ПОЛИПЕПТИД АНТИ-ЦИАНОБАКТЕРИАЛЬНОГО РЕКОМБИНАНТНОГО АНТИТЕЛА, ЕГО ГЕН И СПОСОБ ЕГО ПОЛУЧЕНИЯ

Изобретение относится к биотехнологии. Раскрыт полипептид миметика антитела с функцией распознавания и связывания с цианобактериями, аминокислотная последовательность которого приведена в SEQ ID NO. 3. Также раскрыт ген, кодирующий полипептид миметика антитела. Описан полипептид с функцией анти-цианобактериального рекомбинантного антитела, сконструированный путем соединения указанного полипептида миметика антитела с функцией распознавания и связывания с цианобактериями с С-концом полипептида колицина, где указанный колицин выбирают из колицина Е1, Ia, Ib, А, В или N. Также описаны соответствующий ген и рекомбинантный экспрессионный вектор, содержащий такой ген. Описано применение данного полипептида с эвтрофикацией воды. 7 н. и 3 з.п. ф-лы, 11 ил., 1 табл., 5 пр.

ИММУНОГЕННАЯ КОМПОЗИЦИЯ

BR: Изобретение касается иммуногенной композиции содержащей стафилококковый PNAG, имеющий менее 50% N-ацетилирования, и капсульный полисахарид или олигосахарид типа 8 из Staphylococcus aureus. Композиция может дополнительно содержать капсульный полисахарид или олигосахарид типа 5 из S.aureus, капсульный полисахарид или олигосахарид типа I и/или типа II, и/или типа III из S.epidermidis, а также стафилококковый белок или его фрагмент, который способен связываться с внеклеточным компонентом. Стафилококковый полисахарид, входящий в композицию, может быть конъюгирован с белком-носителем, выбранным из группы столбнячного анатоксина, дифтерийного анатоксина, пневмококкового пневмолизина, альфа-токсина, CRM197, протеина D Н.influenzae, экзопротеина A P.aeruginosa. Также описаны вакцина против стафилококковой инфекции, способ получения указанной вакцины, способы профилактики или лечения стафилококковой инфекции с использованием вакцины и применение иммуногенной композиции для изготовления вакцины ...

КОНСТРУКЦИЯ МОДИФИЦИРОВАННОГО НИТЕВИДНОГО БАКТЕРИОФАГА ДЛЯ ЛЕЧЕНИЯ ИЛИ ПРОФИЛАКТИКИ БАКТЕРИАЛЬНОЙ ИНФЕКЦИИ, МОДИФИЦИРОВАННЫЙ БАКТЕРИОФАГ М13, ФАРМКОМПОЗИЦИЯ И СПОСОБ ЛЕЧЕНИЯ БАКТЕРИАЛЬНОЙ ИНФЕКЦИИ, МОНОКЛОНАЛЬНОЕ АНТИТЕЛО, ГИБРИДОМА (ВАРИАНТ)

Изобретение относится к бактериофагам для использования в лечении или профилактике бактериальных инфекций, особенно бактериальных инфекций слизистых оболочек. С этой целью была получена конструкция бактериофага, несущего на своей поверхности рекомбинантный белок, содержащий поверхностный белок бактериофага и последовательности вариабельной области ScFv полипептида. Штамм модифицированного бактериофага М13 и конструкция пригодны для лечения или профилактики бактериальной инфекции в составе фармкомпозиции, а штамм, конструкция и фармкомпозиция используются в способе лечения бактериальной инфекции; также были получены моноклональные антитела из гибридом 5F8, 2Н6 и 5D8, которые обеспечивают связывание модифицированного бактериофага М13 с Helicobacter pylori. 8 с. и 9 з.п. ф-лы, 3 табл.

МОНОКЛОНАЛЬНОЕ АНТИТЕЛО ЧЕЛОВЕКА ПРОТИВ АЛЬФА-ТОКСИНА ИЗ S. AUREUS И ЕГО ПРИМЕНЕНИЕ В ЛЕЧЕНИИ ИЛИ ПРЕДОТВРАЩЕНИИ ОБРАЗОВАНИЯ АБСЦЕССА

Изобретение относится к биохимии, в частности к моноклональному антителу человека, специфичному к альфа-токсину S. aureus. Дополнительно настоящее изобретение относится к фармацевтическим композициям для лечения или предотвращения образования абсцесса в органе, содержащим по меньшей мере одно антитело или одну нуклеиновую кислоту, кодирующую указанное антитело. Изобретение позволяет расширить ассортимент антител, специфичных к альфа-токсину S. aureus.10 н. и 13 з.п. ф-лы, 7 ил., 4 табл., 6 пр.

Однодоменное антитело и его модификации, специфически связывающиеся с ботулиническим нейротоксином типа А, и способ их применения для терапии или экстренной профилактики интоксикации, вызванной ботулиническим нейротоксином типа А.

Группа изобретений относится к области биотехнологии, иммунологии и микробиологии. Предложено средство однодоменное антитело, специфически связывающееся с ботулиническим нейротоксином типа А, обладающее защитной активностью против летальной дозы ботулинического нейротоксина типа А и имеющее аминокислотную последовательность SEQ ID NO:1 или SEQ ID NO:2. Также создано олигомеризованное однодоменное антитело, специфически связывающееся с ботулиническим нейротоксином типа А, обладающее защитной активностью против летальной дозы ботулинического нейротоксина типа А, содержащее в качестве мономерного блока любой вариант созданного однодоменного антитела. Кроме того, создано антитело, представляющее собой однодоменное антитело, модифицированное Fc-фрагментом иммуноглобулина G1 человека, специфически связывающееся с ботулиническим нейротоксином типа А, обладающее защитной активностью против летальной дозы ботулинического нейротоксина типа А, имеющее конечную аминокислотную последовательность SEQ ...

КОМПОЗИЦИИ ПОЛИСАХАРИДОВ И СПОСОБЫ ПРИМЕНЕНИЯ

... 1. Способ, включающий введение индивидууму, страдающему или подвергающемуся риску развития инфекции не содержащим ica/pga PNAG-позитивным патогеном, эффективного для индукции иммунного ответа против патогена количества выделенного полисахарида, имеющего формулугде n равно по меньшей мере 5, R выбран из группы, состоящей из -NH-CO-CHи -NHпри условии, что менее 50% групп R представляют собой -NH-CO-CH.2. Способ, включающий введение индивидууму, страдающему или подвергающемуся риску развития инфекции не содержащим ica/pga PNAG-позитивным патогеном эффективного для индукции иммунного ответа против патогена количества выделенного полисахарида, конъюгированного с носителем, где полисахарид имеет формулу,где n равно 5 или более, R выбран из группы, состоящей из -NH-CO-СНи -NHпри условии, что менее 50% групп R представляют собой -NH-CO-СН.3. Способ по п. 2, где выделенный полисахарид конъюгирован с носителем посредством линкера.4. Способ по п. 2 или 3, где носитель представляет собой пептидный ...

СПОСОБЫ БЕТА-ГЛЮКАНОВОЙ ИММУНОТЕРАПИИ

... 1. Способ идентификации связывания растворимого β-глюкана с иммунными клетками индивида, где способ включает:получение образца крови индивида, где образец крови содержит иммунные клетки;добавление растворимого β-глюкана по меньшей мере в часть образца крови и инкубацию смеси в условиях, позволяющих растворимому β-глюкану связываться с иммунными клетками; иобнаружение растворимого β-глюкана, связавшегося с иммунными клетками.2. Способ по п. 1, в котором растворимый β-глюкан получен из дрожжей.3. Способ по п. 1 или 2, в котором растворимый β-глюкан содержит β-1,3/1,6 глюкан.4. Способ по п. 1, в котором растворимый β-глюкан содержит β(1,6)-[поли-(1,3)-D-глюкопиранозил]-поли-β(1,3)-D-глюкопиранозу.5. Способ по п. 1, в котором обнаружение растворимого β-глюкана, связавшегося с иммунными клетками, включает приведение образца в контакт с моноклональным антителом, которое специфично связывается с β-глюканом.6. Способ по п. 5, в котором моноклональное антитело содержит BfD I, BfD II, BfD III или ...

ЦИТОТОКСИЧЕСКИЙ ПРОТЕИН И ЕГО ПРИМЕНЕНИЕ

... 1. Цитотоксический протеин, включающий протеин, обладающий по крайней мере 70% или более высокой идентичностью с последовательностью аминокислот, представленной как последовательность SEQ ID No.1. 2. Неполный пептид цитотоксического протеина по п.1, отличающийся тем, что указанный протеин имеет такую же цитотоксическую активность, как активность последовательности аминокислот, представленной как последовательность SEQ ID No.1. 3. Цитотоксический протеин по п.1 или 2, отличающийся тем, что указанный протеин продуцируется Helicobacter pyroli. 4. Цитотоксический протеин по п.1 или 2, отличающийся тем, что указанный протеин получают культивированием трансформанта, трансформированного с помощью рекомбинантного вектора, содержащего ДНК последовательности SEQ ID No.2, кодирующей цитотоксический протеин по п.1 или 2. 5. Цитотоксический протеин по п.4, отличающийся тем, что указанный трансформант депонирован Национальным Институтом Современных Наук и Технологий (National Institute of Advanced Industrial ...

РЕКОМБИНАНТНОЕ АНТИТЕЛО, ПЛАЗМИДА, ЭКСПРЕССИРУЮЩАЯ КАССЕТА, КЛЕТКА-ХОЗЯИН, СПОСОБ ПОЛУЧЕНИЯ ВЫШЕНАЗВАННОГО АНТИТЕЛА (ВАРИАНТЫ), СПОСОБ ИДЕНТИФИКАЦИИ АНТИТЕЛА-КАНДИДАТА, КОМПОЗИЦИЯ И ИММУНОГЕН

Изобретение относится к области биохимии, в частности к иммуногенной композиции, содержащей выделенный антиген O25b. Раскрыта вакцина, содержащая указанную композицию. Также раскрыто применение указанной вакцины для лечения у субъекта инфекции, вызванной штаммом E.coli. Изобретение позволяет эффективно лечить инфекцию, вызванную штаммом E.coli. 3 н. и 9 з.п. ф-лы, 7 ил., 2 табл., 14 пр.

Выделенное антитело (варианты), плазмида, экспрессирующая кассета, клетка-хозяин, фармацевтический препарат, диагностический препарат, выделенный эпитоп, иммуноген, выделенная нуклеиновая кислота, способ получения вышеназванного антитела (варианты), способ идентификации антитела-кандидата (варианты), способ лечения, профилактики и способ диагностики субъектов, потенциально подверженных риску заражения или страдающих от инфекций, вызванных штаммами E. coli с множественной лекарственной

СПОСОБ ОБНАРУЖЕНИЯ ПРОНИЦАЕМОСТИ КИШЕЧНОГО, А ТАКЖЕ ГЕМАТОЭНЦЕФАЛИЧЕСКОГО БАРЬЕРА И МАТЕРИАЛЫ ДЛЯ СООТВЕТСТВУЮЩИХ ТЕСТОВ

МНОГОКОМПОНЕНТНАЯ ИММУНОГЕННАЯ КОМПОЗИЦИЯ ДЛЯ ПРЕДУПРЕЖДЕНИЯ ЗАБОЛЕВАНИЯ, ВЫЗВАННОГО БЕТА-ГЕМОЛИТИЧЕСКИМИ СТРЕПТОКОККАМИ(БГС)

... 1. Иммуногенная композиция, содержащая смесь двух или более чем двух полипептидов, каждый из которых кодируется последовательностью нуклеиновых кислот, имеющей по меньшей мере 90% идентичность последовательности нуклеиновых кислот, выбранной из группы, состоящей из:а) пептидазы С5а ("SCP") (Фиг.1 (SEQ ID NO: 1));б) открытой рамки считывания ("ОРС") 554 (Фиг.3 (SEQ ID NO: 3));в) ОРС 1218 (Фиг.5 (SEQ ID NO: 5));г) ОРС 1358 (Фиг.7 (SEQ ID NO: 7)); ид) ОРС 2459 (Фиг.9 (SEQ ID NO: 9)).2. Иммуногенная композиция по п.1, дополнительно содержащая физиологически приемлемый носитель.3. Иммуногенная композиция по п.1, дополнительно содержащая эффективное количество адъюванта.4. Иммуногенная композиция по п.1, где каждый полипептид способен генерировать антитело, которое специфически распознает указанный полипептид, и где количество указанной иммуногенной композиции является эффективным для предупреждения или уменьшения симптомов колонизации или инфекции, вызванной β-гемолитическими стрептококками, ...

БИОСЕНСОРНАЯ СИСТЕМА ДЛЯ БЫСТРОГО ОБНАРУЖЕНИЯ ОПРЕДЕЛЯЕМЫХ КОМПОНЕНТОВ

СПОСОБ ДИАГНОСТИКИ LAWSONIA INTRACELLULARIS

... 1. Способ диагностики преклинической или клинической инфекции, вызываемой Lawsonia intracellularis, заключающийся в том, что а) берут жидкий образец из организма млекопитающего, б) выявляют специфическое связывание этого жидкого образца с L. intracellularis, в) сравнивают полученный результат с контролем. 2. Способ по п.1, в котором указанный способ представляет собой иммунный анализ. 3. Способ по п.1, в котором указанный способ представляет собой ELISA. 4. Способ по п.1, в котором указанный способ представляет собой блокирующий ELISA. 5. Способ по п.1, в котором применяют одно или несколько моноклональных антител, выбранных из группы, включающей антитело 301:39, антитело 287:6, антитело 110:9, антитело 113:2 и антитело 268:18. 6. Линия клеток гибридомы ЕСАСС, регистрационный номер 04092204, секретирующая антитело 110:9. 7. Линия клеток гибридомы ЕСАСС, регистрационный номер 04092201, секретирующая антитело 113:2. 8. Линия клеток гибридомы ЕСАСС, регистрационный номер 04092202, секретирующая ...

Method of preparation of an intended product to preventive medication and curative of the mastite in the cow, the ewe and the goat.

Immunoassay for detecting group B streptococcus.

Immunoadsorbent combinations for the detection and diagnosis of group b streptococcus polysaccharide antigen, comprising an insoluble carrier, a capture agent having an affinity for specifically binding to the trirhamnose epitope of group b streptococcus antigen and having the formula @-l-rhap(1->2)-@-l-rhap(1->2)@-rhap-1- wherein rhap is rhamnose, and an natigen marker agent having an affinity for binding to monorhamnose epitope of group b streptococcus polysaccharide is bound to the carrier. An immunoassay method test kit and polyclonal antibody are also described.

Vaccine composition

There is disclosed a method for producing at least one antibody against a disease pathogen. The method includes providing a biological sample from an animal infected with, or challenged by, the pathogen or pathogen extract, isolating cells from the biological sample, culturing cells in vitro in a suitable culture medium and harvesting antibodies produced from said cells.

New antibiotic containing simulacrum antibody, preparation method and application thereof

VACCINE COMPOSITION

IMMUNOASSAY FOR DETECTING GROUP B STREPTOCOCCUS

New antibiotic containing simulacrum antibody, preparation method and application thereof.

Retro- inverso- and retro-inverso synthetic peptide analogues

Compositions of human monoclonal antibodies with multiple protection.

Synthetic poly-ig receptor, receptor-antibody complexes, production and use thereof

VACCINE COMPOSITION

New antibiotic containing simulacrum antibody, preparation method and application thereof.

IMMUNOASSAY FOR DETECTING GROUP B STREPTOCOCCUS

New antibiotic containing simulacrum antibody, preparation method and application thereof.

PORPHYROMONAS GINGIVALIS ANTIGENS TO THE DIAGNOSIS AND TREATMENT OF PERIODONTITIS

MORAXELLA (BRANHAMELLA) CATARRHALIS POLYPEPTIDE

CYTOTOXIC PROTEIN AND ITS USE

PROCEDURE FOR THE DIAGNOSIS OF LAWSONIA INTRACELLULARIS

EXPRESS ION VECTOR FOR THE SECRETION OF AN ANTI-BODY FRAGMENT USING ONE E.COLI SIGNALSEQUENZ AS WELL AS PROCEDURES FOR THE MASS PRODUCTION OF THE ANTI-BODY FRAGMENT

ANTIGENS OF POLYPEPTIDE

ANTI-BODY MOLECULES, SPECIFICALLY WITH THE ACTIVE CENTER OR THE ACTIVE GAP OF A GOAL MOLECULE INTERACTION

VAKZIN COMPOSITION

DISTURBANCES OF KARBOHYDRATEN IN VIRUSES OR VIRUS ANTIGENS AND USE IN DIAGNOSTIC, PREVENTIVE AND/OR THERAPEUTIC APPLICATIONS.

ANTI-BODY AND ANTI-BODY CONTAINING PREPARATIONS FOR THE INHIBITION OF PERIODONTITIS.

A COMPOSITION THE IMPROVED ELIMINATION OF BIOACTIVE SUBSTANCES FROM THE BLOODSTREAM PERMITS.

PROCEDURE FOR THE PRODUCTION OR CLEANING OF AN SLEEP-INDUCING MATERIAL FROM A BIOLOGICAL MEANS BY IMMUNOLOGICAL REACTION OF THE KIND OF ANTIGEN ANTI-BODY.

OLIGOSACCHARIDE COMPREHENSIVE COMPOSITION FOR THERAPEUTIC OR DIAGNOSTIC USE.

COGNATE-INDEPENDENT PROOF OF MICROCYSTIN AND NODULARIN COGNATE ONES

REKOMBINANTE PHAGES

Methods and means for the production of Ig-like molecules

The invention provides means and methods for producing one or more Ig-like molecules in a single host cell. Novel CH3 mutations enabling the production of monospecific and/or bispecific Ig-like molecules of interest are also provided.

ENGINEERED MICROBE-TARGETING MOLECULES AND USES THEREOF

... [005841 Described herein are engineered microbe-targeting or microbe-binding molecules, kits comprising the same and uses thereof. Some particular embodiments of the microbe targeting or microbe-binding molecules comprise a carbohydrate recognition domain of mannose-binding lectin, or a fragment thereof, linked to a portion of a Fc region. In some embodiments, the microbe-targeting molecules or microbe-binding molecules can be conjugated to a substrate, e.g., a magnetic microbead, forming a microbe-targeting substrate (e.g., a microbe-targeting magnetic microbead). Such microbe-targeting molecules and/or substrates and the kits comprising the same can bind and/or capture of a microbe and/or microbial matter thereof, and can thus be used in various applications, e.g., diagnosis and/or treatment of an infection caused by microbes such as sepsis in a subject or any environmental surface. Microbe-targeting molecules and/or substrates can be regenerated after use by washing with a low pH buffer ...

Eradication of bacterial biofilm using anti-amyloid monoclonal antibodies

The present invention features compositions comprising an anti-amyloid antibody and methods of treating microbial infection and treating or preventing microbial biofilms using the composition.

SOMATIC HUMAN HYBRIDOMA FUSION PARTNER FOR THE PRODUCTION OF HUMAN MONOCLONAL ANTIBODIES

Compositions and methods of use for equine immunoglobulin compositions and methods of making the compositions

Antigenic polypeptides

Antigenic polypeptides

Lanthanide-based substrates and methods for determining clostridial toxin activity

New antibiotic containing simulacrum antibody, preparation method and application thereof

The invention provides a new antibiotic containing simulacrum antibody. The antibiotic consists of colicin E1, Ia, Ib, A, B, N, or aqueous channel-forming structural domain and the simulacrum antibody which is covalently linked to the carboxyl terminal of the peptide chain of said colicin or aqueous channel-forming structural domain. The simulacrum antibody is formed by the carboxyl terminal of the heavy chain variable (VH) complementarity determining region (CDR) 1 of immunoglobulin connected with the amino terminal of the VH framework region (FR) 2 where the carboxyl terminal is further connected with the amino terminal of the light chain variable (VL) CDR, and the immunoglobulin specifically recognizes the bacterial porin. The antibiotic is useful for preparing antibacterial agents such as anti-Neisseria meningitides, anti-vancomycin-resistant Enterococcus, anti-methicillin-resistant Staphylococcus aureus or anti-multiple drug resistant Pseudomonas aeruginosa.

Lactobacillus rhamnosus pilus polypeptides and methods for producing them

The present invention relates to the fields of life sciences and food, feed or pharmaceutical industry. Specifically, the invention relates to novel peptides, pilus structures, polynucleotides as well as vectors, host cells, products and pharmaceutical compositions comprising the polynucleotides, peptides or pilus structures. The invention also relates to gene clusters and antibodies. Furthermore, the present invention relates to methods for producing the peptides or pilus structures or producing the products comprising the peptides or pilus structures. Furthermore, the present invention relates to treatments as well as uses and methods for screening bacterial strains, for reducing or inhibiting the adhesion of pathogenic bacteria, promoting the adhesion of bacterial cells to the mucus and for modifying immune response in a subject. Still, the present invention relates to methods for detecting probiotic bacterial strains or pathogen strains.

A PREPARATION METHOD OF IgY FOR PREVENTING AND CURE MOUTH DISEASE AND THE TOOTHPASTE BASE ON THE IgY

Composition for pharmaceutical and cosmetic products

Compositions and methods for the diagnosis, treatment and prevention of steroid hormone responsive cancers

Cytotoxic protein and utilization thereof

METHOD FOR DETECTION OF INTESTINAL, AND BLOOD-BRAIN BARRIER PERMEABILITY AND TESTING MATERIALS THERETO

METHOD FOR DETECTION OF INTESTINAL, AND BLOOD-BRAIN BARRIER PERMEABILITY AND TESTING MATERIALS THERETO Methods, assays, and apparatus are disclosed for testing of antigens associated with intestinal and/or blood-brain barrier permeability. For example, blood, saliva or other bodily fluid can be tested for binding (1) to a bacterial toxin (preferably a lipopolysaccharide), and (2) binding to tissue antigens selected from at least one of (a) a gut-related antigen and (b) a blood brain barrier-related antigen. Analysis of test results can be used to assist in detecting and diagnosing diseases associated with leaky gut syndrome (whether due to paracellular or transcellular pathways, and whether due to bacterial toxins or some other cause) and/or to diseases associated with excessive blood brain barrier permeability, which are contemplated herein to include both neuroinflammation and/or neuroautoimmunity conditions, and especially amyotrophic lateral sclerosis, Parkinsons disease, multiple sclerosis ...

Composition with reduced immunogenicity

The present invention relates to polyclonal antibodies directed against at least one non-human biological pathogen, or against at least one molecule derived from said pathogen, towards a human or a non-human animal organism, wherein the said polyclonal antibodies are devoid of an antigenic determinant selected in a group comprising (i) N-glycolneuraminic acid (Neu5Gc) and/or (ii) a-l,3-galactose, and their use as a medicament.

Immuno-based botulinum toxin serotype A activity assays

Mutant fragments of OspA and methods and uses relating thereto

The present invention relates to a polypeptide comprising a mutant fragment of an outer surface protein A (OspA), a nucleic acid coding the same, a pharmaceutical composition 5 (particularly for use as a medicament of in a method of treating or preventing a Borrelia infection) comprising the polypeptide and/or the nucleic acid, a method of treating or preventing a Borrelia infection and a method of immunizing a subject.

Antibodies against immunocomplexes comprising cyanobacterial cyclic peptide hepatotoxins

The present invention relates to means and methods for detecting cyanobacterial cyclic peptide hepatotoxins (CCPH) in aqueous samples, More specifically, the invention provides recombinant anti-immunocomplex (anti-IC) antibodies which bind to immunocomplexes formed between one or more CCPH variants and an anti-CCPH primary antibody, and immunoassays, preferably non-competitive immunoassays, employing the same.

ANTI-PSEUDOMONAS PSL BINDING MOLECULES AND USES THEREOF

Abstract This disclosure relates to an anti-Pseudomonas Psl binding molecules and uses thereof, in particular in prevention and treatment of Pseudomonas infection. Furthermore, the disclosure provides compositions and methods for preventing and treating Pseudomonasinfection.

Methods for identifying antibodies and peptides useful in the treatment of septic shock and experimental arthritis and uses thereof

ANTIBODIES AND ANTIBODY CONTAINING COMPOSITIONS FOR INHIBITING GINGIVITIS

An anti-cyanovirin antibody with an internal image of gp120, a method of use thereof, and a method of using a cyanovirin to induce an immune response to gp120

MULTICOMPONENT IMMUNOGENIC COMPOSITION FOR THE PREVENTION OF BETA-HEMOLYTIC STREPTOCOCCAL (BHS) DISEASE

A number of ß-hemolytic streptococci polynucleotides and polypeptides, particularly Streptococcus pyogenes polypeptides and polynucleotides, are described. Two or more of the polypeptides of the invention can be formulated for use as immunogenic compositions. Also disclosed are methods for immunizing against and reducing infection caused by ß -hemolytic streptococci.

GENETICALLY REPROGRAMMED TREGS EXPRESSING CARS

Nucleic acid molecules comprising a nucleotide sequence encoding an activating chimeric antigen receptor (aCARs) are provided, said aCARs comprising (i) an extracellular binding-domain specifically binding an antigen selected from an antigen of the commensal gut microflora and a self- cell surface antigen specific to the lamina propria (LP) or submucosa of the gastrointestinal tract; (ii) a transmembrane domain; (iii) an intracellular domain including at least one signal transduction element that activates and/or co- stimulates a T cell; and optionally (iv) a stalk region linking the extracellular domain and the transmembrane domain. Compositions and vectors comprising the nucleic acid molecules encoding the aCAR as well as methods for preparing regulatory T cells comprising the vectors and expressing the aCARs are further provided as are methods for treating or preventing a disease, disorder or condition manifested in excessive activity of the immune system in a subject, comprising administering ...

CROSS-PROTECTIVE HUMAN MONOCLONAL ANTIBODY COMPOSITIONS

Cell lines have been produced that secrete human monoclonal antibodies capable of binding to molecules of different bacterial species. These antibodies have been found to be protective against lethal challenges of various bacterial genera. Pharmaceutical compositions containing these antibodies, which can be in combination with other monoclonal antibodies, blood plasma fractions and antimicrobial agents, and the prophylactic and therapeutic use of such compositions in the management of infections are included. Prior to filing of this patent application the continuous transformed human cell lines 9B10, 4F10, 4B9, 7D7, and 9C3, described herein, were deposited in the American Type Culture Collection and given the designations CRL 9006, CRL 9007, CRL 9008, CRL 9009, and CRL 9239, respectively.

LIPIDATED STREPTOCOCCUS PNEUMONIAE ANTIGEN COMPOSITIONS, METHODS OF PREPARATION AND USE

There are provided compositions and methods for prevention or treatment of Streptococcus pneumoniae (SP)-associated diseases. More specifically, there are provided recombinant lipidated fusion proteins comprising pneumococcal surface antigen A (PsaA), the recombinant lipidated fusion proteins comprising, from N-terminus to C-terminus, the N-terminal native lipid signal peptide of PsaA and the C-terminal structural gene for PsaA. Methods of inducing broad spectrum mucosal immunity against SP comprising administering a vaccine comprising recombinant lipidated fusion proteins are also described.

ANTIBODY FOR DETECTING MICROORGANISM

An antibody for detecting a microorganism whereby all serotypes of a single species can be detected; a method for constructing this antibody; a method for detecting a microorganism; and reagent kits for detecting a microorganism. Antibodies against the same functional molecules in cells of various microorganisms, particularly ribosomal proteins and still particularly a ribosomal protein L7/L12, are constructed and an antibody reacting specifically with the target microorganism is selected. Then the microorganism is detected by using this antibody. This antibody is useful in industrial drug products, in particular, remedies for infection with microorganisms typified by bacteria.

A NOVEL SURFACE EXPOSED HAEMOPHILUS INFLUENZAE PROTEIN (PROTEIN E; PE)

The present invention relates to a surface exposed protein (protein E; pE), a virulence factor, which can be detected in Haemophilus influenzae, having an amino acid sequence as described in SEQ ID NO 1, an immunogenic fragment of said surface exposed protein, and a recombinant immunogenic protein (pE (A) ) or truncated variants thereof based on said surface exposed protein. Nucleic acid sequences, vaccines, plasmids and phages, non human hosts, recombinant nucleic acid sequences, fusion proteins and fusion products are also described. A method of producing the said protein or truncated fragments thereof recombinantly is also disclosed.

FUSION OF HETEROOLIGOMERIC MYCOBACTERIAL ANTIGENS

The present invention relates generally to novel immunogenic combinations comprising or encoding at least two heterooligomeric mycobacterial antigens and preferably a fusion polypeptide comprising said two heterooligomeric mycobacterial antigens, where the mycobacterial antigens are selected from the group of Esx, PE and PPE antigens of a Mycobacterium species, particularly a Mycobacterium of the tuberculosis complex such as Mycobacterium tuberculosis (Mtb). The present invention also relates to vectors, host cells and compositions comprising or encoding said immunogenic combination as well as to methods for expressing and producing it. The present invention also relates to methods of using said immunogenic combination, fusion polypeptide, vector, host cell, composition particularly for inducing or stimulating an immune response with the goal of providing a protective response against a Mycobacterium infection or any disease caused by or associated with a Mycobacterium infection.

DETECTION OF ANAPLASMA PLATYS

The invention provides compositions and methods for the detection of Anap lasma platys polynucleotides and polypeptides.

COMPOSITIONS RELATING TO A MUTANT CLOSTRIDIUM DIFFICILE TOXIN AND METHODS THEREOF

In one aspect, the invention relates to an immunogenic composition that includes a mutant Clostridium difficile toxin A and/or a mutant Clostridium difficile toxin B. Each mutant toxin includes a glucosyltransferase domain having at least one mutation and a cysteine protease domain having at least one mutation, relative to the corresponding wild-type C. difficile toxin. The mutant toxins may further include at least one amino acid that is chemically crosslinked. In another aspect, the invention relates to antibodies or binding fragments thereof that binds to said immunogenic compositions. In further aspects, the invention relates to isolated nucleotide sequences that encode any of the foregoing, and methods of use of any of the foregoing compositions.

IMMUNOASSAY FOR DETECTING GROUP B STREPTOCOCCUS

... 2109090 9219969 PCTABS00017 Immunoadsorbent combinations for the detection and diagnosis of group B streptococcus polysaccharide antigen, comprising an insoluble carrier, a capture agent having an affinity for specifically binding to the trirhamnose epitope of group B streptococcus antigen and having the formula .alpha.-L-Rhap(1->2)-.alpha.-L-Rhap(1->2).alpha.-Rhap-1- wherein Rhap is rhamnose, and an antigen marker agent having an affinity for binding to monorhamnose epitope of group B streptococcus polysaccharide antigen of formula .alpha.-L-Rhap-1- when the group B streptococcus polysaccharide is bound to the carrier. An immunoassay method test kit and polyclonal antibody are also described.

REAGENTS

Improved affinity purification media are provided by the use of small specific binding agents, especially Fv antibody fragments or single domain antibody fragments, immobilised on porous carriers having pore sizes in the range 30-1000 angstroms, preferably 30-300 angstroms. Silica is a preferred carrier. The small fragments are able to penetrate the pores and maximise the effective surface area of the carrier, and the microporous silica is sufficiently robust to be used at high pressure, so enabling the speed and/or throughput of a purification procedure to be increased.

COMPOSITIONS CONTAINING PLANT-PRODUCED GLYCOPOLYPEPTIDE MULTIMERS, MULTIMERIC PROTEINS, AND THEIR USE

... 2071502 9106320 PCTABS00005 The present invention contemplates a transgenic plant having somatic and germ cells containing at least two mammalian genes coding for polypeptides capable of autogenously associating with each other to form a biologically active multimer. The present invention also contemplates glycopolypeptide multimers having a polypeptide that contains an immunoglobulin amino acid residue sequence and an oligosaccharide that comprises a core pentasaccharide and N-acetylglucosamine-containing outer branches, such that the multimer is free from sialic acid. The production of passive immunity against a preselected antigen by administering a sialic acid free glycopolypeptide multimer to an animal is also comtemplated.

Verfahren zur Herstellung eines Heil- und Schutzserums gegen Staupe.

Verfahren zur Herstellung von Antitoxinen

Procédé de préparation d'un vaccin

PROCEDURE FOR THE PRODUCTION OF A ANTIKOERPER CONTAINING MILK FOR THE FIGHT OF BACTERIAL INFECTIONS OF THE GASTRO-INTESTINAL TRACT.

Highly stable hybridomaoma cell line for antibody prodn. - made by fusing secreting cell with compatible xenogeneic hybrid as immortalising component

Hybridoma cell line consists of (1), as immortalised cell component, a xenogenetic Hybridoma which has lost (or lacks) ability to produce a particular material, fused to (2) a cell which is able to produce a specific cpd. (A). Component (2) is genetically compatible with the non-transformed partner in the xenogenetic hibridoma. Component (2) and the non-transformed partner in (1) are from the same species, esp. human. (2) is particularly a lymphocyte which has been pre-sensitised to produce (A). USE/ADVANTAGE - When (1) is used as immortalising component, the final hybridomas have higher stability, provide higher (A) yields; grow rapidly and are easy to clone.

PHARMACEUTICAL COMPOSITIONS, THE HUMAN MONOCLONALE OF ANTIKOERPER CONTAINING.

SPOSOBY AND VEHICLES FOR POLUChENIYa Ig-PODOBNYKhMOLEKUL

СПОСОБ ДИАГНОСТИКИ LAWSONIA INTRACELLULARIS

Данное изобретение относится к ветеринарии, в частности к способу диагностики преклинической или клинической инфекции, которая вызывается Lawsonіa іntracellularіs, путем использования антител, специфических для Lawsonіa іntracellularіs.

НОВЫЙ АНТИБИОТИК, СОДЕРЖАЩИЙ МИМЕТИЧЕСКОЕ АНТИТЕЛО, СПОСОБЫ ЕГО ПРИГОТОВЛЕНИЯ И ПРИМЕНЕНИЯ

Изобретение относится к отрасли биологии и медицины и, главным образом, касается нового антибиотика, содержащего миметическое антитело, способов его получения и применения. Новый антибиотик, содержащий миметическое антитело и колицин или содержащий миметическое антитело и каналообразующий домент колицина, при том что миметическое антитело ковалентно присоеденено к карбоксильному концу полипептида колицина, или каналообразующего домена колицина, а колицин выбирают из группы, которая состоит из колицина E1, Ia, Ib, А, В, N; при этом указанное миметическое антитело получают слиянием двух гипервариабельных участков (CDRs), VHCDR1 и VLCDR через когнантный каркасный участок (VHFR2) иммуноглобулина; а иммуноглобулин специфически распознает бактериальные порины. Благодаря этому уникальному механизму действия резистентность к лекарствам, возникающая в результате мутаций, вряд ли может приобретаться патогенными бактериями, а антибиотик не будет наносить вред нормальным клеткам человека, убивая патогенные ...

METHOD OF SCREENING AND DETECTION PROTEIN

Mutant fragments OspA and related methods and application

MUTANTNYEFRAGMENTYOspA AND related SPOSOBY AND APPLICABLE

Antibodies, capability main neutralize the exotoxins TcdA and TcdB by Clostridium difficile

UNIVERSAL ANTIBODY-MEDIATED BIOSENSOR

NOUVEAUX REACTIFS DE DIAGNOSTIC

La présente invention est relative à de nouveaux réactifs de diagnostic. Le réactif se caractérise en ce qu'il comprend un support solide qui se compose d'une couche de matière textile appropriée, fixée à une couche de matière thermoplastique inerte telle que notamment le PVC ou le polystyrène et en ce que la couche de matière textile porte des chaînes latérales constituées par un dérivé d'hydrazine, auxquelles sont fixées par liaison chimique des molécules d'antigène ou d'anticorps. Application à la détection d'anticorps ou d'antigènes d'un fluide biologique. (CF DESSIN DANS BOPI) ...

Un nouveau moyen de lutte contre les virus (tels les virus du SIDA) et contre les bacteries avec les anticorps modifies par changement de charge

Un nouveau moyen de lutte contre les virus (comme les virus du SIDA) et contre les bacteries est propose, selon lequel les anticorps contre les virus et les bacteries doivent etre modifies avec un changement de charge pour eviter l'endocytose des virus et neutraliser l'activite des bacteries.

COMPOSITION BACTERICIDE COMPRENANT UN ANTICORPS DE TYPE IGG, UTILE POUR LA PREVENTION ET LE TRAITEMENT DU RHUMATISME ARTICULAIRE

Produit pour le traitement et la prévention du rhumatisme articulaire. Selon l'invention, on réalise une immunisation passive contre une gamme variée de bactéries infectieuses qui résident dans les voies gastro-intestinales de l'homme, grâce à l'ingestion orale d'immunoglobuline IgG obtenue à partir du lait de vaches qui ont été immunisées contre une gamme spécifique de types de bactéries. Une combinaison particulière des espèces bactériennes est formulée en un vaccin qui est utilisé pour immuniser les vaches laitières. L'anticorps de type IgG obtenu à partir du lait des vaches immunisées constitue le produit de l'invention. Application à la prévention et au traitement du rhumatisme articulaire.

Immunoglobulin variants with altered binding to protein a

Variant immunoglobulins with one or more amino acid modifications in the VH region that have altered binding to Staphylococcus aureus protein A, and methods of using the same are provided.

Compositions and methods for treating or preventing inflammatory bowel disease and colon cancer

The invention provides compositions and methods for useful for the diagnosis of inflammatory bowel disease, ETBF-induced colitis, colonic hyperplasia and/or colon carcinogenesis in a subject in biological samples (e.g., stool, urine, blood, serum, tissue). The invention further provides compositions and methods for the treatment or prevention of colitis, colon cancer, or inflammatory bowel disease (e.g., Crohn's disease).

Non-lipidated variants of neisseria meningitidis orf2086 antigens

The present invention relates to compositions including an isolated non-pyruvylated non-lipidated ORF2086 polypeptide, and methods thereof. In an exemplary embodiment, the compositions described herein are immunogenic. The present invention further relates to compositions that elicit a bactericidal immune response in a mammal against an ORF2086 subfamily B polypeptide from serogroup B Neisseria meningitidis , and methods related thereto.

Inhibition of secretion from non-neuronal cells

The present invention relates to treatment of disease by inhibition of cellular secretory processes, to agents and compositions therefor, and to manufacture of those agents and compositions. The present invention relates particularly, to treatment of disease dependent upon the exocytotic activity of endocrine cells, exocrine cells, inflammatory cells, cells of the immune system, cells of the cardiovascular system and bone cells.

Human Monoclonal Antibody Specific for Lipopolysaccharides (LPS) of Serotype IATS 01 of Pseudomonas Aeruginosa

The present invention relates to a human monoclonal antibody specific for the serotype IATS 01 of P. aeruginosa , and a hybridoma producing said monoclonal antibody. In addition, the present invention relates to pharmaceutical compositions comprising at least one antibody or at least one nucleic acid encoding said antibody.

Human antibodies derived from immunized xenomice

Fully human antibodies against a specific antigen can be prepared by administering the antigen to a transgenic animal which has been modified to produce such antibodies in response to antigenic challenge, but whose endogenous loci have been disabled. Various subsequent manipulations can be performed to obtain either antibodies per se or analogs thereof.

Anti-estrogen and immune modulator combinations for treating breast cancer

Compositions for treating cancers of mucosal tissues including breast, prostate, ovary, colon are disclosed which include various combinations of new or conventional anti-estrogen compounds, aromatase inhibitors, immune modulators, immune inhibitors, immune inhibitor mimicking compounds and steroid or thyroid hormones. Methods of predicting susceptibility of a cancer of mucosal origin to treatment with a composition containing an immune inhibitor or an immune inhibitor mimicking compound are also disclosed. Preferred methods include identifying in a specimen of cancer cells the presence of a Poly-Ig (Fe) receptor or Poly-Ig-like (Fc) receptor capable of binding to an immune inhibitor or an immune inhibitor mimicking compound and of mediating immune inhibition of cancer cell growth.

Method for detecting the presence of target bacteria or a target component carbohydrate antigen thereof

A process is disclosed for separating a carbohydrate antigen from a Gram-positive or Gram-negative bacteria in a purified form that contains no more than 10% protein. The separated antigen is coupled to an affinity column, over which polyclonal antibodies to the same bacteria are chromatographed and recovered in a purified form that exhibits high specificity and sensitivity in immunoassays for the raw carbohydrate antigen corresponding to the purified antigen on the column. A particularly preferred form of rapid immunochromatographic assay employing the purified antibodies, which assay is very useful as an aid to rapid diagnosis of diseases caused by bacteria, is disclosed.

Human binding molecules having killing activity against staphylococci and uses thereof

Described are human binding molecules specifically binding to staphylococci and having killing activity against staphylococci, nucleic acid molecules encoding the human binding molecules, compositions comprising the human binding molecules and methods of identifying or producing the human binding molecules. The human binding molecules can be used in the diagnosis, prophylaxis and/or treatment of a condition resulting from Staphylococcus.

Anti-anthrax antibody, formulations thereof, and methods of use

The present invention provides an antibody which binds to B. anthracis with toxin, formulations for administration of such antibodies intramuscularly, and methods of administering such antibodies prophylactically or therapeutically.

Monoclonal antibodies against the pbp2-a protein and homologous sequences for the treatment of infections by and immunodiagnostics of bacteria of the firmicutes phylum

The present invention relates to monoclonal antibodies capable of recognising and binding to the PBP2-a protein and to other proteins having sequences homologous to PBP2-a, including pathogenic species such as the methyciline-resistant Staphylococcus Aureus (MRSA), coagulase-negative Staphilococcus, Staphylococcus sciuri and Enterococcus , and any other bacteria containing the PBP2-a protein or homologous sequences. The invention also relates to the use of the monoclonal antibodies capable of recognising and binding to the PBP2-a protein and to other proteins having sequences homologous to PBP2-a in a complementary immunodiagnostic test for detecting resistance to beta-lactam antibiotics.

Method for detecting microorganisms belonging to mycoplasma pneumoniae and/or mycoplasma genitalium

A detection method and a detection kit for rapidly and specifically diagnosing Mycoplasma pneumoniae and/or Mycoplasma genitalium infections are provided. The DnaK of Mycoplasma pneumoniae or Mycoplasma genitalium is used as an indicator.

Anti-Botulinum Neurotoxin a Single Domain Antibody Antibodies

Antibodies that bind to botulinum neurotoxin(s) are disclosed herein, as well as related compositions and methods of use. The present disclosure provides antibodies that specifically bind a Botulinum neurotoxin (BoNT) and inhibit the activity of BoNT in cleavage of its substrate.

T-Cell Stimulating Protein B and Methods of Use

Polypeptides that can elicit antibodies that bind to T-cell stimulating protein B (TspB) of N. meningitidis , and methods of use, are provided.

Chemically programmable immunity

Methods and compositions for immediately immunizing an individual against any molecule or compound. The present invention comprises an immunity linker with at least two sites; (1) at least one first binding site that binds to an immune response component in an individual that has been pre-immunized with a universal immunogen, and (2) at least one second binding site that binds specifically to a desired compound or molecule, the target.

Egg White Antibodies for Prevention and Treatment of Specific Localized Intestinal Infections and Diseases Associated with a Pathogenic Organism or Molecule

The present invention provides the method for prevention and treatment of specific localized intestinal infections and diseases using IgA and IgM antibodies obtained from the eggs of hens which have been hyperimmunized to the same specific infections and diseases. The invention describes the high functionality of IgA and IgM antibodies present in the white of an egg from a hyperimmunized chicken as compared to the IgY from the same egg. The invention also describes the resistance of IgA and IgM to low pH environments such as stomach acids. The invention also describes the inhibition of bacterial growth when bacteria are exposed to IgA antibodies specific to said bacteria together with lysozyme from egg whites.

Antibody Preparations

An antibody preparation suitable for intravenous administration in humans includes IgG, IgA and at least 5% IgM antibodies by weight of the total amount of antibodies. The preparation is prepared from human plasma, has specific complement activating activity, and, in an in vitro assay with human serum suitable to determine the ability of the antibody preparation to activate complement unspecifically, the antibody preparation generates substantially no C5 a and/or substantially no C3 a . The antibody preparation can have medical uses.

Protein A Crystals and Cross-Linked Crystals and Methods of Use Thereof

Protein A crystals and Protein A cross-linked protein crystals (CLPCs) are described. Methods of preparing and using are also disclosed.

INACTIVATED STAPHYLOCOCCAL WHOLE-CELL VACCINE

The vaccine that is protective against pathogenic bacterial species, typically staphylococcal species, and including methods to prepare said vaccine and to culture pathogenic bacteria. 1. A composition comprising an inactivated staphylococcal cell wherein said composition is prepared using a staphylococcal cell characterised in that said cell:i) is a gram positive cocci;ii) expresses at least the enzyme catalase;iii) induces an immune response that produces antibodies that bind at least staphylococcal collagen-binding protein; andiv) is resistant to the antibiotic penicillin.2. The composition according to wherein said staphylococcal cell also expresses the enzymes coagulase and/or DNase.3. The composition according to wherein said staphylococcal cell induces an immune response that produces antibodies that bind collagen binding protein4. The composition according to wherein said inactivated staphylococcal cell induces an immune response that produces antibodies that cross react with methicillin resistant claim 1 , vancomycin resistant and vancomycin intermediate resistant staphylococcal species.5. The composition according to wherein said staphylococcal cell is sensitive to the antibiotics cloxacillin claim 1 , erythromycin claim 1 , tetracycline or gentamicin6S. epidermidis, S. aureus, S. hominis, S. haemolyticus, S. warneri, S. capitis, S. saccharolyticus, S. auricularis, S. simulans, S. saprophyticus, S. cohnii, S. xylosus, S. cohnii, S. warneri, S. hyicus, S. caprae, S. gallinarum, S. intermedius, S. hominis.. The composition according to wherein said staphylococcal cell is selected from the group consisting of:7S. aureusS. epidermidis.. The composition according to wherein said staphylococcal cell is or8S. aureusS. epidermidis. The composition according to wherein said or is antibiotic resistant.9. The composition according to wherein said antibiotic resistance is a methicillin resistant staphylococcal cell (MRSA).10. The composition according to wherein said ...

STAPHYLOCOCCUS AUREUS LEUKOCIDINS, THERAPEUTIC COMPOSITIONS, AND USES THEREOF

Disclosed herein are isolated and purified bi-component leukocidin, referred to herein as LukAB, and its components LukA and LukB, antibodies specific to LukA, antibodies specific to LukB, therapeutic compositions containing LukA and/or LukB, or anti-LukA and/or anti-LukB antibodies, uses of the compositions to treat acute inflammatory conditions or infection, methods for identifying inhibitors of LukAB-mediated cytotoxicity of human phagocytes, and methods for using LukAB as a marker to predict severity of infection. 1Staphyloccocus aureus. An active agent useful in inhibiting onset of or treating a infection , comprising at least one of: a) a therapeutically effective amount of a LukA polypeptide having the amino acid sequence of any of SEQ ID NOS:1-14 , or a sequence having at least 70% sequence similarity to any of SEQ ID NOS:1-14 (“LukA”); b) a therapeutically effective amount of a LukB polypeptide having the amino acid sequence of any of SEQ ID NOS:15-27 , or a sequence having at least 70% sequence similarity to any of SEQ ID NOS:15-27 (“LukB”); c) a therapeutically effective amount of an anti-LukA antibody that specifically binds LukA; or d) a therapeutically effective amount of an antibody that specifically binds LukB.2. The active agent of claim 1 , wherein a) is a mature LukA polypeptide.3. The active agent of claim 1 , wherein a) comprises a LukA polypeptide that lacks the amino acid residues corresponding to positions 342-351 of any of SEQ ID NOs:1-14.4. The active agent of claim 1 , wherein b) is a mature LukB polypeptide.5Staphyloccocus aureus. A therapeutic composition for inhibiting onset of or treating a infection claim 1 , comprising the active agent of claim 1 , and a pharmaceutically acceptable carrier.6. The therapeutic composition of claim 5 , comprising therapeutically effective amounts of the anti-LukA antibody claim 5 , therapeutically effective amounts of the anti-LukB antibody claim 5 , or therapeutically effective amounts of the anti-LukA ...

THERAPEUTIC ANTIBODIES AGAINST FLAGELLATED PSEUDOMONAS AERUGINOSA

Improved antibodies are provided selected from human, dual-specific, chimeric or humanized antibodies, wherein said human chimeric and humanized antibodies specifically bind to flagellin type A or type B of , and said dual-specific antibodies specifically binds to flagella type A and type B of , and said antibodies are protective against infection caused by . These antibodies as well as pharmaceutical composition comprising them are useful for the treatment of indications caused by infection. 1P. aeruginosa. An antibody that specifically binds to flagella type A or type B of , but excluding a mouse monoclonal antibody.2P. aeruginosa. The antibody according to claim 1 , which is a human antibody comprising a human IgG constant region fused to human variable regions of an anti-monoclonal antibody that specifically binds to flagella type B.35-. (canceled)6. The antibody according to claim 2 , wherein said IgG constant region is a human IgG1 constant region.7. The antibody according to claim 2 , wherein said variable regions that specifically bind to flagella type B comprises (a) a human Vfragment comprising CDRs present in SEQ ID NO: 1; and (b) a human Vfragment comprising CDRs present in SEQ ID NO: 2.8. The antibody according to claim 7 , wherein said CDRs are as defined by IMGT/V-QUEST or Kabat.9. The antibody according to claim 7 , wherein said human Vfragment comprises the amino acid sequence of SEQ ID NO: 13; and the Vfragment comprising the amino acid sequence of SEQ ID NO: 14.10. The antibody according to claim 9 , comprising the Vfragment fused to a human IgG1 heavy constant domain as set forth in SEQ ID NO: 15 and the Vfragment fused to a human IgG1 light constant domain as set forth in SEQ ID NO: 161130-. (canceled)31. A human IgG antibody that specifically binds to flagella type B claim 9 , comprising the Vfragment fused to a human IgG1 heavy constant domain as set forth in SEQ ID NO: 15 and the Vfragment fused to a human IgG1 light constant domain as set ...

METHODS AND COMPOSITIONS BASED ON SHIGA TOXIN TYPE 1 PROTEIN

The invention is based on the discovery of the epitope in the Stx1 protein for the 13C4 antibody. The invention features non-full length Stx1 polypeptides that include the epitope for the 13C4 monoclonal antibody epitope. The invention also features methods of producing anti-Stx1 antibodies specific for the 13C4 epitope of the Stx1 protein. Additionally, the invention features methods for treating a subject having, or at risk of developing, a Shiga toxin associated disease (e.g., hemolytic uremia syndrome and diseases associated with and infection) with a polypeptide that includes the 13C4 epitope or with an anti-Stx1 antibody developed using the methods of the invention. Furthermore, the invention features the detection of Stx1 in a sample using the antibodies developed using the methods of the invention. 1. A method for producing an anti-Stx1 antibody that specifically binds to the 13C4 epitope of Shiga toxin type 1 (Stx1) protein , said method comprising the steps of:a) immunizing a mammal with a polypeptide comprising at least one amino acid sequence selected from the sequences set forth in SEQ ID NOs: 1, 2, and 3, wherein said polypeptide does not comprise full length Stx1; andb) purifying said anti-Stx1 antibody that specifically binds to the 13C4 epitope of Stx1 protein from a tissue of said mammal or from a hybridoma made using said tissue.2. The method of claim 1 , wherein said anti-Stx1 antibody that specifically binds to the 13C4 epitope of Stx1 protein does not bind Stx2.3. The method of claim 1 , further comprising the step of:(c) screening said antibody against Stx1 and Stx2 in an in vitro neutralization assay, wherein an antibody that neutralizes at least 50% of the cytotoxic effect of Stx1 is an anti-Stx1 antibody that specifically binds to the 13C4 epitope of Stx1 protein.4. The method of claim 1 , wherein said polypeptide comprises at least two of the amino acid sequences set forth in SEQ ID NOs: 1 claim 1 , 2 claim 1 , and 3.5. The method of claim ...

AXMI-115, AXMI-113, AXMI-005, AXMI-163 AND AXMI-184: INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

Compositions and methods for conferring insecticidal activity to host cells are provided. Compositions comprising a coding sequence for a delta-endotoxin polypeptide are provided. The coding sequences can be used in DNA constructs or expression cassettes for transformation and expression in host cells. Compositions also comprise transformed host cells. In particular, isolated delta-endotoxin nucleic acid molecules are provided. Additionally, amino acid sequences corresponding to the polynucleotides are encompassed, and antibodies specifically binding to those amino acid sequences. In particular, the present invention provides for isolated nucleic acid molecules comprising nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO:4, 5, 6, 13, or 14, or the nucleotide sequence set forth in SEQ ID NO:1, 2, 3, 11, or 12, as well as variants and fragments thereof. 1. An isolated or recombinant nucleic acid molecule comprising a nucleotide sequence encoding an insecticidal polypeptide having at least 95% sequence identity SEQ ID NO:6.2. The nucleic acid molecule of claim 1 , wherein said nucleotide sequence is selected from the group consisting of SEQ ID NO:15 and 16.3. An expression cassette comprising the nucleic acid molecule of .4. The expression cassette of claim 3 , further comprising a nucleic acid molecule encoding a heterologous polypeptide.5. A host cell that contains the recombinant nucleic acid molecule of .6. An isolated polypeptide having at least 95% sequence identity SEQ ID NO:6 claim 1 , wherein said polypeptide has insecticidal activity.7. The polypeptide of further comprising heterologous amino acid sequences.8. An antibody that selectively binds to the polypeptide of .9. A composition comprising the polypeptide of .10. The composition of claim 9 , wherein said composition is selected from the group consisting of a powder claim 9 , dust claim 9 , pellet claim 9 , granule claim 9 , spray claim 9 , emulsion claim 9 , colloid claim 9 , and ...

METHODS AND COMPOSITIONS RELATED TO INTRACELLULAR NEUTRALIZATION BY IgG

Disclosed are compositions, antibodies, and methods for binding intracellular antigens.

HUMANIZED PCRV ANTIBODY HAVING ANTI-PSEUDOMONAL ACTIVITY

Provided are a humanized monoclonal antibody against PcrV or a part thereof, and a pharmaceutical composition containing the same as an active ingredient, as an effective means for therapy of infection, particularly infection with . Concretely, the humanized monoclonal antibody of the present invention has an excellent inhibitory activity on the cytotoxicity with respect to a target cell of . Also, the humanized monoclonal antibody of the present invention has a high affinity for PcrV. 1. A humanized monoclonal antibody against PcrV having1) a heavy chain variable region having amino acid sequence of SEQ ID NO: 27, and2) a light chain variable region having amino acid sequence of SEQ ID NO: 28, or antibody fragment thereof.2. A pharmaceutical composition comprising the antibody or antibody fragment thereof according to as an active ingredient and pharmaceutically acceptable carrier.3. A polynucleotide encoding a heavy chain variable region having the amino acid sequence of SEQ ID NO: 27 or a light chain variable region having the amino acid sequence of SEQ ID NO: 28.4. An expression vector comprising the polynucleotide according to . This application is a Divisional application which claims priority under 35 U.S.C. §120 of U.S. application Ser. No. 13/256,219 filed on Sep. 12, 2011, which is the National Phase under 35 U.S.C. §371 of International Application No. PCT/JP2010/053828 filed on Mar. 9, 2010, which claims priority under 35 U.S.C. §119(a)-(d) of Application No. 2009-057929 filed in Japan on Mar. 11, 2009. All of these applications are hereby incorporated by reference for all purposes.The present invention relates to a humanized monoclonal antibody that recognizes PcrV, or a part thereof. More specifically, the present invention relates to an antibody having higher neutralizing activity (hereinafter, also referred to as cytotoxicity inhibiting activity) than conventional anti-PcrV antibodies, or a part thereof, and a pharmaceutical composition containing ...

PROTECTIVE VACCINE BASED ON STAPHYLOCOCCUS AUREUS PROTEIN SA2412

The present invention relates to methods of inducing an immune response to comprising administering a composition comprising an SA2412 polypeptide from as well as derivatives or fragments thereof. The present also encompasses methods of treating and/or reducing the likelihood of a infection by administering a composition comprising an antibody that specifically binds to an SA2412 polypeptide, derivative or fragments thereof. Compositions administered in the methods of the invention can include one or more additional antigens including, but not limited to, IsdB. Compositions used to practice the methods of the invention are also encompassed. 1. A composition comprising an immunologically effective amount of a polypeptide that is at least 95% identical to SEQ ID NO:1 or a fragment of the polypeptide and a pharmaceutically acceptable carrier.2. The composition of wherein the polypeptide is SEQ ID NO:1.3S. aureus. The composition of further comprising one or more additional antigens.4. (canceled)5. The composition of wherein the composition further comprises an adjuvant.6S. aureus. A method of inducing a protective immune response in a patient against an infection comprising the steps of administering to the patient an immunologically effective amount of the composition of .7. The method of wherein the patient is human or a non-human mammal.8. The method of wherein the patient has weakened immunity claim 7 , has received a foreign body implant or is on renal dialysis.9. The method of wherein the patient that weakened immunity has HIV or AIDS.10. The method of wherein the foreign body implant is a catheter claim 8 , a vascular device claim 8 , pacemaker leads claim 8 , defibrillator systems claim 8 , or prosthetic heart valve.1117-. (canceled)18S. aureus. A method of conferring passive immunity to infection in a patient comprising administering to the patient one or more antibodies that specifically bind to a polypeptide of SEQ ID NO:1.1917. The method of claim wherein ...

Group B Streptococcus Polypeptides Nucleic Acids and Therapeutic Compositions and Vaccines Thereof

This invention provides an isolated nucleic acid encoding a polypeptide comprising amino acid sequences of a streptococcal matrix adhesion E (EmaE) polypeptide. Antibodies to the EmaE polypeptide and immunogenic fragments thereof are also provided. This invention provides pharmaceutical compositions, immunogenic compositions, vaccines, and diagnostic and therapeutic methods of use of the isolated polypeptide, antibodies thereto, and nucleic acids. 112-. (canceled)13. An isolated streptococcal Extracellular Matrix Adhesion Protein E (EmaE) which comprises the amino acid sequence set forth in SEQ ID NO:10.14. A vaccine comprising an isolated streptococcal polypeptide EmaE comprising the amino acid sequence set forth in SEQ ID NO:10 and a pharmaceutically acceptable adjuvant.15. The vaccine of claim 14 , further comprising an antigen selected from the group consisting of:a) the polypeptide Spbl or an immunogenic fragment thereof;b) the polypeptide Spb2 or an immunogenic fragment thereof;c) the polypeptide C protein alpha antigen or an immunogenic fragment thereof;d) the polypeptide Rib or an immunogenic fragment thereof;e) the polypeptide Lmb or an immunogenic fragment thereof;f) the polypeptide C5a-ase or an immunogenic fragment thereof;g) Group B streptococcal polysaccharides or oligosaccharides; andh) any combination of one or more of the foregoing.16. An immunogenic composition comprising an isolated streptococcal polypeptide EmaE comprising the amino acid sequence set forth in SEQ ID NO:10 and a pharmaceutically acceptable adjuvant.17. The immunogenic composition of claim 16 , further comprising an antigen selected from the group consisting of:a) the polypeptide Spbl of an immunogenic fragment thereof;b) the polypeptide Spb2 or an immunogenic fragment thereof;c) the polypeptide C protein alpha antigen or an immunogenic fragment thereof;d) the polypeptide Rib or an immunogenic fragment thereof;e) the polypeptide Lmb or an immunogenic fragment thereof;f) the ...

Mycobacterial Antigen Composition

There is provided an antigenic composition comprising (a) a first mycobacterial antigenic polypeptide or a first mycobacterial polynucleotide; and (b) a second mycobacterial antigenic polypeptide or a second mycobacterial polynucleotide; wherein: (i) said first mycobacterial antigenic polypeptide comprises a polypeptide sequence having at least 70% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 1 or 7, or a fragment thereof having at least 7 consecutive amino acids thereof; (ii) said first mycobacterial polynucleotide comprises a polynucleotide sequence encoding said first mycobacterial antigenic polypeptide; (iii) said second mycobacterial antigenic polypeptide comprises a polypeptide sequence having at least 70% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 5, or a fragment thereof having at least 7 consecutive amino acids thereof; and (iv) said second mycobacterial polynucleotide comprises a polynucleotide sequence encoding said second mycobacterial polypeptide. 2. An antigenic composition according to claim 1 , wherein said first mycobacterial polynucleotide comprises a polynucleotide sequence having at least 70% nucleotide sequence identity to the nucleic acid sequence of SEQ ID NO: 2 claim 1 , or a fragment of SEQ ID NO: 2 having at least 21 consecutive nucleotides thereof.3. An antigenic composition according to claim 1 , wherein said second mycobacterial polynucleotide comprises a polynucleotide sequence having at least 70% nucleotide sequence identity to the nucleic acid sequence of SEQ ID NO: 6 claim 1 , or a fragment of SEQ ID NO: 6 having at least 21 consecutive nucleotides thereof.4. An antigenic composition according to claim 1 , further comprising at least one additional mycobacterial antigenic polypeptide claim 1 , which is different from said first mycobacterial antigenic polypeptide and/or said second mycobacterial antigenic polypeptide; or further comprising at least one additional mycobacterial ...

Human Monoclonal Antibodies Against Hendra and Nipah Viruses

The present invention relates to monoclonal antibodies that bind or neutralize Hendra or Nipah virus. The invention provides such antibodies, fragments of such antibodies retaining Hendra or Nipah virus-binding ability, fully human antibodies retaining Hendra or Nipah virus-binding ability, and pharmaceutical compositions including such antibodies. The invention further provides for isolated nucleic acids encoding the antibodies of the invention and host cells transformed therewith. Additionally, the invention provides for prophylactic, therapeutic, and diagnostic methods employing the antibodies and nucleic acids of the invention.

HUMAN ANTIBODIES AGAINST PSEUDOMONAS AERUGINOSA LPS DERIVED FROM TRANSGENIC XENOMOUSE

The invention described herein provides for human antibodies produced in non-human animals that specifically bind to Lipopolysaccharide (LPS). The invention further provides methods for making the antibodies in a non-human animal, expression of the antibodies in cell lines including hybridomas and recombinant host cell systems. Also provided are kits and pharmaceutical compositions comprising the antibodies and methods of treating or preventing infection by administering to a patient the pharmaceutical compositions described herein. 1Pseudomonas aeruginosa. An isolated human monoclonal antibody or antigen-binding portion thereof wherein the antibody specifically binds the lipopolysaccharide (LPS) O-specific side chain of of serotype 06ad.2. The isolated human monoclonal antibody or antigen-binding portion thereof according to claim 1 , wherein the antibody or portion thereof has one or more properties selected from the group consisting of:{'i': 'Pseudomonas aeruginosa', 'a) opsonizes of serotype 06ad;'}{'i': 'Pseudomonas aeruginosa', 'b) promotes complement-dependent phagocytosis of of serotype 06ad;'}{'i': 'Pseudomonas aeruginosa', 'c) enhances the immune response to of serotype 06ad; and'}{'i': 'Pseudomonas aeruginosa', 'd) mediates the killing of of serotype 06ad.'}3Pseudomonas aeruginosaPseudomonas aeruginosa.. The isolated human antibody or antigen-binding portion thereof according to claim 2 , wherein said mediating of the killing of said comprises delivery of an agent lethal to said4Pseudomonas aeruginosaPseudomonas aeruginosa.. The isolated human antibody or antigen-binding portion thereof according to claim 2 , wherein said mediating of the killing of said comprises enhancing the immune response to said5Pseudomonas aeruginosa. The isolated human antibody or antigen-binding portion thereof according to claim 1 , wherein said antibody or antigen-binding portion thereof inhibits claim 1 , treats claim 1 , or prevents infection with of serotype 06ad.6. The ...

P. GINGIVALIS ANTIGENIC COMPOSITION

The present invention provides an antigenic composition, the composition comprising at least one recombinant protein. The recombinant protein comprises at least one epitope. The epitope is reactive with an antibody which is reactive with a polypeptide having the sequence set out in SEQ. ID. NO. 3 or SEQ. ID. NO. 5. The invention also provides methods and compositions for the production of the recombinant protein. Also provided are methods for the diagnosis, treatment and prevention of infection. 129.-. (canceled)30. An antigenic composition comprising at least one isolated and purified protein , wherein the isolated and purified protein consists of SEQ ID NO: 5.31. The antigenic composition as claimed in wherein the antigenic composition further comprises an adjuvant.32P. gingivalis. An antigenic composition comprising a chimeric or fusion protein claim 30 , wherein the chimeric or fusion protein comprises a first and a second polypeptide claim 30 , wherein the first polypeptide consists of SEQ ID NO: 5 and the second polypeptide comprises a sequence.33. The antigenic composition as claims in claim 32 , wherein the antigenic composition further comprises an adjuvant.34P. gingivalis. A method of reducing the severity of infection in a subject claim 30 , the method comprising administering to the subject an antigenic composition as claimed in .35P. gingivalis. A method of reducing the severity of infection in a subject claim 32 , the method comprising administering to the subject the antigenic composition as claimed in .36. An antibody composition claim 32 , the composition comprising at least one antibody claim 32 , the antibody being raised against a protein consisting of SEQ ID NO: 5.37P. gingivalis. An antibody composition claim 32 , the composition comprising at least one antibody which binds a protein consisting of SEQ ID NO: 5 claim 32 , the antibody being raised against a chimeric or fusion protein claim 32 , wherein the chimeric or fusion protein comprises a ...

STAPHYLOCOCCUS AUREUS SPECIFIC ANTIBODIES AND USES THEREOF

The present invention provides antagonizing antibodies that bind to alpha-toxin. The invention further provides a method of obtaining such antibodies and antibody encoding nucleic acids. The invention further relates to therapeutic methods for use of these antibodies for the treatment and/or prevention of staphylococcal disease, including, for example, pneumonia, bacteremia, sepsis, eye infection, and abscess. 1S. aureus. An isolated antagonist antibody that specifically binds to alpha-toxin and comprises: a heavy chain variable region (VH) comprising a VH complementarity determining region one (CDR1) , VH CDR2 , and VH CDR3 of the VH sequence of SEQ ID NO: 35; and a light chain variable region (VL) comprising a VL CDR1 , VL CDR2 , and VL CDR3.2. The isolated antagonist antibody of claim 1 , wherein the VL comprises a VL CDR1 claim 1 , VL CDR2 claim 1 , and VL CDR3 of the VL sequence of SEQ ID NO: 3.3. The isolated antagonist antibody of claim 1 , wherein the VH CDR1 comprises the amino acid sequence of SEQ ID NO: 5 claim 1 , 6 or 7 claim 1 , the VH CDR2 comprises the amino acid sequence of SEQ ID NO: 8 or 9 claim 1 , the VH CDR3 comprises the amino acid sequence of SEQ ID NO: 54 claim 1 , the VL CDR1 comprises the amino acid sequence of SEQ ID NO: 15 claim 1 , the VL CDR2 comprises the amino acid sequence of SEQ ID NO: 16 claim 1 , and the VL CDR3 comprises the amino acid sequence of SEQ ID NO: 17.4. The isolated antagonist antibody of claim 3 , wherein the VH comprises the amino acid sequence of SEQ ID NO: 35 or a variant thereof with one or several conservative amino acid substitutions in residues that are not within a CDR claim 3 , and the VL comprises the amino acid sequence of SEQ ID NO: 3 or a variant thereof with one or several amino acid substitutions in amino acids that are not within a CDR.5. The isolated antagonist antibody of claim 3 , wherein the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 72 or 73 and a light ...

Compositions and methods including B lymphocyte cell line expressing membrane immunoglobulin different from secreted immunoglobulin

Compositions and methods are disclosed herein for producing one or more immunoglobulins in an isolated B lymphocyte cell line. An isolated cell line includes an isolated B lymphocyte cell line capable of expressing at least one exogenously incorporated membrane immunoglobulin reactive to a first antigen and at least one endogenous secreted immunoglobulin reactive to a second antigen.

HIGH AFFINITY ANTIBODIES THAT NEUTRALIZE STAPHYLOCOCCUS ENTEROTOXIN B

This invention provides antibodies that specifically bind and neutralize enterotoxin B. In addition, nucleic acids encoding such antibodies, and cells that express such antibodies are provided. Also provided are methods for treating diseases mediated by, and for neutralizing enterotoxin B. 1. An isolated polynucleotide encoding an antibody heavy chain comprising a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO: 68 , a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO: 69 , and a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO: 70.2. The polynucleotide of further encoding an antibody light chain comprising a light chain CDR1 comprising the amino acid sequence of SEQ ID NO: 56 claim 1 , a light chain CDR2 comprising the amino acid sequence of SEQ ID NO: 57 claim 1 , and a light chain CDR3 comprising the amino acid sequence of SEQ ID NO: 58.3. An isolated polynucleotide encoding an antibody light chain comprising a light chain CDR1 comprising the amino acid sequence of SEQ ID NO: 56 claim 1 , a light chain CDR2 comprising the amino acid sequence of SEQ ID NO: 57 claim 1 , and a light chain CDR3 comprising the amino acid sequence of SEQ ID NO: 58.4. An isolated polynucleotide encoding an antibody heavy chain comprising a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO: 130 claim 1 , a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO: 131 claim 1 , and a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO: 132.5. An isolated polynucleotide of further encoding an antibody light chain comprising a light chain CDR1 comprising the amino acid sequence of SEQ ID NO: 104 claim 4 , a light chain CDR2 comprising the amino acid sequence of SEQ ID NO: 105 claim 4 , and a light chain CDR3 comprising the amino acid sequence of SEQ ID NO: 106.6. An isolated polynucleotide encoding an antibody light chain comprising a light chain CDR1 comprising the amino acid sequence of SEQ ID NO: 104 ...

IMMUNOGENIC COMPOSITIONS

This disclosure relates to immunogenic compositions comprising an isolated immunogenic PcpA polypeptide and at least one additional antigen (such as for example, an isolated immunogenic polypeptide selected from the group consisting of the polyhistidine triad family of proteins (e.g. PhtD) and methods of using these compositions for preventing and treating diseases caused by 1S. pneumoniaeS. pneumoniae. An immunogenic composition comprising an isolated immunogenic PcpA polypeptide and an isolated immunogenic polypeptide selected from the group consisting of the polyhistidine triad family of proteins.2S. pneumoniaeS. pneumoniaeS. pneumoniae. An immunogenic composition of for conferring protection in a subject against disease caused by infection which comprises an isolated immunogenic PcpA polypeptide and an isolated immunogenic polypeptide selected from the group consisting of the polyhistidine triad family of proteins.3S. pneumoniaeS. pneumoniae. The composition of wherein the composition comprises an isolated immunogenic PcpA polypeptide and an isolated immunogenic PhtD polypeptide or a fusion protein thereof.4. The composition of wherein the amino acid sequence of the PhtD polypeptide has at least 80% sequence identity to the amino acid sequence as set forth in SEQ ID NO:1.5. The composition of wherein the PhtD polypeptide is produced recombinantly.6. The composition of wherein the recombinantly produced PhtD polypeptide is an N-terminal truncation lacking the signal peptide sequence.7. The composition of wherein the PhtD protein comprises a polypeptide having an amino acid sequence that has at least 80% sequence identity to the amino acid sequence as set forth in SEQ ID NO:5 and/or the PcpA polypeptide has at least 80% sequence identity to the amino acid sequence as set forth in SEQ ID NO:2 or SEQ ID NO:7.814-. (canceled)15. The composition of comprising:about 5 to 100 μg/dose of the PhtD polypeptide andabout 5 to 100 μg/dose of the PcpA polypeptide.16. The ...

Methods and compositions related to immunizing against staphylococcal lung diseases and conditions

Embodiments of the invention include methods and compositions useful in a vaccination strategy capable of neutralizing Hla to provide immunoprotection against S. aureus pneumonia. In certain aspects the invention includes a Hla with reduced toxicity, represented by a recombinant mutant form of Hla (HlaH35L) in which histidine 35 is convened to leucine, which can be used to abrogate the productive assembly of the toxin and protect a subject from staphylococcal pneumonia.

HUMAN STREPTOCOCCUS PNEUMONIAE ANTIBODIES AND USES THEREFOR

The present invention is directed to particular monoclonal antibodies and fragments thereof that find use in the detection, prevention and treatment of infections. In particular, these antibodies may kill or limit the replication of . Also disclosed are improved methods for producing such monoclonal antibodies. 1Streptococcus pneumoniae.. A human monoclonal antibody panel comprising a plurality of antibodies , wherein antibodies in said panel bind to at least 15 serotypes of2S. pneumoniae. The antibody panel of claim 1 , wherein antibodies in said panel bind to at least 18 serotypes.3S. pneumoniae. The antibody panel of claim 2 , wherein antibodies in said panel bind to 21 serotypes.4. The antibody panel of claim 3 , wherein at least 15 antibodies are serotype specific.5. The antibody panel of claim 4 , wherein at least 17 antibodies are serotype specific.6. The antibody panel of claim 5 , wherein 19 antibodies are serotype specific.7. The antibody panel of claim 1 , wherein the antibody panel is attached to a support.8. The antibody panel of claim 7 , wherein the support is a bead claim 7 , a dipstick claim 7 , a filter claim 7 , a membrane claim 7 , a plate claim 7 , or a chip.9. The antibody panel of claim 1 , wherein the serotypes are selected from 1 claim 1 , 2 claim 1 , 3 claim 1 , 4 claim 1 , 5 claim 1 , 6B claim 1 , 8 claim 1 , 9N claim 1 , 9V claim 1 , 11B claim 1 , 14 claim 1 , 15B claim 1 , 17F claim 1 , 18C claim 1 , 19A claim 1 , 19F claim 1 , 20 claim 1 , 22F claim 1 , 23F claim 1 , 33F and CWPS.10. The antibody panel of claim 1 , wherein at least one antibody reacts with two serotypes.11Streptococcus pneumoniaeStreptococcus pneumoniae.. A method of assessing a in a subject comprising obtaining a first antibody-containing sample from said subject and assessing binding of antibodies in said sample to a human monoclonal antibody panel comprising a plurality of antibodies claim 1 , wherein antibodies in said panel bind to at least 15 serotypes of12S. ...

ANTIBODIES FOR THE TREATMENT OF CLOSTRIDIUM DIFFICILE-ASSOCIATED INFECTION AND DISEASE

Provided herein are reagents, compositions, and therapies with which to treat infection and related disease conditions and pathologies, such as -associated diarrhea, resulting from infection by bacteria and the enterotoxins produced by these bacteria. In particular, antibodies or antigen-binding fragments thereof that bind specifically to toxin A and/or toxin B of and neutralize the activities of these toxins; compositions comprising such antibodies; and methods of using the antibodies and the compositions are provided. 1. An isolated antibody or an antigen-binding fragment thereof , wherein the antibody or antigen-binding fragment thereof:{'i': C. difficile', 'C. difficile, '(a) specifically binds toxin A of and which cross competes for binding to toxin A of with a monoclonal antibody produced by a hybridoma cell line deposited under ATCC Accession No. PTA-9692, PTA-9694, or PTA-9888;'}{'i': 'C. difficile', '(b) specifically binds to a toxin A epitope defined by a monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692, PTA-9694, or PTA-9888;'}{'i': C. difficile', 'C. difficile, '(c) specifically binds toxin B of and which cross competes for binding to toxin B of with a monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9693; and/or'}{'i': 'C. difficile', '(d) specifically binds to a toxin B epitope defined by a monoclonal antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9693.'}24-. (canceled)5. The antibody or antigen-binding fragment thereof of claim 1 , wherein the antibody is selected from the group consisting of(a) an antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9692;(b) an antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9694;(c) an antibody produced by the hybridoma cell line deposited under ATCC Accession No. PTA-9888; and(d) an antibody produced by the hybridoma ...

Compositions and Methods for Modulation and Detection of Immune and Inflammatory Responses

A method for detecting an inflammatory or an autoimmune condition, comprising analyzing bacterial lipids, such as phosphorylated dihydroceramides (PDHC), in a sample; and, comparing results of the analysis of the bacterial lipids in the sample with information on occurrence of the bacterial lipids in a comparable sample, wherein the comparison is indicative of the inflammatory or the autoimmune condition. An example of the autoimmune condition is multiple sclerosis. According to one embodiment, an increased ratio of phosphoglycerol dihydroceramide (PG DHC) to phosphoethanolamine dihydroceramide (PE DHC) in a blood sample indicates a presence of MS in the source patient. The use of PDHCs as biomarkers for detection of MS is described. Antibodies specific to PG DHC or PE DHC are also provided, along with their uses. Also provided are compositions comprising bacteria-originated lipids useful for modulation of immune responses or TLR pathways in humans, animals, and human or animal cells or tissues.

PNEUMOCOCCAL SEROTYPE 6D

Disclosed is a new and emerging serotype of designated serotype 6D, and assays and monoclonal antibodies useful in identifying same. Also disclosed is a novel pneumococcal polysaccharide with the repeating unit→2) glucose 1 (1→3) glucose 2 (1→3) rhamnose (1→4) ribitol (5→phosphate. This new serotype may be included in pneumococcal vaccines. 1Streptococcus pneumoniae. An isolated bacterial strain designated 6D; said bacterial strain characterized as having a capsular polysaccharide having the repeating unit {→2) glucose 1 (1→3) glucose 2 (1→3) rhamnose (1→4) ribitol (5→phosphate}.2Streptococcus pneumoniae. A vaccine comprising a polysaccharide derived from an isolated bacterial strain designated 6D; said bacterium characterized as having a capsular polysaccharide having the repeating unit {→2) glucose 1 (1→3) glucose 2 (1→3) rhamnose (1→4) ribitol (5→phosphate}.3. A vaccine comprising a purified polysaccharide having the repeating unit {→2) glucose 1 (1→3) glucose 2 (1→3) rhamnose (1→4) ribitol (5→phosphate}.4Streptococcus pneumoniae. An isolated or purified antigen binding molecule that binds to 6D; wherein the antigen comprises a polysaccharide having the repeating unit {→2) glucose 1 (1→3) glucose 2 (1→3) rhamnose (1→4) ribitol (5→phosphate}.5. A composition comprising purified or isolated mono- or polyclonal antibodies that react with a purified or isolated polysaccharide having the repeating unit {→2) glucose 1 (1→3) glucose 2 (1→3) rhamnose (1→4) ribitol (5→phosphate}.6Streptococcus pneumoniae. A chemical , physical , or genetic test that differentiates for the bacterium 6D , wherein said bacterium is differentiated based on a capsular polysaccharide having the repeating unit {→2) glucose 1 (1→3) glucose 2 (1→3) rhamnose (1→4) ribitol (5→phosphate}. This application is a divisional of U.S. patent application Ser. No. 12/601,896, filed May 4, 2010, which is related to and claims the benefit of PCT Application No. U.S.08/064,951, filed May 28, 2008, and U.S. ...

COMPLETE GENOME SEQUENCE OF THE METHANOGEN METHANOBREVIBACTER RUMINANTIUM

The present invention includes the complete genome sequence for the methanogen, , including polynucleotides which encode polypeptides or peptides, as well as polynucleotides from non-coding regions. Also included are the encoded polypeptides and peptides, and antibodies directed to these peptides or polypeptides, in addition to expression vectors and host cells for producing these peptides, polypeptides, polynucleotides, and antibodies. The invention further includes methods and compositions for detecting, targeting, and inhibiting microbial cells, especially methanogen cells such as cells, using one or more of the disclosed peptides, polypeptides, polynucleotides, antibodies, expression vectors, and host cells. 166.-. (canceled)67. An isolated polypeptide comprising: a) an amino acid sequence selected from the group consisting of SEQ ID NO: 7555 , 7404 , and 6054; or b) an amino acid sequence selected from the group consisting of SEQ ID NO: 5867-6053 , 6055-7403 , 7405-7554 , and 7556-7584.68. An isolated polypeptide: a) which shares at least 70% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 7555 , 7404 , and 6054; or b) which shares at least 70% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 5867-6053 , 6055-7403 , 7405-7554 , and 7556-7584.69. An isolated polypeptide or peptide comprising an extracellular domain of an amino acid sequence selected from the group consisting of SEQ ID NO: 7555 , 5869 , 5879 , 5880 , 5892 , 5916 , 5926 , 5929 , 5930 , 6093 , 6154 , 6155 , 6180 , 6181 , 6218 , 6384 , 6398 , 6435 , 6478 , 6481 , 6489 , 6492 , 6529 , 6542 , 6605 , 6606 , 6616 , 6617 , 6685 , 6797 , 6827 , 6828 , 6888 , 6905 , 6921 , 6993 , 7023 , 7024 , 7034 , 7107 , 7149 , 7203 , 7398 , 7418 , 7453 , 7454 , 7456 , 7485 , 7521 , 7531 , and 7556.70. An isolated polynucleotide: a) encoding an amino acid sequence selected from the group consisting of SEQ ID NO: 7555 , 7404 , and 6054; b) ...

Human Antibodies to Clostridium difficile Toxins

The present invention provides fully human antibodies that bind to either toxin A or toxin B of , or to both toxin A and toxin B, compositions comprising the antibodies and methods of use. The antibodies of the invention are useful for neutralizing the toxins from , thus providing a means of treating the disease and symptoms associated with a infection, including the treatment of diarrhea, or pseudomembranous colitis caused by . The antibodies may also prevent the severity and/or duration of the primary disease, or may prevent the number, duration, and/or the severity of recurrences, or relapses of the disease attributed to the presence of . The antibodies of the invention may also be useful for diagnosis of an infection by 1Clostridium difficile. An isolated antibody that specifically binds to toxin A or to toxin B , or that binds to , or cross reacts with , both toxin A and B , wherein:{'i': 'Clostridium difficile', 'a) the isolated antibody or antigen-binding fragment thereof that specifically binds toxin A of comprises the three heavy chain complementarity determining regions (HCDR1, HCDR2 and HCDR3) contained within a heavy chain variable region (HCVR) amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 98, 114, 130, 146 and 162; and the three light chain complementarity determining regions (LCDR1, LCDR2 and LCDR3) contained within a light chain variable region (LCVR) amino acid sequence selected from the group consisting of SEQ ID NOs: 10, 106, 122, 138, 154 and 170;'}{'i': 'Clostridium difficile', 'b) the isolated antibody or antigen-binding fragment thereof that specifically binds toxin B of comprises the HCDR1, HCDR2 and HCDR3 contained within a HCVR amino acid sequence selected from the group consisting of SEQ ID NOs: 178, 194, 210, 226, 242, 258, 274, 290, 306, 322, 338 and 354; and the LCDR1, LCDR2 and LCDR3 contained within a LCVR amino acid sequence selected from the group consisting of SEQ ID NOs: 186, 202, 218, 234, 250, 266, 282 ...

CLOSTRIDIUM DIFFICILE-SPECIFIC ANTIBODIES AND USES THEREOF

The present invention is directed to toxin-specific antibodies, compositions, and uses thereof. The anti-toxin antibodies may be specific for either TcdA or TcdB. The invention also includes methods of treating a infection, methods of capturing toxins, and methods of detecting toxins. 2. The isolated or purified antibody or fragment thereof of claim 1 , selected from the group consisting of:an isolated or purified antibody or fragment thereof comprising a sequence of CDR 1 of GRTFNTLS (SEQ ID NO:1); CDR2 of VSRSGGST (SEQ ID NO:7); and CDR3 of AAAATKSNTTAYRLSFDY (SEQ ID NO:13);an isolated or purified antibody or fragment thereof comprising a sequence of CDR 1 of GRTFSMYR (SEQ ID NO:2); CDR2 of ITRNGSST (SEQ ID NO:8); and CDR3 of AATSGSSYLDAAHVYDY (SEQ ID NO:14);an isolated or purified antibody or fragment thereof comprising a sequence of CDR 1 of GRTLSSYI (SEQ ID NO:3); CDR2 of ISRRGGNS (SEQ ID NO:9); and CDR3 of AADGSVAGWGRRSVSVSSYDY (SEQ ID NO:15);an isolated or purified antibody or fragment thereof comprising a sequence of CDR 1 of GRTFSMDP (SEQ ID NO:4); CDR2 of GSSTGRTT (SEQ ID NO:10); and CDR3 of AAAPYGANWYRDEYAY (SEQ ID NO:16);an isolated or purified antibody or fragment thereof comprising a sequence of CDR 1 of IRSFSNRN (SEQ ID NO:5); CDR2 of ISWGGGST (SEQ ID NO:11); and CDR3 of AAEFGHNIATSSDEYDY (SEQ ID NO:17); oran isolated or purified antibody or fragment thereof comprising a sequence of CDR 1 of ERTFSRYP (SEQ ID NO:6); CDR2 of ISSTGTST (SEQ ID NO:12); and CDR3 of AVNSQRTRLQDPNEYDY (SEQ ID NO:18).5. The isolated or purified antibody or fragment thereof of claim 4 , selected from the group consisting of;an isolated or purified antibody or fragment thereof comprising a sequence of CDR 1 of GNIFSINT (SEQ ID NO:19); CDR2 of ITSGGTT (SEQ ID NO:24); and CDR3 of NTVKVVGGRLDNPDY (SEQ ID NO:29);an isolated or purified antibody or fragment thereof comprising a sequence of CDR 1 of GRTASGYG (SEQ ID NO:20); CDR2 of ISRSGAGT (SEQ ID NO:25); and CDR3 of ...

VACCINE AGAINST STREPTOCOCCAL INFECTIONS BASED ON RECOMBINANT PROTEINS

An antigenic composition comprises several antigenic components derived from antigens of subsp. or subsp. , wherein at least one component is a fusion protein or polypeptide comprising two or more such antigens or fragments thereof. The antigenic composition may be used for immunization of mammals against subsp. and/or subsp. . A vaccine composition comprising the antigenic composition as immunizing component is also disclosed. 2. The antigenic composition according to claim 1 , wherein said first fusion polypeptide further comprises at least a part of at least one protein of the protein family designated Scl.3. The antigenic composition according to claim 1 , wherein said first fusion polypeptide further comprises at least a part of a protein designated Eq54.4. The antigenic composition according to claim 1 , wherein said at least part of the protein designated EAG comprises an N-terminal part of the protein.5. The antigenic composition according to claim 1 , wherein said at least part of the protein designated CNE comprises an N-terminal part of the protein.6. The antigenic composition according to claim 1 , wherein said at least one additional polypeptide comprises the second fusion polypeptide in claim 1 , and at least part of the protein designated IdeE.7. The antigenic composition according to claim 6 , which further comprises at least part of the protein designated IdeE2.8. The antigenic composition according to claim 6 , wherein said at least one additional polypeptide comprises the third fusion polypeptide in .9. The antigenic composition according to claim 8 , which further comprises at least part of the protein designated EndoSe or EndoSz.10. The antigenic composition according to claim 1 , wherein the first fusion polypeptide comprises the amino acid sequence as shown in SEQ ID NO: 24 claim 1 , starting from amino acid 12.11. The antigenic composition according to claim 1 , wherein the first fusion polypeptide comprises the amino acid sequence as shown ...

GLYCOCONJUGATES AND THEIR USE AS POTENTIAL VACCINES AGAINST INFECTION BY SHIGELLA FLEXNERI

A conjugate molecule comprising an oligo- or polysaccharide covalently bound to a carrier and its use as potential vaccine against infection by 1. A conjugate molecule comprising an oligo- or polysaccharide selected from the group consisting of:{'sub': x', 'y, '(X)-{B(E)C}-(Y)'}{'sub': x', 'y, '(X)-{(E)CD}-*Y)'}{'sub': x', 'y, '(X)-{AB(E)C}-(Y)'}{'sub': x', 'y, '(X)-{B(E)CD}-(Y)'}{'sub': x', 'y, '(X)-{(E)CDA}-(Y)'}{'sub': x', 'y, '(X)-{DAB(E)C}n-(Y)'}{'sub': x', 'y, '(X)-{B(E)CDA}n-(Y)'}{'sub': x', 'y, '(X)-{(E)CDAB}n-(Y)'}{'sub': x', 'y, '(X)-{AB(E)CD}n-(Y)'}{'sub': x', 'y, '(X)-{DAB(E)CD}-(Y)'}{'sub': x', 'y, '(X)-{B(E)CDAB(E)C}-(Y)'}wherein:A is an alphaLRhap-(1,2) residueB is an alphaLRhap-(1,3) residueC is an alphaLRhap-(1,3) residueE is an alphaDGlcp-(1,4) residueD is a betaDGlcNAcp-(1,2) residuex and y are independently selected among 0 and 1X and Y are independently selected among A, B, C, D, E, AB, B(E), (E)C, CD, DA, AB(E), B(E)C, (E)CD, CDA, AB(E)C, B(E)CD, (E)CDA, CDAB, DAB(E) and wherein n is an integer comprised between 1 and 10 covalently bound to a carrier.2. A molecule according to wherein n is comprised between 2 and 6.3. A molecule according to wherein the carrier is selected among a protein or a peptide comprising at least one T-cell epitope claim 1 , or a derivative thereof.4. A molecule according to claim 3 , wherein the carrier is the peptide PADRE.5. A molecule according to claim 3 , wherein the carrier is the tetanus toxoid.6. A molecule according to claim 1 , wherein the carrier is biotin.7. A molecule according to claim 1 , wherein the saccharide is directly bound to the carrier.8. A molecule according to claim 1 , wherein the saccharide is bound to the carrier via a spacer.9. A molecule according to claim 1 , wherein the saccharide to carrier ratio is comprised between 1:1 and 30:1.10. A molecule according to claim 1 , wherein the saccharide is selected among the tetrasaccharides and pentasaccharides and their oligomers.11. A molecule ...

PEPTIDES PROTECTIVE AGAINST E. FAECALIS, METHODS AND USES RELATING THERETO

The present invention relates to a protective peptide of () or a functional active variant thereof, optionally further consisting of additional amino acid residue(s); a nucleic acid coding for the same; a pharmaceutical composition comprising said peptide or said nucleic acid; an antibody or functional active fragment thereof specifically binding to the antigen; a hybridoma cell line which produces said antibody; a method for producing said antibody; a pharmaceutical composition comprising said antibody; the use of said peptide or said nucleic acid for the manufacture of a medicament for the immunization or treatment of a subject; the use of said antibody or functional fragment thereof for the manufacture of a medicament for the treatment of an infection; a method of diagnosing an infection; and the use of said peptide for the isolation and/or purification and/or identification of an interaction partner of the peptide. 1E. faecalis. A protective peptide consisting of an antigen of of the SEQ ID NO: 21 , SEQ ID NO: 22 , SEQ ID NO: 23 , SEQ ID NO: 24 , SEQ ID NO: 25 , SEQ ID NO: 26 , SEQ ID NO: 27 , SEQ ID NO: 28 , SEQ ID NO: 29 , SEQ ID NO: 30 , SEQ ID NO: 31 , SEQ ID NO: 32 , SEQ ID NO: 33 , SEQ ID NO: 34 , SEQ ID NO: 35 , SEQ ID NO: 36 , SEQ ID NO: 37 , SEQ ID NO: 38 , SEQ ID NO: 39 , SEQ ID NO: 40 or a functional active variant of the antigen of any of the SEQ ID NOs: 21 to 40.2E. faecalisE. faecalis. A protective peptide consisting of an antigen of of the SEQ ID NO: 21 , SEQ ID NO: 22 , SEQ ID NO: 24 or SEQ ID NO: 25 or a functional active variant of an antigen of of the SEQ ID NO: 21 , SEQ ID NO: 22 , SEQ ID NO: 24 or SEQ ID NO: 25 , anda) 1 to 450 additional amino acid residue(s), preferably 1 to 400, 1 to 350, 1 to 300, 1 to 250, 1 to 200, 1 to 150, more preferably 1 to 100, even more preferably at most 1 to 50, most preferably 1, 2, 3, 4, 5, 10, 20, 30 or 40 additional amino acids residue(s) if the antigen is SEQ ID NO: 21, wherein the additional amino acid ...

Poly-n-acetyl glucosamine (pnag/dpnag)-binding peptides and methods of use thereof

The present invention relates to peptides, particularly human monoclonal antibodies, that bind specifically to poly-N-acetyl glucosamine (PNAG), such as Staphylococcal PNAG, in acetylated, partially acetylated and/or fully deacetylated form. The invention further provides methods for using these peptides in the diagnosis, prophylaxis and therapy of infections by bacteria that express PNAG such as but not limited to Staphylococci and E. coli . Some antibodies of the invention enhance opsonophagocytic killing and in vivo protection against bacteria that express PNAG such as but not limited to Staphylococci and E. coli . Compositions of these peptides, including pharmaceutical compositions, are also provided, as are functionally equivalent variants of such peptides.

Neisseria meningitidis compositions and methods thereof

In one aspect, the invention relates to an isolated polypeptide comprising an amino acid sequence that is at least 95% identical to SEQ ID NO: 71. In another aspect, the invention relates to an immunogenic composition including an isolated non-lipidated, non-pyruvylated ORF2086 polypeptide from Neisseria meningitidis serogroup B, and at least one conjugated capsular saccharide from a meningococcal serogroup.

VMP-LIKE SEQUENCES OF PATHOGENIC BORRELIA

The present invention relates to DNA sequences encoding Vmp-like polypeptides of pathogenic Borreliae, the use of the DNA sequences in recombinant vectors to express polypeptides, the encoded amino acid sequences, application of the DNA and amino acid sequences to the production of polypeptides as antigens for immunoprophylaxis, immunotherapy, and immunodiagnosis. Also disclosed are the use of the nucleic acid sequences as probes or primers for the detection of organisms causing Lyme disease, relapsing fever, or related disorders, and kits designed to facilitate methods of using the described polypeptides, DNA segments and antibodies. 130-. (canceled)31. An isolated antibody that binds immunologically to an epitope of SEQ ID NO:15 , SEQ ID NO:16 , SEQ ID NO:17 , SEQ ID NO:18 , SEQ ID NO:19 , SEQ ID NO:20 , SEQ ID NO:21 , SEQ ID NO:22 , SEQ ID NO:23 , SEQ ID NO:24 , SEQ ID NO:25 , SEQ ID NO:26 , SEQ ID NO:27 , SEQ ID NO:28 , SEQ ID NO:29 , or SEQ ID NO:30.32. The isolated antibody of claim 31 , further defined as a monoclonal antibody.33. The isolated antibody of claim 31 , further defined as a polyclonal antibody.34. The isolated antibody of claim 31 , further defined as labeled with a label.35. The isolated antibody of claim 34 , wherein the antibody is further defined as conjugated to a secondary binding ligand.36. The isolated antibody of claim 34 , wherein the antibody is further defined as bound by a secondary antibody directed against the antibody.37. The isolated antibody of claim 31 , further defined as immobilized on an affinity column.38. The isolated antibody of claim 31 , further defined as immunologically bound to a protein or polypeptide comprising an epitope of SEQ ID NO:15 claim 31 , SEQ ID NO:16 claim 31 , SEQ ID NO:17 claim 31 , SEQ ID NO:18 claim 31 , SEQ ID NO:19 claim 31 , SEQ ID NO:20 claim 31 , SEQ ID NO:21 claim 31 , SEQ ID NO:22 claim 31 , SEQ ID NO:23 claim 31 , SEQ ID NO:24 claim 31 , SEQ ID NO:25 claim 31 , SEQ ID NO:26 claim 31 , SEQ ID ...

Antibodies and Immunotoxins that Target Human Glycoprotein NMB

The invention provides high affinity antibodies suitable for forming immunotoxins that inhibit the growth of cells expressing human glycoprotein NMB, including glioblastoma multiforme cells, anaplastic astrocytoma cells, anaplastic oligodendroglioma cells, oligodendroglioma cells, and melanoma cells. The antibodies may be formed in cells transformed with an isolated nucleic acid encoding a polypeptide comprising an antibody heavy chain variable region (“VH”) and an antibody light chain variable region (“VL”). Such nucleic acids are provided. 1. An isolated nucleic acid encoding a polypeptide comprising an antibody heavy chain variable region (“VH”) and an antibody light chain variable region (“VL”) , each variable region having an amino terminus and a carboxyl terminus and comprising four framework regions (“FRs”) , which FRs are numbered sequentially FRs 1-4 starting from the amino terminus , and three complementarity determining regions (“CDRs”) , which CDRs of each region are numbered sequentially CDR1 to CDR3 starting from the amino terminus , wherein CDR1 of said VH has a sequence selected from the group consisting of SEQ ID NOs:22-28 , CDR2 of said VH has the sequence of SEQ ID NO:29 , CDR3 of said VH has the sequence of SEQ ID NO:30 , CDR1 of said VL has the sequence of SEQ ID NO:31 , CDR2 of said VL has the sequence of SEQ ID NO:32 , and CDR3 of said VL has a sequence selected from the group consisting of SEQ ID NO:33-37.2. A nucleic acid of claim 1 , wherein said CDR1 of said VH chain of said polypeptide has the sequence of SEQ ID NO:23 and said CDR3 of said VL chain of said polypeptide has the sequence of SEQ ID NO:34.3. A nucleic acid of claim 1 , wherein said CDR1 of said VH chain of said polypeptide has the sequence of SEQ ID NO:24 and said CDR3 of said VL chain of said polypeptide has the sequence of SEQ ID NO:34.4. A nucleic acid of claim 1 , wherein said CDR1 of said VH chain of said polypeptide has the sequence of SEQ ID NO:25 and said CDR3 of said ...

GRAM-POSITIVE BACTERIA SPECIFIC BINDING COMPOUNDS

The present invention provides improved binding compounds capable of specifically binding Gram-positive bacteria. Binding compounds are provided that are fully human, enabling therapeutic applications in human individuals. 143-. (canceled)44. An antibody or functional part thereof capable of binding a serine-aspartate (SD) repeat-dependent epitope.45. The antibody of claim 44 , wherein the SD repeat epitope is a domain of an SD repeat (sdr) protein.46. The antibody of claim 45 , wherein the sdr protein is located on the surface of a bacterium.47. The antibody of claim 45 , wherein the sdr protein is anchored to the peptidoglycan cell wall of a gram-positive bacterium.48Staphylococcus. The antibody of claim 47 , wherein the gram positive bacterium is a species.49S. aureus.. The antibody of claim 48 , wherein the bacterium is50. The antibody of claim 49 , wherein the sdr protein is selected from the group consisting of C1fA (SdrA) claim 49 , C1fB (SdrB) claim 49 , SdrC claim 49 , SdrD and SdrE.51S. epidermidis.. The antibody of claim 48 , wherein the bacterium is52. The antibody of claim 51 , wherein the sdr protein is selected from the group consisting of SdrF claim 51 , SdrG and SdrH.53S. saprophyticus.. The antibody of claim 48 , wherein the bacterium is54. The antibody of claim 53 , wherein the sdr protein is SdrI.55S. capitis.. The antibody of claim 48 , wherein the bacterium is56. The antibody of claim 55 , wherein the sdr protein is SdrX.57S. caprae.. The antibody of claim 48 , wherein the bacterium is58. The antibody of claim 57 , wherein the sdr protein is selected from the group consisting of SdrY and SdrZ.59. The antibody of claim 44 , wherein the epitope comprises a molecule that binds to or is associated with an Sdr protein.60. The antibody of claim 59 , wherein the molecule that binds to or is associated with an Sdr protein is a component of a cell wall of a gram-positive bacteria.61. The antibody of claim 60 , wherein the molecule is peptidoglycan.62. ...

Targeted enzymatic degradation of quorum-sensing peptides

Methods and compositions for the treatment of biofilms and/or the inhibition of biofilm formation. In one embodiment, a biofilm is treated and/or biofilm formation is inhibited by a method comprising contacting a biofilm or a surface with a bifunctional ligand comprising a quorum-sensing-peptide-binding region and a protease-binding region, whereby the biofilm is treated and/or biofilm formation on the surface is inhibited.

GRAM-POSITIVE BACTERIA SPECIFIC BINDING COMPOUNDS

The present invention provides improved binding compounds capable of specifically binding Gram-positive bacteria. Binding compounds are provided that are fully human, enabling therapeutic applications in human individuals. 143-. (canceled)44. An isolated , synthetic or recombinant nucleic acid encoding one or more of a heavy chain CDR1 , CDR2 or CDR3 amino acid sequence and/or one or more of a light chain CDR1 , CDR2 , or CDR3 amino acid sequence , wherein the nucleic acid is selected from one or more of the group consisting of a heavy chain CDR1 sequence having at least 95% sequence identity to cgctttgccatgagc (SEQ ID NO:12) , a heavy chain CDR2 sequence having at least 95% sequence identity to tcgatcaataatgggaataacccatactacgcacggtcggtacaatac (SEQ ID NO:13) , a heavy chain CDR3 sequence having at least 95% sequence identity to gatcaccctagtagtggctggcccacctttgactcc (SEQ ID NO:14) , a light chain CDR1 sequence having at least 95% sequence identity to cgggccagtgaaaacgttggtgactggttggcc (SEQ ID NO:15) , a light chain CDR2 sequence having at least 95% sequence identity to aagacatctattctagaaagt (SEQ ID NO:16) , and a light chain CDR3 sequence having at least 95% sequence identity to caacactatatacgtttcccgtacact (SEQ ID NO:17).45. The nucleic acid of claim 44 , comprising:(a) the heavy chain CDR1 sequence having at least 95% sequence identity to cgctttgccatgagc (SEQ ID NO:12);(b) the heavy chain CDR2 sequence having at least 95% sequence identity to tcgatcaataatgggaataacccatactacgcacggtcggtacaatac (SEQ ID NO:13); and(c) the heavy chain CDR3 sequence having at least 95% sequence identity to gatcaccctagtagtggctggcccacctttgactcc (SEQ ID NO:14).46. The nucleic acid of claim 44 , comprising:(a) the light chain CDR1 sequence having at least 95% sequence identity to cgggccagtgaaaacgttggtgactggttggcc (SEQ ID NO:15);(b) the light chain CDR2 sequence having at least 95% sequence identity to aagacatctattctagaaagt (SEQ ID NO:16); and(c) the light chain CDR3 sequence having at least 95% ...

POLYVALENT CHIMERIC OSPC VACCINOGEN AND DIAGNOSTIC ANTIGEN

A chimeric polyvalent recombinant protein for use as a vaccine and diagnostic for Lyme disease is provided. The chimeric protein comprises epitopes of the loop 5 region and/or the alpha helix 5 region of outer surface protein C (OspC) types. The OspC types may be associated with mammalian infections. 1. A chimeric recombinant protein comprising epitopes from loop 5 region or alpha helix 5 region , or both , of two or more outer surface protein C (OspC) types.2. The chimeric recombinant protein of claim 1 , comprising epitopes from 5 to 13 OspC types.3. The chimeric recombinant protein of claim 1 , comprising epitopes from 5 OspC types.4. The chimeric recombinant protein of claim 1 , comprising epitopes from 6 OspC types.5. The chimeric recombinant protein of claim 1 , comprising epitopes from 7 OspC types.6. The chimeric recombinant protein of claim 1 , comprising epitopes from 8 OspC types.7. The chimeric recombinant protein of claim 1 , comprising epitopes from 9 OspC types.8. The chimeric recombinant protein of claim 1 , comprising epitopes from 13 OspC types.9. The chimeric recombinant protein of claim 1 , wherein said OspC types are selected from the group consisting of Smar claim 1 , PLi claim 1 , H13 claim 1 , PFiM claim 1 , SL10 claim 1 , PMit claim 1 , PKi claim 1 , Pbes claim 1 , HT22 claim 1 , Pko claim 1 , PLj7 claim 1 , VS461 claim 1 , DK15 claim 1 , HT25 claim 1 , A claim 1 , 72a claim 1 , F claim 1 , E claim 1 , M claim 1 , D claim 1 , U claim 1 , I claim 1 , L claim 1 , H claim 1 , Szid claim 1 , PHez claim 1 , PWa claim 1 , B claim 1 , K claim 1 , N claim 1 , C and T.10. The chimeric recombinant protein of claim 1 , wherein said chimeric protein has an amino acid sequence having at least 95% claim 1 , 96% claim 1 , 97% claim 1 , 98% claim 1 , 99% or more identity claim 1 , or complete (100%) identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 250 claim 1 , SEQ ID NO: 251 claim 1 , SEQ ID NO: 252 claim 1 , SEQ ID NO: ...

Polypeptides and Immunizing Compositions Containing Gram Positive Polypeptides and Methods of Use

The present invention provides isolated polypeptides isolatable from a Staphylococcus spp. Also provided by the present invention are compositions that include one or more of the polypeptides, and methods for making and methods for using the polypeptides.

ENTEROCOCCUS ANTIGENS

The present invention discloses isolated nucleic acid molecules encoding a hyperimmune serum reactive antigen or a fragment thereof as well as hyperimmune serum reactive antigens or fragments thereof from , methods for isolating such antigens and specific uses thereof. 1. A purified antibody , or at least an effective part thereof , which binds specifically to at least a selective part of the isolated hyperimmune serum-reactive antigen of SEQ ID NO: 459 or an antigenic fragment thereof , wherein the antigenic fragment consists of the amino acid sequence of amino acids 4-25 , 50-55 , 76-82 , 117-123 , 131-137 , 139-148 , 157-166 , 239-245 , 253-258 , 266-275 , 277-292 , 300-306 , 51-83 and 93-161 of SEQ ID NO: 459.2. The purified antibody or effective part thereof of claim 1 , which binds specifically to at least a selective part of the isolated hyperimmune serum-reactive antigen of SEQ ID NO: 459.3. The purified antibody or effective part thereof of claim 1 , which binds specifically to at least a selective part of an isolated antigenic fragment consisting of the amino acid sequence of amino acids 51-83 or 93-161 of SEQ ID NO: 459.4. A hybridoma cell line which produces the antibody according to .5Enterococcus faecalis. A method of treating or preventing an infection with comprising administering to an individual in need thereof the antibody according to in an effective amount.6. The antibody according toa) wherein the antibody is a monoclonal antibody;b) wherein the antibody is a humanized antibody;c) wherein the antibody is a chimeric antibody; and/ord) wherein said effective part comprises an Fab fragment.7. A composition comprising an antibody according to claim 1 , optionally containing a pharmaceutically acceptable carrier or excipient.8. A method for producing an antibody as defined in claim 1 , characterized by the following steps:{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, 'a) initiating an immune response in a non-human animal by administering an ...

MONOCLONAL ANTIBODIES THAT REACT WITH THE CAPSULE OF BACILLUS ANTHRACIS

The present disclosure relates to monoclonal antibodies that bind poly-γ-D-glutamic acid (γDPGA), which is present on the surface of . The disclosure also provides chimeric forms of the monoclonal antibodies, humanized forms of the monoclonal antibodies, and fragments thereof, as well as nucleic acids encoding the antibodies and fragments thereof. Pharmaceutical compositions including such antibodies are also disclosed herein. The disclosure further provides prophylactic, therapeutic, and diagnostic methods of using the disclosed antibodies. 1. An isolated monoclonal antibody or an antigen binding fragment thereof , comprising:a heavy chain (H) with a H-complementarity determining region (CDR)1, H-CDR2 and H-CDR3 region and a light chain (L) with a L-CDR1, L-CDR2 and L-CDR3 region, wherein;{'sub': 4', '5', '6', '7', '8', '16', '17', '18', '19', '20', '21', '22, '(a) H-CDR1 comprises the amino acid sequence set forth as amino acids 28 to 32 of SEQ ID NO: 1, H-CDR2 comprises the amino acid sequence set forth as amino acids 47 to 55 of SEQ ID NO: 1, and H-CDR3 comprises the amino acid sequence set forth as amino acids 95 to 111 of SEQ ID NO: 1, wherein Xcan be V or T, Xcan be A or R, Xcan be G or S, Xcan be N or D, Xcan be W or L, Xcan be R or K, Xcan be R or N, Xcan be D or Q, Xcan be N or Q, Xcan be D or Y, Xcan be A or Y, and Xcan be I or Y; and'}{'sub': 6', '7', '8', '11', '12', '13', '18', '19', '20', '21', '22, '(b) L-CDR1 comprises the amino acid sequence set forth as amino acids 23 to 33 of SEQ ID NO: 2, L-CDR2 comprises the amino acid sequence set forth as amino acids 48 to 55 of SEQ ID NO: 2, and L-CDR3 comprises the amino acid sequence set forth as amino acids 88 to 96 of SEQ ID NO: 2, wherein Xcan be I or V, Xcan be D or T, Xcan be F or W, Xcan be F or Y, Xcan be R or A, Xcan be T or A, Xcan be L or Q, Xcan be H or Y, Xcan be S or K, Xcan be S or H, and Xcan be P or L,'}wherein the antibody or antigen binding fragment specifically binds poly-γ-D-glutamic ...

Polypeptides and Immunizing Compositions Containing Gram Positive Polypeptides and Methods of Use

The present invention provides isolated polypeptides isolatable from a Staphylococcus spp. Also provided by the present invention are compositions that include one or more of the polypeptides, and methods for making and methods for using the polypeptides.

Pathogenic Mycobacteria-Derived Mannose-Capped Lipoarabinomannan Antigen Binding Proteins

Described herein are antigen binding proteins that bind to pathogenic mycobacteria-derived Mannose-Capped Lipoarabinomannan (ManLAM) and methods and kits for using and making the antigen binding proteins. Also described herein are antigen binding proteins that bind to the alpha 1-2 linkage mannose caps of ManLAM, antigen binding proteins that bind to a mannose cap with up to three alpha 1-2 linked mannose residues, and antigen binding proteins that bind to LAM with a mannose sugar capping motif. 1. An isolated antigen binding protein or fragment thereof (ABP) that specifically binds to an alpha 1-2 linkage mannose cap of Mannose-Capped Lipoarabinomannan (ManLAM).2. The ABP of claim 1 , wherein the ABP comprises CDR1 claim 1 , CDR2 claim 1 , and CDR3 of a polypeptide comprising amino acid sequences at least 90% identical to the amino acid sequences represented by SEQ ID NOS: 7 claim 1 , 8 claim 1 , and 9 claim 1 , respectively claim 1 , and/or SEQ ID NOS: 27 claim 1 , 28 claim 1 , and 29 claim 1 , respectively claim 1 , wherein the ABP exhibits an equilibrium dissociation constant (Kd) of between 2.268e-10 M and 5.133e-9 M for the alpha 1-2 linkage mannose cap of ManLAM claim 1 , and wherein the ABP binds to the region of ManLAM recognized by a my2F12 monoclonal antibody.32. The ABP of any one of - claims 1 , wherein the ABP comprises the amino acid sequences shown in SEQ ID NO:15 and SEQ ID NO:18.4. An isolated antigen binding protein or fragment thereof claims 1 , comprising CDR1 claims 1 , CDR2 claims 1 , and CDR3 of a polypeptide comprising amino acid sequences at least 90% identical to the amino acid sequences represented by SEQ ID NOS: 7 claims 1 , 8 claims 1 , and 9 claims 1 , respectively claims 1 , or SEQ ID NOS: 27 claims 1 , 28 claims 1 , and 29 claims 1 , respectively.5. An isolated antigen binding protein or fragment thereof that specifically binds to an alpha 1-2 linkage mannose cap of ManLAM wherein the antigen binding protein is produced from a my2F12 ...

TOXIN GENES AND METHODS FOR THEIR USE

Compositions and methods for conferring pesticidal activity to bacteria, plants, plant cells, tissues and seeds are provided. Compositions comprising a coding sequence for a delta-endotoxin polypeptide are provided. The coding sequences can be used in DNA constructs or expression cassettes for transformation and expression in plants and bacteria. Compositions also comprise transformed bacteria, plants, plant cells, tissues, and seeds. In particular, isolated delta-endotoxin nucleic acid molecules are provided. Additionally, amino acid sequences corresponding to the polynucleotides are encompassed, and antibodies specifically binding to those amino acid sequences. In particular, the present invention provides for isolated nucleic acid molecules comprising nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO:61-121 and 133-141, or the nucleotide sequence set forth in SEQ ID NO:1-60, 124-132, and 142-283, as well as variants and fragments thereof. 1. An antibody that selectively binds to a polypeptide comprising the amino acid sequence of SEQ ID NO:96. This application is a divisional of U.S. patent application Ser. No. 12/491,396, filed Jun. 25, 2009, which claims the benefit of U.S. Provisional Application Ser. No. 61/075,719, filed Jun. 25, 2008, and U.S. Provisional Application Ser. No. 61/158,137, filed Mar. 6, 2009, the contents of which are herein incorporated by reference in its entirety.The official copy of the sequence listing is submitted electronically via EFS-Web as an ASCII formatted sequence listing with a file named “APA057US02SEQLIST.txt”, created on May 14, 2013, and having a size of 1,075 kilobytes and is filed concurrently with the specification. The sequence listing contained in this ASCII formatted document is part of the specification and is herein incorporated by reference in its entirety.This invention relates to the field of molecular biology. Provided are novel genes that encode pesticidal proteins. These proteins and the ...

S. AGALACTIAE ANTIGENS I + II

The present invention discloses isolated nucleic acid molecules encoding a hyperimmune serum reactive antigen or a fragment thereof as well as hyperimmune serum reactive antigens or fragments thereof from , and methods for isolating such antigens and specific uses thereof. 115.-. (canceled)16Streptococcus agalactiae. An isolated antibody or an effective part thereof , which specifically binds to a polypeptide comprising SEQ ID NO: 364 , or a variant , analog , derivative , or fragment thereof.17. The antibody of claim 16 , wherein the antibody specifically binds to a polypeptide fragment selected from the group consisting of amino acids 399-417 claim 16 , 503-519 claim 16 , 544-563 claim 16 , 489-556 claim 16 , 386-458 claim 16 , or 458-624 amino acid of SEQ ID NO: 364.18. The antibody of claim 16 , wherein the antibody is a polyclonal antibody.19. The antibody of claim 16 , wherein the antibody is a monoclonal antibody.20. The antibody of claim 16 , wherein the antibody is a humanized antibody.21. The antibody of claim 16 , wherein the antibody is a chimeric antibody.22. The antibody of claim 16 , wherein the antibody is a single chain antibody.23. The antibody of claim 16 , wherein the antibody is bispecific antibody which binds two different epitopes.24. The antibody of claim 16 , wherein the effective part of the antibody comprises a Fab fragment.25. The antibody of claim 16 , wherein the antibody is produced by a hybridoma cell line.26. A pharmaceutical composition comprising the antibody according to .27. The pharmaceutical composition of claim 26 , wherein the antibody specifically binds to a polypeptide fragment selected from the group consisting of amino acids 399-417 claim 26 , 503-519 claim 26 , 544-563 claim 26 , 489-556 claim 26 , 386-458 claim 26 , or 458-624 of SEQ ID NO: 364.28S. agalactiae. The pharmaceutical composition of claim 26 , wherein the pharmaceutical composition further comprises at least one or more antibodies against other polypeptides ...

Engineered Type IV Pilin of Clostridium difficile

The present invention relates to engineered Clostridium difficile type IV pilin (tfp) genes, type IV pilin proteins which can serve as a diagnostic marker for identification of patients infected with C. difficile , and vaccines comprising type IV pilin proteins, antigenic fragments and variants thereof for therapeutic interventions.

AFFINITY CHROMATOGRAPHY MATRIX

The present invention relates to a method of separating one or more immunoglobulin containing proteins from a liquid. The method includes first contacting the liquid with a separation matrix comprising ligands immobilised to a support; allowing the immunoglobulin containing proteins to adsorb to the matrix by interaction with the ligands; followed by an optional step of washing the matrix containing the immunoglobulin containing proteins adsorbed thereon; and recovering said immunoglobulin containing proteins by contacting the matrix with an eluent which releases the proteins. The method improves upon previous separation methods in that each of the ligands comprises one or more of a protein A domain (E, D, A, B, C), or protein Z, or a functional variant thereof, with at least one of the monomers having a substitution of the Asparagine or Histidine at the position corresponding to H18 of B domain of Protein A or Protein Z, and wherein the ligand provides an increase in elution pH compared to non-substituted ligand. 1: A method of separating one or more immunoglobulin containing proteins from a liquid , which method comprises:(a) contacting the liquid with a separation matrix comprising ligands immobilised to a support;(b) allowing said immunoglobulin containing proteins to adsorb to the matrix by interaction with the ligands;(c) an optional step of washing the immunoglobulin containing protein adsorbed matrix;(d) recovering said immunoglobulin containing proteins by contacting the matrix with an eluent which releases the proteins;the improvement being that each of said ligands comprises one or more domains (monomers) of staphylococcal Protein A (SpA) (E, D, A, B, C) or protein Z or a functional variant thereof, wherein in at least one of the one or more monomers, the Asparagine or Histidine at the position corresponding to H18 of B domain of Protein A or Protein Z has been substituted with another amino acid, and wherein the ligand provides an increase in elution pH ...

OLIGOSACCHARIDES AND OLIGOSACCHARIDE-PROTEIN CONJUGATES DERIVED FROM CLOSTRIDIUM DIFFICILE POLYSACCHARIDE PS-II, METHODS OF SYNTHESIS AND USES THEREOF, IN PARTICULAR AS A VACCINE

The present invention provides an oligosaccharide-protein conjugate comprising an oligosaccharide, in particular synthetic oligosaccharide, derived from the repeating unit of the glycopolymer PS-II and a protein carrier. More specifically, the oligosaccharide is the hexasaccharide having the following formula (I) wherein R is a linker or spacer group. In a specific embodiment of the invention, R is (CH2)NH, with n being an integer from 2 to 50. The present invention also provides the use of said oligosaccharide and said oligosaccharide-protein conjugate for the treatment or prevention of a disease caused by the pathogen In still further aspects, the present invention also provides a favourable method for preparing said oligosaccharide and said oligosaccharide-protein conjugate. 1Clostridium difficile. An oligosaccharide-protein conjugate comprising an oligosaccharide representing part of a repeating unit of the glycopolymer PS-II and a protein carrier.3. The oligosaccharide-protein conjugate according to claim 2 , wherein R is an aliphatic or aromatic residue comprising a reactive functional group.4. The oligosaccharide-protein conjugate according to claim 3 , wherein R is (CH)NH claim 3 , with n being an integer from 2 to 50.5. The oligosaccharide-protein conjugate according to claim 1 , wherein the protein carrier is selected from the group consisting of diphtheria toxoid Crm claim 1 , tetanus toxoid claim 1 , outer membrane protein (OMP) claim 1 , bovine serum albumin claim 1 , and keyhole limpet hemocyanine6. The oligosaccharide-protein conjugate according to claim 2 , wherein the protein carrier is diphtheria toxoid Crm.8. The hexasaccharide according to claim 7 , wherein R is (CH)NH claim 7 , with n being an integer from 2 to 50.10Clostridium difficile.. The hexasaccharide according to claim 7 , which is effective to treat or prevent a disease caused by the pathogen11Clostridium difficile.. The oligosaccharide-protein conjugate according to claim 1 , which is ...

Novel Insecticidal Proteins and Methods for Their Use

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest, as probes for the isolation of other homologous (or partially homologous) genes. The insecticidal proteins find use in controlling, inhibiting growth or killing lepidopteran, coleopteran, dipteran, fungal, hemipteran, and nematode pest populations and for producing compositions with insecticidal activity. 1. A recombinant nucleic acid molecule encoding a PIP-1 polypeptide having insecticidal activity against an insect pest in the order Hemiptera and/or an insect pest in the order Lepidoptera.2. The recombinant nucleic acid molecule of claim 1 , wherein the PIP-1 polypeptide comprises any one or more amino acid motifs as represented by positions 171-183 of SEQ ID NO: 213; positions 149-159 of SEQ ID NO: 213; and positions 64-79 of SEQ ID NO: 213.4. The recombinant nucleic acid molecule of claim 1 , or wherein the PIP-1 polypeptide has at least 80% identity to the amino acid sequence of SEQ ID NO: 2.5. The recombinant nucleic acid molecule of selected from:a) a recombinant nucleic acid molecule comprises a polynucleotide of SEQ ID NO: 1, a fragment or a complement thereof;b) a recombinant nucleic acid molecule a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 2 or a fragment thereof;c) a recombinant nucleic acid molecule that hybridizes under stringent conditions to a polynucleotide of SEQ ID NO: 1;d) a recombinant nucleic acid molecule having a polynucleotide sequence of SEQ ...

Staphylococcus aureus Specific Human Recombinant Polyclonal Antibodies and Uses Thereof

Human antibodies that bind to one or more strains strains, including methicillin resistant strains, are disclosed. Also disclosed are human recombinant polyclonal antibody compositions, and therapeutic methods for using the antibodies. 144.-. (canceled)45Staphylococcus aureusS. aureusS. aureusS. aureus;. A method for treating or preventing () infection in a mammal , the method comprising administering an effective amount of a recombinant monoclonal antibody mixture , wherein the antibody mixture comprises at least two human antibodies , each of which binds to and neutralizes a toxin or antigen conserved among at least three different strains ofand wherein each antibody in the antibody mixture binds an epitope that is not bound by another member of the antibody mixture.46. The method of claim 45 , wherein the mammal is a human.47Staphylococcus aureusStaphylococcus aureus. The method of claim 45 , wherein the infection is a methicillin-resistant (MRSA) infection.48Staphylococcus aureusStaphylococcus aureus. The method of claim 45 , wherein the infection is a methicillin-sensitive (MSSA) infection.49Staphylococcus aureusStaphylococcus aureus. The method of claim 45 , wherein the infection is a vancomycin-resistant (VRSA) infection.50Staphylococcus aureusStaphylococcus aureus. The method of claim 45 , wherein the infection is a vancomycin-intermediate (VISA) infection.51. (canceled)52. The method of claim 45 , wherein the antibody mixture comprises at least one of the antibodies identified in Table 2.53. The method of claim 52 , wherein the antibody mixture comprises at least 3 of the antibodies identified in Table 2.54S. aureus. The method of claim 45 , wherein the at least three different strains of includes at least one of the strains identified in Table 4.55S. aureus. The method of claim 54 , wherein the at least three different strains of includes at least five of the strains identified in Table 4.56. The method of claim 45 , wherein the antibody mixture comprises ...

COMPOSITIONS AND METHODS RELATED TO ANTIBODIES TO STAPHYLOCOCCAL PROTEINS ISDA OR ISDB

The present invention concerns methods and compositions for treating or preventing a bacterial infection, particularly infection by a bacterium. The invention provides methods and compositions for providing a passive immune response against the bacteria. In certain embodiments, the methods and compositions involve an antibody, such as a recombinant antibody, that binds IsdA and/or IsdB polypeptides. 1. A recombinant and isolated antibody , or antigen-binding portion thereof , that binds to a Staphylococcal IsdA and/or a Staphylococcal IsdB polypeptide wherein said antibody competes for binding of the polypeptide with a 3D8 , 4H7 , 2A9 , 4B9 , 7E9 , 1B8 , 5H8 , 7D4 and/or 3H11 monoclonal antibody.23-. (canceled)4. The antibody claim 1 , or antigen-binding portion thereof claim 1 , of claim 1 , wherein said antibody claim 1 , or antigen-binding portion thereof claim 1 , comprises:{'sub': 1', '2', '3', '4', '5', '1', '2', '3', '4', '5, '(a) a light chain variable region CDR1 sequence comprising the amino acid sequence QZZZZSNGZTY, wherein Zis S or N; Zis L or I; Zis V or L; Zis H or Y and Zis Y, N or K;'}(b) a light chain variable region CDR2 sequence comprising the amino acid sequence KVS;{'sub': 6', '7', '8', '9', '10', '11', '6', '7', '8', '9', '10', '11, '(c) a light chain variable region CDR3 sequence comprising the amino acid sequence ZQZZHZZPZT, wherein Zis F or S; Zis G, T or S, Zis S or T, Zis V or I, Zis absent or, if present, is P and Zis Y, L or F;'}{'sub': 12', '13', '14', '15', '12', '13', '14', '15, '(d) a heavy chain variable region CDR1 sequence comprising the amino acid sequence GZTFZZYZ, wherein Zis Y or F; Zis T, G or S, Zis E, K, S or D, and Zis T, G or S;'}{'sub': 16', '17', '18', '19', '20', '21', '22', '16', '17', '18', '19', '20', '21', '22, '(e) a heavy chain variable region CDR2 sequence comprising the amino acid sequence IZZZZZZZ, wherein Zis D, N or S; Zis P, R or E, Zis S, D or N; Zis N or G; Zis G or S; Zis D, S or Y; and Zis T or I; and ...

Depleted anti-staphylococcal enterotoxins polyclonal antibodies, preparation and uses thereof

The present invention relates to the preparation of a set of depleted polyclonal antibodies, each depleted polyclonal antibody being raised against one specific staphylococcal enterotoxin, and its use for multiplex detection.

Methods of Improving the Therapeutic Efficacy and Utility of Antibody Fragments

The present disclosure relates to methods and uses of improving the therapeutic efficacy and utility of antibody fragments by employing anti-epitope-tagging technologies.

NEUROTOXINS EXHIBITING SHORTENED BIOLOGICAL ACTIVITY

The present invention relates to the pharmaceutical field. Specifically, it contemplates a polynucleotide encoding a Neurotoxin polypeptide exhibiting a reduced duration of biological effect in a subject, wherein the polypeptide comprises at least one degradation signal in the light chain as well as vectors and host cells comprising the polynucleotide, polypeptides encoded thereby and antibodies specifically binding to the polypeptides. Moreover, the invention relates to medicaments comprising the polynucleotides and polypeptides as well as specific therapeutic applications thereof. Furthermore, the present invention contemplates methods for the manufacture of the polypeptides and medicaments. 1. A modified neurotoxin polypeptide exhibiting a reduced duration of a biological effect in a subject , wherein the neurotoxin polypeptide comprises at least one degradation signal in a light chain of the neurotoxin polypeptide , wherein the degradation signal in the light chain of the neurotoxin polypeptide is selected from:a) at least one internally or terminally introduced PEST motif;b) at least one internally or terminally introduced E3 ligase recognition motif;c) an N-terminal oligo-lysine residue;d) an N-terminally linked ubiquitin;e) a substitution of the N-terminal proline with a basic amino acid;f) substitutions of surface displayed amino acid residues with lysine; andg) a substitution of the N-terminal proline with a basic amino acid in combination with substitutions of surface displayed amino acid residues with lysine.2. The modified neurotoxin polypeptide of claim 1 , wherein the biological effect causes muscle paralysis in the subject.3. The modified neurotoxin polypeptide of claim 1 , wherein the duration of the biological effect in a subject persists less than 4 claim 1 , 3 or 2 weeks.4. The modified neurotoxin polypeptide of claim 1 , wherein the light chain of the neurotoxin polypeptide exhibiting a reduced duration of a biological effect in a subject is a ...

NOVEL IMMUNOGLOBULIN-BINDING PROTEINS WITH IMPROVED SPECIFICITY

The present invention relates to modified immunoglobulin-binding proteins, e.g., protein A, having improved binding specificity for immunoglobulins and methods of making and using the same. 1. A method of affinity purifying one or more immunoglobulins from a sample , the method comprising the steps of:(a) providing a sample comprising one or more immunoglobulins;(b) contacting the sample with a chromatograph matrix under conditions such that the one or more immunoglobulins bind to the matrix, wherein the chromatography matrix comprises an immunoglobulin-binding protein comprising one or more isolated domains comprising the amino acid sequence set forth in SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:12 or a sequence at least 90% identical to SEQ ID NOs:10, 11 or 12, and wherein the one or more isolated domains comprise: (i) at least the glycine residue at position 29 replaced with an amino acid residue other than alanine, threonine or tryptophan when the domain comprises the amino acid sequence set forth in SEQ ID NO:10 or 11, or an amino acid sequence having at least 90% identity to SEQ ID NO: 10 or II or (ii) at least the alanine at position 29 replaced with an amino acid residue other than glycine, threonine or tryptophan when the domain comprises the amino acid sequence set forth in SEQ NO:12 or an amino acid sequence having at least 90% identity to SEQ ID NO:12, and(c) recovering the one or more bound immunoglobulins by eluting under suitable conditions.2. The method of claim 1 , wherein the one or more immunoglobulins is selected from the group consisting of IgG claim 1 , IgA or IgM claim 1 , or a fragment thereof.3. The method of claim 1 , wherein the one or more immunoglobulins is an IgG or a fragment thereof.4. The method of claim 1 , wherein the immunoglobulin-binding protein binds an Fc portion of the one or more immunoglobulins but exhibits reduced binding to a Fab portion of the one or more immunoglobulins relative to wild-type protein A.5. The method of ...

Synthetic lta mimetics and use thereof as vaccine component for therapy and/or prophylaxis against gram-positive infections

The present invention relates to synthetic lipoteicoic acid (LTA) mimetics which are useful as vaccine components for therapy and/or prophylaxis of bacterial infection.

Axmi-205 pesticidal gene and method for its use

Compositions and methods for conferring pesticidal activity to bacteria, plants, plant cells, tissues and seeds are provided. Compositions comprising a coding sequence for pesticidal polypeptides are provided. The coding sequences can be used in DNA constructs or expression cassettes for transformation and expression in plants and bacteria. Compositions also comprise transformed bacteria, plants, plant cells, tissues, and seeds. In particular, isolated pesticidal nucleic acid molecules are provided. Additionally, amino acid sequences corresponding to the polynucleotides are encompassed. In particular, the present invention provides for nucleic acid molecules comprising nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO:2, 3, or 4, the nucleotide sequence set forth in SEQ ID NO:1, 9, 10, or 11, as well as variants and fragments thereof.

AXMI-205 PESTICIDAL GENE AND METHOD FOR ITS USE

Compositions and methods for conferring pesticidal activity to bacteria, plants, plant cells, tissues and seeds are provided. Compositions comprising a coding sequence for pesticidal polypeptides are provided. The coding sequences can be used in DNA constructs or expression cassettes for transformation and expression in plants and bacteria. Compositions also comprise transformed bacteria, plants, plant cells, tissues, and seeds. In particular, isolated pesticidal nucleic acid molecules are provided. Additionally, amino acid sequences corresponding to the polynucleotides are encompassed. In particular, the present invention provides for nucleic acid molecules comprising nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO:2, 3, or 4, the nucleotide sequence set forth in SEQ ID NO:1, 9, 10, or 11, as well as variants and fragments thereof. 1a) a polypeptide comprising the amino acid sequence of any of SEQ ID NO:2, 3, 4, 5, 6, 7, or 8;b) a polypeptide comprising an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO:2, 3, 4, 5, 6, 7, or 8, wherein said amino acid sequence has pesticidal activity;c) a polypeptide that is encoded by the nucleotide sequence of SEQ ID NO:1; andd) a polypeptide that is encoded by a nucleotide sequence which will hybridize under stringent hybridization conditions to the complement of the nucleotide sequence of any of SEQ ID NO:1, 9, 10, 11 or 12, wherein said nucleotide sequence encodes a polypeptide having pesticidal activity, and wherein said hybridization conditions comprise hybridization for 4 to 12 hours in 50% formamide, 1 M NaCl, and 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C.. An antibody that selectively binds to a recombinant polypeptide with pesticidal activity, wherein said recombinant polypeptide is selected from the group consisting of: This application is a divisional of U.S. patent application Ser. No. 12/828,594, filed Jul. 1, 2010, which claims ...

CLOSTEROVIRUS-BASED NUCLEIC ACID MOLECULES AND USES THEREOF

The present invention relates to novel nucleic acid molecules for producing target polypeptides in plant cells. More specifically, the novel nucleic acid molecules comprise a minireplicon derived from a Closteroviridae virus and heterologous polynucleotides encoding the target polypeptides. Also provided are compositions comprising the target polypeptides and uses thereof. 142-. (canceled)43. An isolated nucleic acid molecule for producing two or more target polypeptides in a plant cell , comprising a minireplicon derived from a Closteroviridae virus and two or more heterologous polynucleotides , wherein the nucleic acid molecule is capable of replicating in the plant cell , and wherein the two or more heterologous polynucleotides encode the two or more target polypeptides.44. The nucleic acid molecule of claim 43 , wherein the Closteroviridae virus is Beet yellows virus.45. The nucleic acid molecule of claim 43 , wherein the plant cell is in a plant claim 43 , a plant part claim 43 , or a cell culture medium.46. The isolated nucleic acid molecule of claim 43 , further comprising a polynucleotide encoding one or more movement proteins derived from the Closteroviridae virus.47. The isolated nucleic acid molecule of claim 43 , wherein the two or more target polypeptides comprise two or more subunits of a protein claim 43 , and wherein the two or more target polypeptides are capable of forming the protein in the plant cell.48. The isolated nucleic acid molecule of claim 47 , wherein the protein is an enzyme.49. The isolated nucleic acid molecule of claim 43 , wherein the two or more target polypeptides comprise a first polypeptide and a second polypeptide claim 43 , and wherein the first polypeptide is capable of modifying the second polypeptide in the plant cell.50. The isolated nucleic acid molecule of claim 43 , wherein the two or more target polypeptides comprise a first polypeptide and a second polypeptide claim 43 , and wherein the first polypeptide is capable of ...

High Affinity Antibodies That Neutralize Staphylococcus Enterotoxin B

Provided herein are antibodies that specifically bind and neutralize enterotoxin B. In addition, nucleic acids encoding such antibodies, and cells that express such antibodies are provided. Also provided are methods for treating diseases mediated by, and for neutralizing enterotoxin B. 1Staphylococcus. A recombinant antibody , said antibody comprising a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO: 68 , a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO: 69 , and a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO: 70 , a light chain CDR1 comprising the amino acid sequence of SEQ ID NO: 56 , a light chain CDR2 comprising the amino acid sequence of SEQ ID NO: 57 , and a light chain CDR3 comprising the amino acid sequence of SEQ ID NO: 58 , or an antigen-binding fragment thereof , that binds to enterotoxin B with a dissociation constant (K) of less than 3×10M.2. The antibody of claim 1 , wherein the heavy chain variable domain comprises the amino acid sequence of SEQ ID NO: 176 and the light chain variable domain comprises the amino acid sequence of SEQ ID NO: 174 claim 1 , or an antigen-binding fragment thereof.3. The antibody of claim 1 , wherein the heavy chain comprises the amino acid sequence of SEQ ID NO: 30 and the light chain comprises the amino acid sequence of SEQ ID NO: 28 claim 1 , or an antigen-binding fragment thereof.4. The antibody of claim 1 , or an antigen-binding fragment thereof claim 1 , wherein the affinity of the antibody is less than about 1×10M.5. The antibody of claim 1 , or an antigen-binding fragment thereof claim 1 , wherein the affinity of the antibody is less than about 3×10M.6. A composition comprising the antibody or antigen-binding fragment of and a pharmaceutically acceptable carrier.7Staphylococcus. A recombinant antibody claim 1 , said antibody comprising a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO: 130 claim 1 , a heavy chain CDR2 comprising the amino acid ...

Emp2 antibodies and their therapeutic uses

The present invention provides methods and compositions useful in the treatment or prevention of Chlamydia infections and cancer. The methods and compositions inhibit the entry of Chlamydia into a host cell expressing EMP2 by interfering with the interaction between the Chlamydia and EMP2. The methods and compositions target cancers which express or overexpress EMP2 nucleic acids and polypeptides by targeting EMP2.

ANTIBODIES OR FRAGMENTS THEREOF DIRECTED AGAINST A STAPHYLOCOCCUS AUREUS EPITOPE OF ISAA OR ISAB

The invention concerns antibodies or fragments thereof that are directed against a epitope. 1. A method of treating infection , comprising:administering to an infected animal, or an animal at risk of contracting an infection, an isolated antibody or fragment thereof, wherein said antibody or fragment thereof:{'i': 'Staphylococcus aureus', '(a) binds to an immunodominant antigen IsaA epitope and is secreted by the hybridoma cell line deposited at the DSMZ under accession number DSM ACC2987,'}{'i': 'Staphylococcus aureus', '(b) binds to an immunodominant antigen IsaA epitope selected from the group consisting of: SEQ ID NO: 15, 17 to 19, 21 to 26, 32 to 34 and 57,'}{'i': 'Staphylococcus aureus', '(c) binds to an immunodominant antigen IsaB epitope and is secreted by the hybridoma cell line deposited at the DSMZ under accession number DSM ACC2988, or'}{'i': 'Staphylococcus aureus', '(d) binds to an immunodominant antigen IsaB epitope and comprises a heavy chain variable region and a light chain variable region, wherein the sequence of the heavy chain variable region comprises SEQ ID NO:6 and the sequence of the light chain variable region comprises SEQ ID NO:8.'}2. The method of claim 1 , wherein the animal is human.3Staphylococcus aureus.. The method of claim 1 , wherein the animal is infected by4. The method of claim 1 , wherein the animal has a mastitis or a sepsis caused by the infection.5Staphylococcus aureus. A method of detecting claim 1 , comprising:{'i': 'Staphylococcus aureus', 'contacting an isolated antibody or fragment thereof with a sample suspected of comprising , wherein said antibody or fragment thereof{'i': 'Staphylococcus aureus', '(a) binds to an immunodominant antigen IsaA epitope and is secreted by the hybridoma cell line deposited at the DSMZ under accession number DSM ACC2987,'}{'i': 'Staphylococcus aureus', '(b) binds to an immunodominant antigen IsaA epitope selected from the group consisting of: SEQ ID NO: 15, 17 to 19, 21 to 26, 32 to 34 and ...

ANTIBODIES THAT SPECIFICALLY BIND STAPHYLOCOCCUS AUREUS ALPHA TOXIN AND METHODS OF USE

Herein provided are compositions, methods of manufacture and methods of use pertaining to anti-alpha toxin antibodies and fragments. 184-. (canceled)85Staphylococcus aureus. An isolated antibody or antigen-binding fragment thereof , wherein the isolated antibody or antigen-binding fragment thereof immunospecifically binds to a alpha toxin polypeptide and comprises:(a) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 7, 10, 13 or 69;(b) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 8, 11, 14, 17, 70 or 75;(c) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 9, 12, 15, 18, 16, 65, 66, 67, 71, 72, 76 or 78;(d) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 1 or 4;(e) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 2, 5, 73 or 77; and(f) a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 3, 6, 64, 68 or 74.86. The antibody or antigen binding fragment of claim 85 , wherein the VH CDR1 claim 85 , VH CDR2 claim 85 , VH CDR3 claim 85 , VL CDR1 claim 85 , VL CDR2 and VL CDR3 correspond to the amino acid sequences of SEQ ID NOs: 7 claim 85 , 8 claim 85 , 9 claim 85 , 1 claim 85 , 2 and 3; SEQ ID NOs: 10 claim 85 , 11 claim 85 , 12 claim 85 , 1 claim 85 , 2 and 3; SEQ ID NOs: 13 claim 85 , 14 claim 85 , 15 claim 85 , 4 claim 85 , 5 and 6; SEQ ID NOs: 7 claim 85 , 17 claim 85 , 18 claim 85 , 1 claim 85 , 2 and 3; SEQ ID NOs: 7 claim 85 , 8 claim 85 , 16 claim 85 , 1 claim 85 , 2 and 64; SEQ ID NOs: 7 claim 85 , 8 claim 85 , 65 claim 85 , 1 claim 85 , 2 and 64; SEQ ID NOs; 7 claim 85 , 8 claim 85 , 66 claim 85 , 1 claim 85 , 2 and 64; SEQ ID NOs: 7 claim 85 , 8 claim 85 , 67 claim 85 , 1 claim 85 , 2 and 68; SEQ ID NOs: 7 claim 85 , 8 claim 85 , 67 claim 85 , 1 claim 85 , 2 and 64; SEQ ID NOs: 7 claim 85 , 8 claim 85 , 78 claim 85 , 1 claim 85 , 2 and 64; SEQ ID NOs: 7 claim 85 , 8 claim 85 , 65 claim 85 , 1 claim 85 , 2 and 68; SEQ ID NOs: 69 claim 85 , 70 claim 85 , 71 claim 85 , 1 claim 85 , 2 and 68; SEQ ID NOs: ...

METHODS AND MEANS FOR THE PRODUCTION OF IG-LIKE MOLECULES

The invention provides means and methods for producing one or more Ig-like molecules in a single host cell. Novel CH3 mutations enabling the production of monospecific and/or bispecific Ig-like molecules of interest are also provided. 2. The method of claim 1 , further comprising providing said host cell with a nucleic acid molecule encoding a common light chain.3. The method of claim 1 , wherein said first CH3-domain comprising polypeptide chain comprises the amino acid substitution T366K claim 1 , and said second CH3-domain comprising polypeptide chain comprises the amino acid substitution L351D.4. The method of claim 3 , wherein said first CH3-domain comprising polypeptide chain further comprises the amino acid substitution L351K.5. The method of claim 3 , wherein said second CH3-domain comprising polypeptide chain further comprises an amino acid substitution selected from the group consisting of Y349E claim 3 , Y349D and L368E.6. The method of claim 5 , wherein said second CH3-domain comprising polypeptide chain further comprises the amino acid substitution L368E.7. The method of claim 1 , wherein said third CH3-domain comprising polypeptide chain comprises the amino acid substitutions E356K and D399K claim 1 , and said fourth CH3-domain comprising polypeptide chain comprises the amino acid substitutions K392D and K409D.8. The method of claim 1 , wherein each of the CH3-domain comprising polypeptide chains further comprises a variable region recognizing a target epitope.9. The method of claim 8 , wherein each of the 4 variable regions of the 4 CH3-domain comprising polypeptide chains recognizes different target epitopes.10. The method of claim 8 , wherein the variable regions of the 1and the 2CH3-domain comprising polypeptide chains recognize different target epitopes claim 8 , whereas the variable regions of the 3and the 4CH3-domain comprising polypeptide chains recognize the same target epitopes.11. The method of wherein the target epitope recognized by the ...

METHOD OF PREPARING ANTIGEN FOR ACQUIRING ANTI-HYDROPHOBIC PEPTIDE ANTIBODY

The object of the present invention is to provide a method to obtain an antibody for a hydrophobic peptide, which can be used for general purposes easily and with great reliability. Also provided is a method for preparing an antigen characterized in that a hydrophobic peptide, which is unbound to carrier protein, is used as high-molecular-weight aggregates in an aqueous solution containing a nonionic surfactant. 1. A method of preparing an antigen , wherein a hydrophobic peptide unbound to carrier protein is turned into high-molecular-weight aggregates in an aqueous solution containing a nonionic surfactant.2. The method of preparing an antigen according to claim 1 , wherein the nonionic surfactant is at least one selected from the group consisting of polyoxyethylene (20) sorbitan monolaurate claim 1 , polyoxyethylene (20) sorbitan monooleate claim 1 , polyoxyethylene (8) octylphenyl ether claim 1 , polyoxyethylene (9) octylphenyl ether claim 1 , polyethylene glycol (12) claim 1 , polyethylene glycol (24) claim 1 , polyethylene glycol (60) dodecyl ether and polyethylene glycol cholesterol derivatives.3. The method of preparing an antigen of claim 1 , wherein the high-molecular-weight aggregates of hydrophobic peptide having a molecular weight equal to or greater than 100 kDa account for 20% by mass or more of a total peptide amount in the molecular weight distribution of the aqueous solution containing the nonionic surfactant.4. The method of preparing an antigen according to claim 1 , wherein the hydrophobic peptide is a peptide which forms aggregates having molecular weights equal to or greater than 10 claim 1 ,000 when added to pure water.5. The method of preparing an antigen according to claim 1 , wherein the sequence of the hydrophobic peptide is MLPGLALLLLAAWTARA (SEQ ID NO: 1) claim 1 , FGGYQVNPYVGFEMGYDWLGRMPY (SEQ ID NO: 2) claim 1 , or FLFCWILMILVVLTFVVGANVEK (SEQ ID NO: 3).6. The method of preparing an antigen according to claim 1 , comprising the ...

Immunogenic Composition Comprising Alpha-Hemolysin Oligopeptides

The present invention provides immunogenic compositions useful in prevention and treatment of infection. In particular, the present invention provides methods of inducing an immune response against an alpha-hemolysin-expressing , methods of preventing or treating infections, and composition for preventing or treating infections. 1. An isolated oligopeptide at least 55 amino acids in length but no more than 100 amino acids in length , comprising a first amino acid sequence at least 85% identical to amino acids 27-88 of SEQ ID NO:2.2. The oligopeptide of claim 1 , wherein said first amino acid sequence is at least 90% or at least 95% identical to amino acids 27-88 of SEQ ID NO:2.3. (canceled)4. The oligopeptide of claim 2 , comprising amino acids 27-88 of SEQ ID NO:2.5. The oligopeptide of claim 1 , further comprising a second amino acid sequence identical to amino acids 249-262 of SEQ ID NO:2 claim 1 , or identical except for up to three single amino acid substitutions claim 1 , insertions claim 1 , or deletions.6. The oligopeptide of claim 5 , wherein the second amino acid sequence is identical to amino acids 249-262 of SEQ ID NO:2.7. (canceled)8. The oligopeptide of claim 5 , further comprising a linker between the first amino acid sequence and the second amino acid sequence.9. The oligopeptide of claim 5 , wherein the linker comprises at least one claim 5 , but no more than 15 amino acids selected from the group consisting of glycine claim 5 , serine claim 5 , alanine claim 5 , or a combination thereof.10. (canceled)11. The oligopeptide of claim 1 , which comprises a calculated molecular energy of less than −3000 kcal/mol.1216-. (canceled)17. The oligopeptide of further comprising a heterologous amino acid sequence.1824-. (canceled)25. An isolated polynucleotide comprising a nucleic acid which encodes the oligopeptide of .2627-. (canceled)28. A vector comprising the polynucleotide of .2930-. (canceled)31. A host cell comprising the vector of .3233-. (canceled)34. ...

PROCESS FOR PRODUCING PROTEIN A-LIKE PROTEIN WITH USE OF BREVIBACILLUS GENUS BACTERIUM

The present invention relates to an efficient and economical process for producing a protein A-like protein. Hosts such as and have been used in the production of a protein A-like protein using a genetic recombination technique and however, their low productivity has been a big cause of high cost. Thus, it has been desired strongly to immediately establish a technique enabling the inexpensive, large-scale production of a protein A-like protein using recombinant DNA techniques other than and . The present invention provides a process for producing a protein A-like protein in large amounts, for example, a process comprising allowing a recombinant genus bacterium to express and secrete the protein in large amounts into a culture solution and separating and collecting the accumulated protein A-like protein from the culture solution. 1. An isolated DNA sequence comprising{'i': 'Brevibacillus', 'a promoter which has a promoter activity when said isolated DNA sequence is transformed into a genus bacterium, and'}a DNA sequence encoding a protein A-like protein which is any one of the following DNAs (a) to (c):(a) a protein substantially identical to protein A,(b) a protein comprising protein A-constituting immunoglobulin-binding domain E, D, A, B, and C rearranged' in an arbitrary order,(c) a partial sequence of protein A.2. The DNA sequence according to claim 1 ,wherein the protein A-like protein is obtained by removing signal sequence S and cell wall-binding domain X from protein A.3. The DNA sequence according to claim 1 ,{'i': 'Brevibacillus', 'wherein the promoter is a promoter of a cell wall protein of a genus bacterium, and'}{'i': Brevibacillus', 'Brevibacillus, 'the DNA sequence further comprises downstream of the promoter, a Shine-Dalgarno sequence which is capable of functioning a genus bacterium and a secretion signal peptide-encoding DNA sequence which is capable of functioning in a genus bacterium.'}4. An expression vector comprising a DNA sequence according to ...

IMMUNOGENIC COMPOSITION

The present invention relates to fusion proteins comprising fragments of toxin A and toxin B from , such as wherein the first fragment and the second fragment are adjacent to one another and wherein the first repeat portion and the second repeat portion have sequence similarity to one another. 1. A polypeptide comprising a first fragment and a second fragment , wherein(i) the first fragment is a toxin A repeating domain fragment;(ii) the second fragment is a toxin B repeating domain fragment;(iii) the first fragment comprises a first proximal end within a first repeat portion;(iv) the second fragment comprises a second proximal end within a second repeat portion; andwherein the first fragment and the second fragment are adjacent to one another and wherein the first repeat portion and the second repeat portion have sequence similarity to one another.2. The polypeptide of wherein the first repeat portion and the second repeat portion have high structural similarity to one another.32. The polypeptide of any one of - wherein the polypeptide elicits antibodies that neutralize toxin A or toxin B or both.43C.difficile.. The polypeptide of any one of - wherein the polypeptide elicits a protective immune response in a mammalian host against strains of54. The polypeptide of any one of - wherein the first fragment and the second fragment comprise less than 25% claims 1 , 20% claims 1 , 18% or 15% alpha helical structure.65. The polypeptide of any one of - wherein the first fragment and the second fragment comprise more than 25% claims 1 , 30% claims 1 , 35% claims 1 , 38% or 40% beta sheet structure.76. The polypeptide of any one of - wherein the first proximal end is within repeat portion VII or repeat portion VIII of toxin A.87. The polypeptide of any one of - wherein the second proximal end is within repeat portion II or repeat portion I of toxin B.9. The polypeptide of wherein the first proximal end is within repeat portion VII of toxin A.10. The polypeptide of wherein the ...

S. AUREUS POLYPEPTIDE AND ANTIBODIES

The invention relates to antigenic polypeptides expressed by pathogenic microbes, vaccines comprising said polypeptides; therapeutic antibodies directed to said polypeptides and methods to manufacture said polypeptides, vaccines and antibodies. 1. An isolated antibody , or an effective binding part thereof , which binds an isolated antigenic polypeptide encoded by an isolated nucleic acid consisting of SEQ ID NO: 6.2. The antibody of claim 1 , wherein the antibody is a polyclonal or monoclonal antibody.3. The antibody of claim 1 , wherein the antibody is a chimeric antibody produced by recombinant methods to contain the variable region of said antibody with an invariant or constant region of a human antibody.4. The antibody of claim 1 , wherein the antibody is humanized by recombinant methods to combine the complementarity determining regions of said antibody with both the constant (C) regions and the framework regions from the variable (V) regions of a human antibody.5. The antibody according to wherein the antibody is an opsonic antibody.6. A method for preparing a hybridoma cell-line comprising the steps of:i) immunizing an immunocompetent mammal with a polypeptide comprising an amino acid sequence of SEQ ID NO: 13;ii) fusing lymphocytes of the immunized immunocompetent mammal with myeloma cells to form hybridoma cells;iii) screening monoclonal antibodies produced by the hybridoma cells of step (ii) for binding activity to the polypeptide of i);iv) culturing the hybridoma cells to proliferate and/or to secrete said monoclonal antibody; andv) recovering the monoclonal antibody from the culture supernatant.7. An isolated antibody claim 1 , or an effective binding part thereof claim 1 , which binds an isolated antigenic polypeptide consisting of SEQ ID NO: 13 claim 1 , or an isolated antigenic polypeptide having at least 95% claim 1 , 98% or 99% identity to SEQ ID NO: 13.8. The antibody of claim 7 , wherein the antibody is a polyclonal or monoclonal antibody.9. The ...

HUMAN BINDING MOLECULES HAVING KILLING ACTIVITY AGAINST ENTEROCOCCI

Described are human binding molecules specifically binding to enterococci and having killing activity against enterococci, nucleic acid molecules encoding the human binding molecules, compositions comprising the human binding molecules and methods of identifying or producing the molecules. The molecules can be used, for example, in the diagnosis, prophylaxis, and/or treatment of a condition resulting from 119.-. (canceled)20EnterococcusStaphylococcus aureus.. A human monoclonal antibody having opsonic phagocytic killing activity against at least one strain of each of at least two different species and against at least one strain of21. The human monoclonal antibody of selected from the group consisting of antibodies comprising the variable regions of any one of antibodies CR5140 claim 20 , CR5157 claim 20 , CR5166 claim 20 , CR6016 claim 20 , CR6043 claim 20 , CR6050 claim 20 , CR6078 claim 20 , CR6087 claim 20 , CR6089 claim 20 , CR6241 claim 20 , CR6389 claim 20 , CR6396 claim 20 , CR6409 claim 20 , CR6415 claim 20 , CR6421 claim 20 , CR6429 claim 20 , and antibodies with variable regions that are at least 80% identical thereto.22EnterococcusE. faecalisE. faecium.. The human monoclonal antibody of claim 20 , wherein the at least two different species comprise and23EnterococcusE. faecalisE. faecium.. The human monoclonal antibody of claim 21 , wherein the at least two different species comprise and24. An immunoconjugate comprising:{'claim-ref': {'@idref': 'CLM-00020', 'claim 20'}, 'the human monoclonal antibody of , and'}at least one tag.25. A polynucleotide encoding the human monoclonal antibody of .26. A vector comprising at least one polynucleotide of .27. A host cell comprising at least one vector of .28. A method of producing an antibody claim 26 , the method comprising:{'claim-ref': {'@idref': 'CLM-00027', 'claim 27'}, 'culturing the host cell of under conditions conducive to the expression of the antibody.'}29. The method according to claim 28 , further ...

Bi-specific conjugates

The present invention provides a conjugate comprising: i) at least one first specific binding molecule which binds CD40, wherein said first specific binding molecule is an agonist of CD40; and ii) at least one second specific binding molecule which binds a tag moiety, wherein said tag moiety is not a cancer antigen, wherein said first specific binding molecule and second specific binding molecule are antigen-binding proteins comprising an antigen-binding domain of an antibody and are covalently linked. The conjugate can be combined with a tag construct comprising: i) a tag moiety which is not a cancer antigen; and ii) an antigen, being a cancer antigen or an antigen derived from a pathogen; wherein said antigen is a polypeptide and said tag moiety is covalently linked to said antigen, for use in therapy, to stimulate an immune response by a subject against the antigen in question.

Targeted Enzymatic Degradation Of Quorum-Sensing Peptides

Methods and compositions for the treatment of biofilms and/or the inhibition of biofilm formation. In one embodiment, a biofilm is treated and/or biofilm formation is inhibited by a method comprising contacting a biofilm or a surface with a bifunctional ligand comprising a quorum-sensing-peptide-binding region and a protease-binding region, whereby the biofilm is treated and/or biofilm formation on the surface is inhibited. 1. A method for treating a biofilm and/or inhibiting biofilm formation comprising contacting a biofilm or a surface with a bifunctional ligand comprising a quorum-sensing-molecule-binding region and a protease-binding region , whereby the biofilm is treated and/or biofilm formation on the surface is inhibited.2. The method of claim 1 , wherein the biofilm comprises Gram-positive bacteria.3Staphylococcus aureus, Staphylococcus epidermis, Streptococcus pyogenesStreptococcusStreptococcus agalactiaeStreptococcus bovis, Streptococcus pneumoniae, EnterococcusBacillus anthracis, Corynebacterium diphtheriae, Listeria monocytogenes, Clostridium tetaniClostridium difficile.. The method of claim 2 , wherein the Gram-positive bacteria is one or more of (group A) claim 2 , species (viridans group) claim 2 , (group B) claim 2 , species claim 2 , claim 2 , or4. The method of claim 1 , wherein the biofilm comprises Gram-negative bacteria.5Escherichia coli, EnterobacterProteus mirablis, Pseudomonas aeruginosa, Klebsiella pneumoniae, SalmonellaShigellaSerratiaCampylobacterjejuniNeisseriaBranhamella catarrhalis.. The method of claim 4 , wherein the Gram-negative bacteria is one or more of species claim 4 , species claim 4 , species claim 4 , species claim 4 , species claim 4 , species claim 4 , or6. The method of claim 1 , wherein the surface is a tissue site.7. The method of claim 6 , wherein the tissue site is in contact with an indwelling medical device.8. The method of claim 1 , wherein the surface is an indwelling medical device.9. The method of claim 8 , ...

STAPHYLOCOCCUS AUREUS MATERIALS AND METHODS

The disclosure generally relates to the field of prevention and treatment of infections. In particular, the disclosure relates to immunogens comprising antigens and methods for generating immune reponses to immunogens, and to antibody products specific for the epitopes and methods for treating infection with the antibody products. 110-. (canceled)11S. aureus. A method of treating infection in a subject comprising administering to the subject an antibody product specific for:{'i': 'S. aureus', '(i) an alpha toxin epitope GFNGNVTGDDTGKIGGLIGAN (SEQ ID NO: 1),'}{'i': 'S. aureus', '(ii) an alpha toxin epitope consisting essentially of GNVTGDDTGKIGGLIG (SEQ ID NO: 14) or'}{'i': 'S. aureus', '(iii) an immunogenic equivalent of the alpha toxin epitope of (ii), wherein the immunogenic equivalent is a peptide consisting essentially of an amino acid sequence at least 90% identical to SEQ ID NO: 14.'}12. The method of wherein the antibody product comprises the heavy chain CDRs set out in SEQ ID NOs: 2 claim 11 , 3 and 4 and the light chain CDRs set out in SEQ ID NO: 5 claim 11 , 6 and 7.13. The method of wherein the antibody product comprises the heavy chain variable region set out in SEQ ID NO: 8 and the light chain variable region set out in SEQ ID NO: 9.14. The method of further comprising administering one or more antibiotics.15. The method of wherein the antibiotic is tetracycline claim 14 , doxicycline claim 14 , minocycline claim 14 , trimethoprim-sulfamethoxazole claim 14 , rifampin claim 14 , clindamycin claim 14 , vancomycin claim 14 , linezolid claim 14 , daptomycin claim 14 , tigecycline claim 14 , telavancin claim 14 , dalbavancin claim 14 , oritavancin claim 14 , ceftobiprole claim 14 , mupirocin or iclaprim.16. An antibody product specific for:{'i': 'S. aureus', '(i) an alpha toxin epitope GFNGNVTGDDTGKIGGLIGAN (SEQ ID NO: 1),'}{'i': 'S. aureus', '(ii) an alpha toxin epitope consisting essentially of GNVTGDDTGKIGGLIG (SEQ ID NO: 14) or'}{'i': 'S. aureus', '(iii) ...

Novel targets of acinetobacter baumannii

The present invention provides antigenic polypeptides expressed during an infection by a pathogenic organism, such as Acinetobacter and compositions comprising these polypeptides. The invention further provides compositions for use in treating, preventing or detecting a bacterial infection, in particular vaccine compositions using the antigenic polypeptides. The invention further provides antibodies directed to said antigenic polypeptides.

Peptides and antibodies for the removal of biofilms

This disclosure provides isolated or recombinant polypeptides that are useful to vaccinate individuals suffering from chronic/recurrent biofilm disease or as a therapeutic for those with an existing infection. The individual's immune system will then naturally generate antibodies which prevent or clear these bacteria from the host by interfering with the construction and or maintenance of a functional protective biofilm. Alternatively, antibodies to the polypeptides can be administered to treat or prevent infection. Bacteria that are released from the biofilm by our technology are more readily cleared by the remainder of the host's immune system.

MONOCLONAL ANTIBODIES TO ANTHRAX PROTECTIVE ANTIGEN

The characterization and isolation of F20G75, F20G76 and F20G77, anti-PA monoclonal antibodies which also have neutralizing activities is described. The monoclonal antibodies may be used as a pharmaceutical composition for treating individuals suspected of or at risk of or having a infection. The monoclonal antibodies bind to a specific region comprising amino acids 311-316 of PA, ASFFDI or a larger fragment comprising amino acids 301-330 of PA, SEVHGNAEVHASFFDIGSSVSAGFSNSNSS. Vaccines comprising these peptides may be used to immunize individuals against infection. 1Bacillus anthracis. An anti-antibody comprising an amino acid sequence as set forth in any one of SEQ ID No. 10 , 12 , 14 , 16 , 18 or 20.2. The antibody according to wherein the antibody is a chimeric antibody.3Bacillus anthracis. A neutralizing monoclonal antibody selected from the group consisting of F20G75 claim 1 , F20G76 and F20G77. The instant application is a divisional application of U.S. Ser. No. 12/301,034, filed May 1, 2009 which is a 371 of PCT Application CA07/00872, filed May 17, 2007, now abandoned, which claims the benefit of US Provisional patent application, filed May 17, 2006 number 60/800,831, entitled ‘MONOCLONAL ANTIBODIES TO ANTHRAX PROTECTIVE ANTIGEN’, now abandoned, the contents of which are incorporated herein by reference.The invention relates to vaccines for infections.Anthrax is a well-known infectious disease caused by a Gram-positive bacterium, . There are three types of anthrax infections: cutaneous, gastrointestinal and inhalation. Inhalation anthrax generally occurs after an incubation time of 1-6 days. After the incubation period, a non-specific flu-like illness ensues for 1-3 days followed by a brief intervening period of improvement. Unfortunately, rapid deterioration follows and death is universal in untreated cases.Airborne anthrax has long been concerned a major bioterror threat and it has recently been shown that anthrax can be aerosolized and transmitted by mail ...

ANTIBODIES AGAINST STAPHYLOCOCCUS AUREUS AND USES THEROF

The invention relates to the field of immunology and vaccine development. In particular, it relates to antibodies and fragments thereof against and to therapeutic and diagnostic uses thereof. Provided is an isolated antibody or a functional fragment thereof, which binds to an epitope of the Immunodominant Staphylococcal antigen A (IsaA), wherein said antibody comprises at least four Isa A epitope-binding CDR sequences selected from the group consisting of SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 6, and functional equivalents thereof having an amino acid sequence that is at least 85% identical to an amino acid sequence of SEQ ID NO: 1-6. 1. An isolated antibody or a functional fragment thereof , which binds to an epitope of the Immunodominant Staphylococcal antigen A (IsaA) , wherein said antibody comprises the IsaA epitope-binding CDR sequences represented by SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6 , wherein one or more of the CDRs can be a functional equivalent of the respective sequences having an amino acid sequence that is at least 85% identical to an amino acid sequence of SEQ ID NO: 1-6 and which binds to an epitope of the Staphylococcal IsaA epitope.2. The antibody or fragment thereof according to claim 1 , wherein the functional equivalent has an amino acid sequence that is at least 90% claim 1 , preferably at least 92% claim 1 , more preferably at least 95% identical to an amino acid sequence of SEQ ID NO: 1-6.3. The antibody or fragment thereof according to claim 1 , having a heavy chain sequence comprising a sequence which is at least 85% identical to the sequence of SEQ ID NO:13 and/or having a light chain sequence which is at least 85% identical to the sequence of SEQ ID NO:14.4. The antibody or fragment thereof according to claim 1 , comprising at least one mutation in the germ-line heavy-chain and/or kappa-chain sequence according to .5. The antibody or fragment ...

IMMUNOLOGICAL DETECTION METHOD AND KIT FOR MYCOPLASMA PNEUMONIAE

The present invention aims at providing a specific antibody that can simply and rapidly detect which is a causative bacterium of , with high sensitivity, and also an immunological detection method and a kit containing the same antibody. The present invention makes it possible to diagnose infection with more rapidly and specifically than the conventional method, by producing an antibody recognizing a specific epitope of P30 protein of and performing an immunological detection using the antibody. Also, the present invention enables easy and rapid detection of and diagnosis of infection with the same at a hospital or the like without need of specialized instruments or skilled techniques. 1Mycoplasma pneumoniaeMycoplasma pneumoniae. A method of detecting , comprising an immunoassay using an antibody against P30 protein of , the antibody being an antibody against an epitope of P30 protein located in an amino acid sequence of SEQ ID NO: 3 or 4.2. The detecting method according to claim 1 , wherein the antibody is a monoclonal antibody.3Mycoplasma pneumoniaeMycoplasma pneumoniae. A method of detecting claim 1 , comprising a sandwich immunoassay using first and second antibodies against P30 protein of claim 1 , wherein at least one of the first and second antibodies is an antibody against an epitope of P30 protein located in an amino acid sequence of SEQ ID NO: 3 or 4.4. The detecting method according to claim 3 , wherein the sandwich immunoassay is an ELISA or immunochromatographic assay.5. The detecting method according to claim 3 , wherein at least one of the first and second antibodies is a monoclonal antibody.6. The detecting method according to claim 5 , wherein one of the first and second antibodies is immobilized in a carrier.7Mycoplasma pneumoniae. An immunochromatographic assay for detecting claim 5 , comprising:{'i': 'Mycoplasma pneumoniae', 'providing a membrane carrier having a capturing zone that is formed by previously immobilizing a first antibody against ...

HYPERIMMUNIZED EGG PRODUCT FOR TREATMENT OF NECROTIC ENTERITIS IN POULTRY

In one aspect, the present invention is directed to a method for preventing or treating necrotic enteritis by administering a hyperimmunized egg product obtained from an egg-producing animal to an avian. The hyperimmunized egg product may contain an antibody specific to an antigen selected from the group consisting of α-toxin, elongation factor Tu (EF-Tu), necrotic enteritis B-like (NetB) toxin, Pyruvate: Ferredoxin oxidoreductase (PFO), and elongation factor 1-alpha. 1Clostridium perfringensClostridium perfringensClostridium perfringensClostridium perfringensEimeria tenella. A method for preventing or treating necrotic enteritis in an avian in need thereof , comprising administering to the avian a therapeutically effective amount of a hyperimmunized egg product obtained from an egg-producing animal , thereby preventing or treating the necrotic enteritis in the subject , wherein the hyperimmunized egg product comprises a therapeutically effective amount of an antibody to an antigen selected from the group consisting of α-toxin , elongation factor Tu (EF-Tu) , necrotic enteritis B-like (NetB) toxin , Pyruvate: Ferredoxin oxidoreductase (PFO) , and elongation factor 1-alpha.2. The method of claim 1 , further comprising hyperimmunizing the egg-producing animal with the antigen claim 1 , collecting a hyperimmunized egg from the egg-producing animal that has been hyperimmunized claim 1 , and preparing a hyperimmunized egg product from the hyperimmunized egg.3. The method of claim 1 , wherein the egg-producing animal is hyperimmunized with a composition comprising one or more of an antigenic protein claim 1 , an antigenic bacterium claim 1 , and a genetic vaccine.4Clostridium perfringensClostridium perfringensClostridium perfringensClostridium perfringensEimeria tenella. The method of claim 3 , wherein the composition comprises an antigenic protein selected from the group consisting of α-toxin claim 3 , elongation factor Tu (EF-Tu) claim 3 , necrotic enteritis B-like ( ...

RECOMBINANT GRAM NEGATIVE BACTERIA AND METHODS OF GENERATING AND UTILIZING SAME

The present invention provides novel, recombinant Gram-negative bacteria. In particular, the invention provides recombinant Gram-negative bacteria (e.g., ) lacking genes involved in lipopolysaccharide (LPS, endotoxin) biosynthesis (e.g., lacking genes required for core oligosaccharide biosynthesis) and also provides recombinant Gram-negative bacteria lacking genes involved in LPS biosynthesis that contain one or more exogenous KDO transferases and/or one or more exogenous heptosyltransferases (e.g., from one or more types and/or strains of bacteria). The invention further provides methods of generating and utilizing (e.g., as or in an immunogenic composition (e.g., as or in an adjuvant and/or vaccine)) the recombinant Gram-negative bacteria therapeutic, preventative, and/or research applications. 1. A recombinant Gram-negative bacterial cell lacking all endogenous glycosyltransferases involved in core oligosaccharide biosynthesis within lipopolysaccharide (LPS).2. The recombinant Gram-negative bacterial cell of claim 1 , wherein the cell lacks endogenous waaF claim 1 , waaC claim 1 , waaL claim 1 , waaU claim 1 , waaZ claim 1 , waaY claim 1 , waaJ claim 1 , waaR claim 1 , waaB claim 1 , waaS claim 1 , waaP claim 1 , waaG claim 1 , waaQ claim 1 , and waaA genes.3. The recombinant Gram-negative bacterial cell of claim 1 , wherein the cell possesses endogenous hldD and coaD genes.4. The recombinant Gram-negative bacterial cell of claim 1 , wherein the cell generates sugar precursors of core oligonucleotide biosynthesis but lacks the capability to transfer these sugars to the Lipid IVmolecule.5Escherichia, Shigella., Salmonella, Campylobacter, Neisseria, Haemophilus, Aeromonas, Francisella, Yersinia, Klebsiella, Bordetella, Legionella, Corynebacteria, Citrobacter, Chlamydia, Brucella, Pseudomonas, Helicobacter,Vibrio.. The recombinant Gram-negative bacterial cell of claim 1 , wherein the bacterial cell is from a genus selected from the group consisting of and6. A ...

Compositions and methods for the removal of biofilms

This disclosure provides isolated or recombinant polypeptides that are useful to vaccinate individuals suffering from chronic/recurrent biofilm disease or as a therapeutic for those with an existing infection. The individual's immune system will then naturally generate antibodies which prevent or clear these bacteria from the host by interfering with the construction and or maintenance of a functional protective biofilm. Alternatively, antibodies to the polypeptides can be administered to treat or prevent infection. Bacteria that cannot form functional biofilms are more readily cleared by the remainder of the host's immune system and/or traditional antibiotics. 1Haemophilus influenzaeHaemophilus influenzaeHaemophilus influenzaeHaemophilus influenzae. An isolated polypeptide comprising the amino acid sequence of the IHFa or a fragment or equivalent thereof; and optionally , wherein the peptide is selected from the group of: the tip portion of the DNABII polypeptide; the A5 fragment of IHFa chain; or a polypeptide consisting of an amino acid sequence selected from the group of an amino acid sequence corresponding to positions 10-25 of the IHFa chain; an amino acid sequence corresponding to positions 56-78 of the IHFa; or an amino acid sequence corresponding to positions 86-96 of the IHFa; or a polypeptide comprises the amino acid sequence selected from the group of TFRPGQKLKSRVENASPKDE (SEQ ID NO: 252) , MATITKLDIIEYLSDKYHLS (SEQ ID NO: 348) , KYHLSKQDTKNVVENFLEEI (SEQ ID NO: 349) , FLEEIRLSLESGQDVKLSGF (SEQ ID NO: 350) , KLSGFGNFELRDKSSRPGRN (SEQ ID NO: 351) , RPGRNPKTGDVVPVSARRVV (SEQ ID NO: 352) , ARRVVTFKPGQKLRARVEKTK (SEQ ID NO: 353) , or a biological equivalent each thereof; and optionally wherein the isolated polypeptide further comprises a heterologous amino acid sequence or is coupled to a heterologous non-peptide domain.2. A method to obtain antibodies immunoreactive with an IHF protein or to generate B cells that secrete antibodies immunoreactive with an ...

METHODS OF TREATING S. AUREUS-ASSOCIATED DISEASES

The present invention provides for methods of preventing and/or treating -associated bacteremia and sepsis, and methods for preventing and/or treating -associated pneumonia in immunocompromised patients using anti-alpha-toxin (anti-AT) antibodies. Also provided are methods of reducing bacterial load in the bloodstream or heart of a mammalian subject comprising administering to the subject an effective amount of an isolated anti-alpha toxin (anti-AT) antibody or antigen-binding fragment thereof. Methods of reducing bacterial agglutination and/or thromboembolic lesion formation in a mammalian subject comprising administering to the subject an effective amount of an isolated anti-alpha toxin (anti-AT) antibody or antigen-binding fragment thereof, are also provided. Also provided are methods of preventing or reducing the severity of associated pneumonia in an immunocompromised mammalian subject. 1S. aureusS. aureusStaphylococcus aureus. A method for preventing or reducing the severity of -associated sepsis in a mammalian subject comprising administering to said subject an effective amount of an isolated anti-alpha toxin (anti-AT) antibody or antigen-binding fragment thereof , wherein the isolated antibody or antigen-binding fragment thereof immunospecifically binds to a alpha toxin polypeptide and includes:(a) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 7, 10, 13 or 69;(b) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 8, 11, 14, 17, 70 or 75;(c) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 9, 12, 15, 18, 16, 65, 66, 67, 71, 72, 76 or 78;(d) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 1 or 4;(e) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 2, 5, 73 or 77; and(f) a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 3, 6, 64, 68 or 74.26-. (canceled)7. The method of claim 1 , wherein said mammalian subject is human.8. The method of claim 1 , wherein said isolated anti-AT antibody or antigen- ...

A FULLY NATIVE HUMAN NEUTRALIZING MONOCLONAL ANTIBODY AGAINST TETANUS TOXIN AND ITS APPLICATIONS

The invention describes fully native human neutralizing monoclonal antibodies against tetanus toxin. The invention developed fully native human neutralizing monoclonal antibodies against tetanus toxin through a systematic high through-put platform that is specialized for identifying and developing human native antibody. The neutralizing monoclonal antibodies described in the invention can be used in the prevention, treatment and detection of infection. The fully human neutralizing monoclonal antibodies developed in the invention have a high affinity toward tetanus toxin, as well as possessing high neutralizing activities against the toxin, safe of use with high disease prevention effectiveness, free of exogenous virus contamination, and are widely applicable to various human groups with strong industrial applications. 1. A fully native human neutralizing monoclonal antibody against tetanus toxin or an antigen-binding fragment thereof , wherein the neutralizing monoclonal antibody comprises at least a heavy chain variable domain (VH) having three CDRs and at lease a light chain variable domain (VL) having three CDRs:wherein the CDR1, CDR2, or CDR3 of the VH comprising an amino acid sequence is set forth in any one of SEQ ID NO:1, 2, 3, 9, 10, 11, 19, 20, 21, 27, 28, 29; or said sequence having a replacement, a deletion or an insertion of one or more amino acids thereof; or an amino acid sequence having at least 80% homology to the sequence set forth in SEQ ID NO:1, 2, 3, 9, 10, 11, 19, 20, 21, 27, 28, or 29 and having the same or similar functions; and wherein the CDR1, CDR2, or CDR3 of the VL comprising an amino acid sequence set forth in any one of SEQ ID NO: 4, 5, 6, 13, 14, 15, 23, 24, 25, 30, 31, or 32; or said amino acid sequence having a replacement, a deletion or an insertion of one or more amino acids thereof; or an amino acid sequence having at least 80% homology to the sequence set forth in SEQ ID NO: 4, 5, 6, 13, 14, 15, 23, 24, 25, 30, 31 or 32 and ...

MULTISPECIFIC ANTIGEN-BINDING MOLECULES AND USES THEREOF

The present invention provides multispecific antigen-binding molecules and uses thereof. The multispecific antigen-binding molecules comprise a first antigen-binding domain that specifically binds a target molecule, and a second antigen-binding domain that specifically binds an internalizing effector protein. The multispecific antigen-binding molecules of the present invention can, in some embodiments, be bispecific antibodies that are capable of binding both a target molecule and an internalizing effector protein. In certain embodiments of the invention, the simultaneous binding of the target molecule and the internalizing effector protein by the multispecific antigen-binding molecule of the present invention results in the attenuation of the activity of the target molecule to a greater extent than the binding of the target molecule alone. In other embodiments of the invention, the target molecule is a tumor associated antigen, and the simultaneous binding of the tumor associated antigen and the internalizing effector protein by the multispecific antigen-binding molecule of the present invention causes or facilitates the targeted killing of tumor cells. 1. A method of inhibiting the growth of a tumor or promoting tumor regression in a cancer patient , the method comprising administering to the patient an antibody drug conjugate (ADC) and a multispecific antigen-binding protein , wherein the ADC comprises a drug , toxin or radioisotope conjugated to an antigen-binding protein that specifically binds a tumor target (T) , and wherein the multispecific antigen-binding protein comprises a first antigen-binding domain that specifically binds T , and a second antigen-binding domain that specifically binds an internalizing effector protein (E); wherein the patient is afflicted with a tumor comprising cells that express both T and E.2. The method of wherein the antigen-binding portion of the ADC binds an epitope on T that does not overlap with the epitope on T recognized by ...