Настройки

Укажите год
-

Небесная энциклопедия

Космические корабли и станции, автоматические КА и методы их проектирования, бортовые комплексы управления, системы и средства жизнеобеспечения, особенности технологии производства ракетно-космических систем

Подробнее
-

Мониторинг СМИ

Мониторинг СМИ и социальных сетей. Сканирование интернета, новостных сайтов, специализированных контентных площадок на базе мессенджеров. Гибкие настройки фильтров и первоначальных источников.

Подробнее

Форма поиска

Поддерживает ввод нескольких поисковых фраз (по одной на строку). При поиске обеспечивает поддержку морфологии русского и английского языка
Ведите корректный номера.
Ведите корректный номера.
Ведите корректный номера.
Ведите корректный номера.
Укажите год
Укажите год

Применить Всего найдено 12. Отображено 12.
14-01-2015 дата публикации

Streptococcus suis type 2 LAMP-LFD (loop-mediated isothermal amplification-lateral flow dipstick) detection kit and detection method thereof

Номер: CN104278099A
Принадлежит:

The invention relates to a Streptococcus suis type 2 LAMP-LFD (loop-mediated isothermal amplification-lateral flow dipstick) detection kit and a detection method thereof. The technique can be used for detecting Streptococcus suis type 2. The method is characterized in that by combining the LAMP technique and lateral flow colloidal gold test strip technique, no expensive professional instruments and equipment are needed in the detection process, thereby omitting the step of agarose gel electrophoresis; and the detection result can be visually determined by naked eyes. The method has the characteristics of high accuracy, high speed, high efficiency, high sensitivity and the like, and is convenient, is suitable for animal streptococcicosis diagnosis, quarantine inspection for imports and exports, food sanitation inspection and the like, and has important meanings for promoting Chinese stock farming development and ensuring human/livestock health and animal food safety.

Подробнее
10-06-2015 дата публикации

Traditional Chinese medicine composition containing humifuse euphorbia herbs, radix sophorae flavescentis and scutellaria baicalensis and preparation method thereof

Номер: CN104688883A
Принадлежит:

The invention discloses a traditional Chinese medicine composition containing humifuse euphorbia herbs, radix sophorae flavescentis and scutellaria baicalensis and a preparation method thereof. The traditional Chinese medicine composition is composed of 25-35% of humifuse euphorbia herbs, 15-25% of scutellaria baicalensis, 15-25% of radix sophorae flavescentis, 15-25% of rhizoma atractylodis and 5-15% of pericarpium citri reticulatae. The preparation method includes the steps that particles containing 25% of crude drugs is prepared and an extracting solution containing 0.5 g/ml of crude drugs is prepared. The invention further discloses application of the traditional Chinese medicine composition containing the humifuse euphorbia herbs, the radix sophorae flavescentis and the scutellaria baicalensis for preventing and treating colibacillosis of chicken and reducing death of the chicken. The test result shows that the traditional Chinese medicine composition containing the humifuse euphorbia ...

Подробнее
30-05-2012 дата публикации

Application of yeast dextran injection for improving immune efficiency of foot-and-mouth disease vaccine of dairy cow

Номер: CN0102048686B
Принадлежит:

The invention discloses an application of a yeast dextran injection for improving the immune efficiency of a foot-and-mouth disease vaccine of a dairy cow. Simultaneously, the invention also discloses an application of the yeast dextran injection for enhancing the cellular immune function of the dairy cow, wherein the yeast dextran injection is a 2%-6% carboxymethyl yeast dextran water solution. The yeast dextran injection prepared by the invention is safe, does not have adverse reaction, can effectively enhance the cellular immune function of the dairy cow organism and improve the antibody level of the dairy cow inoculated with an foot-and-mouth disease inactivated vaccine, and can enhance the disease resistance of animals.

Подробнее
15-06-2011 дата публикации

Connection transmission assembly for electric vehicle driving motor and transmission

Номер: CN0102092285A
Принадлежит:

The invention discloses a connection transmission assembly for an electric vehicle driving motor and a transmission. The scheme similar to the scheme of a fuel vehicle is achieved in such a manner that an output shaft of the electric vehicle driving motor is jointed with a clutch assembly and the transmission via 'a connecting disc', thereby effectually enhancing the driving performance indexes of the electric vehicle. The assembly is characterized in that the output shaft at one end of the driving motor is fixedly connected with the connecting disc, the connecting disc is tightly fixed with a flywheel, a clutch friction plate and a pressure disc and is opposite to the flywheel, and a shaft of the transmission penetrates through a release bearing and the pressure disc to be sleeved with the friction plate in a manner of spline.

Подробнее
14-01-2015 дата публикации

Kit and method for fast detecting enterohemorrhagic escherichia coli 0157:H7

Номер: CN104278098A
Принадлежит:

The invention relates to a kit and a method for fast detecting enterohemorrhagic escherichia coli 0157:H7. The technology can be used for the detection of the enterohemorrhagic escherichia coli 0157:H7. The technology is characterized in that a detection result can be intuitively judged through naked eyes by combining a loop-mediated isothermal amplification technology with a transverse flow colloidal gold test strip detection technology. The technology disclosed by the invention has the characteristics of accuracy, fastness, convenience, high efficiency, specificity and sensitivity, is suitable for field detection in the aspects of import and export quarantine, food sanitation inspection and the like, and has great significance in ensuring food safety.

Подробнее
15-06-2011 дата публикации

Electric motor coach power assembly

Номер: CN0102092288A
Принадлежит:

The invention discloses an electric motor coach power assembly in order to solve the problem of low integration and conversion efficiencies of a transmission, an air conditioner compressor, a power steering pump, a brake pneumatic pump, a 24V power generator and the like in the electric motor coach. The power assembly is characterized in that: a rear wheel driving axle of the electric motor coach is driven by an output shaft, a connecting disc, a clutch assembly, the transmission and the like at one end of a driving motor, the other end of the driving motor is equipped with the air conditioner compressor, the power steering pump, the brake pneumatic pump, a radiating circulated water pump and the 24V power generator, and power is transferred to the air conditioner compressor, the pneumatic pump, the power steering pump, the radiating circulated water pump and the 24V power generator through a grooved pulley arranged on the output shaft at the other end of the driving motor and then through ...

Подробнее
27-04-2011 дата публикации

Veterinary yeast glucan injection

Номер: CN0102028704A
Принадлежит:

The invention discloses veterinary yeast glucan injection, and aims to provide an animal immunopotentiator, which is prepared from yeast glucan through chemical modification and is a purely natural green veterinary medicine product. Each 100ml of injection contains 2 to 24g of sulfated or carboxymethyl water-soluble yeast glucan and the balance of water for injection. The injection can nonspecifically enhance the immunity of animals such as rabbits, pigs, sheep, cows and the like and improve the anti-infection capability of the animals. The preparation prepared by the invention is injection and has the advantages of no toxic or side effects, no residues and the like, is convenient to use and meets the current development requirements of green products.

Подробнее
14-04-2010 дата публикации

Yeast glucan synergistic inactivated vaccine for preventing staphylococcus aureus mastitis in dairy cows

Номер: CN0101693109A
Принадлежит:

The invention relates to an oil-emulsion synergistic inactivated vaccine for preventing bacterial mastitis in dairy cows, which comprises cattle mastitis pathogens oil-emulsion synergistic inactivated vaccine and an immunopotentiator, wherein 5-40mg of immunopotentiator (yeast glucan) is contained in per milliliter of bacterial inactivated vaccine. The bacterial oil-emulsion synergistic inactivated vaccine can effectively enhance the cellular and humoral immunity level of dairy cows, have better immunity effect than the common oil-emulsion bacterial inactivated vaccine, reduce the morbidity of bacterial mastitis in dairy cows, have no poison and harm, and be very effective to prevent the bacterial mastitis in dairy cows.

Подробнее
11-05-2011 дата публикации

Application of yeast dextran injection for improving immune efficiency of foot-and-mouth disease vaccine of dairy cow

Номер: CN0102048686A
Принадлежит:

The invention discloses an application of a yeast dextran injection for improving the immune efficiency of a foot-and-mouth disease vaccine of a dairy cow. Simultaneously, the invention also discloses an application of the yeast dextran injection for enhancing the cellular immune function of the dairy cow, wherein the yeast dextran injection is a 2%-6% carboxymethyl yeast dextran water solution. The yeast dextran injection prepared by the invention is safe, does not have adverse reaction, can effectively enhance the cellular immune function of the dairy cow organism and improve the antibody level of the dairy cow inoculated with an foot-and-mouth disease inactivated vaccine, and can enhance the disease resistance of animals.

Подробнее
15-06-2011 дата публикации

Chassis special for electric bus

Номер: CN0102092266A
Принадлежит:

In order to solve the problem of unreasonable distribution of center of gravity of a chassis bearing and a vehicle in the prior art, the invention discloses a chassis special for an electric bus, which comprises a frame and a chassis assembly which consists of a drive motor power assembly, a multi-speed transmission, a front axle, a rear drive axle, a power battery pack, a whole vehicle brake system, a power steering system and an air conditioner compressor, and is arranged on the frame. The chassis is characterized in that: the power battery pack is arranged on a support hanger arranged in the middle of the frame, and the drive motor power assembly and the linked multi-speed transmission are arranged on the rear of the frame.

Подробнее
18-07-2023 дата публикации

Primer group for simultaneously detecting mycoplasma gallisepticum and mycoplasma synoviae and application

Номер: CN116445635A
Принадлежит:

The invention discloses a primer group for simultaneously detecting mycoplasma gallisepticum and mycoplasma synoviae and application, and belongs to the technical field of mycoplasma gallisepticum and mycoplasma synoviae detection.The primer group comprises sequences shown in SEQ ID NO.1-SEQ ID NO.6. The sequences are applied to detection of the two pathogens, and the primer group has the advantages of being easy and convenient to operate, high in detection efficiency, high in sensitivity, high in accuracy and the like; the method can be widely applied to detection and identification of mycoplasma gallisepticum and mycoplasma synoviae in researches of epidemiological investigation of related diseases, clinical application effect evaluation of related medicine and vaccine experimental animals and target animal models and the like, and the detection result is reliable.

Подробнее
30-07-2014 дата публикации

Porcine circovirus II SYBR Green fluorescence PCR (Polymerase Chain Reaction) diagnostic kit and application thereof

Номер: CN103952498A
Принадлежит:

The invention relates to a kit for detecting porcine circovirus II and application of the kit, and belongs to the field of molecular biology. A specific primer group comprises PCV2-Fgggctccagtgctgttattc SEQIDNO.1 and PCV2-Rtagcgggagtggtaggagaa SEQIDNO.2. According to the kit, the principle of PCR is adopted and a porcine circovirus II SYBR Green fluorescence PCR detection method is established. The kit has the characteristics of high specificity, high sensitivity, good stability and the like, and is applicable to high flux sample analysis.

Подробнее