РАСТИТЕЛЬНЫЕ ТИМИДИНКИНАЗЫ И ИХ ПРИМЕНЕНИЕ

Изобретение относится к биотехнологии. Описана фармацевтическая композиция, обладающая тимидинкиназной активностью, содержащая в качестве активного начала выделенный фермент растительную тимидинкиназу или полинуклеотид, кодирующий ее. Раскрыт способ сенсибилизации клетки к пролекарству. Предложен способ фосфорилирования нуклеозидного аналога-монофосфата. Раскрыт способ ингибирования патогенного агента в организме теплокровного животного. Описан способ контроля или модификации роста растения. Предложено средство, включающее нуклеозидный аналог и тимидинкиназу, или ген, кодирующий указанную полученную из растения тимидинкиназу, или вектор, включающий указанный ген, кодирующий указанную полученную из растения тимидинкиназу, в виде комбинации для одновременного, раздельного или последовательного введения при лечении рака. Описаны новые тимидинкиназы, полученные из сосны или резушки Таля. Данное изобретение позволяет получить новые растительные тимидинкиназы, полезные для превращения нуклеозидных ...

МОДИФИЦИРОВАННЫЕ ИНГИБИТОРЫ ПРОТЕИНАЗЫ

Изобретение относится к биотехнологии и может быть использовано в селекции организмов, например растений. Цистатиновый ингибитор протеиназы (оризацистатин 1), имеющий делецию аспарагиновой кислоты в положении 86, и гибридный ингибитор протеиназы, включающий цистатин и ингибитор протеиназы, используют для борьбы с патогенами, паразитами или вредителями. Трансформация организма молекулой ДНК, кодирующей ингибиторы протеиназы, придает ему устойчивость к протеолитическому расщеплению. Ингибиторы протеиназ могут быть также получены с использованием праймеров. 7 с. и 11 з.п. ф-лы, 6 ил., 4 табл.

КАРТОФЕЛЬ С ПОВЫШЕННЫМ ВЫХОДОМ КРАХМАЛА В ПЕРЕСЧЕТЕ НА ОТДЕЛЬНОЕ РАСТЕНИЕ И СПОСОБ ЕГО ПОЛУЧЕНИЯ

Изобретение относится к селекции растений. В растения картофеля встраивают ген Dofl кукурузы, кодирующий ДНК-связывающий белок. Экспрессия данного гена в растении картофеля обеспечивает увеличенный урожай клубней картофеля, а также более высокое содержание крахмала в пересчете на растительный организм по сравнению с нетрансформированными растениями картофеля, выращиваемыми в тех же условиях. 2 н.п. ф-лы, 3 ил., 2 табл.

СПОСОБ УВЕЛИЧЕНИЯ БИОМАССЫ РАСТЕНИЯ

Изобретение относится к области биохимии, в частности к способу увеличения биомассы фотосинтезирующего организма, который включает культивирование указанного фотосинтезирующего организма в присутствии пептида. Также раскрыта генная конструкция для увеличения биомассы фотосинтезирующего организма, а также вектор, ее включающий. Изобретение также относится к клетке для увеличения биомассы фотосинтезирующего организма, а также к самому организму, обладающему увеличенной биомассой по сравнению с нетрансгенным организмом. Изобретение позволяет эффективно увеличивать биомассу фотосинтезирующего организма. 6 н. и 6 з.п. ф-лы, 2 ил., 2 пр.

ЗАЩИТНОЕ ДЕЙСТВИЕ ДОМИНАНТНО-НЕГАТИВНОГО МУТАНТНОГО БЕЛКА KRP ОТ ИНГИБИРОВАНИЯ АКТИВНОГО КОМПЛЕКСА ЦИКЛИН-CDK KRP ДИКОГО ТИПА

Экспрессия в растении мутантного полипептида ингибитора CDK (CKI), имеющего доминантно-негативную антагонистическую активность в отношении белков CKI дикого типа, обеспечивает увеличение мощности растений, массы их корней и размера семян, а также усиление роста растения на раннем этапе. 13 н. и 55 з.п. ф-лы, 4 ил., 3 табл.

СЕГМЕНТ ДНК, СПОСОБНЫЙ ПРИДАВАТЬ РАСТЕНИЮ УСТОЙЧИВОСТЬ К ВРЕДИТЕЛЮ (ВАРИАНТЫ), ВЕКТОР, СПОСОБ ПОЛУЧЕНИЯ РАСТЕНИЙ С ПОНИЖЕННОЙ ЧУВСТВИТЕЛЬНОСТЬЮ К ВРЕДИТЕЛЮ, СПОСОБ ЗАЩИТЫ РАСТЕНИЙ ОТ ЗАРАЖЕНИЯ ВРЕДИТЕЛЕМ, СПОСОБ ВЫДЕЛЕНИЯ СЕГМЕНТА ДНК, СПОСОБ СЕЛЕКТИВНОЙ АМПЛИФИКАЦИИ РЕСТРИКЦИОННЫХ ФРАГМЕНТОВ, ОЛИГОНУКЛЕОТИД, ДИАГНОСТИЧЕСКИЙ НАБОР, СПОСОБ ОБНАРУЖЕНИЯ СЕГМЕНТА ДНК, ПОЛИПЕПТИД

Изобретение относится к генам, способным придавать устойчивость растения к вредителю (нематодам и/или тлям). Предпочтительными являются последовательности нуклеиновых кислот, ДНК последовательность которых представлена в описании, или ее гомологи. Изобретение также относится к вектору, способу получения растений с пониженной чувствительностью к вредителю, способу защиты растений от заражения вредителем. Изобретение относится к олигонуклеотидам, затравкам, диагностическому набору и полипептидам. 11 c. и 24 з.п. ф-лы, 9 ил., 14 табл.

СПОСОБ ПОЛУЧЕНИЯ ГЕНЕТИЧЕСКИ МОДИФИЦИРОВАННЫХ РАСТЕНИЙ КАРТОФЕЛЯ СОРТА ГОЛУБИЗНА С ПОМОЩЬЮ AGROBACTERIUM TUMEFACIENS

Изобретение относится к селекции растений. Экспланты растений картофеля сорта Голубизна сокультивируют с трансформированным штаммом A. tumefaciens, а затем помещают на питательную среду для инициации каллусообразования с последующей регенерацией из них фертильных трансгенных растений. Сокультивирование осуществляют контактированием эксплантов с фильтром, наложенным на поверхность агаризованной среды, с нанесенной на нее с бактериальной суспензией в течение 48±4 часа. Для инициации каллусообразования эксплантов используют питательную среду, содержащую БАП в количестве 2,5÷5,5 мг/л и НУК - 0, 01÷0,05 мг/л. Регенерацию начинают на восьмой день на среде, содержащей БАП в количестве 2,5÷5,5 мг/л и ГКз - 0,01÷0,05 мг/л. В результате увеличивается выход трансформированных растений. 4 з.п. ф-лы, 2 ил., 7 табл.

СПОСОБ ПОЛУЧЕНИЯ ГЕНЕТИЧЕСКИ МОДИФИЦИРОВАННЫХ РАСТЕНИЙ КАРТОФЕЛЯ СОРТА НЕВСКИЙ С ПОМОЩЬЮ AGROBACTERIUM TUMEFACIENS

Изобретение относится к селекции растений. Экспланты растений картофеля сорта Невский сокультивируют с трансформированным штаммом A. tumefaciens, а затем помещают на питательную среду для инициации каллусообразования с последующей регенерацией из них фертильных трансгенных растений. Сокультивирование осуществляют контактированием эксплантов через бумажный фильтр с поверхностью агаризованной среды, на которую нанесен бактериальный штамм, в течение 48±4 ч. Для инициации каллусообразования экспланты помещают на питательную среду, содержащую зеатин в количестве 0,5-3,5 мг/л и НУК - 0,01-0,05 мг/л. На восьмой день экспланты помещают на среду для регенерации, содержащую зеатин в количестве 0,5-3,5 мг/л и ГК3 - 0,01-0, 05 мг/л. В результате увеличивается выход трансформированных растений. 4 з.п. ф-лы, 2 ил., 5 табл.

СПОСОБ ПОЛУЧЕНИЯ ГЕНЕТИЧЕСКИ МОДИФИЦИРОВАННЫХ РАСТЕНИЙ КАРТОФЕЛЯ СОРТА ЛУГОВСКОЙ С ПОМОЩЬЮ AGROBACTERIUM TUMEFACIENS

Изобретение относится к селекции растений. Экспланты растений картофеля сорта Луговской сокультивируют с трансформированным штаммом A. timefaciens, а затем помещают на питательную среду для инициации каллусообразования с последующей регенерацией из них фертильных трансгенных растений. Сокультивацию осуществляют контактированием эксплантов с фильтром, смоченным бактериальной суспензией, в течение 48±4 часа. Для инициации каллусообразования используют питательную среду, содержащую зеатин в количестве 0,2-1,0 мг/л, БАП - 0,2-1,0 мг/л и НУК - 0,01-0,05 мг/л. На восьмой день экспланты помещают на среду для регенерации, содержащую зеатин в количестве 0,2-1,0 мг/л, БАП - 0,2-1,0 мг/л и ГК3 - 0,01-0,05 мг/л. В результате увеличивается выход трансформированных растений. 4 з.п. ф-лы, 2 ил., 4 табл.

ИНСЕКТИЦИДНЫЕ БЕЛКОВЫЕ КОМБИНАЦИИ, СОДЕРЖАЩИЕ CRY1AB И CRY2AA, ДЛЯ РЕГУЛИРОВАНИЯ КУКУРУЗНОГО МОТЫЛЬКА И СПОСОБЫ БОРЬБЫ С УСТОЙЧИВОСТЬЮ НАСЕКОМЫХ

Изобретение относится к области биохимии, в частности к трансгенному растению кукурузы, которое обладает устойчивостью к насекомым-вредителям европейским кукурузным мотылькам, а также к его семени. Раскрыто множество растений кукурузы на поле, включающее не содержащие Bacillus thuringiensis (не содержащие Bt) растения, которые не экспрессируют трансгенные инсектицидные белки, и множество трансгенных растений, которые обладают устойчивостью к насекомым-вредителям европейским кукурузным мотылькам, а также раскрыта смесь семян кукурузы, включающая семена от не содержащих Bt растений, которые не экспрессируют трансгенные инсектицидные белки, и множество семян, содержащих ДНК, кодирующую инсектицидный белок Cry1Ab, и ДНК, кодирующую инсектицидный белок Cry2Аа. Также раскрыт способ снижения развития устойчивости к белку Cry1Ab или белку Cry2Аа у насекомых европейских кукурузных мотыльков. Изобретение позволяет эффективно бороться с насекомыми-вредителями европейским кукурузным мотыльком. 5 н.

КОМБИНИРОВАННОЕ ПРИМЕНЕНИЕ БЕЛКОВ Vip3Ab И Cry1Fa ДЛЯ ВЫРАБАТЫВАНИЯ РЕЗИСТЕНТНОСТИ К НАСЕКОМЫМ

Изобретение относится к области биохимии, в частности к трансгенному растению, которое имеет устойчивость к совке травяной (FAW; Spodoptera frugiperda), содержащее ДНК, кодирующую Vip3Ab, ДНК, кодирующую Cry1Fa, и ДНК, кодирующую третий белок, выбранный из группы, состоящей из CrylC, CrylD и CrylE, его семени, а также к способу предотвращения вырабатывания у совки травяной резистентности к белкам Vip3Ab и Cry1Fa с его использованием. Также раскрыта совокупность растений в поле, содержащая множество вышеуказанных трансгенных растений и растения, не содержащие белки Bacillus thuringiensis (не-Bt растения), и смесь семян, содержащая семена не-Bt растений и множество вышеуказанных семян. Изобретение также относится к композиции для борьбы с чешуекрылыми вредителями, содержащей клетки, экспрессирующие Cry1Fa, Vip3Ab и третий белок, выбранный из группы, состоящей из Cry1C, Cry1D и Cry1E, а также к способу борьбы с совкой травяной с ее использованием. Изобретение позволяет эффективно бороться ...

ОБЪЕКТ СОИ 9582.814.19.1, ПРИДАЮЩИЙ УСТОЙЧИВОСТЬ К НАСЕКОМЫМ И УСТОЙЧИВОСТЬ К ГЕРБИЦИДАМ

Изобретение относится к области биохимии, в частности к способу борьбы с чешуекрылыми насекомыми. Также раскрыта выделенная нуклеиновая последовательность, которая является праймером. Раскрыты растение сои, которое устойчиво к Pseudoplusia includens (соевой пяденице), семя для выращивания указанного растения сои и часть растения сои, которая устойчива к Pseudoplusia includens (соевой пяденице). Изобретение позволяет эффективно бороться с чешуекрылыми насекомыми. 5 н. и 2 з.п. ф-лы, 3 ил., 8 табл., 7 пр.

СИСТЕМА ДЛЯ УНИЧТОЖЕНИЯ РАСТИТЕЛЬНЫХ КЛЕТОК

Изобретение относится к биотехнологии, в частности к системе для уничтожения растительных клеток. Проводят трансформацию растения химерным геном, где кодирующая последовательность гена кодирует РАР-S α протеин или PAP-S β протеин, или его фрагмент, этот ген содержит промотор, который проявляет активность в ответ на специфическое раздражающее воздействие на растение. Растение также может быть трансформировано либо одной конструкцией, включающей два химерных гена, один из которых кодирует инактивированный антивирусный протеин фитоллаки американской, а другой кодирует активатор инактивированного антивирусного протеина фитоллаки американской, либо набором конструкций, где каждый упомянутый выше химерный ген находится в отдельной конструкции. Изобретение позволяет эффективно удалять заданные клетки в организме растения. 5 н. и 32 з.п. ф-лы, 15 ил.

УСТОЙЧИВЫЕ К ГЛИФОСАТУ РАСТЕНИЯ И СПОСОБЫ, СВЯЗАННЫЕ С НИМИ

Изобретение относится к области биохимии, в частности к выделенной молекуле нуклеиновой кислоты для обеспечения в растении устойчивости к глифосату, а также к экспрессирующему вектору, клетке-хозяину, растения, части растения, семени растения, культуре ткани растения, ее содержащего. Также раскрыты способ получения трансгенного растения, части растения, органа растения, семени растения или клетки растения, которая устойчива к глифосату, и способ обеспечения устойчивости к глифосату в растении и использование вышеуказанной молекулы нуклеиновой кислоты. Изобретение также относится к способу борьбы с сорняками на возделываемой посевной площади, содержащей устойчивые к гербицидам растения или устойчивые к гербицидам семена растения, предусматривающему внесение на возделываемую посевную площадь достаточного количества глифосата для борьбы с сорняками на возделываемой посевной площади без существенного влияния на указанные семя или растение. Изобретение позволяет эффективно получать устойчивое ...

ТРАНСГЕННОЕ РАСТЕНИЕ И СПОСОБ ЕГО ПОЛУЧЕНИЯ

Изобретение относится к области биохимии, в частности к трансгенному растению, которое содержит белок FTO и демонстрирует увеличенную биомассу. Также раскрыты клетка для экспрессии белка FTO и способ получения указанного трансгенного растения. Изобретение позволяет эффективно увеличивать биомассу, получаемую из указанного растения. 3 н. и 6 з.п. ф-лы, 1 ил., 2 табл., 6 пр.

КОМПОЗИЦИИ И СПОСОБЫ КОНТРОЛЯ ВРЕДИТЕЛЕЙ РАСТЕНИЙ

Изобретение относится к области биохимии, в частности к химерному гену, содержащему нуклеиновую кислоту, которая кодирует белок, токсичный для кукурузного мотылька (Ostrinia nubilalis). Также раскрыты рекомбинантный вектор, трансгенная клетка-хозяин, трансгенное растение, трансгенное семя, содержащее указанный химерный ген. Раскрыты способы получение белка, получения трансгенного растения, способ борьбы с кукурузным мотыльком (Ostrinia nubilalis) с помощью указанного химерного гена. Изобретение позволяет эффективно бороться с кукурузным мотыльком (Ostrinia nubilalis). 11 н. и 27 з.п. ф-лы, 3 табл., 11 пр.

ПЕСТИЦИДНЫЕ ГЕНЫ И СПОСОБЫ ИХ ПРИМЕНЕНИЯ

Изобретение относится к области биохимии, в частности к рекомбинантному полипептиду, имеющему инсектицидную активность против насекомых-вредителей зеленого овощного клопа и соевой тли. Также раскрыты инсектицидная композиция, рекомбинантная молекула нуклеиновой кислоты, клетка-хозяин, конструкция ДНК, вектор для продуцирования указанного полипептида, инсектицидная композиция, трансгенное растение, трансгенное семя. Раскрыты способы борьбы с популяцией насекомого-вредителя зеленого овощного клопа и/или соевой тли, способ получения указанного полипептида, способ защиты растения, способ повышения урожайности растения. Изобретение позволяет эффективно бороться с насекомыми-вредителями - зеленым овощным клопом и соевой тлей. 14 н. и 22 з.п. ф-лы, 14 ил., 7 табл., 8 пр.

РАСТИТЕЛЬНЫЕ КЛЕТКИ И ОРГАНИЗМЫ РАСТЕНИЙ С МОДИФИЦИРОВАННЫМ КЛЕТОЧНЫМ РОСТОМ, РАЗВИТИЕМ И ДИФФЕРЕНЦИРОВКОЙ

Растительную клетку трансформируют ДНК, кодирующей растительные белки 3Rmyb или РНК, супрессирующую экспрессию белков 3Rmyb. Белок 3Rmyb растений является фактором, активирующим специфичную для фазы G2/M транскрипцию, т.е. фактором, необходимым для роста растительных клеток. Растение, регенерированное из такой клетки, обладает гипертрофией специфичного органа, мужской стерильностью или устойчивостью к стрессу. 2 н. и 10 з.п. ф-лы, 33 ил.

УСТОЙЧИВЫЕ К ГЛИФОСАТУ РАСТЕНИЯ И СПОСОБЫ, СВЯЗАННЫЕ С НИМИ

Изобретение относится к области биохимии, в частности к выделенной молекуле нуклеиновой кислоты для обеспечения в растении устойчивости к глифосату, а также к вектору, клетке, растению, части растения, семени растения, культуре растения, ее содержащим. Также раскрыт способ получения трансгенного растения, части растения, органа растения, семени растения или клетки растения, которая устойчива к глифосату, с использованием вышеуказанной молекулы нуклеиновой кислоты. Изобретение также относится к способу борьбы с сорняками на возделываемой посевной площади, предусматривающему посев вышеуказанного семени или высаживания вышеуказанного растения, а также к способу обеспечения устойчивости к глифосату в растении. Изобретение позволяет эффективно получать растение, устойчивое к глифосату. 13 н. и 14 з.п. ф-лы, 54 ил., 43 табл., 23 пр.

ИНСЕКТИЦИДНЫЕ БЕЛКИ

Изобретение относится к области биохимии, в частности к сконструированному инсектицидному белку Cry1Ba, активному в отношении кукурузного мотылька, нуклеиновой кислоте, его кодирующей, конструкции, содержащей вышеуказанную нуклеиновую кислоту, а также к инсектицидной композиции, содержащей вышеуказанный белок. Также раскрыты рекомбинантный вектор экспрессии, клетка-хозяин, растение и семя, содержащие вышеуказанную конструкцию. Изобретение также относится к способу борьбы с кукурузным мотыльком, включающему приведение кукурузного мотылька в контакт с эффективным количеством инсектицидного белка Cry1Ba. Изобретение позволяет эффективно бороться с кукурузным мотыльком. 10 н. и 4 з.п. ф-лы, 2 ил., 9 табл., 10 пр.

ГИБРИДНЫЙ ИНСЕКТИЦИДНЫЙ БЕЛОК, МОЛЕКУЛА НУКЛЕИНОВОЙ КИСЛОТЫ, КОДИРУЮЩАЯ ТАКОЙ БЕЛОК, ТРАНСГЕННЫЕ РАСТЕНИЯ И ИХ СЕМЕНА, СОДЕРЖАЩИЕ ТАКОЙ БЕЛОК, СПОСОБ ПОЛУЧЕНИЯ БЕЛКА И ЕГО ПРИМЕНЕНИЕ

Группа изобретений относится к области белковой инженерии, молекулярной биологии растений и борьбы с вредителями и касается гибридного инсектицидного белка и его применений. Описанный гибридный инсектицидный белок включает от N-конца до С-конца N-концевой участок белка Cry3A, слитого с С-концевым участком белка Cry1Ab, причем позиция кроссинговера белка Cry3A и белка Cry1Ab расположена в консервативном блоке 2, в консервативном блоке 3 или в консервативном блоке 4 и обладает активностью против западного кукурузного корневого жука. Также представлены молекулы нуклеиновых кислот, кодирующие новые белки, способы получения белков, способы их применения, а также трансгенные растения и их семена, содержащие такие белки. Группа изобретений позволяет получить экономически выгодные средства для борьбы с жуками рода Diabrotica. 13 н. и 26 з.п. ф-лы, 8 ил., 9 табл., 46 пр.

НОВЫЕ ИНСЕКТИЦИДНЫЕ БЕЛКИ И СПОСОБЫ ИХ ПРИМЕНЕНИЯ

Изобретение относится к области биохимии, в частности к выделенному полипептиду, обладающему фунгицидной активностью против грибковых патогенов,,,ии инсектицидной активностью против насекомого, выбранного из западного кукурузного жука, соевой совки и бобовой гусеницы, композиции, его содержащей, а также к выделенной молекуле нуклеиновой кислоты, его кодирующей. Также раскрыты трансгенное растение и его семя, кассета экспрессии, а также ДНК-конструкция, содержащие вышеуказанную выделенную молекулу нуклеиновой кислоты. Изобретение также относится к способу экспрессии в растении полинуклеотида, кодирующего инсектицидный белок, к способу защиты растения от насекомого-вредителя, а также к способу подавления роста насекомого-вредителя с использованием вышеуказанной композиции. Изобретение позволяет эффективно бороться с насекомыми и грибковыми патогенами. 20 н. и 8 з.п. ф-лы, 13 ил., 40 табл., 30 пр.

ПОСЛЕДОВАТЕЛЬНОСТИ НУКЛЕИНОВЫХ КИСЛОТ И ПЕПТИДЫ/БЕЛКИ СЕМЕЙСТВА FT, ОБУСЛОВЛИВАЮЩИЕ СВОЙСТВА ПОДАВЛЕНИЯ ЦВЕТЕНИЯ У ТРАНСФОРМИРОВАННЫХ ИМИ РАСТЕНИЙ ТАБАКА И ТРАНСГЕННЫХ РАСТЕНИЙ

Изобретение относится к области биохимии, в частности, к применению последовательности нуклеиновой кислоты, кодирующей белок, для получения трансгенного растения, у которого стадия цветения подавлена, остановлена или задержана. Также раскрыто применение пептида или белка и вектора для получения трансгенного растения, у которого стадия цветения подавлена, остановлена или задержана. Изобретение позволяет получить трансгенное растение, у которого стадия цветения подавлена, остановлена или задержана. 3 н. и 7 з.п. ф-лы, 18 ил., 4 табл., 4 пр.

СПОСОБ ПОВЫШЕНИЯ УСТОЙЧИВОСТИ РАСТЕНИЙ К ПАТОГЕННЫМ МИКРООРГАНИЗМАМ

Растение трансформируют генетической конструкцией, включающей в себя последовательность ДНК, кодирующую рецептор для системного сигнального соединения, выбранного из группы, состоящей из салициловой кислоты, жасминовой кислоты и брассиностероидов. Предпочтительно, рецептор представляет собой RKS-рецептор. Также могут быть использованы комбинации рецепторов и/или химерные рецепторы. За счет указанной трансформации растение приобретает повышенную устойчивость к патогенным микроорганизмам. 4 н. и 9 з.п. ф-лы, 25 ил.

ФРАГМЕНТ ДНК, ПОЛУЧАЕМЫЙ ИЗ Arabidopsis thaliana, ЕГО СУБФРАГМЕНТ ИЛИ КОМБИНАЦИЯ СУБФРАГМЕНТОВ, ПОСЛЕДОВАТЕЛЬНОСТЬ ХИМЕРНОЙ ДНК И ЕЕ ИСПОЛЬЗОВАНИЕ, РЕПЛИКОН (ВАРИАНТЫ)

Фрагменты ДНК могут быть использованы в селекции растений. Введение промоторных фрагментов ДНК, способных стимулировать индуцируемую нематодами узелково-корневую и кистозную транскрипцию связанных с ними последовательностей ДНК, в растение повторно позволяет придать широкому кругу растений устойчивость к нематодам. 5 с. и 11 з.п. ф-лы, 8 ил., 4 табл.

РАСТЕНИЯ С ПОВЫШЕННОЙ УРОЖАЙНОСТЬЮ И СПОСОБ ИХ ПОЛУЧЕНИЯ

Изобретение относится к биотехнологии. Описан способ увеличения урожайности обеспечивающих урожай частей растений относительно соответствующих растений дикого типа, включающий введение в растение нуклеиновой кислоты, кодирующей циклин-зависимую киназу D-типа (CDKD), содержащую NXTALRE звено, где Х означает любую аминокислоту. Раскрыт способ производства трансгенного растения с повышенной урожайностью, включающий введение в растение или растительную клетку кодирующей CDKD нуклеиновой кислоты, содержащую NXTALRE звено, где Х означает любую аминокислоту, и культивирование растительной клетки в условиях, промотирующих регенерацию и рост зрелого растения. Изобретение позволяет повышать урожайность растений. 2 н. и 12 з.п. ф-лы, 3 ил., 5 табл.

КОМПОЗИЦИИ И СПОСОБЫ КОНТРОЛЯ ВРЕДИТЕЛЕЙ РАСТЕНИЙ

Изобретение относится к области биохимии, в частности к химерной генетической конструкции для экспрессии белка, токсичного для совки-ипсилон (Agrotis ipsilon), а также к содержащему ее вектору, клетке, растению, семени растения. Также раскрыта синтетическая молекула нуклеиновой кислоты для обеспечения экспрессии белка, токсичного для совки-ипсилон (Agrotis ipsilon), а также способ получения устойчивого к совке-ипсилон трансгенного растения. Изобретение также относится к белку, токсичному для совки-ипсилон (Agrotis ipsilon), к способу его получения, а также к содержащей его композиции и к способу борьбы с совкой-ипсилон (Agrotis ipsilon) с его использованием. 11 н. и 16 з.п. ф-лы, 3 табл., 11 пр.

ИЗОЛИРОВАННЫЕ ПОЛИПЕПТИДЫ, КОДИРУЮЩИЕ ИХ ПОЛИНУКЛЕОТИДЫ, ЭКСПРЕССИРУЮЩИЕ ИХ ТРАНСГЕННЫЕ РАСТЕНИЯ И СПОСОБЫ ИХ ИСПОЛЬЗОВАНИЯ

Изобретение относится к области биохимии. Представлена нуклеиновокислотная конструкция для экспрессии в клетке растения для повышения эффективности использования азота растением, содержащая нуклеиновокислотную последовательность, по меньшей мере, на 85% идентичную нуклеотидной последовательности, соответствующей SEQ ID NO: 70, и промоторную последовательность, способную направлять транскрипцию нуклеиновокислотной последовательности в клетке-хозяине. Представлен изолированный полипептид для экспрессии в клетке растения для повышения эффективности использования азота растением, содержащий аминокислотную последовательность, по меньшей мере, на 85% гомологичную аминокислотной последовательности, соответствующей SEQ ID NO: 1186. Также представлена растительная клетка для получения зрелого растения, обладающего повышенной толерантностью к стрессовым условиям посредством более эффективного использования азота растением. Раскрыты способ повышения толерантности растения к стрессовым условиям, способ ...

СПОСОБ ПОЛУЧЕНИЯ ТРАНСГЕННОГО РАСТЕНИЯ КУКУРУЗЫ

Способ предназначен для получения фертильных трансгенных растений кукурузы и может быть использован для введения в хромосому рекомбинантной ДНК. Реципиентные клетки, полученные из способной к регенерации рыхлой эмбриогенной каллусной культуры, обстреливают микрочастицами, покрытыми ДНК. Используется каллусная культура незрелых зародышей в виде комочков 30 - 80 мг, которая культивируется на твердой питательной среде. Вводимая ДНК может содержать ген, кодирующий белок семян, в результате чего содержание аминокислот увеличивается. 3 з.п.ф-лы. 8 ил., 9 табл.

РАСТЕНИЯ С МОДИФИЦИРОВАННЫМИ ХАРАКТЕРИСТИКАМИ РОСТА И СПОСОБ ИХ ПОЛУЧЕНИЯ

... 1. Способ улучшения характеристик роста растения, включающий повышение экспрессии в растение последовательности нуклеиновой кислоты, кодирующей GRUBX белок, и/или включающий повышение активности и/или повышение уровней GRUBX белка в растении, и необязательно отбор растений с улучшенными характеристиками роста. 2. Способ по п.1, где указанное повышение осуществляется путем проведения генетической модификации, предпочтительно в локусе гена, кодирующего GRUBX белок. 3. Способ по п.2, где указанная генетическая модификация осуществляется с помощью одного из сайт-направленных мутагенезов, гомологичной рекомбинации, TILLING и Т-ДНК активации. 4. Способ улучшения характеристик роста растения, включающий введение и экспрессирование в растение выделенной последовательности нуклеиновой кислоты, кодирующей GRUBX белок. 5. Способ по п.4, где указанная нуклеиновая кислота, кодирующая GRUBX белок, сверхэкспрессируется в растение. 6. Способ по п.4 или 5, где указанная нуклеиновая кислота произведена из ...

ГЕНЫ АРАБИДОПСИСА, КОДИРУЮЩИЕ БЕЛКИ, УЧАСТВУЮЩИЕ В САХАРНОМ И ЛИПИДНОМ ОБМЕНЕ, И СПОСОБЫ ИХ ПРИМЕНЕНИЯ

... 1. Изолированная нуклеиновая кислота белка липидного обмена (LMP), включающая полинуклеотидную последовательность, выбранную из группы, состоящей из:а) полинуклеотидной последовательности, указанной в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 или SEQ ID NO: 11;б) полинуклеотидной последовательности, кодирующей полипептид, кодированный полинуклеотидной последовательностью, указанной в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7. SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 или SEQ ID NO: 11;в) полинуклеотидной последовательности, по крайней мере, на 70% идентичной последовательности полноразмерной нуклеиновой кислоты, указанной выше в а) или b);г) полинуклеотидной последовательности, комплементарной к полноразмерной LMP нуклеиновой кислоте указанной выше в а) или б); ид) полинуклеотидной последовательности, которая гибридизируется в строгих условиях ...

СИНТЕТИЧЕСКИЕ ТРАНЗИТНЫЕ ПЕПТИДЫ ХЛОРОПЛАСТОВ

... 1. Выделенная молекула нуклеиновой кислоты, содержащая:нуклеотидную последовательность, кодирующую синтетический транзитный пептид хлоропласта, который происходит из эталонной нуклеотидной последовательности, полученной при выравнивании ферментов 5-энолпирувилшикимат-3-фосфат-синтазы (EPSPS).2. Выделенная молекула нуклеиновой кислоты по п. 1, которая дополнительно содержит представляющую интерес нуклеотидную последовательность, функционально связанную с нуклеотидной последовательностью, кодирующей синтетический транзитный пептид хлоропласта.3. Выделенная молекула нуклеиновой кислоты по п. 1, в которой эталонная нуклеотидная последовательность, полученная при выравнивании ферментов 5-энолпирувилшикимат-3-фосфат-синтазы (EPSPS), выделена из видов, выбираемых из группы, состоящей из видов Brassica, видов Glycine, видов Arabidopsis и видов Duneila.4. Выделенная молекула нуклеиновой кислоты по п. 1, в которой эталонную нуклеотидную последовательность, полученную при выравнивании полипептидов ...

ИНСЕКТИЦИДНЫЕ БЕЛКИ И СПОСОБЫ ИХ ПРИМЕНЕНИЯ

КОМПОЗИЦИИ И СПОСОБЫ КОНТРОЛЯ ВРЕДИТЕЛЕЙ РАСТЕНИЙ

РАСТЕНИЯ, ХАРАКТЕРИЗУЮЩИЕСЯ УЛУЧШЕННЫМИ РОСТОВЫМИ ХАРАКТЕРИСТИКАМИ, И СПОСОБ ИХ ПОЛУЧЕНИЯ

... 1. Способ повышения урожайности растений по сравнению с таковой соответствующих растений дикого типа, предусматривающий модулирование экспрессии растением нуклеиновой кислоты, кодирующей полипептид гомеодомена класса I - лейциновой застежки hox5 (HDZip) или его гомолог, и необязательно отбор растений, характеризующихся повышенной урожайностью, причем указанные полипептид HDZip класса I hox5 или его гомолог содержат в направлении от N-конца к С-концу: (i) кислый бокс; и (ii) гомеодомен класса I; и (iii) лейциновую застежку более, чем с 5 гептадами. ! 2. Способ по п.1, в котором указанный полипептид HDZip класса I hox5 или его гомолог дополнительно содержат один или оба из следующего: (i) Trp хвост; и (ii) аминокислотный мотив RPFF, где R представляет собой Arg, Р представляет собой Pro, a F представляет собой Phe, и в пределах этого мотива возможны одна или несколько консервативных замен в любом положении и/или одна или две неконсервативные замены в любом положении. ! 3. Способ по п.1, в ...

ИНСЕКТИЦИДНЫЕ ПОЛИПЕПТИДЫ, ОБЛАДАЮЩИЕ УЛУЧШЕННЫМ СПЕКТРОМ АКТИВНОСТИ, И ПУТИ ИХ ПРИМЕНЕНИЯ

ПЕСТИЦИДНЫЕ ГЕНЫ И СПОСОБЫ ИСПОЛЬЗОВАНИЯ

ТРАНСГЕННЫЕ РАСТЕНИЯ С УЛУЧШЕННЫМИ ХАРАКТЕРИСТИКАМИ РОСТА

... 1. Трансгенное растение, содержащее GPT трансген и GS трансген, где указанный GPT трансген и указанный GS трансген операбельно связаны с растительным промотором. ! 2. Трансгенное растение по п.1, где GS трансген представляет собой GS1 трансген. ! 3. Трансгенное растение по п.1, где трансген GPT кодирует полипептид, имеющий аминокислотную последовательность, выбранную из группы, состоящей из: (a) SEQ ID NO:2; SEQ ID NO:9; SEQ ID NO:15, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO 24, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35 и SEQ ID NO:36, и (b) аминокислотной последовательности, которая, по меньшей мере, на 75% идентичная аминокислотной последовательности, выбранной из группы, состоящей из SEQ ID NO:2; SEQ ID NO:9; SEQ ID NO:15, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO 24, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35 и SEQ ID NO:36, и который имеет GPT активность. ! 4. Трансгенное растение по п.3, где GS трансген кодирует ...

РЕКОМБИНАНТНАЯ ПОЛИНУКЛЕОТИДНАЯ ПОСЛЕДОВАТЕЛЬНОСТЬ, ХАРАКТЕРИЗУЮЩАЯ УНИКАЛЬНЫЙ ТРАНСФОРМАЦИОННЫЙ АКТ МЕЖДУ ГЕНЕТИЧЕСКОЙ КОНСТРУКЦИЕЙ, ВКЛЮЧАЮЩЕЙ ГЕН cryIIIa, И ГЕНОМНОЙ ДНК КАРТОФЕЛЯ СОРТА НЕВСКИЙ, ЕЕ ПРИМЕНЕНИЕ И СОДЕРЖАЩИЕ ЭТУ ПОСЛЕДОВАТЕЛЬНОСТЬ КЛЕТКА, ТРАНСГЕННОЕ РАСТЕНИЕ И ЕГО ПОТОМСТВО

Изобретение относится к области генетической инженерии, в частности к получению устойчивого к колорадскому жуку и отвечающего условиям биологической и пищевой безопасности трансгенного картофеля. Конструируют рекомбинантную полинуклеотидную последовательность, имеющую общую формулу Х-А, где Х - часть нуклеотидной последовательности, введенной генетической конструкции, соответствующая SEQ ID №1, а А - нуклеотидная последовательность фланкирующего участка геномной ДНК картофеля сорта Невский, соответствующая SEQ ID №2. Получают клетку растения, продуцирующую белок cryIIIa, содержащую рекомбинантную полинуклеотидную последовательность, а также трансгенное растение картофеля и его вегетативное потомство, устойчивое к колорадскому жуку. Используют полинуклеотидную последовательность для идентификации растительной клетки, продуцирующей белок cryIIIa, растения и вегетативного потомства. 5 н.п. ф-лы, 6 ил., 7 табл.

РАСТЕНИЕ, РАСТИТЕЛЬНЫЙ МАТЕРИАЛ, СПОСОБЫ ПОЛУЧЕНИЯ РАСТЕНИЯ, РЕКОМБИНАНТНАЯ ДНК, ВЕКТОР, ШТАММ, СПОСОБЫ СНИЖЕНИЯ НАНЕСЕНИЯ УЩЕРБА УРОЖАЮ

Изобретение обеспечивает растения, которые в результате экпрессии рекомбинантной ДНК имеют пониженную восприимчивость к растительным паразитическим нематодам. В соответствии с предпочтительным вариантом указанная рекомбинантная ДНК вызывает разрушение питательной структуры для нематод. В другом варианте экспрессия указанной рекомбинантной ДНК по крайней мере тормозит образование питательной структуры для нематод. В соответствии с более предпочтительным вариантом указанная рекомбинантная ДНК включает ген-А, который при экспрессии разрушает питательную структуру для нематод, причем ген-А контролируется промотором-А, управляющим экспрессией по крайней мере в питательной структуре для нематод, и ген-В, который при экспрессии нейтрализует разрушающее действие гена-А, причем ген-В контролируется промотором-В, управляющим экспрессией практически во всех клетках растения, где происходит экспрессия гена-А, при условии, что указанный промотор неэффективно управляет экспрессией гена-В в питательной ...

ИНСЕКТИЦИДНЫЕ ПОЛИПЕПТИДЫ С ШИРОКИМ СПЕКТРОМ АКТИВНОСТИ И ИХ ПРИМЕНЕНИЯ

ИНСЕКТИЦИДНЫЕ БЕЛКИ ИЗ РАСТЕНИЙ И СПОСОБЫ ИХ ПРИМЕНЕНИЯ

ИНСЕКТИЦИДНЫЕ ПОЛИПЕПТИДЫ, ОБЛАДАЮЩИЕ УЛУЧШЕННЫМ СПЕКТРОМ АКТИВНОСТИ, И ИХ ПРИМЕНЕНИЯ

RAS OPPOSITE (ROP) И РОДСТВЕННЫЕ МОЛЕКУЛЫ НУКЛЕИНОВЫХ КИСЛОТ, КОТОРЫЕ ПРИДАЮТ УСТОЙЧИВОСТЬ ЖЕСТКОКРЫЛЫМ И ПОЛУЖЕСТКОКРЫЛЫМ НАСЕКОМЫМ-ВРЕДИТЕЛЯМ

ПЕСТИЦИДНЫЕ ГЕНЫ И СПОСОБЫ ИХ ПРИМЕНЕНИЯ

КОМБИНАЦИИ, ВКЛЮЧАЮЩИЕ БЕЛКИ Cry34Ab/35Ab И Сry3Ba, ДЛЯ ПРЕДОТВРАЩЕНИЯ РАЗВИТИЯ УСТОЙЧИВОСТИ У КУКУРУЗНЫХ КОРНЕВЫХ ЖУКОВ (Diabrotica spp.)

... 1. Трансгенное растение, которое продуцирует белок Cry34, белок Cry35 и инсектицидный белок Cry3B.2. Трансгенное растение по п.1, где указанное растение дополнительно продуцирует четвертый инсектицидный белок, выбранный из группы, состоящей из Cry3A и Cry6A.3. Семя растения по любому из пп.1 и 2, где указанное семя содержит указанную ДНК.4. Поле растений, содержащее множество растений по любому из пп.1 и 2.5. Поле растений по п.4, где указанное поле дополнительно содержит резервные растения, не содержащие Bt белки, где указанные резервные растения составляют менее чем 40% всех культур на указанном поле.6. Поле растений по п.5, где указанные резервные растения составляют менее чем 30% всех культур на указанном поле.7. Поле растений по п.5, где указанные резервные растения составляют менее чем 20% всех культур на указанном поле.8. Поле растений по п.5, где указанные резервные растения составляют менее чем 10% всех культур на указанном поле.9. Поле растений по п.5, где указанные резервные ...

КОМПОЗИЦИИ И СООТВЕТСТВУЮЩИЕ СПОСОБЫ МОДУЛИРОВАНИЯ ЭНДОСИМБИОНТОВ

КОМПОЗИЦИИ И СПОСОБЫ БОРЬБЫ С LEPTINOTARSA

РАСТЕНИЯ, УСТОЙЧИВЫЕ К НАСЕКОМЫМ-ВРЕДИТЕЛЯМ

ПОДАВЛЕНИЕ ЭКСПРЕССИИ ГЕНОВ У НАСЕКОМЫХ-ВРЕДИТЕЛЕЙ

МОДИФИЦИРОВАННЫЕ ИНСЕКТИЦИДНЫЕ Cry-БЕЛКИ Cry1Ca

... 1. Вариант белка Cry1Ca, который обладает инсектицидной активностью, в котором все или части из N-концевых альфа-спиралей 1, 2A и/или 2B соответствующего Cry1Ca дикого типа удалены.2. Вариант белка по п. 1, где делеции удаляют всю α-спираль 1 и всю или часть α-спирали 2 в домене I, причем указанный белок содержит α-спирали с 3 по 7.3. Вариант белка по п. 1, где указанные делеции увеличивают инсектицидную активность инсектицидного белка DIG-109, где указанные делеции начинаются перед началом α-спирали 2A и завершаются после конца α-спирали 2B, но не продолжаются на α-спираль 3.4. Вариант белка по п. 1, где указанные делеции увеличивают инсектицидную активность инсектицидного белка DIG-152, где указанные делеции начинаются перед началом α-спирали 2A и завершаются после конца α-спирали 2B, но не продолжаются на α-спираль 3.5. Вариант белка по п. 1, где N-концевые делеции начинаются по меньшей мере с одной дестабилизирующей аминокислоты, и указанный белок содержит добавленный кодон, который ...

ПОДХОД РНК-ИНТЕРФЕРЕНЦИИ ДЛЯ ЗАЩИТЫ СЕЛЬСКОХОЗЯЙСТВЕННЫХ РАСТЕНИЙ ОТ ВРЕДИТЕЛЕЙ

СПОСОБЫ УВЕЛИЧЕНИЯ ВЫХОДА БИОМАССЫ

... 1. Способ идентификации аллеля, который ассоциирован с выходом биомассы собираемого урожая сельскохозяйственной культуры, включающий: получение образца растения сельскохозяйственной культуры; амплификацию ДНК, присутствующей в указанном образце, и обнаружение присутствия полинуклеотидной последовательности, идентичной, по меньшей мере, на 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 97, 98, 99 или 100% SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или 25 в амплифицированной ДНК.2. Способ селекции сельскохозяйственной культуры посредством отбора аллеля, ассоциированного с выходом биомассы собираемого урожая, где указанный аллель представляет собой аллель полинуклеотидной последовательности, причем указанная полинуклеотидная последовательность идентична, по меньшей мере, на 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 97, 98, 99 или 100% SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или 25, где указанный ...

Способы трансформации растений дл экспрессии дельта-эндотоксинов bacillus thuringiensis

... 1. Способ получения трансгенного растения, предусматривающий введение в его геном последовательности нуклеиновой кислоты, содержащей функциональную в растении промоторную последовательность, функционально связанную с полинуклеотидной последовательностью, кодирующей белок Cry2А δ-эндотоксина Bacillus thuringiensis, представленный в SEQ ID NO: 2 или SEQ ID NO: 18, причем экспрессия указанной последовательности нуклеиновой кислоты в указанном растении позволяет получить указанный белок, локализованный в субклеточной органелле или субклеточном компартменте. 2. Способ получения трансгенного растения, предусматривающий введение в его геном последовательности нуклеиновой кислоты, содержащей функциональную в растении промоторную последовательность, функционально связанную с первой полинуклеотидной последовательностью, кодирующей пластидный транзитный пептид, которая связана в рамке считывания со второй полинуклеотидной последовательностью, кодирующей белок Cry2А δ-эндотоксина Bacillus thuringiensis ...

CRY1D ДЛЯ БОРЬБЫ С ХЛОПКОВОЙ СОВКОЙ

КОМБИНИРОВАННОЕ ПРИМЕНЕНИЕ БЕЛКОВ Cry1Fa И Cry1Ab ДЛЯ БОРЬБЫ С ОГНЕВКОЙ САХАРНОГО ТРОСТИКА, РЕЗИСТЕНТНОЙ К Cry-БЕЛКАМ, И ДЛЯ УПРАВЛЕНИЯ РЕЗИСТЕНТНОСТЬЮ НАСЕКОМЫХ НА САХАРНОМ ТРОСТНИКЕ

... 1. Растение сахарного тростника, содержащее ДНК, кодирующую инсектицидный белок Cry1Fa, и ДНК, кодирующую инсектицидный белок Cry1Ab.2. Растение сахарного тростника по п.1, в котором ДНК, кодирующую коровый токсин-содержащий белок Cry1Fa, и ДНК, кодирующую коровый токсин-содержащий белок Cry1Ab, интрогрессированы в указанное растение сахарного тростника.3. Часть растения по п.1.4. Плод размножения черенкованием или клонального размножения растения по п.1.5. Поле растений, содержащее He-Bt-растения убежища и множество растений по п.1, где указанные растения убежища составляют менее чем 40% от всех растений на указанном поле.6. Поле растений по п.5, где указанные растения убежища составляют менее чем 30% от всех злаковых растений на указанном поле.7. Поле растений по п.5, где указанные растения убежища составляют менее чем 20% от всех злаковых растений на указанном поле.8. Поле растений по п.5, где указанные растения убежища составляют менее чем 10% от всех злаковых растений на указанном ...

БОРЬБА С ЖЕСТКОКРЫЛЫМИ НАСЕКОМЫМИ-ВРЕДИТЕЛЯМИ

... 1. Способ контроля жесткокрылых насекомых-вредителей, который включает доставку жесткокрылому вредителю или в его окружающую среду композиции, содержащей по меньшей мере один активный в отношении жесткокрылых белок и по меньшей мере один активный в отношении чешуекрылых белок, где композиция контролирует жесткокрылого вредителя в большей степени, чем можно было бы ожидать за счет любого отдельного активного в отношении жесткокрылых белка, включенного в данную композицию отдельно.2. Способ по п.1, где активный в отношении жесткокрылых белок представляет собой модифицированный Cry3A-белок, а активный в отношении чешуекрылых белок представляет собой белок Cry1 или белок Vip3.3. Способ по п.2, где Cry1-белок представляет собой Cry1Ab.4. Способ по п.2, где белок Vip3 представляет собой белок Vip3Aa.5. Способ по п.4, где белок Vip3Aa представляет собой Vip3Aa20.6. Способ по п.1, где жесткокрылый вредитель представляет собой колорадского жука или кукурузного корневого червя.7. Способ по п.6, где ...

КОМБИНАЦИИ, ВКЛЮЧАЮЩИЕ БЕЛКИ Cry34Ab/35Ab И Cry6Aa, ДЛЯ ПРЕДОТВРАЩЕНИЯ РАЗВИТИЯ УСТОЙЧИВОСТИ У КУКУРУЗНЫХ КОРНЕВЫХ ЖУКОВ (Diabrotica spp.)

... 1. Трансгенное растение, которое продуцирует белок Cry34, белок Cry35 и инсектицидный белок Cry6A.2. Трансгенное растение по п.1, где указанное растение дополнительно продуцирует четвертый инсектицидный белок, выбранный из группы, состоящей из Cry3B и Cry3A.3. Семя растения по любому из пп.1 или 2, где указанное семя содержит указанную ДНК.4. Поле растений, содержащее множество растений по любому из пп.1 или 2.5. Поле растений по п.4, где указанное поле дополнительно содержит резервные растения, не содержащие белки Bt, где указанные резервные растения составляют менее чем 40% всех культур на указанном поле.6. Поле растений по п.5, где указанные резервные растения составляют менее чем 30% всех культур на указанном поле.7. Поле растений по п.5, где указанные резервные растения составляют менее чем 20% всех культур на указанном поле.8. Поле растений по п.5, где указанные резервные растения составляют менее чем 10% всех культур на указанном поле.9. Поле растений по п.5, где указанные резервные ...

КОМБИНАЦИИ, ВКЛЮЧАЮЩИЕ БЕЛКИ Cry3Aa И Cry6Aa, ДЛЯ ПРЕДОТВРАЩЕНИЯ РАЗВИТИЯ УСТОЙЧИВОСТИ У КУКУРУЗНЫХ КОРНЕВЫХ ЖУКОВ (Diabrotica spp.)

... 1. Трансгенное растение, которое продуцирует инсектицидный белок Cry3A и инсектицидный белок Cry6A.2. Трансгенное растение по п.1, где указанное растение дополнительно продуцирует третий инсектицидно активный белок, выбранный из группы, состоящей из Cry3B, Cry34 и Cry35.3. Семя растения по любому из пп.1-2, где указанное семя содержит указанную ДНК.4. Поле растений, содержащее множество растений по любому из пп.1-2.5. Поле растений по п.4, где указанное поле дополнительно содержит резервные не содержащие Bt белки растения, где указанные резервные растения составляют менее чем 40% всех культур на указанном поле.6. Поле растений по п.5, где указанные резервные растения составляют менее чем 30% всех культур на указанном поле.7. Поле растений по п.5, где указанные резервные растения составляют менее чем 20% всех культур на указанном поле.8. Поле растений по п.5, где указанные резервные растения составляют менее чем 10% всех культур на указанном поле.9. Поле растений по п.5, где указанные резервные ...

КОМПОЗИЦИИ И СПОСОБЫ КОНТРОЛЯ ВРЕДИТЕЛЕЙ РАСТЕНИЙ

СИНТЕТИЧЕСКИЕ ГЕНЫ

... 1. Синтетическая последовательность ДНК для экспрессии представляющего интерес белка в клетках кукурузы, которая содержит:a) оптимизированную по кодонам последовательность ДНК, кодирующую представляющий интерес белок,b) по меньшей мере, одну последовательность сигнала полиаденилирования, выбранную из группы, состоящей из класса I и класса II, где:класс I выбирают из группы, состоящей из AATAAA, AATAAT, AACCAA, ATATAA, AATCAA, ATACTA, ATAAAA, ATGAAA, AAGCAT, ATTAAT, ATACAT, AAAATA, ATTAAA, AATTAA, AATACA и CATAAA; икласс II выбирают из группы, состоящей из ATATAT, TTGTTT, TTTTGT, TGTTTT, TATATA, TATTTT, TTTTTT, ATTTTT, TTATTT, TTTATT, TAATAA, ATTTAT, TATATT, TTTTAT, ATATTT, TATTAT, TGTTTG, TTATAT, TGTAAT и AAATAA; игде указанная оптимизированная по кодонам последовательность ДНК содержит, по меньшей мере, одну последовательность сигнала полиаденилирования из класса II, и где указанная синтетическая последовательность ДНК содержит меньше последовательностей сигналов полиаденилирования класса ...

КОМБИНИРОВАННОЕ ПРИМЕНЕНИЕ Vip3Ab И Cry1Ab ДЛЯ РЕГУЛИРОВАНИЯ УСТОЙЧИВЫХ НАСЕКОМЫХ

... 1. Трансгенное растение, включающее ДНК, кодирующую инсектицидный белок Vip3Ab, и ДНК, кодирующую инсектицидный белок Cry1Ab.2. Семя растения по п.1.3. Растение по п.1, где указанную ДНК интрогрессировали в указанное растение.4. Семя растения по п.3.5. Поле растений, включающих Bt-резерватные растения и множество растений по п.1, в котором указанные резерватные растения составляют менее 40% от всех растений сельскохозяйственных культур на указанном поле.6. Поле растений по п.5, на котором указанные резерватные растения составляют менее 30% от всех растений сельскохозяйственных культур на указанном поле.7. Поле растений по п.5, на котором указанные резерватные растения составляют менее 20% от всех растений сельскохозяйственных культур на указанном поле.8. Поле растений по п.5, на котором указанные резерватные растения составляют менее 10% от всех растений сельскохозяйственных культур на указанном поле.9. Поле растений по п.5, на котором указанные резерватные растения составляют менее 5% ...

РАСТЕНИЯ, УСТОЙЧИВЫЕ К НАСЕКОМЫМ-ВРЕДИТЕЛЯМ

... 1. Трансгенное растение или репродуктивный материал, или материал для размножения трансгенного растения, или культивируемая клетка трансгенного растения, которая экспрессирует или способна экспрессировать по меньшей мере одну интерферирующую рибонуклеиновую кислоту (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного вредителя,где РНК содержит по меньшей мере один сайленсирующий элемент, где сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, игде ген-мишень(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO:1, 174, 404, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, ...

РЕКОМБИНАНТНАЯ ПОЛИНУКЛЕОТИДНАЯ ПОСЛЕДОВАТЕЛЬНОСТЬ, ХАРАКТЕРИЗУЮЩАЯ УНИКАЛЬНЫЙ ТРАНСФОРМАЦИОННЫЙ АКТ МЕЖДУ ГЕНЕТИЧЕСКОЙ КОНСТРУКЦИЕЙ, ВКЛЮЧАЮЩЕЙ ГЕН CRYIIIA, И ГЕНОМНОЙ ДНК КАРТОФЕЛЯ СОРТА ЕЛИЗАВЕТА,ЕЕ ПРИМЕНЕНИЕ И СОДЕРЖАЩИЕ ЭТУ ПОСЛЕДОВАТЕЛЬНОСТЬКЛЕТКА, ТРАНСГЕННОЕ РАСТЕНИЕ И ЕГО ПОТОМСТВО

... 1. Рекомбинантная полинуклеотидная последовательность, характеризующая уникальный трансформационный акт между генетической конструкцией, включающей ген cryIIIa, и геномной ДНК картофеля сорта Елизавета, обеспечивающий экспрессию названного гена на уровне, достаточном для проявления у растения признака устойчивости к колорадскому жуку, с общей формулой Х-А, где Х - часть нуклеотидной последовательности введенной генетической конструкции, соответствующая SEQ ID №1, а А - нуклеотидная последовательность фланкирующего участка геномной ДНК картофеля сорта Елизавета, соответствующая SEQ ID №2. 2. Клетка растения картофеля, продуцирующая белок cryllla, которая содержит рекомбинантную полинуклеотидную последовательность по п.1. 3. Растение устойчивого к колорадскому жуку трансгенного картофеля, содержащее клетки по п.2. 4. Совокупность потомков растения по п.3, сохранивших в ряду поколений генотипический признак родительского организма, контролируемый по наличию в геномной ДНК рекомбинантной полинуклеотидной ...

ОБЪЕКТ КУКУРУЗЫ MON 87411

... 1. Молекула рекомбинантной ДНК, обнаруживаемая в образце, содержащем ДНК кукурузы, при этом нуклеотидная последовательность указанной молекулы представляет собой:(а) последовательность, выбираемую из группы, состоящей из SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:21 и SEQ ID NO:25; или(b) нуклеотидную последовательность, полностью комплементарную (а),при этом присутствие такой молекулы ДНК является диагностическим признаком для ДНК объекта кукурузы MON 87411 в указанном образце.2. Молекула рекомбинантной ДНК, обнаруживаемая в образце, содержащем ДНК кукурузы, при этом нуклеотидная последовательность указанной молекулы представляет собой нуклеотидную последовательность, имеющую по меньшей мере 99% идентичности с SEQ ID NO:1 или с ее полным комплементом, и при этом присутствие такой молекулы ДНК является диагностическим признаком для ДНК объекта кукурузы MON 87411 в указанном образце.3. Молекула ...

СИНТЕТИЧЕСКИЕ ПРОИСХОДЯЩИЕ ИЗ BRASSICA ТРАНЗИТНЫЕ ПЕПТИДЫ ХЛОРОПЛАСТОВ

... 1. Выделенная молекула нуклеиновой кислоты, содержащая синтетическую происходящую из Brassica нуклеотидную последовательность, которая кодирует пептид, содержащий непрерывную аминокислотную последовательность первого транзитного пептида хлоропластов Brassica, причем пептид дополнительно содержит непрерывную аминокислотную последовательность второго транзитного пептида хлоропластов.2. Выделенная молекула нуклеиновой кислоты по п. 1, дополнительно содержащая представляющую интерес нуклеотидную последовательность, функционально связанную с синтетической происходящей из Brassica нуклеотидной последовательностью.3. Выделенная молекула нуклеиновой кислоты по п. 1, где первый транзитный пептид хлоропластов Brassica происходит из Brassica napus.4. Выделенная молекула нуклеиновой кислоты по п. 3, где второй транзитный пептид хлоропластов происходит из Brassica sp., отличного от вида, из которого происходит первый транзитный пептид хлоропластов Brassica.5. Выделенная молекула нуклеиновой кислоты ...

Endo-Xyloglucan-Transferase

Transgene Pflanzen, deren oberirdische Teile früher reifen und vollständig absterben

The present invention relates to transgenic plants, in particular to potato plants, in which the aerial parts ripen earlier and more rapidly than in wild plants and wither completely without influencing the capacity of the underground vegetal parts. These plants are characterised by a reduced GDP mannose pyrophosphorylase activity in their cells. This invention further relates to methods for producing such plants as well as to nucleic acid molecules coding the vegetal GDP mannose pyrophosphorylase.

SUKROSEPHOSPHATSYNTHASE (SPS), VERFAHREN ZU IHRER HERSTELLUNG, IHRE C-DNS, UND VERWENDUNG DER C-DNS ZUR MODIFIZIERUNG DER SPS-EXPRESSION IN PFLANZENZELLEN

BIOLOGISCHE INSEKTENBEKAEMPFUNGSMITTEL UND DESSEN VERWENDUNG.

Pflanzen mit erhöhtem Ertrag

Verfahren zur Herstellung einer Pflanze mit einem erhöhten Ertrag, verglichen mit einer entsprechenden Pflanze vom Wildtyp, welches wenigstens den folgenden Schritt umfasst: Erhöhen oder Erzeugen einer oder mehrerer Aktivitäten, ausgewählt aus der Gruppe bestehend aus einer (DL)-Glycerin-3-phosphatase, einer 2-Desoxyglucose-6-phosphatphosphatase, einer 3-Methyl-2-oxobutanoat-Hydroxymethyltransferase, einer Alkoholacetyltransferase, einer Aminosäurepermease, einer Aminomethyltransferase, einem Ammoniumtransporter, einem Aquaporin, einem ATP-bindenden Protein eines Arabinosetransportsystems, einer Argininosuccinatsynthase, einer Aspartataminotransferase, einem B1906-Protein, einem B3410-Protein, einer Cardiolipinsynthetase, einem CoA-Transferase-ähnlichen Protein (NAD(P)-bindend), einem Cobalttransportprotein, einem DNA- und proteinbindenden Protein zur Steuerung des Proteoms auf der posttranskriptionellen Ebene, einer Enoyl-CoA-Hydratase, einer Enoyl-CoA-Isomerase, einer Ethanolaminkinase ...

Verfahren zur Verbesserung der Wirksamkeit von Insektentoxinen.

Verbesserte Cannabispflanzen und Verfahren zur Herstellung und Verwendung derselben

Hierin offenbart ist eine Pflanze der Gattung Cannabis, die nicht blühen muss, um Trichome mit Sekundärverbindungen herzustellen. Hierin wird eine Pflanze der Gattung Cannabis bereitgestellt, die Trichome an nicht blühenden Teilen der Pflanze, wie z.B. Blättern, aufweist. Die offenbarten Pflanzen haben einen hohen Gewichtsanteil an sekundären Verbindungen und einen hohen Grad an Trichomabdeckung auf der Oberfläche der Pflanze. Ebenfalls hierin offenbart sind Verfahren zur Herstellung von Sekundärverbindungen aus einer Pflanze der Gattung Cannabis, ohne die Pflanze der Gattung Cannabis zum Blühen bringen zu müssen. Die offenbarten Verfahren sehen beispielsweise vor, die Trichomentwicklung in einer Pflanze der Gattung Cannabis zu induzieren, ohne die Pflanze der Gattung Cannabis blühen zu lassen.

Herstellung von Pflanzen mit verbesserter Wurzelbildung und verbesserter Vasen-Lebensdauer durch Verwendung von Stressresistenzgenen

PFLANZEN MIT ERHÖHTEM ERTRAG UND VERFAHREN ZUR ERZEUGUNG DAVON

Chemicals for sea lice monitoring and control

Fusion proteins for insect control

Method of planting transgenic crops

The present invention provides a method for reducing the incidence of resistance of insects to insecticidal plants. In particular, there is provided a locus at which insects feed comprising at least two regions, characterised in that: a) a first region comprises plants which produce at least a first insecticidal toxin; and b) a second region comprises plants which produce at least a second insecticidal toxin; wherein an insect which can develop resistance to the first toxin does not develop resistance to the second toxin, and the first region comprises plants which produce the first toxin but not the second toxin when the plants of the second region produce the second toxin but not the first toxin. The invention also provides a method for controlling insects. The toxins are preferably Bacillus thuringeinsis crystal proteins and VIP proteins. The crop is preferably a transgenic cotton plant.

Semiochemicals for sea lice monitoring and control

Modification of plant development and morphology

Characterisation of gene function using double stranded RNA inhibition

Pest And Pathogen Control

Transcriptional regulation in plants

Increasing isoprenoid biosynthesis

Methods of increasing biotic stress resistance in plants

Genetic reduction of male fertility in plants

Dna constructs.

A chemically-inducible plant gene expression cassette comprising a first promoter operatively linked to a regulator sequence which is derived from the alcR gene and encodes a regulator protein, and an inducible promoter operatively linked to a target gene which encodes a protein which is damaging to insects or whose expression induces a metabolic pathway which produces a metabolite which is damaging to insects, the inducible promoter being activated by the regulator protein in the presence of an effective exogenous inducer whereby application of the inducer causes expression of the target gene.

Insect resistant and herbicide tolerant breeding stack of soybean event pDAB9582.814.19.1 and pDAB4468.04.16.1

SEC23 NUCLEIC ACID MOLECULES THAT CONFER RESISTANCE TO COLEOPTERAN AND HEMIPTERAN PESTS

Proteins toxic to hemipteran insect species

Nucleotide sequences encoding insecticidal proteins

MODIFIED PYR/PYL RECEPTORS ACTIVATED BY ORTHOGONAL LIGANDS

Insect resistant cotton plants and methods for identifying same

Protein kinases and uses thereof.

Nucleic acid molecules are disclosed that are induced upon pathogen invasion or elicitor treatment. Such molecules aree functional in plants, plant tissue and in plant cells for inducible gene expression and altering the diseasee resistance phenotype of plants. Such molecules are, or are related to, sequences of calcium dependent protein kinase genes. Also diclosed are methods for obtaining transgenic plants containing such nucleic acid molecules and methods for using such molecules. Polypeptides encoded by such nucleic acids are also diclosed herein.

Isolated novel nucleic acid and protein molecules from corn and methods of using those molecules to generate transgene plants with enhanced agronomic traits

This disclosure provides purified nucleic acids and polypeptides. Also provided are transgenic plants, seeds, and plant cells containing DNA for expression of the proteins that are useful for imparting enhanced agronomic trait(s) to transgenic crop plants, methods of making such plants and methods of making agricultural commodity including seeds and hybrid seeds from such plants.

Nucleotide sequences and polypeptides encoded thereby useful for modifying plant characteristics

Isolated polynucleotides and polypeptides encoded thereby are described, together with the use of those products for making transgenic plants with increased tolerance to abiotic stress (e.g., high or low temperature, drought, flood).

Zinc knuckle proteins

TZP proteins and method of their use for improving plant characteristics are disclosed.

Genes regulating plant branching, promotors, genetic constructs containing same and uses thereof

The invention relates to genes coding for TCP family transcription factors and having a biological role in the development of axillary buds and branch growth. Furthermore, the invention relates to the promoters of the transcription of said genes, to the genetic constructs containing same and to the uses thereof, including the use of agents that modulate the expression of these genes in order to modify plant architecture.

Processing cellulosic biomass

Improved systems and methods for reducing costs and increasing yields of cellulosic ethanol are disclosed herein, along with plants genetically transformed for increased biomass, expression of lignocellulolytic enzyme polypeptides, and/or simplification of harvesting and downstream processing. Methods for processing biomass from these transgenic plants that involve less severe and/or less expensive pre-treatment protocols than are typically employed are also disclosed.

Methods and compositions for controlling plant pests

Compositions and methods for conferring pesticidal activity to bacteria, plants, plant cells, tissues and seeds are provided. Compositions comprising a coding sequence for a delta-endotoxin polypeptide are provided. The coding sequences can be used in DNA constructs or expression cassettes for transformation and expression in plants and bacteria. Compositions also comprise transformed bacteria, plants, plant cells, tissues, and seeds. In particular, isolated delta-endotoxin nucleic acid molecules are provided. Additionally, amino acid sequences corresponding to the polynucleotides are encompassed, and antibodies specifically binding to those amino acid sequences. In particular, the present invention provides for isolated nucleic acid molecules comprising nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO:13-24 or the nucleotide sequence set forth in SEQ ID NO:1-12 and 25-44, as well as variants and fragments thereof.

Soybean event mon89788 and methods for detection thereof

The present invention provides for soybean plant and seed comprising transformation event MON89788 and DNA molecules unique to these events. The invention also provides methods for detecting the presence of these DNA molecules in a sample.

Yield Enhancement in Plants by Modulation of a ZM-LOBDP1 Protein

Compositions and methods for modulating plant development and for increasing yield in a plant are provided. The compositions include a ZM-LOBDP1 sequence. Compositions of the disclosure comprise amino acid sequences and nucleotide sequences selected from SEQ ID NOS: 1 and 2 as well as variants and fragments thereof. Nucleotide sequences encoding the ZM-LOBDP1 molecule are provided in DNA constructs for expression in a plant of interest are provided for modulating the level of a ZM-LOBDP1 sequence in a plant or a plant part are provided. The methods comprise introducing into a plant or plant part a heterologous polynucleotide comprising a ZM-LOBDP1 sequence of the disclosure. The level of the ZM-LOBDP1 polypeptide can be increased or decreased. Such method can be used to increase the yield in plants; in one embodiment, the method is used to increase grain yield in cereals.

Yield Enhancement in Plants by Modulation of a ZM-ZFP1 Protein

Compositions and methods for modulating plant development and for increasing yield in a plant are provided. The compositions include a ZM-ZFP1 sequence. Compositions of the disclosure comprise amino acid sequences and nucleotide sequences selected from SEQ ID NOS: 1 and 2 as well as variants and fragments thereof. Nucleotide sequences encoding the ZM-ZFP1 molecule are provided in DNA constructs for expression in a plant of interest are provided for modulating the level of a ZM-ZFP1 sequence in a plant or a plant part are provided. The methods comprise introducing into a plant or plant part a heterologous polynucleotide comprising a ZM-ZFP1 sequence of the disclosure. The level of the ZM-ZFP1 polypeptide can be increased or decreased. Such method can be used to increase the yield in plants; in one embodiment, the method is used to increase grain yield in cereals.

Compositions and methods for modulation of plant cell division

The present invention provides compositions and methods for modulating cell division in plants. In particular, the present invention provides polynucleotides that encode REVOLUTA. In addition, REVOLUTA vectors and transformed plants are provided wherein plant cell division is modulated by expression of a REVOLUTA transgene as compared to a control population of untransformed plants. The present invention also provides methods for the isolation and identification of REVOLUTA genes from higher plants.

Method for detection of genetically modified maize bt11

The invention discloses a method for detection of genetically modified maize BT11. The principle of the method is that the DNA template of the sample is amplified at a temperature of 63° C.˜65° C. for 45˜60 min by using 4 specific primers and a DNA polymerase with strand displacement activity. The identification thereof is to make a judgment on whether BT11 component is contained in the sample by directly observing the turbidity in the reaction tube or the color change after the addition of SYBR Green with naked eyes or by agarose gel electrophoresis. The detection method of the invention has the advantages of high specificity, quickness, simplicity and convenience and the like, which provides a convenient method for detection of genetically modified maize BT11 with an extensive application prospect.

Plants containing a heterologous flavohemoglobin gene and methods of use thereof

Plant nitrogen use efficiency in corn has been improved by transformation with a flavohemoglobin gene. Plants comprising a flavohemoglobin gene have decreased nitric oxide (NO) levels, increased biomass accumulation under a sufficient nitrogen growth condition, and increased chlorophyll content under a limiting nitrogen growth condition. Additionally, these transformed plants evidence higher levels of yield.

Markerless transformation

Methods for identification of successful transformation without a need for in vitro selection are provided. Direct detection of nucleotide sequences of interest is described which eliminate the need for use of ancillary nucleotide sequences.

Dominant Negative Mutant Kip-Related Proteins (KRP) in Zea Mays and Methods of Their Use

The present invention provides expression vectors comprising polynucleotides encoding mutant Zea mays KRP dominant negative proteins, and methods of using the same. In addition, transgenic plants expressing said KRP dominant negative proteins are provided. Furthermore, methods of increasing average seed weight, seed size, seed number and/or yield of a plant by using said KRP dominant negative proteins are provided.

Transcription factors

The invention provides polynucleotide sequences isolated from plants encoding transcription factors. Polypeptides encoded by the polynucleotides are also provided. Products and methods of use are disclosed.

Plants Having Modulated Carbon Partitioning and a Method for Making the Same

The present invention relates generally to the field of molecular biology and concerns a method for modulating carbon partitioning in plants. More specifically, the present invention concerns a method for modulating carbon partitioning in plants by modulating expression in a plant of a nucleic acid encoding a particular type of NAC transcription factor. The present invention also concerns plants having modulated expression of a nucleic acid encoding a NAC transcription factor, which plants have modulated carbon partitioning relative to control plants. The invention also provides constructs useful in the methods of the invention.

Enhancin gene bel1 from bacillus thuringiensis and its use in biological insecticide

The isolation, cloning of an enhancin gene bel1 from Bacillus thuringiensis , and the use of an enhancin Bel1 in biological insecticides are disclosed in the present invention. A new enhancin gene bel1 is isolated from Bacillus thuringiensis subsp. kurstaki YBT-1520, and its encoded product is a new enhancin Bel1. The enhancin has very strong effect-enhancing activity on the insecticidal action of insecticidal crystal protein Cry1Ac in killing Lepidoptera insects. The insecticidal activity of genetically engineered Bacillus thuringiensis BMB0187 developed on the basis of this enhancin is 5.7 times as high as that of the initial strain.

Biologically-active radiolabeled cry1fa and receptor binding assay methods

Cysteine-specific radiolabeled Cry1Fa protein retains insecticidal activity against insect pests and binds to insect brush border membrane vesicle receptors in a saturable manner. The biologically-active radiolabeled Cry1Fa protein is useful in competitive binding assays with other Cry toxins.

Genes homologous to the flowering locus t (ft) gene and the use thereof for modulating tuberization

Use of genes homologous to the FT gene of Arabidopsis thaliana of any vegetable species to modulate tuberization in plants that develop tubercles, nucleotide sequence that encodes the potato SP6A protein (homologous to the FT of Arabidopsis thaliana ), genetic constructs that express said gene and the use thereof.

Novel Bacillus thuringiensis Gene With Lepidopteran Activity

The invention provides nucleic acids, and variants and fragments thereof, obtained from strains of Bacillus thuringiensis encoding polypeptides having pesticidal activity against insect pests, including Lepidoptera. Particular embodiments of the invention provide isolated nucleic acids encoding pesticidal proteins, pesticidal compositions, DNA constructs, and transformed microorganisms and plants comprising a nucleic acid of the embodiments. These compositions find use in methods for controlling pests, especially plant pests.

Method for Modifying Plant Architecture and Enhancing Plant Biomass And/Or Sucrose Yield

The present invention relates to methodology and constructs for modifying plant architecture and enhancing plant biomass and/or sucrose yield.

Plant regulatory elements and uses thereof

The present invention provides novel DNA molecules and constructs, including their nucleotide sequences, useful for modulating gene expression in plants and plant cells. The invention also provides transgenic plants, plant cells, plant parts, seeds, and commodity products comprising the DNA molecules operably linked to heterologous transcribable polynucleotides, along with methods of their use.

Sugar and lipid metabolism regulators in plants iii

Isolated nucleic acids and proteins associated with lipid and sugar metabolism regulation are provided. In particular, lipid metabolism proteins (LMP) and encoding nucleic acids originating from Arabidopsis thaliana are provided. The nucleic acids and proteins are used in methods of producing transgenic plants and modulating levels of seed storage compounds. Preferably, the seed storage compounds are lipids, fatty acids, starches or seed storage proteins.

Novel bacillus thuringiensis insecticidal proteins

The invention pertains to novel insecticidal compounds derived from Bacillus thuringiensis strains. New proteins designated Cry2Ae, Cry2Af, and Cry2Ag, and variants thereof are provided, as well as DNA sequences encoding these proteins or their variants. Further provided are recombinant hosts expressing such proteins, particularly plant cells and plants.

Polynucleotides and methods for improving plants

The invention provides methods and compositions for producing plant with altered biomass, the methods comprising the step of altering the expression and/or activity of the polypeptide comprising the sequence of SEQ ID NO:1, or a variant thereof, in a plant cell or plant. The invention also provides a polypeptide comprising the sequence of SEQ ID NO:1, and fragments of variants thereof the sequence. The invention also provides polynucleotides encoding such polypeptide sequences. The invention also provides constructs, cells and plants comprising such polynucleotides.

Corn event mir162

A novel transgenic corn event designated MIR162 is disclosed. The invention relates to nucleic acids that are unique to event MIR162 and to methods for detecting the presence of the MIR162 event based on DNA sequences of the recombinant constructs inserted into the corn genome that resulted in the MIR162 event and of genomic sequences flanking the insertion site. The invention further relates to corn plants comprising the transgenic genotype of MIR162 and to methods for producing a corn plant by crossing a corn plant comprising the MIR162 genotype with itself or another corn variety. Seeds of corn plants comprising the MIR162 genotype are also objects of the present invention. The invention also relates to methods of controlling insects using MIR162 corn plants.

Method to increase crop grain yield utilizing complementary paired growth and yield genes

The present invention provides methods to increase crop yield utilizing transgenic complementary paired genes controlling plant growth and yield. The specific genes increase female reproductive organs and are paired with genes responsible for modifying the growth of non-yield specific plant tissues. Plants, plant progeny, seeds and tissues created by these methods are also described. Polynucleotides encoding the paired sequences are provided for expression in a plant of interest. Expression cassettes, plants, plant cells, plant parts and seeds comprising the sequences of the invention are further provided. In specific embodiments, the polynucleotide is operably linked to a constitutive promoter.

Modified oil encapsulating proteins and uses thereof

The invention provides modified oleosins, including at least one artificially introduced cysteine, and methods and compositions for producing the modified oleosins. Also provided are polynucleotides encoding the modified oleosins, constructs and host cells comprising the polynucleotides, methods for producing oil bodies comprising the modified oleosins, in vivo and in vitro, and methods for producing oil in host cells and plants. The invention also provides methods for increasing the rate of CO 2 assimilation in photosynthetic cells and plants, and involves reducing or preventing lipid recycling, and/or expressing modified oleosins with artificially introduced cysteine residues in the photosynthetic cells and plants. Also provided are methods for increasing oil production in plants, via expression of modified oleosins in the non-photosynthetic tissues/organs of plants. The method also optionally includes the step of extrating the oil from the non-photosynthetic tissues/organs of the plant, or processing the oil rich non-photosynthetic tissues/organs into animal or biofuel feedstocks.

OsMPT GENE FOR MODIFYING PLANT ARCHITECTURE AND INCREASING YIELD, AND USES THEREOF

The present invention relates to a rice ( Oryza sativa )-induced Oryza sativa modifier of plant type (OsMPT) protein which is involved in adjusting tillering angle or angle of attachment between a leaf and a stem, a gene encoding the protein, a recombinant plant expression vector including the gene, a plant transformed by the recombinant plant expression vector, a method for modifying architectures of plants by adjusting the level of the gene in the cells thereof, to a method for manufacturing an architecturally modified plant transformed by the gene, to a plant with increased yield which is manufactured by the method, and to a composition containing the gene for modifying the architectures of plants and increasing the yield thereof.

Transgenic plants having increased biomass

Methods and materials for modulating biomass levels in plants are disclosed. For example, nucleic acids encoding biomass-modulating polypeptides are disclosed as well as methods for using such nucleic acids to transform plant cells. Also disclosed are plants having increased biomass levels and plant products produced from plants having increased biomass levels.

Down-regulating gene expression in insect pests

The present invention relates to genetic control of infestation by insect pest species, particularly prevention and/or control of pest infestation of plants, using interfering ribonucleic acid (RNA) molecules. Compositions and combinations containing the interfering RNA molecules of the invention for use in topical applications, for example in the form of insecticides.

Polynucleotides encoding proteins involved in plant metabolism

The invention provides isolated pyruvate dehydrogenase kinase nucleic acids and their encoded polypeptides. The present invention provides methods and compositions relating to altering pyruvate dehydrogenase kinase levels in plants. The invention further provides recombinant expression cassettes, host cells, transgenic plants, and antibody compositions.

USE OF Cry1Da IN COMBINATION WITH Cry1Ca FOR MANAGEMENT OF RESISTANT INSECTS

The subject invention includes methods and plants for controlling fall armyworm lepidopteran insects, said plants comprising a Cry1Da insecticidal protein and a Cry1Ca insecticidal protein, and various combinations of other proteins comprising this pair of proteins, to delay or prevent development of resistance by the insects.

Cytokinin Oxidase-Like Sequences and Methods of Use

Methods and compositions for modulating plant development are provided. Polynucleotide sequences and amino acid sequences encoding cytokinin oxidase polypeptides are provided. The sequences can be used in a variety of methods including modulating root development, modulating floral development, modulating leaf and/or shoot development, modulating seed size and/or weight, modulating tolerance under abiotic stress, and modulating resistance to pathogens. Polynucleotides comprising CKX promoters are also provided. The promoters can be used to regulate expression of a sequence of interest. Transformed plants, plant cells, tissues, and seed are also provided.

Cyclotides Having Nematocidal Activity and Methods of Use Thereof

The invention provides novel cyclotide polypeptides, and variants and fragments thereof, obtained from Butterfly pea and having pesticidal activity against nematodes. Particular embodiments of the invention provide isolated nucleic acids encoding pesticidal proteins, biopesticide compositions, expression cassettes, and transformed microorganisms and plants comprising a nucleic acid of the invention. These compositions find use in methods for controlling pests, especially plant-parasitic pests such as nematodes and insects.

Nucleotide sequences and corresponding polypeptides conferring modulated plant characteristics

The present invention relates to isolated nucleic acid molecules and their corresponding encoded polypeptides. The present invention further relates to the uses of these nucleic acid molecules and polypeptides. For example, the nucleic acid molecules and polypeptides could be used in making enzymes or used to make plants, plant cells, plant materials or seeds of a plant having such modulated growth or phenotype characteristics that are altered with respect to wild type plants grown under similar conditions.

Plant transcriptional regulators of abiotic stress ii

The instant disclosure relates to plant regulatory polypeptides, polynucleotides that encode them, homologs from a variety of plant species, and methods of using the polynucleotides and polypeptides to produce transgenic plants having advantageous properties compared to a reference plant, including improved abiotic stress tolerance. Sequence information related to these polynucleotides and polypeptides can also be used in bioinformatic search methods to identify related sequences and is also disclosed.

Defensin-Encoding Nucleic Acid Molecules Derived From Nicotiana Alata, Uses Therefor And Transgenic Plants Comprising Same

The present invention provides nucleic acid molecules derived from Nicotiana alata , which encode defensin-like molecules. The present invention contemplates the use of such nucleic acid molecules in the generation of transgenic plants having resistance or at least reduced sensitivity to plant pests including insects, microorganisms, fungi and/or viruses and the of the encoded defensin-like molecules in compositions for topical application to a plant or a plant part so as to reduce prevent or reduce infestation of the plant or plant part by plant pests. The transgenic plants provided by the present invention include monocotyledonous and dicotyledonous plants, and particularly include crop plants and ornamental flowering plants.

Grain Filling of a Plant Through the Modulation of NADH-Glutamate Synthase

The invention relates to a method for increasing the grain filling of a plant, wherein said method comprises overexpressing in said plant a wheat NADH-dependent glutamate synthase, in order to increase the grain weight and/or the grain protein content.

Method and composition for generating programmed cell death resistant algal cells

The present invention provides transgenic algal cells resistant to programmed cell death (PCD) and methods and compositions useful in generating such cells. Specifically, the invention utilizes expression of one or more mammalian anti-apoptotic genes in algal cells to promote resistance to PCD, which is useful for stress tolerance and increased cell viability and biomass production during cultivation.

Nitrogen Responsive Early Nodulin Gene

Isolated nucleic acids and proteins and plants expressing the same for improved nitrogen utilization, increased yield, and increased stress tolerance.

Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with increased tolerance to environmental stress

This invention relates generally to nucleic acid sequences encoding proteins that are associated with abiotic stress responses and abiotic stress tolerance in plants. In particular, this invention relates to nucleic acid sequences encoding proteins that confer drought, heat, cold, and/or salt tolerance to plants.

Nucleic acid molecules that target pp1-87b and confer resistance to coleopteran pests

This disclosure concerns nucleic acid molecules and methods of use thereof for control of coleopteran pests through RNA interference-mediated inhibition of target coding and transcribed non-coding sequences in coleopteran pests. The disclosure also concerns methods for making transgenic plants that express nucleic acid molecules useful for the control of coleopteran pests, and the plant cells and plants obtained thereby.

Nitrogen-efficient monocot plants

Methods of increasing nitrogen utilization efficiency in monocot plants through genetic modification to increase the levels of alanine aminotransferase expression and plants produced there from are described. In particular, methods for increasing the biomass and yield of transgenic monocot plants grown under nitrogen limiting conditions compared to non-transgenic plants are described. In this way, monocot plants may be produced that maintain a desired yield while reducing the need for high levels of nitrogen application.

Nitrate transport components

This invention relates to isolated nucleic acid fragments encoding high affinity nitrate transport components. The invention also relates to the construction of recombinant DNA constructs encoding all or a portion of nitrate transport components, in sense or antisense orientation, wherein expression of the recombinant DNA construct may alter levels of the nitrate transport components in a transformed host cell.

Plants Having Enhanced Yield-Related Traits and a Method for Making the Same

Nucleic acids and the encoded embryonic flower 2 (EMF2) polypeptides or Ubiquitin C-terminal Hydrolase 1 (UCH1-like) polypeptides are provided. A method of enhancing yield-related traits in plants by modulating expression of nucleic acids encoding EMF2 polypeptides or UCH1-like polypeptides is provided. Plants with modulated expression of the nucleic acids encoding EMF2 polypeptides or UCH1-like polypeptides have enhanced yield-related traits relative to control plants.

Plants resistant to pathogens and methods for production thereof

The present invention relates to plant genes involved in negative regulation of resistance to plant pathogens and uses thereof. More particularly, the invention relates to plants having a defective phytosulfokine (PSK) function and exhibiting an increased resistance to plant pathogens. The invention also relates to methods for producing modified plants resistant to various diseases. Furthermore, the invention relates to plants having a defective PSK receptor (PSKR) function, and to methods of screening and identifying molecules that modulate PSKR expression or activity.

Genes encoding nematode toxins

Compositions and methods for conferring nematicidal activity to bacteria, plants, plant cells, tissues and seeds are provided. Compositions including a coding sequence for nematicidal polypeptides are provided. The coding sequences can be used in DNA constructs or expression cassettes for transformation and expression in plants and bacteria. Compositions also include transformed bacteria, plants, plant cells, tissues, and seeds. In particular, isolated nematicidal nucleic acid molecules are provided. Additionally, amino acid sequences corresponding to the polynucleotides are encompassed. In particular, the present invention provides for isolated nucleic acid molecules including nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO:4, 5, 8, 9, 13, 14, 47, 48, or 49, the nucleotide sequence set forth in SEQ ID NO:1, 2, 3, 6, 7, 10, 11, 12, 15, 45, or 46, as well as variants and fragments thereof.

Plants Having Enhanced Yield-Related Traits and a Method for Making the Same

The present invention relates generally to the field of molecular biology and concerns a method for enhancing yield-related traits in plants by modulating expression in a plant of a nucleic acid encoding an SGT1 polypeptide, or a CLC-pKG polypeptide, or a HD-hydrolase-like polypeptide. The present invention also concerns plants having modulated expression of a nucleic acid encoding an SGT1 polypeptide, or a CLC-pKG polypeptide, or a HD-hydrolase-like polypeptide, which plants have enhanced yield-related traits relative to corresponding wild type plants or other control plants. The invention also provides constructs useful in the methods of the invention.

Marchantiales-derived unsaturated fatty acid synthetase genes and use of the same

A Δ5 fatty acid desaturase gene, a Δ6 fatty acid desaturase gene, and a Δ6 fatty-acid-chain elongase gene are isolated from a single species of Marchantiales. By introducing these genes into higher plants, transformed plants which can produce arachidonic acid and eicosapentaenoic acid (EPA) are obtained.

Functional expression of yeast nitrate transporter (ynt1) in maize to improve nitrate uptake

The present invention provides methods and compositions relating to altering NT activity, nitrogen utilization and/or uptake in plants. The invention relates to a method for the production of plants with maintained or increased yield under low or normal nitrogen fertility. The invention provides isolated nitrate transporter (NT) nucleic acids and their encoded proteins. The invention further provides recombinant expression cassettes, host cells, and transgenic plants. Plants transformed with nucleotide sequences encoding the NT enzyme show improved properties, for example, increased yield.

Invertebrate micrornas

This invention provides plants having resistance to invertebrate pests. More specifically, this invention discloses a non-natural transgenic plant cell expressing at least one invertebrate miRNA in planta for suppression of a target gene of an invertebrate pest or of a symbiont associated with the invertebrate pest. Also provided are recombinant DNA constructs for expression of at least one invertebrate miRNA in planta, a non-natural transgenic plant containing the non-natural transgenic plant cell of this invention, a non-natural transgenic plant grown from the non-natural transgenic plant cell of this invention, and non-natural transgenic seed produced by the non-natural transgenic plants, as well as commodity products produced from a non-natural transgenic plant cell, plant, or seed of this invention. This invention further provides a method of suppressing at least one target gene of an invertebrate pest of a plant or of a symbiont associated with the invertebrate, including providing a plant including the non-natural transgenic plant cell of this invention, wherein the invertebrate is the invertebrate pest, the recombinant DNA is transcribed in the non-natural transgenic plant cell to the recombinant miRNA precursor, and when the invertebrate pest ingests the recombinant miRNA precursor, the at least one target gene is suppressed.

Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance

Provided are isolated polynucleotides and nucleic acid constructs which comprise a nucleic acid sequence at least 80% identical to a nucleic acid sequence selected form the group consisting of SEQ ID NOs: 277, 1-276, 278-469 and 785-2397; and isolated polypeptides which comprise an amino acid sequence at least 80% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs: 482, 470-481, 483-784 and 2398-3818. Also provided are transgenic cells and plants expressing same and methods of using same for increasing nitrogen use efficiency, yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, and/or abiotic stress tolerance of a plant.

COMBINATIONS INCLUDING Cry34Ab/35Ab AND Cry6Aa PROTEINS TO PREVENT DEVELOPMENT OF RESISTANCE IN CORN ROOTWORMS (DIABROTICA SPP.)

The subject invention relates in part to Cry34Ab/35Ab in combination with Cry6Aa. The subject invention relates in part to the surprising discovery that combinations of Cry34Ab/Cry35Ab and Cry6Aa are useful for preventing development of resistance (to either insecticidal protein system alone) by a corn rootworm ( Diabrotica spp.) population. Included within the subject invention are plants producing these insecticidal Cry proteins, which are useful to mitigate concern that a corn rootworm population could develop that would be resistant to either of these insecticidal protein systems alone. Plants (and acreage planted with such plants) that produce these two insecticidal protein systems are included within the scope of the subject invention. The subject invention also relates in part to combinations of Cry34Ab/35Ab and Cry3Aa proteins “triple stacked” with a Cry6Aa protein. Transgenic plants, including corn, comprising a cry6Aa gene, cry34Ab/35Ab genes, and a cry3Aa gene are included within the scope of the subject invention. Thus, such embodiments target rootworms with three modes of action.

Transgenic Plants

Disclosed herein are transgenic plants having recombinant DNA which expresses a G1073 transcription factor which provides enhanced resistance and/or tolerance to water deficit. More specifically the DNA constructs comprise a polynucleotide which encodes at least a functional part of a G1073 transcription factor or a homologous transcription factor.

Use of active cytokinin synthase gene

Cytokinin is a plant hormone that regulates various physiological activities including cell division, cell cycle, cellular senescence, and axillary buds outgrowth. The present invention provides a method for producing a transformed plant by introducing an isolated nucleic acid or recombinant vector containing the isolated nucleic acid into a plant cell such that the amount of active cytokinin synthesized from nucleotide cytokinin is increased in the plant cell and by regenerating a plant body from the plant cell.

Nucleic acid construct for increasing abiotic stress tolerance in plants

Provided are nucleic acid constructs which comprise a polynucleotide encoding adenosine phosphate-isopentenyltransferase (IPT) operably linked to a stress-related promoter. Also provided are host cells transformed with the nucleic acid constructs, transgenic plants expressing the IPT coding sequence under the transcriptional regulation of a stress-related promoter and methods of using same for increasing abiotic stress tolerance of a plant, and biomass of plants under stress or normal conditions.

Secreted Insecticidal Protein and Gene Compositions From Bacillus Thuringiensis and Uses Therefor

The present invention relates to the isolation and characterization of nucleotide sequences encoding novel insecticidal proteins secreted into the extracellular space from Bacillus thuringiensis and related strains. The proteins are isolated from culture supernatants of Bacillus thuringiensis and related strains and display insecticidal activity against lepidopteran insects including European corn borer (ECB), tobacco budworm (TBW) and diamondback moth (DBM). Insecticidal proteins encoded by nucleotide sequences that hybridize under stringent conditions to the isolated and characterized nucleotide sequences are disclosed. Methods are disclosed for making and using transgenic cells and plants comprising the novel nucleotide sequence of the invention.

Isolated polypeptides, polynucleotides useful for modifying water user efficiency, fertilizer use efficiency, biotic/abiotic stress tolerance, yield and biomass in plants

Polynucleotides, polypeptides, plant cells expressing same and methods of using same for increasing abiotic stress tolerance water use efficiency (WUE), fertilizer use efficiency (FUE), biomass, vigor and/or yield of a plant. The method is effected by expressing within the plant an exogenous polynucleotide encoding a polypeptide comprising an amino acid sequence at least 80% homologous to the amino acid sequence selected from the group consisting of SEQ ID NOs:33, 34, 30, 27-29, 31, 32, 35-52, 1401-1403, 1405-1435, 1437-1494, 1496-1542, 1544-1553, 1555-1559, 1561-1827, 1829-1866, 1868-2450, 2453-2458, 2460-2463, 2465-2481, 2483, 2485-2746, 2765-2769, 3052-3065 and 3067-3259, thereby increasing the water use efficiency (WUE), the fertilizer use efficiency (FUE), the biomass, the vigor and/or the yield of the plant.

Transcription factors in plants related to levels of nitrate and methods of using the same

This disclosure concerns plant nitrogen responses. Embodiments concern regulatory factors that contribute to the response to nitrogen sources and/or their metabolites in plants.

MYB96 gene from Arabidopsis thaliana and uses thereof

A method for increasing cuticular wax biosynthesis of plant includes transforming a plant cell with the recombinant vector containing MYB96 (myb domain protein 96) gene from Arabidopsis thaliana . A method for producing a transgenic plant with increased cuticular wax biosynthesis includes transforming a plant cell with the recombinant vector containing the MYB96 gene, and regenerating the transformed plant cell into the transgenic plant. A plant and a seed with increased cuticular wax biosynthesis are produced by the method. A method for producing a biofuel using a cuticular wax includes separating and purifying a cuticular wax from the plant. A composition for increasing cuticular wax biosynthesis of plant includes the MYB96 gene.

Soybean aphid resistance gene rag2

Provided herein are isolated nucleic acid molecules representing a genetically defined region of the genome of the aphid resistant soybean plant ( Glycine max ) cultivar PI 200538 that confers resistance to soybean aphid ( Aphis glycines ). Within the region is a gene encoding the aphid resistance protein Rag2. Also provided herein are methods for conferring aphid resistance on a plant or enhancing aphid resistance in a plant by transforming it to contain and express such nucleic acid sequences encoding Rag2 aphid resistance or introgressing DNA encoding the trait into the plant by plant breeding. Further provided are polymorphic markers useful for identifying plant germplasm containing aphid resistance, and methods for using such markers.

Proteins Toxic To Hemipteran Insect Species

The present invention discloses Hemipteran insect inhibitory proteins, methods of using such proteins, nucleotide sequences encoding such proteins, methods of detecting and isolating such proteins, and their use in agricultural systems.

Yield enhancement in plants by modulation of ap2 transcription factor

Compositions and methods for modulating flower organ development, leaf formation, phototropism, apical dominance, fruit development, initiation of roots and for increasing yield in a plant are provided. The compositions include an AP2 transcription factor sequence. Compositions of the invention comprise amino acid sequences and nucleotide sequences selected from SEQ ID NOS: 1-11 as well as variants and fragments thereof. Nucleotide sequences encoding the AP2 transcription factors are provided in DNA constructs for expression in a plant of interest are provided for modulating the level of an AP2 transcription factor sequence in a plant or a plant part are provided. The methods comprise introducing into a plant or plant part a heterologous polynucleotide comprising an AP2 transcription factor sequence of the invention. The level of the AP2 transcription factor polypeptide can be increased or decreased. Such method can be used to increase the yield in plants; in one embodiment, the method is used to increase grain yield in cereals.

Sugar and Lipid Metabolism Regulators in Plants III

Isolated nucleic acids and proteins associated with lipid and sugar metabolism regulation are provided. In particular, lipid metabolism proteins (LMP) and encoding nucleic acids originating from Arabidopsis thaliana are provided. The nucleic acids and proteins are used in methods of producing transgenic plants and modulating levels of seed storage compounds. Preferably, the seed storage compounds are lipids, fatty acids, starches or seed storage proteins.

Composition containing gene encoding abc transporter proteins for increasing size of plant seed and content of fat stored within seed

The present invention relates to a composition for increasing the size of a plant seed and the content of fat store within the seed, and more specifically to a composition containing a gene encoding ABC transporter proteins for increasing the size of a plant seed and the content of fat store within the seed, and a method for increasing the size of a plant seed and the content of fat store within the seed comprising a step of introducing said gene and a promoter for overexpressing said gene to a plant.

Maize Event DP-004114-3 and Methods for Detection Thereof

The invention provides DNA compositions that relate to transgenic insect resistant maize plants. Also provided are assays for detecting the presence of the maize DP-004114-3 event based on the DNA sequence of the recombinant construct inserted into the maize genome and the DNA sequences flanking the insertion site. Kits and conditions useful in conducting the assays are provided.

Biological control

The invention relates to a non-human multicellular organism carrying a dominant lethal genetic system, the lethal effect of which is conditional, wherein the lethal effect of the lethal system occurs in the natural environment of the organism.

Transgenic plants with enhanced agronomic traits

This invention provides transgenic plant cells with recombinant DNA for expression of proteins that are useful for imparting enhanced agronomic trait(s) to transgenic crop plants. This invention also provides transgenic plants and progeny seed comprising the transgenic plant cells where the plants are selected for having an enhanced trait selected from the group of traits consisting of enhanced water use efficiency, enhanced cold tolerance, increased yield, enhanced nitrogen use efficiency, enhanced seed protein and enhanced seed oil. Also disclosed are methods for manufacturing transgenic seed and plants with enhanced traits.

Axmi-192 family of pesticidal genes and methods for their use

Compositions and methods for conferring pesticidal activity to bacteria, plants, plant cells, tissues and seeds are provided. Compositions comprising a coding sequence for a toxin polypeptide are provided. The coding sequences can be used in DNA constructs or expression cassettes for transformation and expression in plants and bacteria. Compositions also comprise transformed bacteria, plants, plant cells, tissues, and seeds. In particular, isolated toxin nucleic acid molecules are provided. Additionally, amino acid sequences corresponding to the polynucleotides are encompassed, and antibodies specifically binding to those amino acid sequences. In particular, the present invention provides for isolated nucleic acid molecules comprising nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO:28-62, or the nucleotide sequence set forth in SEQ ID NO:1-27, as well as variants and fragments thereof.

Soybean Transgenic Event MON87705 and Methods for Detection Thereof

The present invention provides a transgenic soybean event MON87705, and cells, seeds, and plants comprising DNA diagnostic for the soybean event. The invention also provides compositions comprising nucleotide sequences that are diagnostic for said soybean event in a sample, methods for detecting the presence of said soybean event nucleotide sequences in a sample, probes and primers for use in detecting nucleotide sequences that are diagnostic for the presence of said soybean event in a sample, growing the seeds of such soybean event into soybean plants, and breeding to produce soybean plants comprising DNA diagnostic for the soybean event.

Methods and compositions for nuclease-mediated targeted integration of transgenes

Disclosed herein are methods and compositions for homology-independent targeted insertion of donor molecules into the genome of a cell.

Altering root structure during plant development

Isolated nucleic acid fragments and recombinant constructs comprising such fragments for altering root structure during plant development are disclosed along with methods of root structure alteration during plant development.

Hybrid caulimovirus promoters and constructs thereof

The present invention relates to novel hybrid promoters comprising a caulimovirus promoter operably linked to one or more of an EF1α, Act8, Act2 or Act11 promoter. The present invention also relates to novel DNA constructs comprising at least one expression cassette which comprises the hybrid promoter thereof. The present invention further relates to transgenic plants/seeds comprising such DNA constructs.

Novel Use of a Dense and Erect Panicle 1 Gene in Improving Nitrogen Utilization Efficiency

The present invention provides methods of increasing nitrogen utilization efficiency (NUE) in a transgenic plant comprising the introduction of a nucleic acid encoding a dep1 polypeptide into a plant to produce a transgenic plant that expresses the nucleic acid to produce the dep1 polypeptide, thereby resulting in an increased NUE as compared with a control plant. Also provided are methods of increasing NUE in a plant comprising reducing the amount and/or activity of a DEP1 polypeptide.

Agronomic traits via genetically induced elevation of phytohormone levels in plants

Disclosed herein are transgenic plants that have been modified to express β-glucosidase, and methods and materials for making same. The transgenic plants possess several advantageous features including increased biomass, increased trichome density and increased parasite resistance.

Insecticidal protein, gene encoding the same and uses thereof

The invention relates to an insecticidal protein, its gene encoding and the uses thereof. The protein comprises: (a) a protein consisting of an amino acid sequence shown by SEQ ID NO:2 or a sequence of amino acid residuses at positions 1 to 640 thereof; or (b) a protein derived from (a) by substitution, deletion, or addition of one or more amino acid residuses of the amino acid sequences in (a), and having insecticidal activity; or (c) a protein generated by the expression of nucleic acid molecules containing a sequence of amino acid residuses at the positions 1 to 1920 of SEQ ID NO:1; or (d) a protein generated by the expression of nucleic acid molecules containing a complementary sequence that hybridized with the sequence of nucleotides at the positions 1 to 1920 of SEQ ID NO:1 under stringent conditions. The protein has high expression level and strong toxicity against pests.

Manipulation of Ammonium Transporters (AMTs) to Improve NUE in Higher Plants

The present invention provides polynucleotides and related polypeptides of the protein AMT. The invention provides genomic sequence for the AMT gene. AMT is responsible for controlling nitrogen utilization efficiency in plants.

INTERFERING RNAs THAT PROMOTE ROOT GROWTH

siRNA, miRNA and amiRNA molecules having plant root growth promoting activity, compositions comprising the same, and uses thereof.

Axmi-205 pesticidal gene and method for its use

Compositions and methods for conferring pesticidal activity to bacteria, plants, plant cells, tissues and seeds are provided. Compositions comprising a coding sequence for pesticidal polypeptides are provided. The coding sequences can be used in DNA constructs or expression cassettes for transformation and expression in plants and bacteria. Compositions also comprise transformed bacteria, plants, plant cells, tissues, and seeds. In particular, isolated pesticidal nucleic acid molecules are provided. Additionally, amino acid sequences corresponding to the polynucleotides are encompassed. In particular, the present invention provides for nucleic acid molecules comprising nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO:2, 3, or 4, the nucleotide sequence set forth in SEQ ID NO:1, 9, 10, or 11, as well as variants and fragments thereof.

Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency

Provided are isolated polynucleotides encoding a polypeptide at least 80% homologous to the amino acid sequence selected from the group consisting of SEQ ID NOs: 757, 456-756, 758-774, 8385-10836, and 10838-14462; and isolated polynucleotide comprising nucleic acid sequences at least 80% identical to SEQ ID NO: 377, 1-376, 378-455, and 775-8384. Also provided are nucleic acid constructs comprising same, isolated polypeptides encoded thereby, transgenic cells and transgenic plants comprising same and methods of using same for increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of a plant.

Methods for producing transgenic plants

A method of producing a stably transformed corn plant in a single container is demonstrated. This method allows for the automation of the transformation process and reduces labor, material, and ergonomic costs associated with traditional plant tissue culture systems.

Method for controlling pest infestations

The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5′ UAAACAAUCGCAAGAAGCUGA 3′ (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5′ AGCUUCUUGCGAUUGUUUAAG 3′ (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.

Insecticidal proteins from plants and methods for their use

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity.

Compositions and methods for controlling leptinotarsa

Disclosed herein are methods of controlling insect pests, in particular Leptinotarsa spp. which infest crop plants, and methods of providing plants resistant to such pests. Also disclosed are polynucleotides and recombinant DNA molecules and constructs useful in such methods, insecticidal compositions such as topical sprays containing insecticidal double-stranded RNAs, and solanaceous plants with improved resistance to infestation by Leptinotarsa spp. Further disclosed are methods of selecting target genes for RNAi-mediated silencing and control of Leptinotarsa spp.

Lepidopteran-Active Cry1Da1 Amino Acid Sequence Variant Proteins

Engineered Cry1Da amino acid sequences are provided that exhibit improved Lepidopteran insecticidal activity and an enhanced Lepidopteran spectrum compared to the naturally occurring Cry1Da protein toxin. Polynucleotide sequences intended for use in expression of the improved proteins in plants are also provided. Particular embodiments provide compositions containing insect inhibitory amounts of the engineered proteins, as well as recombinant plants, plant parts, and seeds containing polynucleotide constructs encoding one or more of the improved engineered proteins.

Methods and compositions for increasing rna interference

The present invention relates to compositions containing a combination of a first active component comprising one or more sulfated polysaccharides and/or glycosaminoglycans and a second active component comprising one or more RNAi-inducing molecules, and methods for using these compositions to enhance double-stranded RNA (dsRNA)-mediated gene silencing in pest or pathogen species. The invention further relates to methods for controlling pests or pathogens, methods for preventing pest infestations or pathogen infections and methods for knocking down gene expression in pests or pathogens using the compositions and methods of the invention.

SOYBEAN PLANT AND SEED CORRESPONDING TO TRANSGENIC EVENT MON87712 AND METHODS FOR DETECTION THEREOF

The present invention provides a transgenic soybean comprising event MON87712 that exhibits increased yield. The invention also provides cells, plant parts, seeds, plants, commodity products related to the event, and DNA molecules that are unique to the event and were created by the insertion of transgenic DNA into the genome of a soybean plant. The invention further provides methods for detecting the presence of said soybean event nucleotide sequences in a sample, probes and primers for use in detecting nucleotide sequences that are diagnostic for the presence of said soybean event. 14-. (canceled)5. A polynucleotide probe diagnostic for the presence of event MON87712 DNA , wherein said polynucleotide probe is of sufficient length to bind to a nucleic acid molecule comprising SEQ ID NO: 1 , SEQ ID NO: 2 , or at least 55 consecutive nucleotides of SEQ ID NO: 7 or of SEQ ID NO: 8 , or complements thereof , and wherein said polynucleotide probe hybridizes under stringent hybridization conditions with a DNA molecule comprising SEQ ID NO: 1 , SEQ ID NO: 2 , or at least 55 consecutive nucleotides of SEQ ID NO: 7 or of SEQ ID NO: 8 , or complements thereof and does not hybridize under stringent hybridization conditions with a DNA molecule not comprising SEQ ID NO: 1 , SEQ ID NO: 2 , or at least 55 consecutive nucleotides of SEQ ID NO: 7 or of SEQ ID NO: 8 , or complements thereof.6. A method of detecting the presence of a DNA molecule derived from event MON87712 in a DNA sample , the method comprising:{'claim-ref': {'@idref': 'CLM-00005', 'claim 5'}, 'a) contacting said DNA sample with the polynucleotide probe of ;'}b) subjecting said DNA sample and said polynucleotide probe to stringent hybridization conditions; andc) detecting hybridization of said polynucleotide probe to said DNA molecule derived from event MON87712 in said DNA sample.7. A pair of DNA molecules comprising a first DNA molecule and a second DNA molecule different from the first DNA molecule , capable of ...

SOYBEAN PLANT AND SEED CORRESPONDING TO TRANSGENIC EVENT MON87712 AND METHODS FOR DETECTION THEREOF

The present invention provides a transgenic soybean comprising event MON87712 that exhibits increased yield. The invention also provides cells, plant parts, seeds, plants, commodity products related to the event, and DNA molecules that are unique to the event and were created by the insertion of transgenic DNA into the genome of a soybean plant. The invention further provides methods for detecting the presence of said soybean event nucleotide sequences in a sample, probes and primers for use in detecting nucleotide sequences that are diagnostic for the presence of said soybean event. 115-. (canceled)16. A hybrid soybean plant or seed wherein at least one parent is derived from a soybean comprising event MON87712.1723-. (canceled)25. The method of claim 24 , wherein the three different primers comprise SEQ ID NO: 10 claim 24 , SEQ ID NO: 11 or 15 claim 24 , and SEQ ID NO: 13.26. (canceled) This application claims the benefit of U.S. Provisional Application Nos. 61/392,267 and 61/393,448, filed on Oct. 12, 2010 and Oct. 15, 2010, herein incorporated by reference in their entirety.The sequence listing that is contained in the file named “MONS299WO.txt”, which is 26.3 kilobytes as measured in Microsoft Windows operating system and was created on 5 Oct. 2011, is filed electronically herewith and incorporated herein by reference.The present invention relates to transgenic soybean event MON87712 and plants comprising the event that exhibit increased yield. The invention also provides cells, plant parts, seeds, plants, commodity products related to the event, and DNA molecules that are unique to the event and were created by the insertion of transgenic DNA into the genome of a soybean plant. The invention further provides methods for detecting the presence of said soybean event nucleotide sequences in a sample, probes and primers for use in detecting nucleotide sequences that are diagnostic for the presence of said soybean event.Soybean () is an important crop and is a ...

Plant promoter for transgene expression

This disclosure concerns compositions and methods for promoting transcription of a nucleotide sequence in a plant or plant cell, employing a promoter from a Panicum virgatum (Pavir.Cb02009) egg cell gene. Some embodiments relate to a promoter from a Panicum virgatum (Pavir.Cb02009) egg cell gene that functions in plants to promote transcription of operably linked nucleotide sequences. Other embodiments relate to a 3′ UTR from a Panicum virgatum (Pavir.Cb02009) egg cell gene that functions in plants to promote transcription of operably linked nucleotide sequences.

CORN EVENT MON 87411

The invention provides corn event MON 87411, and plants, plant cells, seeds, plant parts, and commodity products comprising event MON 87411. The invention also provides polynucleotides specific for event MON 87411 and plants, plant cells, seeds, plant parts, and commodity products comprising polynucleotides specific for event MON 87411. The invention also provides methods related to event MON 87411. 16-. (canceled)825-. (canceled)26. The method of claim 7 , wherein said sample comprises a corn plant claim 7 , corn plant cell claim 7 , fractured corn cells claim 7 , corn seed claim 7 , progeny corn plant claim 7 , corn plant part claim 7 , corn plant tissue claim 7 , or commodity corn product.27. The method of claim 7 , wherein detecting the presence of said DNA amplicon comprises detecting by direct sequence analysis claim 7 , detecting hybridization of a DNA probe to said DNA amplicon claim 7 , or detecting the size or composition of said DNA amplicon.28. The method of claim 7 , wherein said first DNA molecule is comprised in the corn genomic DNA region of SEQ ID NO:1 and said second DNA molecule is comprised in the inserted transgenic DNA region of SEQ ID NO:1.29. The method of claim 7 , wherein said pair of DNA molecules comprises the nucleotide sequence of SEQ ID NO:18 and SEQ ID NO:20 claim 7 , or SEQ ID NO:22 and SEQ ID NO:24.31. The method of claim 30 , wherein said DNA probe is labeled with at least one detectable label.32. The method of claim 31 , wherein said detectable label comprises a florescent tag claim 31 , radioactive tag claim 31 , antibody based tag claim 31 , or chemiluminescent tag.33. The method of claim 31 , wherein detecting hybridization of said DNA probe to said amplicon comprises detecting said detectable label.34. The method of claim 30 , wherein the DNA probe comprises the nucleotide sequence of SEQ ID NO:19 or SEQ ID NO:23.35. A kit for performing the method of claim 7 , wherein said kit comprises said pair of DNA molecules.36. A kit ...

Promoter, promoter control elements, and combinations, and uses thereof

The present invention is directed to promoter sequences and promoter control elements, polynucleotide constructs comprising the promoters and control elements, and methods of identifying the promoters, control elements, or fragments thereof. The invention further relates to the use of the present promoters or promoter control elements to modulate transcript levels in plants, and plants containing such promoters or promoter control elements.

Rnai strategies for control of whitefly

The present disclosure provides compositions and methods utilizing double strand ribonucleic acid (dsRNA) to control insects, including whiteflies. More particularly, the present invention relates to several specific synthetic dsRNAs that induce RNA interference (RNAi) in the target insects and methods of delivering the dsRNAs to them, such as allowing feeding on plants treated with, or transgenically expressing, the dsRNAs.

INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity. 1. An insecticidal polypeptide selected from:a) a PIP-75 polypeptide comprising an amino acid sequence having greater than 80% sequence identity compared to the amino acid sequence of SEQ ID NO: 79; andb) a PIP-75 polypeptide comprising the amino acid sequence of SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86 or SEQ ID NO: 87, wherein the insecticidal polypeptide is operably linked to a heterologous signal peptide or transit peptide and the insecticidal polypeptide has insecticidal activity against Western corn rootworm.2. (canceled)3. (canceled)4. (canceled)5. (canceled)6. An insecticidal composition comprising the PIP-75 polypeptide of .7. (canceled)8. A recombinant polynucleotide encoding the insecticidal polypeptide selected from:a) a PIP-75 polypeptide comprising an amino acid sequence having greater than 80% sequence identity compared to the amino acid sequence of SEQ ID NO: 79; andb) a PIP-75 polypeptide comprising the amino acid sequence of SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86 ...

Chimeric promoters for use in plants

The present invention provides polynucleotide molecules useful for expressing transgenes in plants. The present invention also provides expression constructs containing the polynucleotide molecules useful for expressing transgenes in plants. The present invention also provides transgenic plants and seeds containing the polynucleotide molecules useful for expressing transgenes in plants.

Plants with enhanced yield and methods of construction

Transgenic plants having enhanced yield and having enhanced seed yield are disclosed. The transgenic plants are transformed with a transgenic polynucleotide encoding one or more metabolic enzymes. The metabolic enzymes can be from any biological source. The transgenic polynucleotide(s) comprises a nucleic acid sequences encoding the metabolic enzymes under the control of functional plant promoters, the one or more metabolic enzymes are targeted to the plastids by the addition of plastid targeting signals. Optionally the functional plant promoters are seed specific promoters and the metabolic enzymes are targeted to the plastids by the addition of plastid targeting peptide heterologous to the metabolic enzymes. Methods of making the transgenic plants and transgenic polynucleotides are disclosed. The magnitude of the increases in seed yield achieved with these transgenic plants are unprecedented.

Drought resistance in plants: upl3

The present invention relates to a new method for increasing drought resistance of a plant. The method encompasses the impairment of the expression of a gene or genes in said plant. In comparison to a plant not manipulated to impair the expression of said gene(s), the plants display improved drought resistance. Also provided are plants and plant product that can be obtained by the method according to the invention.

Nucleotide sequence and use thereof in increasing the density of secretory glandular trichomes in plants

The present invention discloses a nucleotide sequence and use thereof in increasing the density of secretory glandular trichomes in plants. The nucleotide sequence is selected from the group consisting of: 1) a nucleotide sequence according to any one of SEQ ID NOs: 1, 3 and 5; 2) a nucleotide sequence derived from the nucleotide sequence according to any one of SEQ ID NOs: 1, 3 and 5 through substitution, deletion or addition of one or more nucleotides; 3) a nucleotide sequence having at least 80% homology with any one of SEQ ID NOs: 1, 3 and 5. The present invention significantly increases the density of secretory glandular trichomes by transferring any one of the above nucleotide sequences into the plants by means of genetic engineering. Therefore, the invention shows great potential in insect resistance and production of specific metabolites, and has extremely high practical application value.

LEPIDOPTERAN-ACTIVE CRY1DA1 AMINO ACID SEQUENCE VARIANT PROTEINS

Engineered Cry1Da amino acid sequences are provided that exhibit improved Lepidopteran insecticidal activity and an enhanced Lepidopteran spectrum compared to the naturally occurring Cry1Da protein toxin. Polynucleotide sequences intended for use in expression of the improved proteins in plants are also provided. Particular embodiments provide compositions containing insect inhibitory amounts of the engineered proteins, as well as recombinant plants, plant parts, and seeds containing polynucleotide constructs encoding one or more of the improved engineered proteins. 1. An engineered insecticidal protein comprising an amino acid sequence as set forth in any of SEQ ID NO:44 , SEQ ID NO: 40 , SEQ ID NO: 12 , SEQ ID NO:26 , SEQ ID NO:4 , SEQ ID NO:6 , SEQ ID NO:8 , SEQ ID NO:10 , SEQ ID NO:16 , SEQ ID NO:18 , SEQ ID NO:20 , SEQ ID NO:22 , SEQ ID NO:24 , SEQ ID NO:32 , SEQ ID NO:34 , SEQ ID NO:36 , SEQ ID NO:38 or SEQ ID NO:42 , or an insect inhibitory fragment thereof.2. The engineered insecticidal protein of claim 1 , wherein the engineered insecticidal protein exhibits inhibitory activity against an insect species of the order Lepidoptera.3SpodopteraHelicoverpa.. The engineered insecticidal protein of claim 2 , wherein the Lepidoptera is selected from the group consisting of a and a4Helicoverpa zeaSpodoptera frugiperda.. The engineered insecticidal protein of claim 2 , wherein the Lepidoptera is selected from the group consisting of and5. A polynucleotide encoding the engineered insecticidal protein or pesticidal fragment thereof of claim 1 , wherein the polynucleotide is operably linked to a heterologous promoter.6. A polynucleotide encoding an engineered insecticidal protein claim 1 , wherein the polynucleotide comprises a nucleotide sequence that optionally:a. Hybridizes under stringent conditions to the reverse complement of the polynucleotide sequence as set forth in any of SEQ ID NO: 43, SEQ ID NO: 39, SEQ ID NO: 11, SEQ ID NO: 11, SEQ ID NO: 25, SEQ ID NO: 3, ...

YIELD IMPROVEMENT IN PLANTS

Polynucleotides and polypeptides incorporated into expression vectors are introduced into plants and were ectopically expressed. These polypeptides may confer at least one regulatory activity and increased yield, increased light use efficiency, increased photosynthetic capacity, increased photosynthetic rate, increased photosynthetic resource use efficiency, greater vigor, and/or greater biomass as compared to a control plant. 1. A transgenic plant having greater photosynthetic resource use efficiency than a control plant;wherein the transgenic plant comprises an exogenous recombinant polynucleotide comprising a photosynthetic tissue-enhanced promoter which is operably linked to a nucleic acid sequence that encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 278;wherein the photosynthetic tissue-enhanced promoter regulates expression of the polypeptide in a photosynthetic tissue to a level that is effective in conferring greater photosynthetic resource use efficiency in the transgenic plant relative to the control plant;wherein the control plant does not comprise the recombinant polynucleotide;wherein the photosynthetic tissue-enhanced promoter does not regulate protein expression in a constitutive manner; andwherein expression of the polypeptide under the regulatory control of the photosynthetic tissue-enhanced promoter confers greater photosynthetic resource use efficiency in the transgenic plant relative to the control plant.2. (canceled)3. The transgenic plant of claim 1 , wherein the photosynthetic tissue-enhanced promoter is an RBCS4 promoter as set forth in SEQ ID NO: 863.4. (canceled)5. The transgenic plant of claim 1 , wherein the transgenic plant has an altered trait claim 1 , relative to the control plant claim 1 , that confers the greater photosynthetic resource use efficiency claim 1 , wherein the altered trait is selected from the group consisting of:{'sub': '2', '(a) increased photosynthetic capacity, measured as an increase in the ...