cylindrical body ,wherein at least the body is comprised of a silk fibroin material characterized by beta-sheet secondary structure, andwherein the stent is designed and engineered to be grafted to an external wall of a subject's trachea.2. The stent of claim 1 , wherein the silk fibroin material present in the body is formed from a silk fibroin solution having a concentration of about 1% w/w % to about 30% w/w %.3. The stent of or claim 1 , wherein the silk fibroin material comprises an additive that is embedded within the material or coated on a surface of the body.4. The stent of claim 3 , wherein the additive is silk fibroin fibers.5. The stent of claim 3 , wherein the additive is a plasticizer.6. The stent of claim 5 , wherein the plasticizer is present in the silk fibroin material at a concentration of about 1% to about 30% by weight.7. The stent of or claim 5 , wherein the plasticizer is selected from the group consisting of: 1 claim 5 ,2-butylene glycol; 2-amino-2-methyl-1 claim 5 ,3-propanediol; 2 claim 5 ,3-butylene glycol; allyl glycolate; butyl lactate; diethanolamine; diethylene glycol monoethyl ether; ethyl glycolate; ethyl lactate; ethylene glycol; ethylene ...

Bioerodible Composites for Endoprostheses

A bioerodible endoprosthesis includes a composite including a matrix comprising a bioerodible magnesium alloy and a plurality of ceramic nanoparticles within the matrix. The bioerodible magnesium alloy has a microstructure including equiaxed Mg-rich solid solution-phase grains having an average grain diameter of less than or equal to 5 microns. The microstructure can be produced by one or more equal-channel high-strain processes.

Implant Made of a Fiber Composite Material

The invention relates to an implant and a set for producing an implant and their uses. Furthermore, the invention describes a method of making an implant as per the invention. An implant for producing bone implants with improved mechanical characteristics, especially with adjustable mechanical characteristics, is provided via the invention. The implant as per the invention made up of a fiber composite material contains 1. Implant made of a fiber composite material , containing:a) resorbable mineral bone cement as a matrix material,b) reinforcing, long metallic fibers and/or endless metallic fibers with an aspect ratio of at least 100:1 in the form of at least one fiber structure that provides a framework and that preforms the contour of the implant.2. Implant according to claim 1 , characterized in that the fiber structures providing a framework are aligned in preferential directions in the implant and/or are concentrated in the outer area of the implant.3. Implant according to claim 1 , characterized in that the fiber structures providing a framework exist in the form of multifilaments and/or in the form of a fiber preform made of at least one layer.4. Implant according to claim 3 , characterized in that the fiber structures between the metallic fibers contain pores with a size of 100-2500 μm.5. Implant according to claim 1 , characterized in that more than 80% by weight of the metallic fibers are located in a range of 0.1-5 mm measured from the outside of the implant.6. Implant according to claim 1 , characterized in that the long metallic fibers and/or endless metallic fibers are made of a non-resorbable metal.7. Implant according to claim 1 , characterized in that the long metallic fibers and/or endless metallic fibers are made of a resorbable metal.8. Implant according to claim 1 , characterized in that the implant has a compressive strength of >50 MPa and/or a bending strength of >10 MPa.9. Implant according to claim 1 , characterized in that the mineral bone ...

OXYGEN-CHARGED IMPLANTABLE MEDICAL DEVICES FOR AND METHODS OF LOCAL DELIVERY OF OXYGEN VIA OUTGASSING

Oxygen-charged (or oxygen-rich) implantable medical devices for and methods of local delivery of oxygen via outgassing is disclosed. The presently disclosed oxygen-charged implantable medical devices are, for example, polymeric implants that are functionalized to locally deliver oxygen from the implant surface for prolonged periods of time, thus increasing rates of healing and reducing rates of infection as compared with conventional medical implant devices. 1. An implantable medical device comprising one or more gases dissolved in one or more materials.2. The implantable medical device of claim 1 , comprising one or more gases dissolved in one or more polymeric materials.3. The implantable medical device of claim 2 , wherein the one or more polymeric materials are functionalized.4. The implantable medical device of claim 1 , wherein the material is hyperbarically-charged with one or more gases.5. The implantable medical device of claim 2 , wherein the one or more polymeric materials is selected from the group consisting of polyvinyl alcohol (PVA) claim 2 , polylactic acid (PLA) claim 2 , ethylene vinyl alcohol (EVOH) claim 2 , poly(lactide-co-glycolide) (PLGA) claim 2 , polyglycolide (PGA) claim 2 , nylon claim 2 , polyketone claim 2 , polyether ether ketone (PEEK) claim 2 , polyethylene terephthalate (PET) claim 2 , polyvinylidine chloride (PVDC) claim 2 , polyacrylonitrile (PAN) claim 2 , polyamides (PAs) claim 2 , polyvinyl chloride (PVC) claim 2 , polyvinylidene fluoride (PVDF) claim 2 , polyethylenimine (PEI) claim 2 , polycarbonate (PC) claim 2 , ethylene chlorotrifluoroethylene (ECTFE) claim 2 , polyethylene naphthalene (PEN) claim 2 , polytrimethylene terephthalate (PTT) claim 2 , liquid crystal polymers (e.g. claim 2 , Kevlar) claim 2 , nanocellulose claim 2 , poly(methylmethacrylate (PMMA) claim 2 , polybutylene terephthalate (PBT) claim 2 , poly(p-xylylene) claim 2 , and derivatives thereof.6. The implantable medical device of claim 1 , wherein the one ...

COMPOSITE AND AN ARTICLE COMPRISING THE SAME

The present invention relates to composites for reflecting energy produced from a body to the body itself. Accordingly, the present invention provides composites comprising inert materials and methods of using the composites to enhance health conditions of animals by reflecting the energy produced from a body to the body itself. 1. A composite comprising a first layer and a second layer attached on the first layer , wherein the first layer comprises carbon fiber in the amount of about 65% to about 90% (w/w) based on the total composite and the second layer comprises , based on the total composite , graphene in an amount of about 0.01% to about 1% (w/w) , carbon nanotube in an amount of 0.1% to about 3.0% (w/w) , and a resin or an adhesive material in an amount of about 10% to about 35% (w/w).2. The composite of claim 1 , wherein the resin is polyethylene (PE) claim 1 , polypropylene (PP) claim 1 , polyester claim 1 , thermoplastic polyurethane (TPU) claim 1 , thermoplastic elastomer (TPE) claim 1 , acrylic resin claim 1 , polyurethane (PU) claim 1 , silicone resin claim 1 , polyvinyl chloride (PVC) claim 1 , polystyrene (PS) claim 1 , polyamide (PA) claim 1 , polyoxymethylene (POM) claim 1 , polycarbonate (PC) claim 1 , poly(methyl methacrylate) (PMMA) or thermoplastic rubber (TPR) or a combination thereof.3. The composite of claim 1 , wherein the adhesive material is PMMA claim 1 , polyurethane claim 1 , epoxy or any modified form thereof.4. The composite of claim 1 , wherein the amount of carbon fiber ranges from about 70% to about 90% (w/w).5. The composite of claim 1 , wherein the amount of graphene ranges from about 0.05% to about 1% (w/w).6. The composite of claim 1 , wherein the amount of carbon nanotube ranges from about 0.1% to about 2.5% (w/w).7. The composite of claim 1 , wherein the amount of resin or an adhesive material ranges from about 10% to about 30% (w/w).8. The composite of claim 1 , which can reflect energy produced by vibration of water ...

Iron-based biodegradable metals for implantable medical devices

Iron-based biodegradable metals and the method of fabricating are disclosed. The iron-based biodegradable metals, which have an accelerated degradation rate and a yield strength similar to stainless steel, comprises a composite structure of multiple iron layers separated by thin alloying metallic layers. The composite structure are built layer by layer using additive manufacturing technologies. The iron-based biodegradable metals can be fabricated into a small diameter tube for laser cutting into implantable bare metal stents or drug eluting stents with biodegradable polymer coating. The iron-based biodegradable metals can be fabricated and/or machined into orthopedic implants. 1. Iron-based biodegradable metals , comprising:a composite structure of multiple iron layers and thin alloying metallic layers, in which the iron layers are separated by the thin alloying metallic layers.2. Iron-based biodegradable metals as claimed in claim 1 , wherein:the iron layers comprise large columnar iron grains and small equiaxed iron grains. The iron layers may comprise all small equiaxed grains or large columnar grains at certain process conditions and certain amount of alloying elements in the thin metallic layer to achieve the desired degradation rate and mechanical properties.3. An iron layer as claimed in claim 1 , wherein:the iron layers typically have a thickness of 5 to 50 μm, and the iron layers could be built up to 1 mm depending on a specific medical implant application. The thickness for every iron layer in the iron-based biodegradable metals can be identical or different. The iron layers can be built layer by layer by additive manufacturing technologies, such as laser selective sintering, electron beam selective melting, physical vapor deposition, electroforming, or friction stir processing.4. Iron-based biodegradable metals as claimed in claim 1 , whereinthe multiple iron layers are separated by the thin alloying metallic layers. The alloying metallic layers are much ...

Methods of Using Water-Soluble Inorganic Compounds for Implants

A method for controlling generation of biologically desirable voids in a composition placed in proximity to bone or other tissue in a patient by selecting at least one water-soluble inorganic material having a desired particle size and solubility, and mixing the water-soluble inorganic material with at least one poorly-water-soluble or biodegradable matrix material. The matrix material, after it is mixed with the water-soluble inorganic material, is placed into the patient in proximity to tissue so that the water-soluble inorganic material dissolves at a predetermined rate to generate biologically desirable voids in the matrix material into which bone or other tissue can then grow.

SHAPE MEMORY POLYMER COMPOSITIONS

The present invention relates to compositions comprising shape memory polymer (SMP) materials and uses thereof. Particularly, although not exclusively, the present invention relates to biocompatible shape memory polymer (SMP) materials and uses thereof in the medical field. 153-. (canceled)54. A composition for a suture anchor comprising a biocompatible , resorbable Shape Memory Polymer (“SMP”) material which comprises at least one further component , wherein the SMP material is capable of being activated by contact with an aqueous solution and further wherein the device is capable of undergoing a shape change upon said contact with an aqueous solution.55. The composition according to claim 54 , wherein the shape memory polymer (SMP) material is a non-cross linked semi-crystalline shape memory polymer material.56. The composition according to claim 55 , wherein the SMP material comprises a polymer selected from poly (D claim 55 , L) lactide (PDLA) claim 55 , (lactic-co-glycolic acid) (PDLA) claim 55 , poly (L claim 55 , co DL) lactide claim 55 , poly (L-lactide-co-e-captolactone) and copolymers comprising said polymers.57. The composition according to claim 56 , wherein the SMP material comprises an SMP co-polymer.58. The composition according to claim 56 , wherein the SMP material comprises poly (D claim 56 , L-lactide) at a ratio of between about 60-80% L-lactide and between about 20-40% DL-lactide.59. The composition according to claim 56 , wherein the SMP material comprises poly (D claim 56 , L-lactide) at a ratio of about 70% L-lactide and about 30% DL-lactide.60. The composition according to claim 60 , wherein the at least one further component is selected from a plasticizer claim 60 , an inorganic filler claim 60 , a pharmaceutical agent claim 60 , a bioactive agent claim 60 , a magnetic component claim 60 , and combinations thereof.61. The composition according to claim 60 , wherein the at least one further component is a plasticizer.62. The composition ...

AN ECHOGENIC COATING FOR ULTRASOUND IMAGING OF MEDICAL DEVICES IN DEEP TISSUE LAYERS

An echogenic coating composition on a medical device to be inserted into a body at depths greater than 5 cm includes: (i) a polymer matrix and (ii) an amount of ultrasound-reflective microparticles having a diameter that is at least 10 and at most 250 μm in size, with a defined relationship between the particle size, expressed as D50, and the surface density. A method for ultrasound detection of a medical device at a scan depth greater than 5 cm includes: providing the medical device with the echogenic coating composition and to an echogenic assembly including the medical device and a convex probe. 4. The echogenic coating composition of claim 1 , wherein the wherein the polymer material is selected from the group consisting of: poly(ether sulfones) claim 1 , polyurethanes claim 1 , polyacrylates claim 1 , polymethacrylates claim 1 , polyamides claim 1 , polycarbonates claim 1 , polyepoxides claim 1 , polyethers claim 1 , polyimides claim 1 , polyesters claim 1 , fluorinated polyolefins claim 1 , polystyrenes and combinations thereof.5. The echogenic coating composition of claim 1 , wherein the microparticles are spherical.6. The echogenic coating composition of claim 1 , wherein the microparticles are made of glass.7. A method of using Use of an echogenic coating composition claim 1 , comprising:{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, 'providing the echogenic coating composition defined in on a medical device; and'}inserting the medical device into a body at depths greater than 5 cm.8. A medical device for use at scan depths greater than 5 cm claim 1 , preferably greater than 10 cm claim 1 , more preferably greater than 15 cm claim 1 , comprising:{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, 'a medical device comprising the echogenic coating composition defined in .'}9. A method for ultrasound detection of a medical device claim 1 , comprising:{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, 'providing the medical device with the echogenic coating ...

Biodegradable Magnesium Alloys and Composites

Biodegradable, magnesium alloys and composites, articles produced therefrom, methods of making the same, and methods of using the same are described. 1. A composite comprising:magnesium;a rare earth element present at a concentration up to about 15 wt %; andsilica present at a concentration up to about 15 wt %;wherein the composite has a nanocrystalline grain size.2. (canceled)3. The composite of claim 1 , wherein the rare earth element is not present in an oxide.4. The composite of claim 3 , wherein the rare earth element is selected from the group consisting of yttrium (Y) claim 3 , gadolinium (Gd) claim 3 , terbium (Tb) claim 3 , dysprosium (Dy) claim 3 , neodymium (Nd) claim 3 , lanthanum (La) claim 3 , cerium (Ce) claim 3 , praseodymium (Pr) claim 3 , and samarium (Sm).5. (canceled)6. The composite of claim 1 , further comprising an additive selected from the group consisting of Ti claim 1 , Al claim 1 , Zr claim 1 , Zn claim 1 , and Mn.7. The composite of claim 1 , wherein the composite consists essentially of magnesium claim 1 , yttrium claim 1 , and silica.8. The composite of claim 1 , further comprising a Ca—P coating.9. The composite of claim 8 , wherein the Ca—P coating is selected from the group consisting of: hydroxyapatite (Ca(PO)(OH)) claim 8 , tetracalcium phosphate (TTCP claim 8 , Ca(PO)O) claim 8 , tricalcium phosphate [α-TCP claim 8 , α-Ca(PO)and β-TCP claim 8 , β-Ca(PO)] claim 8 , dicalcium phosphate anhydrous (DCPA claim 8 , monetite claim 8 , CaHPO) claim 8 , di-calcium phosphate dihydrate (DCPD claim 8 , brushite claim 8 , CaHPO.2HO) claim 8 , and octacalcium phosphate (OCP claim 8 , CaH(PO).5HO).10. (canceled)11. (canceled)12. (canceled)13. An article comprising the composite of claim 1 , wherein the article is selected from the group consisting of: orthopedic implants claim 1 , cochlear implants claim 1 , surgical staples claim 1 , aneurism coils claim 1 , vascular closing devices claim 1 , plates claim 1 , screws claim 1 , intramedullary ...

POLYISOPRENE LATEX GRAPHENE COMPOSITES AND METHODS OF MAKING THEM

The present invention relates to a method of preparing reduced graphene oxide, incorporation of the reduced graphene oxide into polyisoprene latex to provide a polyisoprene latex graphene composite and elastomeric articles prepared using the polyisoprene latex-graphene composite. In particular, the reduction of graphene oxide is accomplished without the use of strong reducing agents and organic solvents and incorporation of the reduced graphene oxide into polyisoprene latex is accomplished using room temperature latex mixing method or hot maturation. The resultant composite exhibits good colloid stability and polyisoprene latex films produced from the composite exhibit good mechanical properties with improved ageing resistance. 1. A method of preparing an elastomeric article comprising:a) dipping a former into a polyisopropene latex graphene composite composition comprising polyisoprene latex bonded to or cross-linked with an at least partially reduced graphene oxide and at least one stabilizer, to form an elastomeric film on the former; andb) curing the elastomeric film to obtain a cured elastomeric film, andc) producing an elastomeric article using the cured elastomeric film,and optionally dipping the former into a coagulant solution before step a).2. The method of claim 1 , wherein the method comprising dipping a former into a coagulant solution before step a).3. The method of claim 1 , wherein the coagulant solution comprises metal salt ions of sodium claim 1 , calcium claim 1 , magnesium claim 1 , barium claim 1 , zinc or aluminum.4. The method claim 1 , wherein the coagulant solution comprises a metallic stearate in a concentration of about 0.1 to 5.0% by weight claim 1 , a wetting agent in a concentration of about 0.001 to 1.0% by weight and/or an anti-foaming agent in a concentration of 0.001 to 1.0% by weight.5. The method of claim 1 , wherein the at least one stabilizer is selected from the group consisting of: a metal hydroxide claim 1 , an anionic ...

Thixotropic Processing of Magnesium Composites with a Nanoparticles-Haloed Grain Structure for Biomedical Implant Applications

In described embodiments, the present invention includes a magnesium-based composite material formed from a plurality of α-phase magnesium grains; and a β-alloy phase comprising magnesium and nano-diamond and/or and phosphate containing nanoparticles, the β-alloy phase surrounding each of the plurality of magnesium grains. A method of manufacturing a composite material is also disclosed. 1. A magnesium-based composite material comprising:a plurality of α-phase magnesium grains; anda β-alloy phase comprising magnesium and particles selected from the group consisting of nano-diamond particles, nano-phosphate particles, and a combination of nano-diamond particles and nano-phosphate particles, the β-alloy phase surrounding each of the plurality of magnesium grains.2. The composite material according to claim 1 , wherein nano-diamond particles comprise a functionalized nano-diamond.3. The composite material according to claim 2 , wherein the functionalized nano-diamond is formed from a functional group selected from the group consisting of hydroxyl group claim 2 , a carboxyl group claim 2 , a carbonyl group claim 2 , and a combination thereof.4. The composite material according claim 2 , wherein each of the functionalized nano-diamonds has a size range between about 2 nm and about 10 nm.5. The composite material according to claim 1 , wherein the nano-phosphate particles are selected from the group consisting of calcium phosphate claim 1 , hydroxyapatite claim 1 , tri-calcium phosphate claim 1 , and calcium hydrogen phosphate.6. The composite material according claim 5 , wherein each of the nano-phosphate particles has a size range between about 20 nm and about 300 nm.7. The composite material according claim 1 , wherein the β-alloy phase forms a halo around each of the plurality of magnesium grains.8. The composite material according to claim 1 , comprising between about 1 percent and about 30% by weight of the β-alloy phase comprising magnesium and particles selected ...

Radiopaque Composite Wire for Medical Applications and Method of Making a Radiopaque Composite Wire

A radiopaque composite wire for medical applications comprises a core comprising a rare earth metal, an outer layer comprising a nickel-titanium alloy disposed over the core, and a diffusion barrier comprising a barrier material between the core and the outer layer. A method of making a radiopaque composite wire includes cold drawing a composite billet through a die, where the composite billet includes a tube comprising a nickel-titanium alloy disposed about a rod comprising a rare earth metal, and a barrier layer comprising a barrier material disposed between the tube and the rod. After cold drawing, the composite billet is annealed to relieve strain. After multiple passes of the cold drawing and annealing, a radiopaque composite wire having a core comprising the rare earth metal, an outer layer comprising the nickel-titanium alloy, and a diffusion barrier comprising the barrier material between the core and the outer layer is formed.

Method and apparatus for treating bone fractures, and/or for fortifying and/or augmenting bone, including the provision and use of composite implants

A composite implant comprising an injectable matrix material which is flowable and settable, and at least one reinforcing element for integration with the injectable matrix material, the at least one reinforcing element adding sufficient strength to the injectable matrix material such that when the composite implant is disposed in a cavity in a bone, the composite implant supports the bone. A method for treating a bone, the method comprising: selecting at least one reinforcing element to be combined with an injectable matrix material so as to together form a composite implant capable of supporting the bone; positioning the at least one reinforcing element in a cavity in the bone; flowing the injectable matrix material into the cavity in the bone so that the injectable matrix material interfaces with the at least one reinforcing element; and transforming the injectable matrix material from a flowable state to a non-flowable state so as to establish a static structure for the composite implant, such that the composite implant supports the adjacent bone.

VACUUM MEMBRANE THERMOFORMED POLY-4-HYDROXYBUTYRATE MEDICAL IMPLANTS

Methods to produce thermoformed implants comprising poly-4-hydroxybutyrate homopolymer, copolymer, or blend thereof, including surgical meshes, have been developed. These thermoforms are preferably produced from porous substrates of poly-4-hydroxybutyrate homopolymer or copolymer thereof, such as surgical meshes, by vacuum membrane thermoforming. The porous thermoformed implant is formed by placing a porous substrate of poly-4-hydroxybutyrate homopolymer or copolymer thereof over a mold, covering the substrate and mold with a membrane, applying a vacuum to the membrane so that the membrane and substrate are drawn down on the mold and tension is applied to the substrate, and heating the substrate while it is under tension to form the thermoform. The method is particularly useful in forming medical implants of poly-4-hydroxybutyrate and copolymers thereof, including hernia meshes, mastopexy devices, breast reconstruction devices, and implants for plastic surgery, without exposing the resorbable implants to water and without shrinking the porous substrate during molding. 116-. (canceled)17. A medical implant comprising a substrate formed of an oriented poly-4-hydroxybutyrate homopolymer , copolymer or blend , wherein the medical implant is three-dimensional , and wherein the medical implant is porous.18. The medical implant of claim 17 , wherein the substrate undergoes less than 20% shrinkage during a thermoforming process.19. The medical implant of claim 17 , wherein the substrate comprises monofilament fibers with a tensile strength between 300 and 1 claim 17 ,500 MPa.20. The medical implant of claim 17 , wherein the substrate has been heated to at least 52° C. claim 17 , more preferably above 60° C. claim 17 , but less than 110° C.21. The medical implant of claim 17 , wherein the oriented poly-4-hydroxybutyrate homopolymer claim 17 , copolymer or blend is produced by a microorganism or enzymatic process.22. The medical implant of claim 17 , wherein the substrate is ...

Implantable Polymeric Device for Sustained Release of Buprenorphine

The present invention provides compositions, methods, and kits for treatment of opiate addiction and pain. The invention provides a biocompatible nonerodible polymeric device which releases buprenorphine continuously with generally linear release kinetics for extended periods of time. Buprenorphine is released through pores that open to the surface of the polymeric matrix in which it is encapsulated. The device may be administered subcutaneously to an individual in need of continuous treatment with buprenorphine. 136-. (canceled)37. A method of treating opioid addiction , the method comprising subcutaneously implanting buprenorphine into a human in need thereof , thereby providing a therapeutically-effective plasma level of buprenorphine.38. The method of claim 37 , wherein the therapeutically-effective plasma level of buprenorphine is from about 0.1 ng/ml to about 70 ng/ml.39. The method of claim 37 , wherein the therapeutically-effective plasma level of buprenorphine is from about 0.1 ng/ml to about 1 ng/ml.40. The method of claim 37 , wherein the therapeutically-effective plasma level of buprenorphine is about 0.5 ng/ml.41. The method of claim 37 , wherein the therapeutically-effective plasma level of buprenorphine is sustained for at least 3 months.42. The method of claim 37 , wherein the buprenorphine is a pharmaceutically-acceptable salt.43. The method of claim 37 , wherein the buprenorphine is buprenorphine hydrochloride.44. The method of claim 37 , wherein the buprenorphine is implanted with a carrier.45. The method of claim 44 , wherein the carrier is a polymer matrix.46. The method of claim 45 , wherein the polymer comprises ethylene vinyl acetate.47. A method of treating opioid addiction and pain claim 45 , the method comprising subcutaneously implanting into a subject in need thereof a therapeutically-effective amount of buprenorphine.48. The method of claim 47 , wherein the therapeutically-effective amount is from about 0.1 mg per day to about 5 mg per ...

Multi-Layered Graft for Tissue Engineering Applications

A multi-layer device is provided that is useful in tissue regeneration, for example, for vascular regeneration, e.g., for use in treatment of a coronary vascular disease, such as for treatment of myocardial infarction. A method of making the device also is provided. 1. A method of making a synthetic tubular graft device , comprising:depositing an ECM gel layer over a first tubular, porous, biodegradable polymer matrix; anddepositing a second tubular, porous, biodegradable polymer matrix over the ECM gel to produce a tubular structure.2. The method of claim 1 , wherein the first tubular claim 1 , porous claim 1 , biodegradable polymer matrix is a dry-electrospun matrix.3. The method of claim 1 , wherein the ECM gel is prepared from vascular tissue.4. The method of claim 1 , wherein the second tubular claim 1 , porous claim 1 , biodegradable polymer matrix is prepared by phase separation.5. The method of claim 1 , wherein the first tubular claim 1 , porous claim 1 , biodegradable polymer matrix and/or the second tubular claim 1 , porous claim 1 , biodegradable polymer matrix comprises one or more of: poly(lactic acid) (PLA); poly(trimethylene carbonate) (PTMC); poly(caprolactone) (PCL); poly(glycolic acid) (PGA); poly(glycolide-co-trimethylenecarbonate) (PGTMC); poly(L-lactide-co-glycolide) (PLGA); polyethylene-glycol (PEG-) containing block copolymers; polyphosphazene; poly(ester urethane) urea (PEUU); poly(ether ester urethane)urea (PEEUU); poly(ester carbonate)urethane urea (PECUU); poly(carbonate)urethane urea (PCUU); a polyurethane; a polyester; a polymer comprising monomers derived from alpha-hydroxy acids such as: polylactide claim 1 , poly(lactide-co-glycolide) claim 1 , poly(L-lactide-co-caprolactone) claim 1 , polyglycolic acid claim 1 , poly(dl-lactide-co-glycolide) claim 1 , and/or poly(-lactide-co-dl-lactide); a polymer comprising monomers derived from esters including polyhydroxybutyrate claim 1 , polyhydroxyvalerate claim 1 , polydioxanone claim 1 , and ...

TECHNIQUES TO IMPROVE POLYURETHANE MEMBRANES FOR IMPLANTABLE GLUCOSE SENSORS

The invention provides an implantable membrane for regulating the transport of analytes therethrough that includes a matrix including a first polymer; and a second polymer dispersed throughout the matrix, wherein the second polymer forms a network of microdomains which when hydrated are not observable using photomicroscopy at 400× magnification or less. In one aspect, the homogeneous membrane of the present invention has hydrophilic domains dispersed substantially throughout a hydrophobic matrix to provide an optimum balance between oxygen and glucose transport to an electrochemical glucose sensor. 1. An implantable device for measuring an analyte in a hydrophilic body fluid , comprising:(a) a polymeric membrane comprising (i) a matrix comprising a first polymer; and (ii) a second polymer dispersed throughout said matrix, wherein said second polymer forms a network of microdomains which are not photomicroscopically observable when hydrated at 400× magnification or less; and(b) a proximal layer of enzyme reactive with said analyte.2. A method of monitoring glucose levels , comprising:{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, '(a) providing (i) a host, and (ii) an implantable device according to ; and'}(b) implanting said device in said host.3. A method for preparing an implantable membrane comprising the steps of:(a) forming a composition comprising a dispersion of a second polymer within a matrix of a first polymer, said dispersion forming a network of microdomains which are not photomicroscopically observable when hydrated at 400× magnification or less;(b) maintaining said composition at a temperature sufficient to maintain said first polymer and said second polymer substantially soluble;(c) applying said composition at said temperature to a substrate to form a film thereon; and(d) permitting said resultant film to dry to form said membrane. Any and all priority claims identified in the Application Data Sheet, or any correction thereto, are hereby ...

ABSORBABLE / BIODEGRADABLE COMPOSITE YARN CONSTRUCTS AND APPLICATIONS THEREOF

Absorbable composite medical devices such as surgical meshes and braided sutures, which display two or more absorption/biodegradation and breaking strength retention profiles and exhibit unique properties in different clinical settings, are made using combinations of at least two types of yarns having distinctly different physicochemical and biological properties and incorporate in the subject construct special designs to provide a range of unique properties as clinically useful implants. 119-. (canceled)20. A method for tissue repair , comprising , implanting , at a site of tissue damage a surgical mesh in a subject in need of tissue repair , wherein the surgical mesh comprises a biodegradable knitted mesh comprising: at least first and second yarn components , the yarn components having differing absorption profiles and differing strength retention profiles in the biological environment; wherein the first yarn component further comprises a monofilament of a slow-absorbing copolyester; the second yarn component comprises a monofilament of a fast-absorbing copolyester; the first yarn component comprising a polymer comprising at least 80 percent of l-lactide-based sequences; the second yarn component comprising a copolymer comprising at least 70 percent of glycolide-based sequences; wherein the biodegradable knitted mesh is knit in a four bar pattern wherein the slow-absorbing first yarn component is knit in a two bar pattern and the fast-absorbing second yarn component is knit in a two bar pattern and are initially mechanically interdependent , and wherein upon incubation in a buffered solution at a pH of 7.2 at about 50° C. for about 2 weeks the biodegradable knitted mesh retains more than 20 percent of its maximum burst force and undergoes at least 12 percent elongation under a force of 16 N per cm of mesh width.21. The method of claim 20 , wherein the second yarn component is a polyaxial copolymer.22. The method of claim 20 , wherein either the first yarn ...

FERROMAGNETIC PARTICLES BOUND TO POLYMERIC IMPLANTS

It has been discovered that iron-platinum magnetic particles can be dispersed in a polymer and coated into or onto, or directly linked to, polymeric materials, especially hydrogels, and magnetized. The magnetized materials are used to attract, capture, and/or retain magnetically labeled cells in the material in vivo. The magnetic particles have an iron/platinum core. Annealing the Fe:Pt is very important for introducing a crystal structure LIO interior crystalline phase. The Fe:Pt molar ratio for creation of the crystal phase is important and a molar range of 1.2-3.0 Fe to Pt (molar precursors, i.e starting compounds) is desired for magnetization. The magnetic force as a whole can be measured with a “Super Conducting Quantum Interference Scaffold”, which is a sensitive magnetometer. The overall magnetic force is in the range from 0.1 to 2.0 Tesla. 1. A material selected from the group consisting of a hydrogel , polymeric implant , bone cement or tissue engineering scaffold comprising magnetizable particles.2. The material of wherein the particles are ferromagnetic particles.3. The material of wherein the particles are iron oxide or ferromagnetic particles comprising iron (Fe) and platinum (Pt) complexes having an L1interior crystalline phase.4. The material of formed by annealing of Fe/Pt particles at a temperature over 400° C.5. The material of wherein the Fe/Pt is stabilized prior to annealing by application of a colloidal coating of thermally resistant inorganic materials selected from the group consisting of silica claim 4 , alumina powder claim 4 , ceramics claim 4 , iron oxides claim 4 , titanium oxides claim 4 , urethanes and epoxies.6. The material of in a hydrogel matrix.7. The material of wherein the particles are bound to an implant claim 1 , prosthetic claim 1 , heart valve claim 1 , pacemaker leads claim 1 , facial or skull reconstruction plate claim 1 , tissue engineering scaffold claim 1 , breast or bladder reconstruction mesh.8. The material of ...

PROLONGED DRUG-ELUTING PRODUCTS

A drug-eluting product is disclosed comprising an at least partially bioabsorbable element and an active pharmaceutical agent having a morphology, a solubility, and an average particle size which are selected so that the active pharmaceutical agent continues to dissolve during the biodegradation of the bioabsorbable element. The morphology is a crystalline, semi-crystalline or amorphous morphology, the solubility is less than 100 μg/ml and the average particle size is grater that about 100 nm. 1. A drug-eluting product comprising an at least partially bioabsorbable element and including an active pharmaceutical agent having a morphology , a solubility and an average particle size which are selected so that said active pharmaceutical agent continues to dissolve during the biodegradation of said bioabsorbable element , said morphology comprising a crystalline , semi-crystalline , or amorphous morphology , said solubility comprising a solubility of less than 100 μg/ml and said average particle size being greater than about 100 nm.2. The drug-eluting product of claim 1 , wherein said active pharmaceutical agent has an average particle size of between about 1 and 10 μ.3. The drug-eluting product of claim 1 , wherein said active pharmaceutical agent has a solubility of less than about 75 μg/ml.4. The drug-eluting product of claim 1 , wherein said active pharmaceutical agent includes a first portion of said active pharmaceutical agent having a particle size of between about 1 and 4 μ claim 1 , and a second portion of said active pharmaceutical agent having a particle size of between about 2 and 10 μ.5. The drug-eluting product of claim 1 , comprising a drug-eluting stent.6. The drug-eluting product of claim 1 , wherein said active pharmaceutical agent continues to dissolve for a period of at least about 3 months.7. The drug-eluting product of claim 1 , wherein said active pharmaceutical agent continues to dissolve for a period of at least about 6 months.8. The drug-eluting ...

Medical device balloons with improved strength properties and processes for producing same

A tubular parison for forming a medical device balloon. The parison is formed of a polymeric material, for instance a thermoplastic elastomer. The parison has an elongation at break which is not more than 80% of the elongation of the bulk polymeric material. The elongation of the parison is controlled by altering extrusion conditions. Balloons prepared from the parisons provide higher wall strength and/or higher inflation durability than balloons prepared from conventional parisons of the same material.

Medical examination gloves

The disclosed medical examination glove comprises natural or nitrile rubber latex, and a water soluble singlet oxygen generator. The glove can be manufactured by contacting a glove former with a coagulant solution comprising divalent calcium cations and carbonate particles and a water soluble singlet oxygen generator and then contacting the glove former with a natural or nitrile rubber latex dispersion.

Silicone Article, a Tube and Method of Forming an Article

The disclosure is directed to a silicone article. The silicone article includes a silicone composition, the silicone composition including a silicone matrix component, a fumed silica filler; and a vinyl-terminated silicone polymer having a viscosity of about 500 centipoise to about 5000 centipoise, wherein the silicone article has a turbidity of less than about 0.3 nephelometric turbidity units (NTU). The disclosure is further directed to a tube and to a method of forming the article.

SILVER AND TITANIA-LOADED POLYETHYLENE MEDICAL DEVICE FILM

A health care and/or entertainment device protective film may be configured to contact human skin, e.g., to limit the transmission of infection by bacteria, fungi, protozoa, prions, and/or viruses. The film may be formed as a nanocomposite film including at least 75 wt. %, relative to total organic matrix weight, of polyethylene, silver particles, and TiOparticles, wherein the silver particles and TiOparticles are distributed within and/or on an outer surface of the polyethylene, wherein the silver particles have a size of 1 to 1,000 nm, and wherein the TiOparticles have a size of 1 to 50 nm. Such films may be applied to health care and/or entertainment devices, including virtual reality googles.

Implantable Polymeric Device for Sustained Release of Buprenorphine

The present invention provides compositions, methods, and kits for treatment of opiate addiction and pain. The invention provides a biocompatible nonerodible polymeric device which releases buprenorphine continuously with generally linear release kinetics for extended periods of time. Buprenorphine is released through pores that open to the surface of the polymeric matrix in which it is encapsulated. The device may be administered subcutaneously to an individual in need of continuous treatment with buprenorphine. 136-. (canceled)37. A method of providing norbuprenorphine to a human , the method comprising subcutaneously implanting buprenorphine into the human , wherein the human receives a mean plasma level of norbuprenorphine.38. The method of claim 37 , wherein the mean plasma level of norbuprenorphine is from about 0.75 ng/ml to about 1 ng/ml.39. The method of claim 37 , wherein the buprenorphine is provided as an implantable device claim 37 , wherein the implantable device comprises a carrier.40. The method of claim 39 , wherein the carrier comprises a polymer.41. The method of claim 40 , wherein the polymer is non-erodible.42. The method of claim 40 , wherein the polymer is ethylene vinyl acetate.43. The method of claim 37 , wherein the human receives the mean plasma level of norbuprenorphine for at least 3 months.44. The method of claim 37 , wherein the buprenorphine is a pharmaceutically-acceptable salt.45. The method of claim 37 , wherein the buprenorphine is buprenorphine hydrochloride. This application claims the benefit of U.S. Provisional Patent Application Ser. No. 60/384,733, filed May 31, 2002, the disclosure of which is incorporated herein by reference in its entirety.This invention was made in part during work supported by a grant from the National Institute of Mental Health (1R43 MH60037-01). The government has certain rights in the invention.The invention provides a nonbioerodible, polymeric device for subcutaneous implantation and sustained ...

BIORESORBABLE 3D PRINTED ADHESION BARRIERS

An adhesion barrier is comprised of, consists of, or consists essentially of a sheet having a top surface and a bottom surface. The sheet includes either (i) interconnected links or (ii) interconnected, vertically aligned, partitions. The links form pores or the partitions form pores, with the pores extending from the top surface through the bottom surface. The sheet is comprised of, consists of, or consists essentially of a flexible or elastic polymer. 1. An adhesion barrier comprising , consisting of , or consisting essentially of a sheet having a top surface and a bottom surface ,said sheet comprising either (i) interconnected links or (ii) interconnected, vertically aligned, partitions,said links forming pores or said partitions forming pores, said pores extending from said top surface through said bottom surface,and wherein said sheet is comprised of, consists of, or consists essentially of a flexible or elastic polymer.2. The adhesion barrier of claim 1 , wherein:said sheet has a thickness of at least 0.1, 1, or 2 millimeters, up to 4 or 5 millimeters or more;said pores have an average diameter of at least 0.05, 0.1 or 0.5 millimeters, up to 1 or 2 millimeters or more; and/orsaid partitions when present have an average thickness of at least 0.1 or 0.2 millimeters, up to 0.5, 1, or 2 millimeters or more.3. The adhesion barrier of claim 1 , wherein said sheet is comprised of interconnected links.4. The adhesion barrier of claim 3 , wherein said links are rectangular claim 3 , pentagonal claim 3 , hexagonal claim 3 , round claim 3 , or elliptical in shape.5. The adhesion barrier of claim 3 , wherein said links include at least one internal bridge configured to reduce lateral compacting of said links.6. The adhesion barrier of claim 1 , wherein said sheet comprises interconnected claim 1 , vertically aligned claim 1 , partitions.7. The adhesion barrier of claim 6 , wherein said partitions are curved claim 6 , planar claim 6 , or a combination thereof.8. The ...

Polymer coating for medical devices

Coatings are provided in which surfaces may be activated by covalently bonding a combination of silane derivatives (A) to the metal surface, covalently bonding a lactone polymer (B) to the silane derivative by in situ ring opening polymerization, and depositing at least one layer of a polyester (C) on the bonded lactone polymer. Biologically active agents or therapeutic compounds may be deposited with any of the polyester layers. Such coated surfaces may be useful in medical devices, in particular stents.

USE OF ECHOGENIC COATING FOR ULTRASOUND IMAGING OF MEDICAL DEVICES IN DEEP TISSUE LAYERS

A medical device to be inserted into a body at depths greater than 5 cm, includes an echogenic coating composition including: (i) a polymer matrix and (ii) an amount of ultrasound-reflective microparticles having a diameter that is at least 10 and at most 250 μm in size, with a defined relationship between the particle size, expressed as D , and the surface density. A method for ultrasound detection of a medical device at a scan depth greater than 5 cm includes providing the medical device with the echogenic coating composition. An echogenic assembly includes the medical device having the echogenic coating composition and a convex probe. 4. The medical device of claim 1 , wherein the polymer material is selected from poly(ether sulfones) claim 1 , polyurethanes claim 1 , polyacrylates claim 1 , polymethacrylates claim 1 , polyamides claim 1 , polycarbonates claim 1 , polyepoxides claim 1 , polyethers claim 1 , polyimides claim 1 , polyesters claim 1 , fluorinated polyolefins claim 1 , polystyrenes and combinations thereof.5. The medical device of claim 1 , wherein the microparticles are spherical.6. The medical device of claim 1 , wherein the microparticles are made of glass.7. A method for ultrasound detection of a medical device comprising:disposing the medical device at a scan depth greater than 5 cm, preferably greater than 10 cm, more preferably greater than 15 cm,{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, 'ultrasonically detecting the medical device having the echogenic coating composition of .'}8. The method of claim 7 , further comprising:utilizing a linear or convex probe, preferably a convex probe.9. The method of claim 8 , further comprising:utilizing a convex probe with a radius of curvature between 5 and 80 mm.10. The method of claim 8 , further comprising:utilizing a convex probe operating with ultrasound waves with a frequency of between 2.5 and 7.5 MHz.11. An echogenic assembly comprising:{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, 'a ...