Настройки

Укажите год
-

Небесная энциклопедия

Космические корабли и станции, автоматические КА и методы их проектирования, бортовые комплексы управления, системы и средства жизнеобеспечения, особенности технологии производства ракетно-космических систем

Подробнее
-

Мониторинг СМИ

Мониторинг СМИ и социальных сетей. Сканирование интернета, новостных сайтов, специализированных контентных площадок на базе мессенджеров. Гибкие настройки фильтров и первоначальных источников.

Подробнее

Форма поиска

Поддерживает ввод нескольких поисковых фраз (по одной на строку). При поиске обеспечивает поддержку морфологии русского и английского языка
Ведите корректный номера.
Ведите корректный номера.
Ведите корректный номера.
Ведите корректный номера.
Укажите год
Укажите год
Применить Всего найдено 517. Отображено 108.
29-12-2016 дата публикации

LIGHT GUIDE PLATE, BACKLIGHT MODULE, AND DISPLAY DEVICE

Номер: US20160377784A1
Автор: Wei GUO, Jie ZENG, Zhongjie LIU, GUO WEI, ZENG JIE, LIU ZHONGJIE, GUO Wei, ZENG Jie, LIU Zhongjie
Принадлежит: Shenzhen China Star Optoelectronics Technology Co., Ltd.

The present invention provides a light guide plate, a backlight module, and a display device. The light guide plate contains a platform of uniform thickness along an edge of the light guide plate for installing a flexible printed circuit (FPC). The platform contains a plurality of through openings for installing light emitting diodes (LEDs). The backlight module contains LEDs, a FPC, and the light guide plate. The FPC is configured on the platform. The LEDs are configured inside the openings. The display device contains the backlight module. The present invention enhances the reliable connection between the FPC and light guide plate, reduces the probability of coupling failure, and lower the manufacturing difficulty and cost.

Подробнее
Номер записи: 1
26-09-2019 дата публикации

CROWN IDENTIFICATION DEVICE, IDENTIFICATION METHOD, PROGRAM, AND STORAGE MEDIUM

Номер: WO2019181025A1
Автор: SEKIYA Kazuki, OCHIAI Hiroaki, NAGOSHI Yurika, GUO Wei, MU Yue, HIRAFUJI Masayuki, NINOMIYA Seishi, TAKATA Daisuke
Принадлежит:

Provided is a system for identifying each crown of a fruit tree using airborne images. This crown identification device 40 comprises an identification reference determination unit 41 and a crown identification unit 42. The identification reference determination unit 41 comprises: a first image acquisition unit 411 for acquiring a first airborne image including a plurality of fruit trees in a defoliation period in a fruit tree field; a skeleton extraction unit 412 for extracting an entire crown skeleton including the plurality of fruit trees from the first airborne image through image processing; a peak extraction unit 413 for extracting a peak in the crown skeleton corresponding to each fruit tree; and an identification reference extraction unit 414 for extracting a minimum polygonal crown candidate region including all peaks as an identification reference for each fruit tree, and extracting the centroid from the crown candidate region as an identification reference for each fruit tree.

Подробнее
Номер записи: 2
10-11-2016 дата публикации

BACKLIGHT MODULE FOR LIQUID CRYSTAL DISPLAY

Номер: US20160327718A1
Автор: Zhongjie LIU, Yanxue ZHANG, Wei GUO, LIU ZHONGJIE, ZHANG YANXUE, GUO WEI, LIU Zhongjie, ZHANG Yanxue, GUO Wei
Принадлежит:

A backlight module including a light guide plate, an optical film and a light-shielding adhesive. The optical film is disposed on a top surface of the light guide plate; a portion of the light-shielding adhesive adhering to an edge of a top surface of the optical film; and another portion of the light-shielding adhesive adhering to a side surface of the optical film and a side surface of the light guide plate, and adhering to an edge of a bottom surface of the light guide plate. Further disclosed is a liquid crystal display having the backlight module with light-shielding adhesives used to fix the optical film onto the light guide plate, and the light-shielding adhesive is used to fix the light guide plate and the optical film into the back frame without using a glue frame to fix the light guide plate and the optical film into the back frame.

Подробнее
Номер записи: 3
23-05-2019 дата публикации

DEVICE FOR COLLECTING BREEDING DATA IN FARM FIELD, DEVICE FOR ANALYZING FEATURE IN BREEDING, METHOD FOR COLLECTING BREEDING DATA IN FARM FIELD, PROGRAM, AND RECORDING MEDIUM

Номер: WO2019097892A1
Автор: SEKIYA Kazuki, TANIGUCHI Shigeharu, KAMIYA Toshiyuki, OCHIAI Hiroaki, NAGOSHI Yurika, GUO Wei, MU Yue, HIRAFUJI Masayuki, NINOMIYA Seishi, TAKATA Daisuke
Принадлежит:

Provided is a new system which is capable of easily acquiring data for phenotyping from an actual farm field in which a crop is actually bred. This device 1 for collecting breeding data is characterized by including: an information storage unit 101 which holds farm field information, a photographing condition, and aerial photography images of a farm field which are associated with the photographing condition; a classification unit 111 which classifies, on the basis of a photographing altitude of the photographing condition, the aerial photography images into a plurality of image groups for which photographing altitude ranges are different from each other; an image processing unit which generates, from the photographing condition and one image group among the plurality of image groups, image-processed data (a two-dimensional orthomosaic, a numerical surface model, and a point cloud), and analyzes a plant trait of the farm field from the image-processed data; a visualizing unit 113 which ...

Подробнее
Номер записи: 4
24-11-2016 дата публикации

METHOD FOR MANUFACTURING THIN-FILM SOLAR CELL AND THIN-FILM SOLAR CELL

Номер: US20160343893A1
Автор: Qingrong REN, Lu WANG, Wei GUO, REN QINGRONG, WANG LU, GUO WEI, REN Qingrong, WANG Lu, GUO Wei
Принадлежит: BOE TECHNOLOGY GROUP CO., LTD.

The present disclosure provides a method for manufacturing a thin-film solar cell, and the thin-film solar cell. The method includes steps of: forming a first electrode on a substrate; forming an N-type doped layer and an intrinsic semiconductor film on the first electrode; doping ions into the intrinsic semiconductor film, and subjecting the ion-doped intrinsic semiconductor film to activation treatment using an excimer laser annealing (ELA) process, so as to form a P-type doped layer at an upper layer of the intrinsic semiconductor film; and forming a second electrode on the P-type doped layer.

Подробнее
Номер записи: 5
11-05-2017 дата публикации

Fork-Type Covered Stent

Номер: US20170128189A1
Автор: Yongsheng WANG, Caiping LIU, Deyuan ZHANG, Wei GUO, WANG YONGSHENG, LIU CAIPING, ZHANG DEYUAN, GUO WEI, WANG Yongsheng, LIU Caiping, ZHANG Deyuan, GUO Wei
Принадлежит: Lifetech Scientific (Shenzhen) Co., Ltd.

A bifurcated stem graft () comprises a body () and a side branch () that forms an acute angle with the body (). The side branch () comprises a covering film () and a first bare stent () only disposed on the covering film (). Part of the first bare stent () is positioned adjacent a boundary line () of the body () and the covering film () and is located in a vertex angle area () of the acute angle. Due to the fact that part of the first bare stem () is attached to the vertex angle area (), after the stem () is released, the self-expanded part of the first bare stent () enables the vertex angle area () of the side branch () to be effectively supported, the covering film is not prone to shrinkage, and a leading wire can enter easily. Meanwhile, a special bare stent attached to the vertex angle area () does not need to be additionally disposed on the first bare stent (), and thus the technology for preparing the bare stem is simplified; furthermore, the first bare stent () is only disposed on the side branch () and does not need to span the connecting part of the body () and the side branch (), and thus the waveform can be shaped easily. 1. A bifurcated stent graft , characterized in comprising a body and a side branch that forms an acute angle with the body; the side branch comprising a covering film and a first bare stent disposed only on the covering film; a part of the first bare stent is positioned adjacent a boundary line of the body and the covering film , and is located in a vertex angle area of the acute angle.2. The bifurcated stent graft of claim 1 , characterized in that the first bare stent comprises a plurality of proximal vertices and distal vertices; the connection line of the plurality of distal vertices is annular; and at least a part of the plurality of proximal vertices is located in the vertex angle area claim 1 ,3. The bifurcated stent graft of claim 1 , characterized in that the first bare stent comprises a plurality of proximal vertices and distal ...

Подробнее
Номер записи: 6
10-08-2017 дата публикации

Learning A MAC Address in VXLAN

Номер: US20170228251A1
Автор: Jun YANG, Hui CAO, Fengshan DU, Wei GUO, YANG JUN, CAO HUI, DU FENGSHAN, GUO WEI, YANG Jun, CAO Hui, DU Fengshan, GUO Wei
Принадлежит:

A source Medium Access Control (MAC) address is learned upon receiving a data message from a local network, and a learned local MAC address entry is added to a MAC address forwarding table. A source MAC address is not learned upon receiving a data message from a tunnel. When a local MAC address entry in the MAC address forwarding table changes, a synchronization message is sent via each tunnel associated with a Virtual Extensible Local Area Network (VXLAN) in the changed local MAC address entry, and is saved into a database corresponding to the tunnel. Each tunnel corresponds to one database.

Подробнее
Номер записи: 7
11-05-2017 дата публикации

RADIOGRAPHIC DETECTION SUBSTRATE AND MANUFACTURE METHOD THEREOF, RADIOGRAPHIC DETECTION DEVICE

Номер: US20170133428A1
Автор: Wei GUO, Xingdong LIU, GUO WEI, LIU XINGDONG, GUO Wei, LIU Xingdong
Принадлежит: BOE TECHNOLOGY GROUP CO., LTD.

A radiographic detection substrate, a manufacture method thereof, and a radiographic detection device are provided. The radiographic detection substrate includes a substrate; and a thin film transistor and a signal storage unit which are formed on the substrate; the thin film transistor includes a gate electrode, an insulating layer, an active layer, a source electrode, a drain electrode and a passivation layer which are sequentially formed on the substrate; the signal storage unit includes a storage capacitor, the storage capacitor includes a first electrode and a second electrode, the first electrode is formed on the insulating layer and lapped with the drain electrode, the second electrode is connected to a ground line; the passivation layer is formed on the source electrode, the drain electrode, the first electrode and the ground line. The present invention efficiently decreases the number of masking processes by at least one connection method selected from lapping the first electrode and the drain electrode, connecting the second electrode to the ground line through the first via hole, and connecting the third electrode to the first electrode via the second via hole, to simplify the manufacture process of the radiographic detection substrate and reduce the manufacture costs. 1. A radiographic detection substrate , comprising:a substrate; anda thin film transistor and a signal storage unit that are formed on the substrate,wherein the thin film transistor comprises a gate electrode, an insulating layer, an active layer, a source electrode, a drain electrode and a passivation layer;the signal storage unit comprises a storage capacitor, and the storage capacitor comprises a first electrode and a second electrode, the first electrode is formed on the insulating layer and lapped with the drain electrode, the second electrode is connected to a ground line; andthe passivation layer is formed on the source electrode, the drain electrode, the first electrode and the ...

Подробнее
Номер записи: 8
20-04-2017 дата публикации

METHOD AND SYSTEM FOR IMAGE SEGMENTATION

Номер: US20170109893A1
Автор: Lin CONG, Wei GUO, Qiang LI, CONG LIN, GUO WEI, LI QIANG, CONG Lin, GUO Wei, LI Qiang
Принадлежит: SHANGHAI UNITED IMAGING HEALTHCARE CO., LTD.

The present disclosure relates to a method and a system for image segmentation, the technique includes: obtaining a lung image and a lung model based on a plurality of chest image samples in a training set; pre-processing a lung image; acquiring a binary image of boundaries of the lung image; performing the generalized Hough transform on the binary image to locate initial boundaries of the lung image and obtain a Hough location; aligning the lung model to Hough location to obtain an alignment result; applying dynamic programming algorithm to the alignment result to obtain a segmentation result; and transforming the segmentation result back to the original coordinate system. 1. A method comprising:obtaining a lung model;obtaining a chest image including a lung;pre-processing the chest image;acquiring a binary image including a boundary of the lung based on the pre-processed chest image;performing generalized Hough transform on the binary image to locate an initial boundary of the lung in the chest image to obtain a Hough location of the lung;aligning the lung model to the Hough location of the lung to obtain an alignment result;applying dynamic programming algorithm to the alignment result to obtain a segmentation result; andtransforming the segmentation result back to a coordinate system of the chest image.2. The method of claim 1 , wherein the lung model is obtained by:obtaining a training set, wherein the training set includes a plurality of chest image samples;selecting a first chest image sample from the training set;acquiring a first lung contour in the first chest image sample;selecting a plurality of the second chest image samples from the training set;acquiring a plurality of second lung contours, a second lung contour corresponding to a second chest image;processing the plurality of second lung contours to obtain transformed second lung contours;aligning the transformed second lung contours with the first lung contour;determining an average lung contour; ...

Подробнее
Номер записи: 9
06-04-2017 дата публикации

METHOD FOR OBTAINING INTERNET PROTOCOL HEADER REPLACEMENT MAPPING AND NETWORK NODE

Номер: US20170099370A1
Автор: Yue LI, Wei GUO, Xiaolong GUO, Song ZHU, LI YUE, GUO WEI, GUO XIAOLONG, ZHU SONG, LI Yue, GUO Wei, GUO Xiaolong, ZHU Song
Принадлежит: HUAWEI TECHNOLOGIES CO., LTD.

The present invention discloses a method for obtaining an Internet protocol header replacement mapping, which belong to the field of communications technologies. The method includes: obtaining, by a network node, fixed IP header information which is bound to a UE, where the network node is an MME or an eNB or a PGW or an SGW; establishing an IP header replacement mapping according to the fixed IP header information, where the IP header replacement mapping is correspondence between the fixed IP header information and an index or a bearer; and performing data transmission with the UE according to the IP header replacement mapping. In the present invention, the network node establishes the IP header replacement mapping according to the obtained fixed IP header information which is bound to the UE, the method is more flexible. 1. A method for obtaining an Internet protocol header replacement mapping , comprising:obtaining, by an mobility management entity, MME, from a UE, fixed IP header information which is bound to the UE;establishing, by the MME, an IP header replacement mapping according to the obtained fixed IP header information, where the IP header replacement mapping is correspondence between the fixed IP header information and an index;sending, by the MME, the established IP header replacement mapping to the UE, and receives a data packet sent by the UE after the UE substitutes the corresponding fixed IP header information with the index in the IP header replacement mapping;querying, by the MME, the IP header replacement mapping according to the index in the data packet sent by the UE, to obtain the fixed IP header information corresponding to the data packet sent by the UE; andrecovering, by the MME, the index in the data packet sent by the UE to the corresponding fixed IP header information, and forwards the fixed IP header information to another network node.2. The method according to claim 1 , the method further comprising:sending, by the MME, the ...

Подробнее
Номер записи: 10
11-05-2017 дата публикации

Camera Module and Manufacturing Method Thereof

Номер: US20170134624A1
Автор: Baozhong ZHANG, Bojie ZHAO, Ye WU, Wei GUO, ZHANG BAOZHONG, ZHAO BOJIE, WU YE, GUO WEI, ZHANG Baozhong, ZHAO Bojie, WU Ye, GUO Wei
Принадлежит: NINGBO SUNNY OPOTACH CO., LTD.

A camera module includes an optical lens unit and a light sensing unit. The light sensing unit is provided along a light outgoing path of the optical lens unit so that the light sensing unit is able to sense light emitted from the optical lens unit. The light sensing unit further includes a photoelectric converting element and a conducting unit connected to the photoelectric converting element. The conducting unit transfers electrical signals converted and generated during operation of the photoelectric converting element, and conducts heat generated during operation of the photoelectric converting element outside. 1: A camera module , comprising:an optical lens unit, anda light sensing unit provided along a light outgoing path of said optical lens unit so that said light sensing unit is able to sense light emitted from said optical lens unit, a photoelectric converting element, and', 'a conducting unit connected to said photoelectric converting element, wherein said conducting unit transfers electrical signals converted and generated during an operation of said photoelectric converting element, and conducts heat generated during the operation of said photoelectric converting element to the surroundings., 'wherein said light sensing unit comprises2: The camera module claim 1 , as recited in claim 1 , wherein said conducting unit further comprises a substrate and a circuit board contacted with said substrate claim 1 , wherein said substrate and said photoelectric converting element are closely attached to conduct the heat generated during operation of said photoelectric converting element claim 1 , and said circuit board is electrically coupled with said photoelectric converting element to transfer electrical signals converted and generated during the operation of said photoelectric converting element.3: The camera module claim 2 , as recited in claim 2 , wherein said substrate has a first platform surface and a second platform surface parallel to said first platform ...

Подробнее
Номер записи: 11
09-02-2017 дата публикации

BACKLIGHT MODULE AND DISPLAY APPARATUS

Номер: US20170038522A1
Автор: Jie ZENG, Wei GUO, ZENG JIE, GUO WEI, ZENG Jie, GUO Wei
Принадлежит: SHENZHEN CHINA STAR OPTOELECTRONICS TECHNOLOGY CO., LTD., WUHAN CHINA STAR OPTOELECTRONICS TECHNOLOGY CO., LTD.

A backlight module is disclosed. The backlight module includes a reflection sheet including a first body and a second body; a light guide plate disposed on the first body of the reflection sheet; an optical film set disposed on the light guide plate; a plastic frame inside of which the reflection sheet, the light guide plate, and the optical film set are all disposed; and a connecting member configured to fixedly bond the second body to an inner side surface of the plastic frame. The present invention can ensure that the reflection sheet is fixedly bonded on the plastic frame well so that not only can a narrow frame design be achieved, but also the optical films can meet the requirement of fixing strength. 1. A backlight module comprising:a reflection sheet including a first body and a second body formed integrally, the second body being disposed on a side of the first body, and the first body and the second body defining and embracing an upwardly-opened cavity;a light guide plate disposed on the first body of the reflection sheet;an optical film set disposed on the light guide plate;a plastic frame inside of which the reflection sheet, the light guide plate, and the optical film set are all disposed; anda connecting member configured to fixedly bond the second body to an inner side surface of the plastic frame.2. The backlight module according to claim 1 , wherein the refection sheet further comprises a third body formed by extending the second body toward an upper surface of the plastic frame claim 1 , and the third body is fixedly bonded to the upper surface of the plastic frame by the connecting member.3. The backlight module according to claim 2 , wherein the refection sheet further comprises a fourth body formed by extending the second body toward an outer surface of the plastic frame and the fourth body is fixedly bonded to the outer surface of the plastic frame by the connecting member.4. The backlight module according to claim 3 , wherein the first body ...

Подробнее
Номер записи: 12
12-10-2017 дата публикации

IDENTITY VERIFICATION METHOD, TERMINAL, AND SERVER

Номер: US20170295177A1
Автор: Feiyue HUANG, Jilin LI, Guofu TAN, Xiaoli JIANG, Dan WU, Junwu CHEN, Jianguo XIE, Wei GUO, Yihui LIU, Jiandong Xie, HUANG FEIYUE, LI JILIN, TAN GUOFU, JIANG XIAOLI, WU DAN, CHEN JUNWU, XIE JIANGUO, GUO WEI, LIU YIHUI, XIE JIANDONG, HUANG Feiyue, LI Jilin, TAN Guofu, JIANG Xiaoli, WU Dan, CHEN Junwu, XIE Jianguo, GUO Wei, LIU Yihui, Xie Jiandong
Принадлежит:

An identity verification method performed at a terminal includes: displaying and/or playing in an audio form action guide information selected from a preset action guide information library, and collecting a corresponding set of action images within a preset time window; performing matching detection on the collected set of action images and the action guide information, to obtain a living body detection result indicating whether a living body exists in the collected set of action images; according to the living body detection result that indicates that a living body exists in the collected set of action images: collecting user identity information and performing verification according to the collected user identity information, to obtain a user identity information verification result; and determining the identity verification result according to the user identity information verification result.

Подробнее
Номер записи: 13
15-12-2016 дата публикации

METALLIC OXIDE THIN FILM TRANSISTOR, ARRAY SUBSTRATE AND THEIR MANUFACTURING METHODS, DISPLAY DEVICE

Номер: US20160365366A1
Автор: Lei ZHAO, Wei GUO, ZHAO LEI, GUO WEI, ZHAO Lei, GUO Wei
Принадлежит: BOE TECHNOLOGY GROUP CO., LTD.

The present invention provides a metallic oxide thin film transistor and its manufacturing method, an array substrate and its manufacturing method, as well as a display device, which is belong to the field of thin film transistor manufacturing technology. The method for manufacturing the metallic oxide thin film transistor comprises a step of forming patterns of an oxide active layer and an etch stopping layer through a one-time patterning process.

Подробнее
Номер записи: 14
01-03-2012 дата публикации

2D-3D SWITCHABLE DISPLAY DEVICE AND METHOD FOR DRIVING SAME

Номер: US20120050261A1
Автор: FENG Sha, GUO Wei
Принадлежит:

A 2D-3D switchable display device includes a display panel and a polarization element. The display panel includes a plurality of left-eye image regions, a plurality of right-eye image regions alternating with the left-eye image regions, and a plurality of switchable regions each disposed between a corresponding right-eye image region and a left-eye image region adjacent to the corresponding right-eye image region. The polarization element is configured to adjust a left-eye image provided by the left-eye image regions and a right-eye image provided by the right-eye image regions to achieve different polarizations. When the 2D-3D switchable display device works in a 3D mode, each switchable region displays a black sub-image; and when the 2D-3D switchable display device works in a 2D mode, each switchable region displays a gray sub-image. 1. A 2D-3D switchable display device , comprising:a display panel comprising a plurality of left-eye image regions, a plurality of right-eye image regions alternating with the left-eye image regions, and a plurality of switchable regions each disposed between a corresponding right-eye image region and a left-eye image region adjacent to the corresponding right-eye image region; anda polarization element comprising a plurality of first polarization regions corresponding to the left-eye image regions and a plurality of second polarization regions corresponding to the right-eye image regions, the first polarization regions and the second polarization regions configured to adjust a left-eye image provided by the left-eye image regions and a right-eye image provided by the right-eye image regions to achieve different polarizations such that the right-eye image and the left-eye image are separated from each other using polarization lenses,wherein when the 2D-3D switchable display device works in a 3D mode, each switchable region displays a black sub-image; and when the 2D-3D switchable display device works in a 2D mode, each switchable ...

Подробнее
Номер записи: 15
01-03-2012 дата публикации

METHODS OF SCREENING FOR RISK OF PROLIFERATIVE DISEASE AND METHODS FOR THE TREATMENT OF PROLIFERATIVE DISEASE

Номер: US20120052504A1
Автор: Amalfitano Andrea, Boustany Rose-Mary N., Guo Wei-Xing
Принадлежит:

A method of screening a subject for a proliferative disease risk factor comprises detecting the presence or absence of upregulation of the CLN3 gene in the subject. The upregulation of the CLN3 gene in the subject indicates the subject is at increased risk of developing a proliferative disease. Methods of screening compounds for the treatment of proliferative diseases based on the CLN3 gene and its product are also disclosed, along with methods of treating such diseases and vectors useful therefore. 1. A method of screening a subject for a proliferative disease risk factor , comprising:detecting the presence or absence of upregulation of the CLN3 gene in said subject;the upregulation of the CLN3 gene in said subject indicating said subject is at increased risk of developing a proliferative disease.2. The method of claim 1 , wherein said subject has been previously diagnosed as afflicted with said proliferative disease.3. The method of claim 1 , wherein said subject has not been previously diagnosed as afflicted with said proliferative disease.4. The method of claim 1 , wherein said subject has been previously prognosed to be at risk of developing said proliferative disease.5. The method of claim 1 , wherein said subject has not been previously prognosed to be at risk of developing said proliferative disease.6. The method of claim 1 , wherein said detecting step is carried out by detecting increased mRNA levels for said CLN3 gene.7. The method of claim 1 , wherein said proliferative disease is cancer.8. The method of claim 1 , wherein said proliferative disease is breast cancer.9. The method of claim 1 , wherein said proliferative disease is colon cancer.10. A method according to claim 1 , wherein said patient has undergone treatment for said proliferative disease.1146-. (canceled) This application is a continuation application of, and claims priority to, U.S. application Ser. No. 12/357,750, having a filing date of Jan. 22, 2009 and issued as U.S. Pat. No. 8,003,327 ...

Подробнее
Номер записи: 16
15-03-2012 дата публикации

METHOD, APPARATUS, AND SYSTEM FOR ACQUIRING LOAD INFORMATION

Номер: US20120064896A1
Автор: Chen Yanyan, GUO Wei, GUO Xuanyu, LV Boya
Принадлежит: Huawei Technologies Co., Ltd.

The present invention discloses a method, an apparatus and a system for acquiring load information. In one method, a source access controller and a target access controller can interact through inter-Radio Access Technology (RAT) handover related messages so that a source RAT system can acquire load information of a target RAT system when an inter-RAT Packet Switched (PS) handover is performed. This enables load balancing between different RAT systems so as to guarantee communications quality of the systems. In another method of the present invention, the source access controller and the target access controller interact through a Radio Access Network (RAN) Information Management (RIM) based load information request message and an RIM based load information response message, so that the source RAT system can acquire load information of the target RAT system before an inter-RAT PS domain handover is performed. 1. A method for acquiring load information , comprising:before an inter-Radio Access Technology (RAT) handover is performed, sending, through a core network, by a source access controller to which a source cell belongs, a Radio Access Network (RAN) Information Management (RIM) based load information request message to a target access controller to which a target cell belongs; andreceiving, by the source access controller, an RIM based load information response message returned by the target access controller according to the RIM based load information request message through the core network, wherein the RIM based load information response message carries load information of the target cell.2. The method of claim 1 , wherein the sending claim 1 , through the core network claim 1 , by the source access controller to which the source cell belongs claim 1 , the RIM based load information request message to the target access controller to which the target cell belongs comprises: sending claim 1 , through the core network claim 1 , by the source access controller to ...

Подробнее
Номер записи: 17
10-05-2012 дата публикации

LASER DEVICE, A LIGHT SIGNAL GENERATION DEVICE, AND AN OPTICAL RESONATOR AND A METHOD FOR PRODUCING LIGHT

Номер: US20120114003A1
Автор: BYRNE Diarmuid, CORBETT Brian, DONEGAN John F., ENGELSTAEDTER Jan-Peter, GUO Wei-Hua, LAMBKIN Paul Martin, LU Qiao-Yin, PETERS Frank, ROYCROFT Brendan John
Принадлежит:

A laser device includes a ridge waveguide having an active layer between upper and lower cladding layers. A ridge formed in the upper cladding layer defines the width of a light guiding region in the active layer, and is formed so that a portion of the light guiding region extends into the ridge. A plurality of reflecting slots extend across and into the ridge to a depth sufficient to extend into the extending portion in order that the reflectivity of each slot is on the order of 2%. The slots intersect more than 20% of the total mode energy in the light guiding region, and this in combination with the gain of the active layer facilitates lasing within the light guiding region independently of the reflectivity of end facets of the waveguide. The laser device is particularly suitable for integrally forming with other optical components on a single semiconductor chip. 1. A laser device comprising a waveguide , a longitudinally extending light guiding region defined within the waveguide , at least two reflecting means at locations spaced apart longitudinally relative to the light guiding region and at least one of the reflecting means being located intermediate longitudinally spaced apart ends of the waveguide for partially reflecting light being guided in the light guiding region , the amplitude of the reflectivity of each reflecting means being at least 2% , and the amplitude of the combined reflectivity of the respective reflecting means is such that lasing is independent of the reflectivity of at least one of any facets in which the light guiding region may terminate.2. A laser device as claimed in in which at least two reflecting means are provided intermediate the longitudinally spaced apart ends of the waveguide claim 1 , and the amplitude of the combined reflectivity of the respective reflecting means is such that lasing is independent of the reflectivity of any of the facets in which the light guiding region terminates claim 1 , and preferably claim 1 , the ...

Подробнее
Номер записи: 18
31-05-2012 дата публикации

UNC-45A SPLICE VARIANTS BASED CANCER DIAGNOSTICS AND THERAPEUTICS

Номер: US20120135408A1
Автор: Chen Daisi, Epstein Henry Fredric, GUO Wei, SINGH Ram
Принадлежит: The Board of Regents of the University of Texas System

Methods and compositions to diagnose and treat cancers using UNC-45A splice variants are disclosed. Expression of a human UNC-45A929 splice variant that is shorter than UNC-45A944 splice variant is increased in cancer cells including metastatic cancers. siRNA to inhibit or downregulate UNC-45A splice variants in cancers are disclosed. 1. A short interfering RNA (siRNA) or a short hairpin RNA (shRNA) molecule for selectively reducing the expression of a human UNC-45A splice variant in a cell , wherein the RNA molecule is substantially complementary to at least a part of a mRNA encoding the splice variant , wherein the splice variant comprises a nucleic acid sequence as in SEQ ID NO: 1 (nucleotide positions 1-835) or SEQ ID NO: 2.2. The siRNA of claim 1 , wherein the siRNA targets TGGCCGTCACTACCCTGGTTTCTTT or GGACAGAGGTGGTAGTGAACT of the UNC-45A929 splice variant.3. The siRNA of claim 1 , wherein the siRNA targets GGTCCAGGGACCCCCGAGCCCCG or GTGAGTGGTCCAGGGACCCC of UNC-45A944.4. A pharmaceutical composition comprising an effective amount of a siRNA or shRNA of that specifically inhibits the expression of a human UNC-45A929 splice variant in a cancer cell.5. The pharmaceutical composition of claim 4 , wherein the siRNA comprises one or more modified nucleotides.6. The pharmaceutical composition of claim 4 , wherein the shRNA is expressed from a vector.7. A method of reducing the proliferation of a cancer cell claim 1 , the method comprising contacting the cancer cell with an RNAi agent of that specifically downregulates the expression of UNC-45A splice variants.8. The method of claim 7 , wherein the RNAi agent is a siRNA molecule that specifically targets UNC-45A929 splice variant.9. The method of claim 7 , wherein the RNAi agent is a shRNA molecule.10. The method of claim 7 , wherein the cancer cell is selected from the group consisting of breast cancer claim 7 , cervical cancer and colon cancer.11. The method of claim 7 , wherein the cancer cell is a metastatic breast ...

Подробнее
Номер записи: 19
14-06-2012 дата публикации

Real-Time Media Optimization Over Remoted Sessions

Номер: US20120151008A1
Автор: Iyer Subhashri, Khan Humayun, Mahajan Rajneesh, Sheih Guo-Wei, Srinivisan Srivatsa K., Velayutham Senthil K.
Принадлежит: MICROSOFT CORPORATION

Real-time media optimization may be provided. First, a remote session may be established with a remote computing device. Then, during the remote session, non-real-time media data may be exchanged with the remote computing device over a server path. Moreover, real-time media data may be exchanged with the remote computing device over a media path during the remote session. 1. A method for providing real-time media optimization , the method comprising:establishing a remote session with a remote computing device;exchanging, during the remote session, non-real-time media data with the remote computing device over a server path; andexchanging, during the remote session, real-time media data with the remote computing device over a media path.2. The method of claim 1 , wherein establishing the remote session comprises establishing a hop between a client running on a local computing device and an application running on a server claim 1 , the established hop being in the server path.3. The method of claim 1 , wherein establishing the remote session comprises establishing the media path between a remote media manager running in a client running on a local computing device and the remote computing device.4. The method of claim 1 , wherein exchanging the non-real-time media data with the remote computing device over the server path comprises passing the non-real-time information to a server in the server path.5. The method of claim 1 , wherein exchanging the non-real-time media data with the remote computing device over the server path comprises passing non-real-time information to a server in the server path claim 1 , the non-real-time information comprising information corresponding to a location of a local computing device.6. The method of claim 1 , wherein exchanging the real-time media data with the remote computing device over the media path comprises exchanging the real-time media data directly between a local computing device and the remote computing device without ...

Подробнее
Номер записи: 20
05-07-2012 дата публикации

COMPOSITE NANOPARTICLES AND METHODS FOR MAKING THE SAME

Номер: US20120168669A1
Автор: CHE Yong, GUO Wei, MURAKAMI Makoto
Принадлежит: IMRA AMERICA, INC

A composite nanoparticle, for example a nanoparticle containing one or a plurality of cores embedded in another material. A composite nanoparticle can be formed by a one step process that includes: ejecting material from a bulk target material using physical energy source, with the bulk target material disposed in a liquid. Composite nanoparticles are formed by cooling at least a portion of the ejected material in the liquid. The composite fine particles may then be collected from the liquid. A product that includes composite fine particles may be formed with laser ablation, and ultrashort laser ablation may be utilized so as to preserve composite nanoparticle stoichiometry. For applications of the composite fine particles, optical properties and/or magnetic properties may be exploited for various applications. 1. A composite fine particle comprising:a first magnetic material; anda second material in contact with said first magnetic material, said second material being suitable for optical characterization of a material and/or plasmon coupling, wherein said composite fine particle is formed by laser ablation of a bulk composite material in a liquid, wherein said bulk composite material comprises said first magnetic material and said second material.2. The composite fine particle of claim 1 , wherein said composite fine particle comprises at least one dimension in the range from about 1 nm to less than about 5 μm.3. The composite fine particle of claim 1 , wherein said composite fine particle comprises a core/shell structure comprising a core of a first composition and a shell of a second composition claim 1 , wherein said shell surrounds at least a portion of said core.4. The composite fine particle of claim 1 , wherein said composite fine particle comprises at least two cores of a first composition embedded in a matrix of a second composition.5. The composite fine particle of claim 1 , wherein said composite fine particle comprises a compositionally anisotropic ...

Подробнее
Номер записи: 21
12-07-2012 дата публикации

MEASURING EQUIPMENT FOR PROBE-EFFECT CANCELLATION AND METHOD THEREOF

Номер: US20120176150A1
Автор: CHEN Tung-Yang, Guo Wei-Da, Hsu Hsing-Chou, Lee Jui-Ni, Yang Sheng-Fan
Принадлежит:

A measuring equipment, such as a vector network analyzer, is provided. The measuring equipment includes a first port and a second port, a probe connected to the first port, an antenna connected to the second port, and a test board corresponding to a type of a device-under-test. A probe-effect is obtained by measuring the test board via the probe and the antenna. 1. A measuring equipment , comprising:a first port and a second port;a probe connected to the first port;an antenna connected to the second port; anda test board, corresponding to a type of a device-under-test;wherein a probe-effect is obtained by measuring the test board via the probe and the antenna.2. The measuring equipment of claim 1 , wherein the device-under-test is measured by probe and the antenna to obtain a measurement result claim 1 , and the measurement result is calibrated according to the probe-effect.3. The measuring equipment of claim 1 , wherein the type of the device-under-test is one of a capacitive type claim 1 , a resistive type and a power/ground type.4. The measuring equipment of claim 3 , wherein the test board comprises a transmission line without termination if the device-under-test is of the capacitive type.5. The measuring equipment of claim 3 , wherein the test board comprises a transmission line with termination if the device-under-test is of the resistive type.6. The measuring equipment of claim 3 , wherein the test board comprises a transmission lines and a decoupling capacitor forming a current loop claim 3 , if the device-under-test is of the power/ground type.7. The measuring equipment of claim 3 , wherein the test board comprises two transmission lines and two decoupling capacitors forming a current loop.8. The measuring equipment of claim 1 , wherein the probe and the antenna do not directly contact the test board and the device-under-test.9. A method for probe-effect cancellation of a measuring equipment claim 1 , the measuring equipment having a first port and a second ...

Подробнее
Номер записи: 22
02-08-2012 дата публикации

METHOD AND DEVICE FOR CARRYING MBMS NOTIFICATION INFORMATION

Номер: US20120195251A1
Автор: GUO Wei, Ma Zijiang
Принадлежит: ZTE CORPORATION

A method for carrying MBMS notification information comprising: when the MBMS notification information is transmitted more than once in a modification period of MCCH information, carrying at least once the MBMS notification information in a sub-frame carrying the MCCH information at the time of arrival of the modification period of the MCCH information; and when the MBMS notification information is transmitted once in the modification period of the MCCH information, carrying the MBMS notification information in the sub-frame carrying the MCCH information at the time of arrival of the modification period of the MCCH information. Also disclosed is a device for carrying MBMS notification information. The method for carrying MBMS notification information allows a receiving terminal to save more power. 1. A method for carrying MBMS notification information comprising:when the MBMS notification information is transmitted more than once in a modification period of MCCH information, carrying at least once the MBMS notification information in a sub-frame carrying the MCCH information at the time of arrival of the modification period of the MCCH information; andwhen the MBMS notification information is transmitted once in the modification period of the MCCH information, carrying the MBMS notification information in the sub-frame carrying the MCCH information at the time of arrival of the modification period of the MCCH information.2. The method according to claim 1 , wherein the time of arrival of the modification period of the MCCH information means an upcoming Modification period of the MCCH information indicated by the MBMS notification information.3. The method according to claim 1 , wherein the sub-frame carrying the MCCH information at the time of arrival of the modification period of the MCCH information is the first multicast sub-frame carrying the MCCH information before the modification period of the MCCH information arrives claim 1 , or a sub-frame carrying the ...

Подробнее
Номер записи: 23
11-10-2012 дата публикации

METHOD FOR COLLECTING PER CALL MEASUREMENT DATA AND MOBILITY MANAGEMENT DEVICE AND BASE STATION THEREOF

Номер: US20120258685A1
Автор: Cheng Ming, GUO Wei, Lin Lingfeng, Lv Pingbao, Ma Yuchu, WANG Yunhua
Принадлежит:

A method for collecting per call measurement data PCMD is proposed in the present invention. The method comprises: when an instruction to activate a PCMD-related function is received, sending by a base station a message including an indication of whether the base station is capable of collecting the PCMD to a mobility management entity MME device; when an instruction to start PCMD collection is received, sending by the MME device a message including an indication of starting collecting the PCMD to at least one base station capable of collecting the PCMD; based on the received indication of starting collecting the PCMD, collecting by the base station the PCMD for at least one user equipment UE connection. A mobility management entity device and a base station for collecting the per call measurement data PCMD are also proposed in the present invention. 1. A method for collecting per call measurement data PCMD , comprising:when an instruction to activate a PCMD-related function is received, sending by a base station a message including an indication of whether the base station is capable of collecting the PCMD to a mobility management entity MME device;when an instruction to start PCMD collection is received, sending by the MME device a message including an indication of starting collecting the PCMD to at least one base station capable of collecting the PCMD;based on the received indication of starting collecting the PCMD, collecting by the base station the PCMD for at least one user equipment UE connection.2. The method according to claim 1 , further comprising:sending by the base station a message including the collected PCMD to the MME device.3. The method according to claim 1 , further comprising:when an instruction to stop the PCMD collection is received, sending by the MME device a message including an indication of stopping collecting the PCMD to the at least one base station capable of collecting the PCMD.4. The method according to claim 3 , further comprising: ...

Подробнее
Номер записи: 24
01-11-2012 дата публикации

POLYNUCLEOTIDES FOR USE IN MEDICINE

Номер: US20120277282A1
Автор: Gotthardt Michael, Greaser Marion Lewis, GUO Wei, Hübner Norbert
Принадлежит: MAX-DELBRUCK-CENTRUM FUR MOLEKULARE MEDIZIN

The invention refers to polynucleotides selected from the group consisting of a) polynucleotides encoding for the polypeptide RBM20 comprising a P638L mutation for a human polypeptide RBM20, or a P641L mutation for a rat polypeptide RBM20, b) polynucleotides with a reverse complementary sequence of the polynucleotide of a) above, and c) polynucleotides with an identity at least 50% to a polynucleotide of a) or b) above 1. A polynucleotide selected from the group consisting of:a) a polynucleotide encoding the polypeptide RBM20 comprising a P638L or a P641L mutation (Homo sapiens) or a P641L mutation (Rattus norvegicus),b) a polynucleotide with a reverse complementary sequence of the polynucleotide of a) above, andc) a polynucleotide with an identity at least 50% sequence identity to a polynucleotide of a) or b) above.2. The polynucleotide of claim 1 , which comprises RNA.3. A polypeptide encoded by a polynucleotide of .4. A method for diagnosing or monitoring a cardiac disease in a biological sample obtained from a subject claim 1 , comprising:determining the presence of a P638L mutation or a P641L mutation in a RBM20 transcript or in a RBM20 protein in a sample from a human or a rat, respectively, anddeducing from the presence of a P638L mutation or P641L mutation that the subject suffers from a cardiac disease.5. The method of claim 4 , wherein the cardiac disease is selected from the group consisting of cardiomyopathy and Sudden Cardiac Death (SCD).6. The method of claim 5 , wherein the cardiomyopathy is selected from the group consisting of restrictive cardiomyopathy (RCM) claim 5 , dilated cardiomyopathy (DCM) claim 5 , hypertrophic cardiomyopathy (HCM) claim 5 , arrhythmogenic right ventricular cardiomyopathy (ARVC).7. A kit for diagnosing claim 5 , prognosing claim 5 , or monitoring a cardiac disease in a subject claim 5 , comprisinga means for determining a P638L mutation in a RBM20 transcript or in a RBM20 protein in a biological sample from a human.8. The ...

Подробнее
Номер записи: 25
08-11-2012 дата публикации

SYSTEMS AND METHODS FOR CONSTANT CURRENT CONTROL WITH PRIMARY-SIDE SENSING AND REGULATION IN VARIOUS OPERATION MODES

Номер: US20120281438A1
Автор: Fang Lieyi, Lin Guo Wei
Принадлежит:

System and method for regulating a power converter. The system includes a first signal processing component configured to receive at least a sensed signal and generate a first signal. The sensed signal is associated with a primary current flowing through a primary winding coupled to a secondary winding for a power converter. Additionally, the system includes a second signal processing component configured to generate a second signal, an integrator component configured to receive the first signal and the second signal and generate a third signal, and a comparator configured to process information associated with the third signal and the sensed signal and generate a comparison signal based on at least information associated with the third signal and the sensed signal. 1. A system for regulating a power converter , the system comprising:a first signal processing component configured to receive at least a sensed signal and generate a first signal, the sensed signal being associated with a primary current flowing through a primary winding coupled to a secondary winding for a power converter;a second signal processing component configured to generate a second signal;an integrator component configured to receive the first signal and the second signal and generate a third signal;a comparator configured to process information associated with the third signal and the sensed signal and generate a comparison signal based on at least information associated with the third signal and the sensed signal;a signal generator configured to receive at least the comparison signal and generate a modulation signal; anda gate driver configured to receive the modulation signal and output a drive signal to a switch, the switch being configured to affect the primary current flowing through the primary winding;wherein the drive signal is associated with at least one or more switching periods, each of the one or more switching periods including at least an on-time period for the switch and a ...

Подробнее
Номер записи: 26
22-11-2012 дата публикации

System and Method for Measuring Optical Signal-to-Noise Ratio

Номер: US20120293804A1
Автор: DONEGAN John F., Flood Edward, GUO Wei-Hua
Принадлежит: The Provost, Fellows and Scholars of The Holy and Undivided Trinity of Queen Elizabeth, Near Dublin

The invention provides a system and method for measuring optical signal-to-noise-ratio (OSNR) in an optical communication system. A channel filter is adapted to select one specific optical communication channel from a wavelength-division-multiplexing (WDM) optical communication system, wherein the channel comprises an optical signal carrying digital bit information and noise from associated optical power amplifiers in the system. At least one optical delay interferometer is adapted to measure at least two interferograms of the noisy signal. The invention provides a mechanism for calculating the in-band OSNR from extinctions of the interferograms measured at different optical delays by referring to each other, wherein said optical delays are selected to be substantially less than a bit period of the optical channel. Because of the selection of the optical delays and/or the self-reference between the two measurements, the system can follow any changes happening to the signal such as additional filtering, self (cross)-phase modulation, the bias and drive signal change of the modulator used to generate the optical signal. 1. A system for measuring optical signal-to-noise-ratio (OSNR) in an optical communication system comprising: at least one optical delay interferometer adapted to measure at least two interferograms of the noisy signal; and', 'means for calculating the in-band OSNR from extinctions of the interferograms measured at different optical delays, wherein said optical delays are selected to be substantially less than a bit period of the optical communication channel., 'a channel filter adapted to select one specific optical communication channel from a wavelength-division-multiplexing (WDM) optical communication system, the channel comprises an optical signal carrying digital bit information and noise from optical power amplifiers; characterised by2. The system of wherein the at least one optical delay interferometer comprises means for varying the optical ...

Подробнее
Номер записи: 27
20-12-2012 дата публикации

SUBSTRATE TRAY AND MANUFACTURING METHOD OF A FLEXIBLE ELECTRONIC DEVICE

Номер: US20120318771A1
Автор: Guo Jing, GUO Wei, Lee Woobong, REN Qingrong, Zhang Hang
Принадлежит: BOE Technology Group Co., Ltd.

Provided is a substrate tray for supporting a flexible substrate during manufacturing of a flexible electronic device. The substrate tray comprises a tray baseboard, and the tray baseboard has a groove zone provided with a plurality of grooves. A method for manufacturing a flexible electronic device is also provided, in which the substrate tray is used to support a flexible substrate. 1. A substrate tray for supporting a flexible substrate during manufacturing of a flexible electronic device , wherein , it comprises a tray baseboard , and the tray baseboard has a groove zone provided with a plurality of grooves.2. The substrate tray according to claim 1 , wherein claim 1 , the tray baseboard also has a planar edge zone at the periphery of the groove zone.3. The substrate tray according to claim 1 , wherein claim 1 , the plurality of grooves are strip-like grooves extending to edges of the groove zone.4. The substrate tray according to claim 3 , wherein claim 3 , the plurality of strip-like grooves comprise a plurality of transversally-extending strip-like grooves and a plurality of vertically-extending strip-like grooves.5. The substrate tray according to claim 3 , wherein claim 3 , the strip-like grooves extend from one side edge of the groove zone to another side edge on the opposite of said one side edge.6. The substrate tray according to claim 1 , wherein claim 1 , the depths of the grooves are no larger than 1 μm claim 1 , and the side lengths of the cross-section profiles of the grooves are m μm˜n mm claim 1 , in which claim 1 , 1≦m≦10 claim 1 , 1≦n≦10.7. The substrate tray according to claim 6 , wherein claim 6 , the cross-section profiles of the grooves are one or more selected from a group consisted of circle claim 6 , ellipse and polygon.8. The substrate tray according to claim 1 , wherein claim 1 , the material of the tray baseboard is selected from a group consisted of glass claim 1 , metal and plastic.9. A method for manufacturing a flexible electronic ...

Подробнее
Номер записи: 28
21-02-2013 дата публикации

Electronic Device for Controlling Magnitude of Charging Current for Charging To-be-charged Electronic Device

Номер: US20130043831A1
Автор: HU Chen-Yang, Jung Guo-Wei
Принадлежит:

By controlling a charging current magnitude for charging a to-be-charged electronic device by a charging electronic device and current magnitudes of other loading elements of the charging electronic device, when the charging electronic device is switched to a fast charge mode or to an efficiency mode from a normal charge mode, a required current can be directly provided to the to-be-charged electronic device without raising a hardware cost for upgrading charging capabilities. 1. An electronic device configured to control a magnitude of a charge current for a to-be-charged electronic device , comprising:a connection unit;a first loading unit;a control unit configured to control the electronic device to charge the to-be-charged electronic device under a first charge mode or a second charge mode; anda power supply unit coupled to the first loading unit, the control unit and the connection unit;wherein the power supply unit is configured to provide a first current to the to-be-charged electronic device via the connection unit and configured to provide a second current to the first loading unit when the electronic device is under the first charge mode;wherein the control unit is configured to adjust the second current to be a third current, and the power supply unit is configured to generate a fourth current according to both the second current and the third current so as to provide the fourth current to the to-be-charged electronic device when the electronic device is switched from the first charge mode to the second charge mode; andwherein the third current is smaller than the second current, and the fourth current is larger than the first current.2. The electronic device of claim 1 , wherein the electronic device is a display claim 1 , and the first loading unit is a backlight source claim 1 , a speaker claim 1 , or a universal serial bus port.3. The electronic device of further comprising:a second loading unit coupled to the power supplying unit;wherein the control ...

Подробнее
Номер записи: 29
07-03-2013 дата публикации

AUTOMATED LITHOGRAPHIC HOT SPOT DETECTION EMPLOYING UNSUPERVISED TOPOLOGICAL IMAGE CATEGORIZATION

Номер: US20130061184A1
Автор: GUO Wei, Leslie Alan J.
Принадлежит: INTERNATIONAL BUSINESS MACHINES CORPORATION

A method for proactively preventing lithographic problems is disclosed, which employs information generated from layout patterns including hot spots in a first technology node to identify hot spots in a second technology node employing a scaled down minimum dimension. In this proactive approach, problematic patterns or complex product geometries are identified in a chip design layout of the second technology node based on detection, in the chip design layout, of topological features that are similar to topological features of known hot spots in the first technology node. The identified patterns are potential hot spots in the chip design layout for the second technology node. Known hot spots in layout patterns in the first technology node are topologically categorized to provide a database for performing the fault detection and diagnosis on the chip design layout. 1. A method of modifying lithographic hot spots in a chip design layout comprising:generating a set of reference feature key points by performing, employing at least one computing means, a first scale invariant feature transformation (SIFT) on a reference pattern including a lithographic hot spot located in a first chip design layout;generating a set of target feature key points by performing, employing said at least one computing means, a second SIFT on a target pattern located in a second chip design layout;matching said set of reference feature key points with said set of target feature key points by identifying, employing said at least one computing means, pairs of feature key points across said set of reference feature key points and said set of target reference feature key points, wherein each of said pairs are selected to provide maximum matching between topological features of said set of reference feature key points and topological features of said set of target feature key points; andstoring data representing a result of said matching in a non-transitory machine readable data storage medium ...

Подробнее
Номер записи: 30
21-03-2013 дата публикации

Authenticating Linked Accounts

Номер: US20130074167A1
Автор: Ayres Lynn C., Bailey David W., Guo Wei-Quiang Michael, Huang Lin, Rouskov Yordan I.
Принадлежит: MICROSOFT CORPORATION

Embodiments of authenticating linked accounts are presented herein. In an implementation, an authentication service provides functionality to form links between a plurality of user accounts. A client may then authenticate by providing credentials for one account in a group of linked accounts, and is permitted access to each account in the group of linked accounts based upon the linking. Thus, a single sign-in of a client to one account may permit the client to obtain services for service providers corresponding to multiple linked accounts, without an individual sign-in to each account. 1. A method comprising:receiving one or more inputs from a client that define a link between a plurality of user accounts at one or more service providers, each of the plurality of user accounts requiring a separate sign-in;forming a link identifier that identifies a plurality of account identifiers corresponding to the plurality of user accounts as a set of linked accounts;storing the link identifier at an authentication service; andmanaging authentication of the client to the set of linked accounts, such that the client, upon providing to the authentication service credentials corresponding to one account in the set of linked accounts, receives an access to each account in the set of linked accounts.2. The method as recited in claim 1 , wherein:the authentication service manages authentication of clients on behalf of the one or more service providers; andthe access to each account in the set of linked accounts includes access to corresponding services provided by the one or more service providers.3. The method as recited in claim 1 , further comprising:exposing an application programming interface callable by the client;indicating a plurality of user accounts that are linkable to one another by the client; andstoring the link identifier in response to an indication linking more than one of the user accounts received from the client via the interface.4. The method as recited in claim ...

Подробнее
Номер записи: 31
28-03-2013 дата публикации

OPTICAL RECEIVER

Номер: US20130077980A1
Автор: DONEGAN John F., GUO Wei-Hua, Lu Qiaoyin
Принадлежит: TRINITY COLLEGE DUBLIN

The invention provides a solution for the full integration of a coherent receiver on Indium Phosphide (InP) or other material that has a number of advantages over current coherent receiver design. PIN waveguides can be reverse biased and forward biased to modify the mode effective index so as to realize an integrated polarization beam splitting function and the 90 degree optical hybrid. The fabrication tolerance is therefore greatly increased; resulting in much reduced complexity and cost for the final receiver. 1. An integrated receiver system comprising:an indium phosphide layer or other semiconductor base; anda PIN waveguide layer adapted to be reverse biased and/or forward biased to modify a mode effective index of the waveguide so as to provide an integrated polarization beam splitting function and a 90 degree optical hybrid function.2. The receiver system of wherein the indium phosphide layer or other semiconductor base comprises at least one of: a polarization beam splitter claim 1 , a 90 degree optical hybrid claim 1 , or a photodiode.3. The receiver system of wherein the waveguide is forward biased to inject current into a waveguide to change the effective index of a transverse electric mode and transverse magnetic mode simultaneously.4. The receiver system of wherein the waveguide is reverse biased to provide an electric field across the waveguide such that the electric field will only change the effective index of a transverse electric mode.5. The receiver system of wherein the forward biasing compensates for phase error from the 90 degree optical hybrid.6. The receiver system of comprising means for controlling the forward and reverse biasing.7. The receiver system of wherein the PIN waveguide layer comprises a Mach-Zehnder interferometer.8. The receiver system of wherein the 90 optical hybrid function comprises two-by-two beam splitters adapted to receive a current injection to generate a 90 degree phase shift.9. The receiver system of comprising a PIN ...

Подробнее
Номер записи: 32
02-05-2013 дата публикации

ARRAY SUBSTRATE, MANUFACTURING METHOD THEREOF, LIQUID CRYSTAL PANEL, AND DISPLAY DEVICE

Номер: US20130107155A1
Автор: GUO Wei, Lee Woobong
Принадлежит: BOE Technology Group Co., Ltd.

The embodiments of the present invention disclose an array substrate and manufacturing method thereof, and a display device. The array substrate provided in an embodiment of the present invention comprises: a substrate, and a gate metal layer, an active layer and a source/drain metal layer formed on the substrate; wherein, on at least one side of the gate metal layer, there is formed an isolation buffer layer, and/or, on at least one side of the source/drain metal layer, there is formed an isolation buffer layer; furthermore, the isolation buffer layer is made of molybdenum oxide. 1. An array substrate , comprising a base substrate , as well as a gate metal layer , an active layer and a source/drain metal layer that are formed on the base substrate;wherein, on at least one side of the gate metal layer in a thickness direction, there is formed an isolation buffer layer, and/or, on at least one side of the source/drain metal layer in a thickness direction, there is formed an isolation buffer layer; andthe isolation buffer layer is made of molybdenum oxide.2. The array substrate according to claim 1 , wherein the array substrate adopts a bottom-gate structure claim 1 , and a gate insulating layer is formed between the gate metal layer and the active layer;on at least one side of the gate metal layer, there is formed an isolation buffer layer, which comprises: a first isolation buffer layer is formed between the gate metal layer and the base substrate; or, a first isolation buffer layer is formed between the gate metal layer and the base substrate, and a third isolation buffer layer is formed between the gate metal layer and the gate insulating layer;wherein, the first isolation buffer layer is made of molybdenum oxide, and the third isolation buffer layer is made of metal molybdenum or molybdenum oxide.3. The array substrate according to claim 1 , wherein the array substrate adopts a top-gate structure claim 1 , and the array substrate further comprises a gate ...

Подробнее
Номер записи: 33
06-06-2013 дата публикации

CONTROLLER NOTIFICATION SYSTEM

Номер: US20130143662A1
Автор: DEL CASTILLO LEONARDO G., FURR KEVIN L., Glaser Russell E., GUNN STEVEN R., GUO Wei, LANDERS AMY LYNN, LUM RICHARD S.
Принадлежит: MICROSOFT CORPORATION

A method of associating a controller to a console comprises, at the controller, establishing a connection with the console such that the controller is assigned to one of a plurality of different ports of the console over which different controllers may separately communicate with the console. A visual indication is then provided on the controller to indicate to the user of the controller which one of the plurality of different ports of the console has been assigned to the controller and over which the controller communicates with the console. 1. A method of associating a controller to a console , comprising at the controller:establishing a connection with the console, the controller being assigned to one of a plurality of different ports of the console over which different controllers may separately communicate with the console;visually indicating on the controller to a user of the controller which one of the plurality of different ports of the console has been assigned to the controller and over which the controller communicates with the console.2. The method of claim 1 , wherein said visually indicating comprises illuminating one of a plurality of visual indicators on the controller claim 1 , each visual indicator corresponding to a respective one of the plurality of different ports on the console claim 1 , the illuminated visual indicator indicating on the controller which port of the plurality of ports of the console has been assigned to the controller.3. The method of claim 2 , wherein the plurality of visual indicators comprises a plurality of light-emitting diodes (LEDs) claim 2 , each of the LEDs representing a different one of said plurality of ports to which the controller may be assigned claim 2 , the method further comprising illuminating one of the LEDs to indicate which one of the plurality of ports of the console has been assigned to the controller.4. The method of claim 2 , further comprising providing other notifications to the user via the visual ...

Подробнее
Номер записи: 34
13-06-2013 дата публикации

METHOD OF TREATING NON-SMALL CELL LUNG CANCER WITH BIS-(THIOHYDRAZIDE)AMIDE COMPOUNDS

Номер: US20130149392A1
Автор: GUO Wei, Vukovic Vojo
Принадлежит: Synta Pharmaceuticals Corp.

The present invention is a method for treating non-small cell lung cancer in a subject in need thereof, comprising administering to the subject an effective amount of a bis(thiohydrazideamide) compound of formula (I): 2. The method of claim 1 , wherein Z is O claim 1 , Rand Rare the same and Rand Rare the same.6. The method of claim 1 , wherein Ris —H and Ris —H claim 1 , an alkyl or substituted alkyl group.7. The method of claim 1 , wherein Rand Rare each an alkyl group optionally substituted with —OH claim 1 , halogen claim 1 , phenyl claim 1 , benzyl claim 1 , pyridyl claim 1 , or C1-C8 alkoxy and Ris —H or methyl.8. The method of claim 1 , wherein Rand Rare each an optionally substituted phenyl group.9. The method of claim 1 , wherein the phenyl group represented by Rand the phenyl group represented by Rare optionally substituted with one or more groups selected from: —R claim 1 , —OH claim 1 , —Br claim 1 , —Cl claim 1 , —I claim 1 , —F claim 1 , —OR claim 1 , —O—COR claim 1 , —COR claim 1 , —CN claim 1 , —NCS claim 1 , —NO claim 1 , —COOH claim 1 , —SOH claim 1 , —NH claim 1 , —NHR claim 1 , —N(RR) claim 1 , —COOR claim 1 , —CHO claim 1 , —CONH claim 1 , —CONHR claim 1 , —CON(RR) claim 1 , —NHCOR claim 1 , —NRCOR claim 1 , —NHCONH claim 1 , —NHCONRH claim 1 , —NHCON(RR) claim 1 , —NRCONH claim 1 , —NRCONRH claim 1 , —NRCON(RR) claim 1 , —C(═NH)—NH claim 1 , —C(═NH)—NHR claim 1 , —C(═NH)—N(RR) claim 1 , —C(═NR)—NH claim 1 , —C(═NR)—NHR claim 1 , —C(═NR)—N(RR) claim 1 , —NH—C(═NH)—NH claim 1 , —NH—C(═NH)—NHR claim 1 , —NH—C(═NH)—N(RR) claim 1 , —NH—C(═NR)—NH claim 1 , —NH—C(═NR)—NHR claim 1 , —NH—C(═NR)—N(RR) claim 1 , —NR—C(═NH)—NH claim 1 , —NR—C(═NH)—NHR claim 1 , —NR—C(═NH)—N(RR) claim 1 , —NR—C(═NR)—NH claim 1 , —NR—C(═NR)—NHR claim 1 , —NR—C(═NR)—N(RR) claim 1 , —NHNH claim 1 , —NHNHR claim 1 , —NHNRR claim 1 , —SONH claim 1 , —SONHR claim 1 , —SONRR claim 1 , —CH═CHR claim 1 , —CH═CRR claim 1 , —CR═CRR claim 1 , —CR═CHR claim 1 , —CR═CRR claim 1 , —CCR ...

Подробнее
Номер записи: 35
07-11-2013 дата публикации

NETWORK JITTER SMOOTHING WITH REDUCED DELAY

Номер: US20130294463A1
Автор: KHALIL Hosam A., Shieh Guo-Wei, Wang Tian
Принадлежит:

A method of compensating for jitter in a packet stream is described. The method comprises placing undecoded frames extracted from packets in the packet stream into a jitter buffer while decoding frames from the jitter buffer and placing the decoded frames into a sample buffer at a rate determined using an average playout delay. The average playout delay is the running average of the playout delay calculated for each packet as each packet becomes available. The playout delay for each packet is the sum of a sample buffer delay and a jitter buffer delay. As each packet is received, the average playout delay is adjusted based on a comparison of the playout delay associated with the received packet to the current average playout delay. 1. A method of compensating for jitter in a packet stream comprising:placing encoded frames extracted from packets forming a data stream into a jitter buffer;decoding frames from the jitter buffer; andplacing the decoded frames into a sample buffer at a rate determined by an average playout delay, the average playout delay being determined by the running average of the playout delay calculated for each packet that forms the data stream.2. The method of claim 1 , wherein the playout delay for each packet is the sum of a sample buffer delay and a jitter buffer delay.3. The method of claim 2 , wherein the average playout delay is adjusted as each packet is received based on a comparison of the playout delay associated with the received packet to the current average playout delay.4. The method of claim 3 , wherein the average playout delay is adjusted by determining if there are enough samples in the sample buffer to respond to a samples-pull request and if there are not enough samples in the sample buffer to respond to a samples-pull request claim 3 , producing additional samples for the sample buffer.5. The method of claim 4 , wherein producing additional samples for the sample buffer comprises determining if the first packet in the jitter ...

Подробнее
Номер записи: 36
05-12-2013 дата публикации

ETHERNET COMMUNICATION SYSTEM AND METHOD BASED ON MMC/SD INTERFACE

Номер: US20130325994A1
Автор: Chai Hongfeng, GUO Wei, He Shuo, Lu Zhijun, Meng Hongwen, Xu Yunfeng, Zhou Zhonggue
Принадлежит:

The present invention is directed to an Ethernet communication method and system which are based on the MMC/SD interface. In the invention, the communication system includes at least one master device and at least one slave device, the at least one master device and the at least one slave device are connected via MMC/SD interface and communicate with each other on the Ethernet. The Ethernet communication method and system disclosed herein enables the device with the MMC/SD interface to act as a node in the network, and thus greatly expanding the application domain of such devices. 1. An Ethernet communication system based on the MMC/SD interface , comprises at least one master device and at least one slave device , the at least one master device and the at least one slave device are connected through the MMC/SD interface and communicate with each other on the Ethernet.2. The Ethernet communication system based on the MMC/SD interface according to claim 1 , characterized in that claim 1 , when the at least one slave device sends application data to the at least one master device claim 1 , the at least one slave device put the application data into a transmission buffer to wait for the at least one master device to receive it in manner of periodic polling.3. The Ethernet communication system based on the MMC/SD interface according to claim 2 , characterized in that claim 2 , each of the at least one master device includes a master controller claim 2 , a master communication protocol stack device claim 2 , and a master MMC/SD physical interface driver device claim 2 , wherein the master controller is used for controlling the operation of the master communication protocol stack device and the master MMC/SD physical interface driver device claim 2 , the master communication protocol stack device is used for transmitting and receiving the information for the master device claim 2 , and the master MMC/SD physical interface driver device is used for the transmission of the ...

Подробнее
Номер записи: 37
02-01-2014 дата публикации

POLYAMIDE-AMINE DENDRIMER OR DERIVATIVE THEREOF-MATH1 GENE NANO PARTICLE AND USE THEREOF IN TREATMENT OF HEARING LOSS

Номер: US20140004196A1
Автор: Gao Wei-Quiang, Guo Wei-Wei, HAN Dong, Wu Nan, Wu Yan, Yang Shi-Ming, Young Wei-Yen, Zhai Suo-Quiang, Zhao Li-Dong
Принадлежит:

Polyamidoamine, its partially degraded products or its complexes-Math1 gene nanoparticles, method for preparing the same and use thereof, the gene nanoparticles can be produced through complex coacervating of polyamidoamine, or polyamidoamine complexes and a Math1 gene-containing plasmid. The gene nanoparticles are controllable in particle size, uniform in size, favorable for surface modification, can enhance the ability of expression and delivery of the Math1 gene, and is useful in a sensorineural hearing loss caused by hair cells loss due to noise, drug toxicity etc. 1. A polyamidoamine-Math1 gene nanoparticle , comprising a polyamidoamine and a plasmid as shown in , with a particle size of 100-200 nm , a distribution index of 0.10-0.25 , zeta potential of about 10-50 mV , encapsulation efficiency of 90-95%.2. A partially degraded polyamidoamine products Math1 gene nanoparticle , comprising a polyamidoamine and a plasmid as shown in , with a particle size of 100-200 nm , a distribution index of 0.10-0.25 , zeta potential of about 10-50 mV , encapsulation efficiency of 90-95% , the partially degraded polyamidoamine products are obtained by thermal treatment of an intact polyamidoamine molecule.3. A polyamidoamine complexes-Math1 gene nanoparticle , comprising polyamidoamine complexes and a plasmid as shown in , with a particle size of 100-200 nm , a distribution index of 0.10-0.25 , zeta potential of about 10-50 mV , encapsulation efficiency of 90-95% , the complexes are obtained by mixing a polyamidoamine or its partially degraded products and a cyclodextrin , the partially degraded products is obtained by thermal treatment of an intact polyamidoamine molecule.4. A method for preparing nanoparticles , wherein a suspension of nanoparticles is obtained by subjecting an aqueous solution of polyamidoamine , partially degraded products of polyamidoamine or polyamidoamine complexes and a Math1 gene-containing plasmid in PBS solution to complex coacervation , said ...

Подробнее
Номер записи: 38
23-01-2014 дата публикации

Federated Realm Discovery

Номер: US20140026205A1
Автор: Ayres Lynn, Chen Rui, Faulkner Sarah, Guo Wei-Qiang, Rouskov Yordan I.
Принадлежит: MICROSOFT CORPORATION

A federated realm discovery system within a federation determines a “home” realm associated with a portion of the user's credentials before the user's secret information (such as a password) is passed to a non-home realm. A login user interface accepts a user identifier and, based on the user identifier, can use various methods to identify an account authority service within the federation that can authenticate the user. In one method, a realm list of the user device can be used to direct the login to the appropriate home realm of the user. In another method, an account authority service in a non-home realm can look up the user's home realm and provide realm information directing the user device to login at the home realm. 1. A method comprising:transmitting a request for authentication to a home security authority of a user, the home security authority of the user associated with a first realm, and the user having an account with the first realm;receiving a partner security token in response to transmitting the request for authentication;submitting the partner security token to a non-home security authority associated with a network service responsive to the user navigating to the network service, the non-home security authority and the network service associated with a second realm, the first realm and the second realm being members of a federation; andreceiving from the non-home security authority a security token for accessing the network service.2. The method of claim 1 , further comprising accessing the network service using the security token received from the non-home security authority.3. The method of claim 2 , wherein the accessing further comprises accessing the network service without causing display of a login user interface of the non-home security authority.4. The method of claim 2 , wherein the accessing further comprises accessing the network service without causing display of a login user interface of the home security authority.5. The method of ...

Подробнее
Номер записи: 39
27-02-2014 дата публикации

Scalable Session Management

Номер: US20140059354A1
Автор: BACK ADAM, Guo Wei-Quiang Michael, Jiang Wei, PAYA ISMAIL CEM, Rouskov Yordan I., Whited John D.
Принадлежит: MICROSOFT CORPORATION

Scalable session management is achieved by generating a cookie that includes an encrypted session key and encrypted cookie data. The cookie data is encrypted using the session key. The session key is then signed and encrypted using one or more public/private key pairs. The encrypted session key can be decrypted and verified using the same private/public key pair(s). Once verified, the decrypted session key can then be used to decrypt and verify the encrypted cookie data. A first server having the private/public key pair(s) may generate the cookie using a randomly generated session key. A second server having the same private/public key pair(s) may decrypt and verify the cookie even if the session key is not initially installed on the second server. A session key cache may be used to provide session key lookup to save public/private key operations on the servers. 1. A method comprising:identifying cookie data;encrypting the cookie data using a session key to generate encrypted cookie data;signing and encrypting the session key using a private/public key pair having a key identifier to generate an encrypted signed key;applying a message authentication code to the cookie data and the session key to generate an authentication tag;combining the key identifier, the encrypted signed key, the encrypted cookie data, and the authentication tag to form a cookie; andmaintaining the session key in association with the encrypted signed key.2. A method comprising:maintaining a store of private/public key pairs;signing and encrypting a session key using a private/public key pair to generate an encrypted signed key; andmaintaining, in a session key cache, the session key in association with the encrypted signed key.3. A system comprising:a memory;a processor; identify a session key associated with an established session between the system and a client device;', 'sign the session key with a private key associated with a first private/public key pair, generating a signed session key; ...

Подробнее
Номер записи: 40
27-03-2014 дата публикации

METHOD, APPARATUS, AND SYSTEM FOR ACQUIRING LOAD INFORMATION

Номер: US20140086207A1
Автор: Chen Yanyan, GUO Wei, GUO Xuanyu, LV Boya
Принадлежит: Huawei Technologies Co., Ltd.

The present invention discloses a method, an apparatus and a system for acquiring load information. In one method, a source access controller and a target access controller can interact through RAT handover related messages so that a source RAT system can acquire load information of a target RAT system when an inter-RAT PS handover is performed. This enables load balancing between different RAT systems so as to guarantee communications quality of the systems. In another method of the present invention, the source access controller and the target access controller interact through a RAN RIM based load information request message and an RIM based load information response message, so that the source RAT system can acquire load information of the target RAT system before an inter-RAT PS domain handover is performed. This enables load balancing between different RAT systems so as to guarantee the communications quality of the systems. 1. A method for acquiring load information , the method is applicable to a PS domain handover from an E-UTRAN to a UTRAN , comprising:sending, by a source eNB to which a source cell belongs, a handover request to an SGSN, so that a first relocation request message is sent from the SGSN to a target RNC to which a target cell belongs;receiving, by the source eNB, a first relocation command message from the SGSN, wherein the first relocation command message is returned by the SGSN according to an first relocation request acknowledge message returned by the target RNC;wherein the handover request message carries a first transparent container IE that carries a source cell load information IE;wherein the first relocation request message carries the first transparent container IE;wherein the first relocation request acknowledge message carries a second transparent container IE that carries a target cell load information;wherein the first relocation command message carries the second transparent container IE.2. The method of claim 1 , wherein the ...

Подробнее
Номер записи: 41
02-01-2020 дата публикации

CELLULOSE ACETATE FIBERS IN NONWOVEN FABRICS

Номер: US20200002847A1
Автор: Appling Yancey, Gaynor Scott Gregory, Ghosh Koushik, Hassan Mohammad Abouelreesh, Izallalen Mounir, Posa James M., Qin Guo Wei, Shah Syed Ali, Spruell Jason Michael, Steach Jeremy Kenneth
Принадлежит: EASTMAN CHEMICAL COMPANY

Staple fibers and filament yarns formed from cellulose esters, such as cellulose acetate, are described herein, along with methods of making the fibers and their use in nonwoven fabrics and articles. The filament yarns and fibers described herein may be coated with at least one finish and, in some cases, may be coated with two or more finishes selected to enhance the properties of the fibers. Staple fibers as described herein may be used to produce nonwoven webs that are strong, soft, absorbent, and biodegradable, and may be used in wet or dry nonwoven articles for a variety personal care, medical, industrial, and commercial applications. 1. A staple fiber formed from cellulose acetate , wherein said fiber is at least partially coated with at least one finish , wherein said fiber has a denier per filament of less than about 3.0 and a crimp frequency of less than 22 crimps per inch (CPI) , and wherein a plurality of said fibers exhibit a fiber-to-fiber staple pad coefficient of friction of not more than about 0.70.2. The staple fiber of claim 1 , wherein said fiber has a static half-life of not more than about 12 minutes and wherein a plurality of said fibers exhibit a fiber-to-fiber staple pad coefficient of friction of at least about 0.1.3. The staple fiber of claim 1 , wherein a plurality of said fibers exhibit a fiber-to-fiber staple pad coefficient of friction of at least about 0.1 and wherein said fiber has a surface resistivity claim 1 , expressed as log R claim 1 , of not more than about 11.4. The staple fiber of claim 1 , wherein said fiber is at least partially coated with a spinning finish and a top-coat finish claim 1 , wherein said spinning finish is present on said fiber in an amount of at least about 0.5% FOY and wherein said top-coat finish is present on said fiber in an amount of not more than about 0.5% FOY claim 1 , and wherein each of said spinning finish and said top-coat finish have been applied prior to cutting a filament yarn to form said ...

Подробнее
Номер записи: 42
02-01-2020 дата публикации

CELLULOSE ACETATE FIBERS IN NONWOVEN FABRICS

Номер: US20200002858A1
Автор: Appling Yancey, Gaynor Scott Gregory, Ghosh Koushik, Hassan Mohammad Abouelreesh, Izallalen Mounir, Posa James M., Qin Guo Wei, Shah Syed Ali, Spruell Jason Michael, Steach Jeremy Kenneth
Принадлежит: EASTMAN CHEMICAL COMPANY

Staple fibers and filament yarns formed from cellulose esters, such as cellulose acetate, are described herein, along with methods of making the fibers and their use in nonwoven fabrics and articles. The filament yarns and fibers described herein may be coated with at least one finish and, in some cases, may be coated with two or more finishes selected to enhance the properties of the fibers. Staple fibers as described herein may be used to produce nonwoven webs that are strong, soft, absorbent, and biodegradable, and may be used in wet or dry nonwoven articles for a variety personal care, medical, industrial, and commercial applications. 1. A nonwoven web comprising a plurality of cellulose acetate staple fibers , wherein said cellulose acetate staple fibers have a crimp frequency of less than about 24 crimps per inch (CPI) , and wherein said cellulose acetate staple fibers are at least partially coated with at least one finish ,wherein said nonwoven web has one or more of the following characteristics (i) through (v):{'sup': '2', '(i) a wet tensile strength in the machine direction (MD) in the range of about 10 to about 1000 Nm/kg, measured according to NWSP 110.4 Option A with a 1-inch sample strip and normalized for the basis weight of the nonwoven;'}{'sup': '2', '(ii) a wet tensile strength in the cross direction (CD) in the range of 10 about to about 1000 Nm/kg, measured according to NWSP 110.4 Option A with a 1-inch sample strip and normalized for the basis weight of the nonwoven;'}{'sup': '2', '(iii) a dry tensile strength in the machine direction (MD) in the range of about 10 to about 2000 Nm/kg, measured according to NWSP 110.4 Option A with a 1-inch sample strip and normalized for the basis weight of the nonwoven;'}{'sup': '2', '(iv) a dry tensile strength in the cross direction (CD) in the range of about 10 to about 2000 Nm/kg, measured according to NWSP 110.4 Option A with a 1-inch sample strip and normalized for the basis weight of the nonwoven;'}(v) ...

Подробнее
Номер записи: 43
07-01-2016 дата публикации

METHOD AND GUIDE CANE FOR GUIDING THE BLIND

Номер: US20160005334A1
Автор: GUO Wei
Принадлежит:

Guiding the blind includes receiving, via a camera module, a signal sent from a processing module to instruct the camera module to take an image of an informational blind pathway including a digital object identifier, capturing, via the camera module, the image of the informational blind pathway, sending, via the camera module, the image to the processing module, receiving and analyzing, via the processing module, the image sent by the camera module, acquiring, via the processing module, information included in the digital object identifier in the image of the informational blind pathway, converting, via the processing module, the information included in the digital object identifier into speech information, and outputting the speech information to be played on an audio device. 1. A method , comprising:receiving, via a camera module, a signal sent from a processing module to instruct the camera module to take an image of an informational blind pathway including a digital object identifier;capturing, via the camera module, the image of the informational blind pathway;sending, via the camera module, the image to the processing module;receiving and analyzing, via the processing module, the image sent by the camera module;acquiring, via the processing module, information included in the digital object identifier in the image of the informational blind pathway;converting, via the processing module, the information included in the digital object identifier into speech information; andoutputting the speech information to be played on an audio device.2. The method as described in claim 1 , wherein a Bluetooth information sending module sends the speech information to a Bluetooth headset matched with the Bluetooth information sending module.3. The method as described in claim 1 , wherein the informational blind pathway comprises an informational tile including the digital object identifier.4. The method as described in claim 1 , wherein the digital object identifier includes ...

Подробнее
Номер записи: 44
20-01-2022 дата публикации

CONJUGATES OF FUSION PROTEINS OF GLP-1 AND FGF21

Номер: US20220016254A1
Автор: GUO Wei, Wu Bo, Wu Xinle, ZHANG Yuanyuan, ZOU Haixia
Принадлежит:

The present disclosure provides conjugates of polypeptides comprising GLP-1, polypeptide linker and FGF21. Pharmaceutical compositions comprising the same and methods of treating diseases are also provided. 175-. (canceled)76. A polypeptide conjugate comprising a fusion polypeptide conjugated to at least one clearance reducing moiety (CRM) ,wherein the fusion polypeptide comprises or consists essentially of, from N-terminus to C terminus, a GLP-1, a polypeptide linker and a FGF21;wherein the at least one CRM is conjugated to at least one conjugatable residue in the fusion polypeptide; andwherein the polypeptide linker has a length of at least 0-120 amino acid residues, andwherein the fusion polypeptide comprises up to two conjugatable residues.77. The polypeptide conjugate of claim 76 , wherein the fusion polypeptide comprises a first conjugatable residue and a second conjugatable residue claim 76 , wherein: the first conjugatable residue is present in the FGF21 and the second conjugatable residue is present in the polypeptide linker.78. The polypeptide conjugate of claim 77 , wherein both the first and the second conjugatable residues are lysine or cysteine.79. The polypeptide conjugate of claim 78 , wherein the FGF21 comprises up to one conjugatable residue and the conjugatable residue in the FGF21 is an introduced lysine.80. The polypeptide conjugate according to claim 79 , wherein the conjugatable residue in the FGF21 comprises a substitution selected from the group consisting of: G170K claim 79 , P171K claim 79 , S172K claim 79 , Q173K claim 79 , G174K claim 79 , A180K claim 79 , S181K claim 79 , S71K and ins182K relative to SEQ ID NO: 36.81. The polypeptide conjugate according to claim 79 , wherein the FGF21 further comprises one or more mutations at positions selected from K56 claim 79 , K59 claim 79 , K69 claim 79 , and K122 relative to SEQ ID NO: 36 claim 79 , to a non-conjugatable residue claim 79 , and the GLP-1 further comprises substitution of K26 and ...

Подробнее
Номер записи: 45
09-01-2020 дата публикации

CELLULOSE ACETATE FIBERS IN NONWOVEN FABRICS

Номер: US20200010980A1
Автор: Appling Yancey, Gaynor Scott Gregory, Ghosh Koushik, Hassan Mohammad Abouelreesh, Izallalen Mounir, Posa James M., Qin Guo Wei, Shah Syed Ali, Spruell Jason Michael, Steach Jeremy Kenneth
Принадлежит: EASTMAN CHEMICAL COMPANY

Staple fibers and filament yarns formed from cellulose esters, such as cellulose acetate, are described herein, along with methods of making the fibers and their use in nonwoven fabrics and articles. The filament yarns and fibers described herein may be coated with at least one finish and, in some cases, may be coated with two or more finishes selected to enhance the properties of the fibers. Staple fibers as described herein may be used to produce nonwoven webs that are strong, soft, absorbent, and biodegradable, and may be used in wet or dry nonwoven articles for a variety personal care, medical, industrial, and commercial applications. 1. A staple fiber formed from cellulose acetate and at least partially coated with at least one ionic fiber finish , wherein said fiber has a surface resistivity , expressed as log R , of not more than about 11.2. The fiber of claim 1 , wherein said fiber has a static half-life of not more than about 25 seconds and wherein a plurality of said fibers exhibit a fiber-to-fiber staple pad coefficient of friction of at least about 0.1.3. The fiber of claim 1 , wherein a plurality of said fibers exhibit a fiber-to-fiber staple pad coefficient of friction of at least about 0.10 and a plurality of said fibers exhibit a fiber-to-metal staple pad coefficient of friction of at least about 0.20.4. The fiber of claim 1 , wherein said fiber is not coated with a spinning finish and is coated with at least one top-coat finish in an amount of not more than about 0.4% FOY claim 1 , wherein said top-coat finish comprises said ionic fiber finish claim 1 , and wherein said staple fiber has a crimp frequency in the range of from about 10 to about 17 crimps per inch (CPI).5. The fiber of claim 1 , wherein said fiber has a denier per filament in the range of from about 0.5 to about 3 claim 1 , a crimp frequency in the range of from about 8 to about 24 CPI claim 1 , a length in the range of from about 3 to about 75 mm claim 1 , and a Y-shaped or round ...

Подробнее
Номер записи: 46
14-01-2016 дата публикации

APPARATUS USED FOR SECURITY INFORMATION INTERACTION

Номер: US20160014115A1
Автор: Chai Hongfeng, Chen Chengqian, GUO Wei, He Shuo, Li Dingzhou, Lu Zhijun, Yan Xiangxiang, Yu Bin, Zheng Jianbin, Zhou Yu
Принадлежит:

The invention provides an apparatus used for security information interaction comprising a first system management device for providing an operational environment for routine applications and a second system management device for providing an operational environment in a safe mode for security applications so as to perform a security information interaction process. The apparatus used for security information interaction disclosed by the invention has a high safety and a wide applicability and is low in cost. 1. An apparatus used for security information interaction comprising:a first system management device for providing an operational environment for routine applications;a second system management device for providing an operational environment in a safe mode for security applications so as to perform a security information interaction process;wherein, in case that the current application to be operated is a routine application, the apparatus used for security information interaction selects the first system management device as a currently used system management device, and in case that the current application to be operated is a security application, the apparatus used for security information interaction selects the second system management device as a currently used system management device.2. The apparatus used for security information interaction according to claim 1 , characterized in that the resource used by the second system management device is isolated from the resource used by the first system management device.3. The apparatus used for security information interaction according to claim 2 , characterized in that the second system management device further comprises:an external device interface for providing a safe data communication interface for various types of external security carriers;a virtual security carrier manager which, based on a virtual security carrier creating request received from a virtual security carrier server and an associated ...

Подробнее
Номер записи: 47
10-04-2014 дата публикации

CROSS-DOMAIN AUTHENTICATION

Номер: US20140101718A1
Автор: Blinn Arnold N., Calinov Iulian D., Guo Wei-Quiang Michael, Jiang Wei, Perumal Raja Pazhanivel
Принадлежит: MICROSOFT CORPORATION

Providing services within a network of service providers sharing an authentication service and a set of business rules. A central server receives a first request from a first server to provide a first service to a user via a client without forcing the user to present credentials. In response to the received first request, the central server stores data identifying the first service on the client. The central server further receives a second request from a second server to provide a second service to the user via the client after the user presents the credentials to the second service. After receiving the second request and the presented credentials, the central server allows the user access to the second service. In response to allowing the user access to the second service, the central server further allows the user access to the first service as a result of the stored data. 120-. (canceled)21. A method for providing a first service and a second service to a user via a client being coupled to a data communication network , said first service being provided by a first network server also being coupled to the data communication network , said second service being provided by a second network server also being coupled to the data communication network , said method comprising:receiving a first request from the first network server to provide the first service in a first domain to the user, said user not authenticated for the first service and not authenticated for the second service when the first request is received;storing first data on the client in response to the received first request, said first data identifying that the first service desires to authenticate the user, said first data stored on the client further identifying that the user is not authenticated for the first service, and not authenticated for the second service when the first data is stored;allowing the user to access the first service without authenticating the user during which the user ...

Подробнее
Номер записи: 48
15-01-2015 дата публикации

TECHNIQUES FOR SYNCHRONOUS RECTIFICATION CONTROL OF DC-DC CONVERTERS IN ELECTRIFIED VEHICLES

Номер: US20150019055A1
Автор: Bai Hua, Duan Chen, GUO Wei, Householder Fred A., Krozek Dennis, Nie Zhong, Zhang Mengyang
Принадлежит:

Techniques are presented for synchronous rectification control (SRC) of a DC-DC converter in an electrified vehicle (EV) can include determining a required output current for the DC-DC converter based on a secondary voltage of a secondary battery system of the EV, the DC-DC converter being configured to convert a primary voltage from a primary battery system of the EV to the secondary voltage. The techniques can include determining, at the controller, a switching frequency for the DC-DC converter that causes the DC-DC converter to output the required output current. The techniques can include determining turn-on and turn-off delays of the DC-DC converter based on the required output current and the switching frequency using one or more look-up tables. The techniques can also include controlling the DC-DC converter efficiency based on the turn-on and turn-off delays. 1. A method , comprising:determining, at a controller of an electrified vehicle (EV), the controller including one or more processors, a required output current for a DC-DC converter based on a secondary voltage of a secondary battery system of the EV, the DC-DC converter being configured to convert a primary voltage from a primary battery system of the EV to the secondary voltage;determining, at the controller, a switching frequency for the DC-DC converter that causes the DC-DC converter to output the required output current;determining, at the controller, turn-on and turn-off delays of the DC-DC converter based on the required output current and the switching frequency using one or more look-up tables; andcontrolling, by the controller, the DC-DC converter based on the turn-on and turn-off delays.2. The method of claim 1 , further comprising determining claim 1 , at the controller claim 1 , an input current claim 1 , an output current claim 1 , an input voltage claim 1 , and an output voltage of the DC-DC converter in response to controlling the DC-DC converter based on the turn-on and turn-off delays. ...

Подробнее
Номер записи: 49
16-01-2020 дата публикации

LIFE EVALUATING DEVICE AND ROBOT SYSTEM

Номер: US20200016776A1
Автор: GUO Wei, Nakagawa Hiroshi
Принадлежит:

Provided is a life evaluating device that evaluates the life of a lubricant in a machine including a motor and a transmission mechanism that is lubricated by the lubricant and transmits power of the motor to a movable unit. The life evaluating device includes a motor-heat-value calculating unit that calculates a motor heat value on the basis of a current value of the motor, a frictional-heat-value calculating unit that calculates a frictional heat value in the transmission mechanism on the basis of rotating speed of the motor and a coefficient of friction of the transmission mechanism, a lubricant-temperature estimating unit that estimates temperature of the lubricant on the basis of the calculated frictional heat value and the calculated motor heat value, and a life estimating unit that estimates the life of the lubricant on the basis of the estimated temperature of the lubricant and information concerning impurities in the lubricant. 1. A life evaluating device that evaluates a life of a lubricant in a machine including at least one motor and at least one transmission mechanism that is lubricated by the lubricant and transmits power of the at least one motor to a movable unit , the life evaluating device comprising:a motor-heat-value calculating unit that calculates a motor heat value on the basis of a current value of the at least one motor;a frictional-heat-value calculating unit that calculates a frictional heat value in the at least one transmission mechanism on the basis of rotating speed of the at least one motor and a coefficient of friction of the at least one transmission mechanism;a lubricant-temperature estimating unit that estimates temperature of the lubricant on the basis of the frictional heat value calculated by the frictional-heat-value calculating unit and the motor heat value calculated by the motor-heat-value calculating unit; anda life estimating unit that estimates the life of the lubricant on the basis of the temperature of the lubricant ...

Подробнее
Номер записи: 50
16-01-2020 дата публикации

NOVEL ANTI-TRKB ANTIBODIES

Номер: US20200017590A1
Автор: GUO Wei, LU Bai, YAO Hongyang
Принадлежит:

Provided is an isolated TrkB agonist antibody that binds to an epitope contained in one of the extracellular domains of TrkB and is capable of activating TrkB, wherein the extracellular domains comprises extracellular D1, D2, D3, D4, D5 domains and juxtamembrane domain of TrkB. Methods of using the TrkB agonist antibody in treating or reducing the risk of a TrkB associated conditions in a subject, wherein said condition is selected from cell differentiation, synaptic development, neural injury repairing and/or neurite branching. 15-. (canceled)6. An isolated TrkB agonist antibody , comprising 3 heavy chain CDR sequences selected from the group consisting of 1) SEQ ID NOs: 12-14 , or a variant thereof having 1 , 2 or 3 amino acid modifications; 2) SEQ ID NOs: 18-20 , or a variant thereof having 1 , 2 or 3 amino acid modifications; 3) SEQ ID NOs: 24-26 , or a variant thereof having 1 , 2 or 3 amino acid modifications; 4) SEQ ID NOs: 32-34 , or a variant thereof having 1 , 2 or 3 amino acid modifications; 5) SEQ ID NOs: 40-42 , or a variant thereof having 1 , 2 or 3 amino acid modifications; 6) SEQ ID NOs: 48-50 , or a variant thereof having 1 , 2 or 3 amino acid modifications; 7) SEQ ID NOs: 56-58 , or a variant thereof having 1 , 2 or 3 amino acid modifications; 8) SEQ ID NOs: 64-66 , or a variant thereof having 1 , 2 or 3 amino acid modifications; or 9) SEQ ID NOs: 72-74 , or a variant thereof having 1 , 2 or 3 amino acid modifications , and/or3 light chain CDR sequences selected from the group consisting of 1) SEQ ID NOs: 9-11, or a variant thereof having 1, 2 or 3 amino acid modifications; 2) SEQ ID NOs: 15-17, or a variant thereof having 1, 2 or 3 amino acid modifications; 3) SEQ ID NOs: 21-23, or a variant thereof having 1, 2 or 3 amino acid modifications; 4) SEQ ID NOs: 29-31, or a variant thereof having 1, 2 or 3 amino acid modifications; or 5) SEQ ID NOs: 37-39, or a variant thereof having 1, 2 or 3 amino acid modifications; 6) SEQ ID NOs: 45-47, or a variant ...

Подробнее
Номер записи: 51
21-01-2021 дата публикации

CROWN IDENTIFICATION DEVICE, IDENTIFICATION METHOD, PROGRAM, AND RECORDING MEDIUM

Номер: US20210019496A1
Автор: GUO Wei, HIRAFUJI Masayuki, Mu Yue, NAGOSHI Yurika, NINOMIYA Seishi, OCHIAI Hiroaki, SEKIYA Kazuki, TAKATA Daisuke
Принадлежит:

The present invention provides a system for identifying individual crowns of individual fruit trees using aerial images. A crown identification device of the present invention includes an identification criterion determination unit and a crown identification unit . The identification criterion determination unit includes a first image acquisition section that acquires a first aerial image including a plurality of individual fruit trees in a deciduous period in a fruit farm field, a skeleton extraction section that processes the first aerial image to extract a whole crown skeleton including the plurality of individual fruit trees, a vertex extraction unit that extracts vertexes of each crown skeleton corresponding to each individual fruit tree, and an identification criterion extraction section that extracts a crown candidate region of a minimum polygonal shape including all the vertexes as an identification criterion for each individual fruit tree and extracts a centroid of the crown candidate region. The crown identification unit includes a second image acquisition section that acquires a second aerial image of the fruit tree farm field at the time of identifying a crown at the same scale as the first aerial image, a whole crown extraction section that processes the second aerial image to extract a whole crown image including the plurality of individual fruit trees, and a crown identification section that collates the crown candidate region and the centroid of the identification criterion with the whole crown image to identify a crown region of each individual fruit tree in the second aerial image. 1. An identification device for identifying a crown of an individual fruit tree in an image , the identification device comprising:an identification criterion determination unit anda crown identification unit; a first image acquisition section that acquires a first aerial image including a plurality of individual fruit trees in a deciduous period in a fruit farm field,', ...

Подробнее
Номер записи: 52
28-01-2016 дата публикации

DISPLAY PANEL, MANUFACTURING METHOD OF THE SAME, AND DISPLAY DEVICE

Номер: US20160026310A1
Автор: GUO Wei, Wang Can
Принадлежит:

A display panel includes a touch scanning electrode and a touch sensing electrode. One of the touch scanning electrode and the touch sensing electrode is provided with at least one separation layer therein or both the touch scanning electrode and the touch sensing electrode are provided with at least one separation layer therein respectively, and the at least one separation layer separates the touch scanning electrode or the touch sensing electrode which is provided with the at least one separation layer into at least two electrode sub-layers, wherein, the at least two electrode sub-layers are made of an electrode material capable of being transformed from an amorphous state into a polycrystalline state, and the at least one separation layer is used for preventing the electrode material from being subject to a crystallization reaction before a crystallization process. 114-. (canceled)15. A display panel including a touch scanning electrode and a touch sensing electrode , wherein , one of the touch scanning electrode and the touch sensing electrode is provided with at least one separation layer therein or both the touch scanning electrode and the touch sensing electrode are provided with at least one separation layer therein respectively , the at least one separation layer separates the touch scanning electrode or the touch sensing electrode which is provided with the at least one separation layer into at least two electrode sub-layers , the at least two electrode sub-layers are made of an electrode material capable of being transformed from an amorphous state into a polycrystalline state , and the at least one separation layer is used for preventing the electrode material from being subject to a crystallization reaction before a crystallization process.16. The display panel according to claim 15 , wherein claim 15 , the at least one separation layer is made of a metal conductive material having a low resistivity and a light transmittance equal to or greater than 60 ...

Подробнее
Номер записи: 53
24-04-2014 дата публикации

TRANS-REFLECTIVE LIQUID CRYSTAL DISPLAY ARRAY SUBSTRATE, MANUFACTURING METHOD THEREOF AND DISPLAY DEVICE

Номер: US20140111747A1
Автор: GUO Wei, Wang Can
Принадлежит: BOE Technology Group Co., Ltd.

A trans-reflective liquid crystal display array substrate and a manufacturing method thereof. The trans-reflective liquid crystal display array substrate () includes a substrate () and a thin film transistor () provided thereon. A black matrix () is provided on the thin film transistor () and a reflective layer () is located on the black matrix (). The brightness of the liquid crystal display panel is increased by enlarging the pixel aperture ratio. 1. A trans-reflective liquid crystal display array substrate , comprising a substrate and a thin film transistor provided on the substrate , wherein ,a black matrix and a reflective layer located on the black matrix are provided over the thin film transistor.2. The trans-reflective liquid crystal display array substrate according to claim 1 , wherein the reflective layer is electrically connected to a drain electrode of the thin film transistor.3. The trans-reflective liquid crystal display array substrate according to claim 1 , wherein a plurality of protrusions are formed on the black matrix.4. The trans-reflective liquid crystal display array substrate according to claim 1 , wherein the protrusions are formed in a region of the array substrate where the thin film transistor is located.5. The trans-reflective liquid crystal display array substrate according to claim 1 , wherein the reflective layer is conformally formed on the black matrix with protrusions in the region corresponding to the thin film transistor.6. The trans-reflective liquid crystal display array substrate according to claim 1 , wherein the reflective layer is a metal layer having a reflection effect.7. The trans-reflective liquid crystal display array substrate according to claim 1 , wherein material of the metal layer for forming the reflective layer is molybdenum or aluminum-neodymium.8. A trans-reflective liquid crystal display panel claim 1 , comprising the array substrate according to claim 1 , further comprising a color filter substrate opposed ...

Подробнее
Номер записи: 54
04-02-2016 дата публикации

ACCESSIBLE PROCESSING METHOD OF WEBPAGE CONTENTS AND ACCESSIBLE WEBPAGE DEVICE

Номер: US20160034432A1
Автор: GUO Wei, Jin Weijian, Li Liyong, LI YANG, Tang Xiaojun, Wen He, Zhang Xu
Принадлежит:

An accessible processing method of webpage contents and accessible webpage device are provided. The foregoing accessible processing method may include the follows. A document outline list tag is added to a webpage. After the document outline list tag obtains a focus, the following is further included. All title tags of a specified level in current webpage may be traversed. An anchor point may be added to each title tag of the specified level. Text information of each title tag of the specified level may be respectively copied to a corresponding link newly established. The link newly established may be enabled to point to an anchor point of a corresponding title label. Each link newly established may be taken as a list item. The list item may be added to the document outline list tag. 1. An accessible processing method of webpage contents , comprising:adding a document outline list tag to a webpage;wherein after the document outline list tag obtains a focus, the method further comprises:traversing all title tags of a specified level in a webpage;adding an anchor point to each title tag of the specified level;respectively copying text information of the each title tag of the specified level to a corresponding link newly established;enabling the link newly established to point to an anchor point of a corresponding title tag;taking each link newly established as a list item; andadding the list item to the document outline list tag.2. The method according to claim 1 , further comprising:setting an accessible semantic identity (ID) in the document outline list tag, wherein contents of the accessible semantic ID comprise operation instructions of a document outline.3. The method according to claim 1 , wherein adding the document outline list tag to the webpage comprises:adding the document outline list tag to a navigation position of the webpage.4. The method according to claim 1 , further comprising:setting an attribute value of a shortcut key of a tag in the document ...

Подробнее
Номер записи: 55
04-02-2021 дата публикации

MANAGING HOST SPAN INFORMATION FOR LOGICAL ENTITIES IN SOFTWARE DEFINED NETWORKS

Номер: US20210036924A1
Автор: GUO Wei, Lin Yanjun, PING Yang, Sun Li
Принадлежит:

Described herein are systems and methods to manage and identify host spans of logical entities in software defined networks. In one example, a control system may identify a first graph that includes nodes that represent logical entities and hosts and further includes directional edges that represent a topology of the logical entities and hosts. The control system further identifies groups of strongly connected components in the first graph and generates a second graph based on the identified groups. The second graph includes nodes that represent the groups and any nodes of the first graph not included in the groups, and further includes directional edges that indicate a topology of the nodes. The control system may then follow the directional edges of the second graph to allocate host spans to the logical entities represented in the nodes. 1. A method comprising:identifying a first graph, wherein the first graph comprises nodes that represent one or more hosts and one or more logical entities of a software defined network, and wherein the first graph further comprises directional edges that indicate a topology of the nodes in the first graph;identifying one or more groups of strongly connected components in the first graph;generating a second graph based on the identified one or more groups, wherein the second graph comprises nodes that represent the one or more groups and any nodes of the first graph not included in the one or more groups, and wherein the second graph further comprises directional edges that indicate a topology of the nodes in the second graph; andidentifying a host span for each of the nodes in the second graph based on the directional edges of the second graph.2. The method of claim 1 , wherein the logical entities comprise one or more logical switches or logical routers.3. The method of further comprising generating the first graph based on a user generated network configuration for the software defined network and host status reports claim 1 , ...

Подробнее
Номер записи: 56
18-02-2021 дата публикации

SPIRO COMPOUND AS INDOLEAMINE-2,3-DIOXYGENASE INHIBITOR

Номер: US20210047290A1
Автор: CHAI Yongshuai, GUO Wei, Wang Zhaoyin
Принадлежит:

Disclosed in the present invention are an indoleamine-2,3-dioxygenase inhibitor and a preparation method therefor. The inhibitor of the present invention has a structure as represented by general formula (I), wherein the definitions of Ar, E, Y, X, V, D, W, B, ring A and ring B are as shown in the description and claims. Also disclosed in the present invention is a preparation method for the inhibitor. The compound of general formula (I) of the present invention can be used as an indoleamine-2,3-dioxygenase inhibitor for preparing a medicament for preventing and/or treating indoleamine-2,3-dioxygenase-mediated diseases. 13. The compound of Formula (I) described in is characterized in that the compound is:(±) N-(4-chlorophenyl)-6-(quinoline-4-yl)spiro[3.3]heptane-2-carboxamide;(±) (cis/trans) N-(4-chlorophenyl)-6-(quinoline-4-yl)spiro[2.5]octane-1-carboxamide;(±) N-(4-chlorophenyl)-6-(6-fluoroquinoline-4-yl)spiro[3.3]heptane-2-carboxamide;(±) (cis/trans) N-(4-chlorophenyl)-6-(6-fluoroquinoline-4-yl)spiro[2.5]octane-1-carboxamide;(±) (cis/trans) N-(4-chlorophenyl)-6-(6-fluoroquinoline-4-yl)spiro[2.5]octane-1-carboxamide;(±) (cis/trans) 6-(6-fluoroquinoline-4-yl)-N-(4-(trifluoromethyl)phenyl)spiro[2.5]octane-1-carboxamide(±) (cis/trans) 6-(6-fluoroquinoline-4-yl)-N-phenyl spiro[2.5]octane-1-carboxamide(±) (cis/trans) 4-chlorine-N-(6-(6-fluoroquinoline-4-yl)spiro[2.5]octane-1-yl)benzamide(±) (cis/trans) 1-(4-chlorophenyl)-3-(6-(6-fluoroquinoline-4-yl)spiro[2.5]-octane-1-yl) urea(±) N-(4-chlorophenyl)-7-(6-fluoroquinoline-4-yl)spiro[3.5]nonane-1-carboxamide(±) 1-(4-chlorophenyl)-3-(7-(6-fluoroquinoline-4-yl)spiro[3.5]) nonane-1-yl) urea(±) 4-chlorine-N-(7-(6-fluoroquinoline-4yl)spiro[3.5]nonane-1-yl)benzamide(±) 4-chlorine-N-(7-(6-fluoroquinoline-4yl)spiro[3.5]nonane-1-yl)benzsulfamide(±) N-(3-bromophenyl)-7-(6-fluoroquinoline-4-yl)spiro[3.5]nonane-1-carboxamideN-(4-chlorophenyl)-7-(6-fluoroquinoline-4-yl)spiro[3.5]nonane-2-carboxamide (enantiomer 1)N-(4-chlorophenyl)-7 ...

Подробнее
Номер записи: 57
16-02-2017 дата публикации

SYSTEM THAT CONVERTS BETWEEN WIRELESS OPERATION AND WIRED OPERATION

Номер: US20170043246A1
Автор: GUO Wei, Lum Richard
Принадлежит:

A system communicates with a device in both a wired mode and a wireless mode, and is able to switch between these two modes without permanent disruption to an ongoing use. The system is configured to receive an indication of a condition that suggests switching from the wireless mode of operation to a wired mode of operation, to display a notification for the device to switch, and to transition from the wireless mode of operation to the wired mode of operation. 120-. (canceled)21. A method implemented by a controller comprising:monitoring, at the controller, power supply data associated with a controller power supply;detecting, based at least in part on the monitoring, a condition that suggests switching from a wireless mode of operation to a wired mode of operation during use of the controller;sending, based on the condition and to a console, data corresponding to the condition that suggests switching from the wireless mode of operation to the wired mode of operation;transitioning from the wireless mode of operation to the wired mode of operation; andbased at least in part on transitioning from the wireless mode of operation to the wired mode of operation, sending a session identification to the console thereby causing the console to re-associate the controller with saved data, the saved data being generated during the use of the controller before the transitioning from the wireless mode of operation to the wired mode of operation.22. The method as recited in claim 21 , wherein the condition is based at least in part on the controller power supply being low.23. The method as recited in claim 21 , wherein the condition is based at least in part on a loss of packets transmitted during the use of the controller in the wireless mode of operation.24. The method as recited in claim 21 , wherein the condition is based at least in part on a determination that packets transmitted during the use of the controller in the wireless mode of operation contain incorrect data.25. ...

Подробнее
Номер записи: 58
24-02-2022 дата публикации

ELECTRICAL CONNECTOR FOR A CONTROLLER

Номер: US20220059960A1
Автор: GUO Wei, Li Haitao, Mu Yong, Wang Kun, Zhang Ke, ZHANG Yingjie, Zheng Michael, Zheng Xinyan
Принадлежит:

An electronic device including a plurality of ports for electrically connecting the device to another device. The electronic device may include a housing including a front, a back and at least a first side and an opposing second side extending between the front and the back, a printed circuit board housed by the housing, and an electrical connector electrically connected to the printed circuit board. The electrical connector may include a first spring contact, a second spring contact, and an electrically conductive bridge mechanically and electrically connecting the first spring contact and the second spring contact. The electrically conductive bridge may be housed by the housing. The first and second spring contacts may extend outside of the housing and may be accessible from the first and second sides of the housing, respectively. 1. A controller comprising:a housing including a front, a back and at least a first side and an opposing second side extending between the front and the back;a printed circuit board housed by the housing, the printed circuit board including two opposing major surfaces with a side wall extending between the two opposing major surfaces, the printed circuit board situated in the housing with a first of the two opposing major surfaces facing the back of the housing a second of the two opposing major surfaces facing the front of the housing;a first spring contact electrically coupled to the printed circuit board, the first spring contact extending outside and away from the first side of the housing; anda second spring contact electrically coupled to the printed circuit board, the second spring contact extending outside and away from the second side of the housing.2. The controller of claim 1 , wherein the housing is configured to be mounted to a DIN rail with the back of the housing facing the DIN rail.3. The controller of claim 1 , wherein the printed circuit board is completely housed within the housing.4. The controller of claim 1 , ...

Подробнее
Номер записи: 59
18-02-2016 дата публикации

STARTING AN APPLICATION ON A MOBILE DEVICE

Номер: US20160048675A1
Автор: Chai Hongfeng, GUO Wei, He Shuo, Li Dinagzhou, Lu Zhijun, Zhou Yu
Принадлежит:

The invention relates to management of programs on a mobile device, and in particular, to a method for activating application programs on a mobile device, and a mobile device based on this method. The method for activating application programs on a mobile device according to an embodiment of the invention comprises the following steps: receiving an application request from a device which is located outside the mobile device; identifying a transmission protocol associated with the application request; and if there are a plurality of safety entities in the mobile device which support the transmission protocol and store application programs associated with the application request, activating an application program associated with the application request in a default safety entity. 1. A method for activating application programs on a mobile device , characterized in that the method comprises the following steps:receiving an application request from a device which is located outside the mobile device;identifying a transmission protocol associated with the application request; andif there are a plurality of safety entities in the mobile device which support the transmission protocol and store application programs associated with the application request, activating an application program associated with the application request in a default safety entity.2. The method for processing according to claim 1 , wherein the transmission protocol is based on near field communication technology claim 1 , Bluetooth technology and WiFi technology.3. The method for processing according to claim 1 , wherein each of the application programs is given a unique identifier in the mobile device.4. The method for processing according to claim 1 , wherein a correlation between the safety entity and the transmission protocol which it supports is stored in the mobile device in a form of list.5. The method for processing according to claim 1 , wherein a correlation between the application program ...

Подробнее
Номер записи: 60
18-02-2016 дата публикации

SECURITY INFORMATION INTERACTION SYSTEM, DEVICE AND METHOD BASED ON ACTIVE COMMAND OF SECURE CARRIER

Номер: US20160050232A1
Автор: Chai Hongfeng, GUO Wei, He Shuo, Li Dingzhou, Lu Zhijun, Zhou Yu
Принадлежит:

The invention proposes a security information interaction system, apparatus and method based on security carrier's active command. The method comprises: an information interaction terminal, based on a user's command, establishes a security dialogue channel between the information interaction terminal and a security carrier so as to perform a security information interaction process, wherein the user's command indicates a target application associated with the security information interaction process; and the security carrier activates the target application during the establishment of the security dialogue channel and then executes the security information interaction process based on the security dialogue channel. In the security information interaction system, apparatus and method based on security carrier active command disclosed in the invention, the security carrier can initiate an active command to the information interaction terminal. 1. A security information interaction system based on security carrier's active command , comprising:an information interaction terminal which, based on a user's command, establishes a security dialogue channel between the information interaction terminal and the security carrier so as to perform a security information interaction process, wherein the user's command indicates a target application associated with the security information interaction process; anda security carrier which activates the target application when the security dialogue channel is established and then executes the security information interaction process based on the security dialogue channel.2. The security information interaction system based on security carrier's active command according to claim 1 , characterized in that during the procedure of executing the security information interaction process claim 1 , the security carrier can send a security carrier active command to the information interaction terminal so as to use the particular function of ...

Подробнее
Номер записи: 61
25-02-2021 дата публикации

STENT GRAFT USED FOR INTERVENTIONAL TREATMENT OF ABDOMINAL AORTIC DISEASES

Номер: US20210052364A1
Автор: GUO Wei, LI Anwei, Wang Yongsheng
Принадлежит:

The invention discloses a stent graft used for interventional treatment of abdominal aortic disease, comprising a tube body composed of a tubular covering and a plurality of annular stents, and the tube body comprises a first tube body and a second tube body that arranged in sequence from the proximal end to the distal end, wherein the diameter of the first tube body is greater than diameter of the second tube body; the first tube body and the second tube body are connected by a transition section as a whole; the diameter at central part of the transition section is smaller than the diameter of the proximal end of the transition section and the diameter of the distal end of the transition section; a plurality of fenestrations are disposed on the first tube body and the transition section. The invention provides a stent graft having a smaller diameter of the portion near the branch vessels or branch stents after released, and has more space for accommodating branch vessels or branch stents for interventional treatment of abdominal aortic diseases. 1. A stent graft used for interventional treatment of abdominal aortic disease , comprising a tubular body composed of a tubular covering and a plurality of annular stents , wherein the tubular body comprises a first tube body and a second tube body that arranged in sequence from the proximal end to the distal end , and the diameter of the first tube body is greater than the diameter of the second tube body;the first tube body and the second tube body are connected by a transition section as a whole; the diameter at central part of the transition section is smaller than the diameter of the proximal end and the diameter of the distal end of the transition section;a plurality of fenestrations are disposed on the first tube body and the transition section.2. The stent graft used for interventional treatment of abdominal aortic disease according to claim 1 , wherein the fenestrations comprise front wall fenestrations and side ...

Подробнее
Номер записи: 62
14-02-2019 дата публикации

TESTING SYSTEM FOR AN ELECTRICAL CABLE

Номер: US20190049504A1
Автор: ALLEN Christopher John, AMARASINGHE Saluka Abhishek, Giaimo, GUO Wei, III Edward Charles, MAJOR Attila, PATEL Sanketkumar Natvarbhai, TABER Andrew Smith
Принадлежит:

A testing system may include an electrical cable, a computing device, a communication interface, at least one downstream device, and testing software. The communication interface may be coupled to the electrical cable and to the computing device. The at least one downstream device may be coupled to the electrical cable. The testing software may be stored on the computing device. The testing software may be configured to initiate and evaluate transfer of data between the computing device and the at least one downstream device through the electrical cable and the communication interface. 1. A testing system , comprising:an electrical cable;a computing device;a communication interface coupled to the computing device;at least one upstream signal degradation component coupled to the electrical cable and to the communication interface;at least one downstream device;at least one downstream signal degradation component coupled to the electrical cable and to the at least one downstream device; andtesting software stored on the computing device, the testing software being configured to initiate and evaluate transfer of data between the computing device and the at least one downstream device through the electrical cable and the communication interface.2. The testing system of claim 1 , wherein the at least one downstream device comprises:a data reception module configured to receive the data from the computing device; anda data transmission module configured to send the data back to the computing device.3. The testing system of claim 1 , wherein:the at least one upstream signal degradation component comprises upstream signal attenuation circuitry and upstream extension cables; andthe at least one downstream signal degradation component comprises downstream signal attenuation circuitry and downstream extension cables.4. The testing system of claim 1 , wherein:the testing software is configured to initiate transfer of the data from the computing device to the at least one ...

Подробнее
Номер записи: 63
04-03-2021 дата публикации

VENOUS VALVE REPLACEMENT DEVICE

Номер: US20210059819A1
Автор: GUO Wei, Li Jianmin, Qiu Jiaming, Wang Yongsheng
Принадлежит:

A venous valve replacement device includes a stent with a blood flow channel and two leaflets connected to the stent, wherein one side of each leaflet is configured as a fixed edge connected with the stent, and the other side is configured as a movable edge, and wherein the movable edges of the two leaflets cooperates with each other to open or close the blood flow channel, and the movable edges of the two leaflets are provided with flaps that attach to each other in a closed configuration 1. A venous valve replacement device , comprising a stent with a blood flow channel and two leaflets connected to the stent , wherein one side of each leaflet is configured as a fixed edge connected with the stent , and the other side is configured as a movable edge , and wherein the movable edges of the two leaflets cooperates with each other to open or close the blood flow channel , and the movable edges of the two leaflets are provided with flaps that attach to each other in a closed configuration.270-. (canceled)71. The venous valve replacement device according to claim 1 , wherein the flap protrudes from the corresponding movable edge claim 1 , and wherein the middle portion of the movable edge protrudes toward the fixed edge or protrudes away from the fixed edge claim 1 , and the apex of the protruding portion is the apex of the movable edge.72. The venous valve replacement device according to claim 1 , wherein the fixed edge is shaped as a parabola claim 1 , wherein the apex is located at the upstream of the normal blood flow claim 1 , and the fixed edge gradually extends towards the downstream of the normal blood flow from the apex on both sides.73. The venous valve replacement device according to claim 71 , wherein the same leaflet is provided with two flaps claim 71 , and the two flaps are respectively located on both sides of the apex of the movable edge.74. The venous valve replacement device according to claim 1 , wherein in the closed configuration claim 1 , the ...

Подробнее
Номер записи: 64
03-03-2016 дата публикации

METHOD FOR IMPLEMENTING VIRTUAL SECURE ELEMENT

Номер: US20160062784A1
Автор: Chai Hongfeng, GUO Wei, He Shuo, Li Dingzhou, Lu Zhijun, Zhou Yu
Принадлежит: CHINA UNIONPAY CO., LTD.

The invention discloses a method for realizing virtual secure element (VSE), which comprises the following steps: a secure element manager (SEM) generates a request which comprises virtualized configuration information; and a virtual machine monitor in a hypervisor allocates an address space for the VSE according to the above request. 1. A method for realizing virtual secure element (VSE) , characterized by comprising the following steps:a secure element manager (SEM) generates a request which comprises virtualized configuration information; anda virtual machine monitor VMM in a hypervisor allocates an address space for the VSE according to the above request.2. The method according to claim 1 , characterized in that claim 1 ,before the SEM generates the request, the SEM uses a secure key to conduct a secure verification on the credibility of the current operating system.3. The method according to claim 2 , characterized in that claim 2 ,the virtualized configuration information comprises chip operating system (COS) of VSE, storage space capacity of VSE and personalized data of VSE, andthe SEM configures the COS and personalized data for the VSE.4. The method according to claim 3 , characterized in that claim 3 ,the hypervisor records the address information allocated for the VSE.5. A method for realizing virtual secure element (VSE) claim 3 , characterized by comprising the following steps:a secure element manager (SEM) generates a request which comprises virtualized configuration information; anda memory management unit (MMU) allocates an address space for the VSE according to the above request.6. The method according to claim 5 , characterized in that claim 5 ,before the SEM generates the request, the SEM uses a secure key to conduct a secure verification on the credibility of the current operating environment.7. The method according to claim 6 , characterized in that claim 6 ,the virtualized configuration information comprises chip operating system (COS) of VSE, ...

Подробнее
Номер записи: 65
03-03-2016 дата публикации

METHOD AND SYSTEM FOR EFFICIENT PASSWORD INPUT

Номер: US20160065562A1
Автор: GUO Wei
Принадлежит: ALIBABA GROUP HOLDING LIMITED

Embodiments of the present application disclose a method for receiving password input from a user. During operation, the system receives, by a computing device, user input indicating that a user is entering a password. The system displays a plurality of shortcut keyboards of a keyboard sequence in successive order based on an arrangement of characters in the password. The system displays a first shortcut keyboard with a first key labeled with at least a first character of the password prior to displaying a second shortcut keyboard with a second key labeled with one or more characters positioned subsequent to the first character in the password. The system then receives input from the user selecting at least one key of each shortcut keyboard from the plurality of shortcut keyboards, and determines the password entered by the user based on the characters entered by the user through the key selections. 1. A computer-implemented method for receiving password input from a user , comprising:receiving, by a computing device, user input indicating that a user is entering a password;displaying a plurality of shortcut keyboards of a keyboard sequence in successive order based on an arrangement of characters in the password, wherein a first shortcut keyboard with a first key labeled with at least a first character of the password is displayed prior to displaying a second shortcut keyboard with a second key labeled with one or more characters positioned subsequent to the first character in the password;receiving input from the user selecting at least one key of each shortcut keyboard from the plurality of shortcut keyboards; anddetermining the password entered by the user based on the characters entered by the user through the key selections.2. The method of claim 1 , further comprising:generating the keyboard sequence corresponding to the password based on the password input from the user, wherein the keyboard sequence comprises at least two shortcut keyboards.3. The method of ...

Подробнее
Номер записи: 66
10-03-2016 дата публикации

DETECTOR DEVICE FOR FUNCTIONAL CERTIFICATION

Номер: US20160069952A1
Автор: Huang Guo-Wei, Shiao Yu-Shao
Принадлежит:

A detector device for functional certification includes a probe, a waveguide and a first micro-antenna. The probe includes a tip portion and a through-portion, wherein an end of the through-portion penetrates a first surface of the probe to form a first opening, and an opposite end of the through-portion penetrates the tip portion to form a second opening. The waveguide is disposed in the through-portion. The first micro-antenna is installed in the second opening and electrically connected with the waveguide. 1. A detector device for functional certification comprising:a probe including a tip portion and a through-portion, wherein an end of the through-portion penetrates a first surface of the probe to form a first opening, and an opposite end of the through-portion penetrates the tip portion to form a second opening;a waveguide disposed in the through-portion; anda first micro-antenna installed in the second opening and electrically connected with the waveguide.2. The detector device according to claim 1 , wherein the first micro-antenna is a horn micro-antenna.3. The detector device according to claim 2 , wherein the probe further includes a second surface claim 2 , wherein the first surface has a first edge and a second edge opposite to the first edge claim 2 , the second surface has the second edge and a third edge opposite to the second edge claim 2 , wherein the first edge is longer than the second edge claim 2 , the second edge is longer than the third edge.4. The detector device according to claim 3 , wherein the probe further includes a third surface and a fourth surface claim 3 , wherein the third surface and the second surface jointly have the third edge claim 3 , and the third surface and the fourth surface jointly have the a fourth edge opposite to the third edge claim 3 , wherein the first surface and the fourth surface have the same extending direction claim 3 , and the third surface and the fourth surface are corporately formed as the tip portion.5. ...

Подробнее
Номер записи: 67
28-02-2019 дата публикации

ORGANIC LIGHT EMITTING DIODE PACKAGE STRUCTURE, ELECTRONIC DEVICE AND PACKAGING METHOD

Номер: US20190067631A1
Автор: CAO Zhonglin, Chen Shiqi, GUO Wei, XU Yuanjie, ZANG Pengcheng
Принадлежит:

An organic light emitting diode package structure, an electronic device and a packaging method are disclosed. The organic light emitting diode package structure includes a first substrate, a second substrate, and an organic light emitting diode device. The second substrate is disposed opposite to the first substrate. The organic light emitting diode device is disposed between the first substrate and the second substrate. At least one of the first substrate and the second substrate is provided with a groove, and the groove is disposed on the surface of the first substrate facing the second substrate or/and the surface of the second substrate facing the first substrate. The organic light emitting diode device is sealed in the groove. 1. An organic light emitting diode package structure comprising:a first substrate;a second substrate opposite to the first substrate; andan organic light emitting diode device disposed between the first substrate and the second substrate,wherein a groove is disposed on at least one of the first substrate and the second substrate, the groove is disposed on at least one of a surface of the first substrate facing the second substrate and a surface of the second substrate facing the first substrate, and the organic light emitting diode device is sealed in the groove.2. The organic light emitting diode package structure of claim 1 , wherein the groove comprises a first groove disposed on the first substrate claim 1 , and the organic light emitting diode device is disposed in the first groove.3. The organic light emitting diode package structure of claim 1 , wherein the groove comprises a first groove disposed on the first substrate claim 1 , and a second groove disposed on the second substrate at a position corresponding to the first groove claim 1 , and the first groove and the second groove are opposite to each other claim 1 , andwherein at least a first part of the organic light emitting diode device is located in the first groove.4. The ...

Подробнее
Номер записи: 68
28-02-2019 дата публикации

POWER MODULE ASSEMBLY AND ASSEMBLING METHOD THEREOF

Номер: US20190069438A1
Автор: GUO Wei, SUN Hao, YOU Peiai
Принадлежит:

The present disclosure provides a power module assembly and an assembling method thereof. The power module assembly includes a housing, a circuit board, at least one resilient set, at least two power devices, and at least one fastening unit. The housing includes at least one heat-dissipation surface. The at least one resilient set is disposed between the housing and the circuit board and includes at least one resilient piece. Each resilient piece includes a base section and two pushing fingers, so as to form an M-word shape or a bird-wings shape. The fastening unit is disposed between the two power devices, connected to the base section of the resilient piece and configured to drive the base section of the resilient piece, so that the two pushing fingers of the resilient piece push against the two power devices respectively and the two power devices are attached to the heat-dissipation surface. 1. A power module assembly comprising:a housing including at least one heat-dissipation surface;a circuit board configured to mount on the housing, wherein the circuit board comprises at least one first through hole;at least one resilient set disposed between the housing and the circuit board, wherein the resilient set comprises at least one resilient piece and each resilient piece comprises a base section and two pushing fingers, wherein the two pushing fingers are outwardly extended from two opposite edges of the base section respectively;at least two power devices electrically connected to the circuit board and located between the resilient set and the heat-dissipation surface of the housing, wherein the two power devices are opposite to the two pushing fingers of the resilient piece respectively; andat least one fastening unit disposed between the two power devices, connected to the base section of the resilient piece through the first through hole and driving the base section of the resilient piece, so that the two pushing fingers of the resilient piece push against the ...

Подробнее
Номер записи: 69
15-03-2018 дата публикации

Aneurysm Treatment Method

Номер: US20180071076A1
Автор: GUO Wei, Li Wuyang, LIU Caiping, XIAO Benhao, ZHANG Deyuan
Принадлежит: LIFETECH SCIENTIFIC (SHENZHEN) CO., LTD.

A method for treating an aneurysm with at least one branch blood vessel branched from a diseased aorta comprises implanting an aortic stent graft and an auxiliary stent into a diseased blood vessel to isolate the aneurysm, wherein the auxiliary stent comprises a bifurcated stent graft, one end of the aortic stent graft is attached to the wall of a healthy blood vessel upstream of the aneurysm, and the auxiliary stent comprises a body portion and a branch portion communicated with the body portion, one end of the body portion is communicated with a healthy blood vessel downstream of the aneurysm, the other end of the body portion is communicated with the aortic stent graft, and the branch portion is suspended within the diseased blood vessel. A straight stent graft is advanced towards the branch portion from the location downstream of the bifurcated stent graft and deployed to communicate the branch portion and the branch blood vessel. 1. A method for treating an aneurysm , the aneurysm located at a diseased aorta and at least one branch blood vessel branched from the diseased aorta , characterized in that the treatment method comprises:successively implanting an aortic stent graft and an auxiliary stent into a diseased blood vessel to isolate the aneurysm, wherein the auxiliary stent comprises a bifurcated stent graft, one end of the aortic stent graft is attached to the wall of a healthy blood vessel upstream of the aneurysm, and the auxiliary stent comprises a body portion and a branch portion communicated with the body portion, one end of the body portion is communicated with a healthy blood vessel downstream of the aneurysm, the other end of the body portion is communicated with the aortic stent graft, and the branch portion is suspended within the diseased blood vessel;advancing a straight stent graft towards the branch portion from a location downstream of the bifurcated stent graft; anddeploying the straight stent graft to communicate the branch portion and ...

Подробнее
Номер записи: 70
27-02-2020 дата публикации

User Plane Link Establishment Method, Base Station, And Mobility Management Device

Номер: US20200068466A1
Автор: GUO Wei, XU Lan
Принадлежит:

The present disclosure relates to user plane link establishment methods. One example method includes sending, by a first base station, an obtaining request associated with user equipment to a second base station, receiving, by the first base station, a response message corresponding to the obtaining request, where the response message includes a peer address associated with the user equipment, and establishing, by the first base station and based on the peer address, a user plane link corresponding to the user equipment. 1. A user plane link establishment method , comprising:sending, by a first base station, an obtaining request associated with user equipment to a second base station;receiving, by the first base station, a response message corresponding to the obtaining request, wherein the response message comprises a peer address associated with the user equipment; andestablishing, by the first base station and based on the peer address, a user plane link corresponding to the user equipment.2. The method according to claim 1 , wherein the response message comprises an extension information element claim 1 , and wherein the extension information element is used to indicate the peer address.3. The method according to claim 2 , wherein the extension information element is uplink general packet radio service (GPRS) tunneling protocol (GTP) tunnel node information.4. The method according to claim 2 , wherein the response message comprises context information of the user equipment claim 2 , and wherein the extension information element is an information element in the context information.5. The method according to claim 1 , wherein the peer address comprises an Internet protocol (IP) address of a serving gateway (SGW).6. A user plane link establishment method claim 1 , comprising:receiving, by a second base station, an obtaining request associated with user equipment sent by a first base station;determining, by the second base station, a peer address associated with the ...

Подробнее
Номер записи: 71
07-03-2019 дата публикации

PREPARATION METHOD OF A FORMAMIDE COMPOUND

Номер: US20190071391A1
Автор: GUO Wei, Tang Chenghan, Wei Anxing, Zhao Yunjian
Принадлежит:

The present application provides a preparation method of a formamide compound, the preparation process includes: uniformly mixing raw material of methanoic acid and an amine compound selected from a primary amine or a secondary amine to prepare a homogeneous reaction system; the above homogeneous reaction system is heated to 160-230° C., allowing carbon monoxide to be decomposed from the homogeneous reaction system and participates in the reaction, and collecting the reaction product to obtain a formamide compound. The present application provides a new technology using a homogeneous method to synthesize a formamide compound, the reaction process needs no use of a catalyst, the operation process is simple and controllable, and the raw material of the amine compound has a high selectivity. 1. A preparation method of formamide compound , comprising:mixing raw materials of methanoic acid and an amine compound selected from a primary amine or a secondary amine to prepare a homogeneous reaction system;heating the homogeneous reaction system to 160-230° C., to allow carbon monoxide to be decomposed from the homogeneous reaction system and to take part in reaction, and collecting reaction product to obtain the formamide compound.2. The preparation method according to claim 1 , wherein the homogeneous reaction system is heated to 160-230° C. to allow pressure in the homogeneous reaction system to rise to 1.0-3.0 MPa claim 1 , keeping reaction for 1-5 hours claim 1 , and collecting the reaction product.3. The preparation method according to claim 1 , wherein the homogeneous reaction system contains a solvent claim 1 , which is water or a solvent miscible with water claim 1 , or a solvent immiscible with water but miscible with the generated formamide compound.4. The preparation method according to claim 3 , wherein the solvent is water formed during preparing the homogeneous reaction system from methanoic acid and the amine compound claim 3 , and/or water added during ...

Подробнее
Номер записи: 72
15-03-2018 дата публикации

ICT PROBE CONTACT IMPROVEMENT

Номер: US20180074094A1
Автор: GUO Wei, Hou Yanlong, Zhang Weifeng, Zhao Lin
Принадлежит:

A method of testing a printed circuit board (PCB) with an in-circuit test (ICT) probe having an improved probe-to-via contact is provided. The ICT probe includes a tip attached to a spindle; a housing having a cavity, a portion of the spindle insertable into the cavity; and a heating element wrapped helically around the spindle, the heating element coupled to the housing. The probe is contacted with a surface of a flux layer of a test via of the PCB, said contact compressing the heating element and recessing the insertable portion of the spindle into the cavity. The tip of the probe is heated with the heating element to a temperature capable of at least partially melting the flux layer, the tip at least partially penetrating the flux layer to contact a surface of a solder plugging the test via. 1. A method for in-circuit testing a printed circuit board (PCB) , the method comprising: a tip attached to a spindle;', 'a housing having a cavity, a portion of the spindle insertable into the cavity;', 'a heating element wrapped helically around the spindle, the heating element coupled to the housing;, 'providing a probe comprisingcontacting a surface of a flux layer of a test via of the PCB with the probe, said contact compressing the heating element and recessing the insertable portion of the spindle into the cavity; andheating the tip of the probe with the heating element to a temperature capable of at least partially melting the flux layer, the tip at least partially penetrating the flux layer to contact a surface of a solder plugging the test via.2. The method of claim 1 , wherein heating the tip of the probe further comprises passing a current through the heating element.3. The method of claim 2 , further comprising controlling the current through the heating element such that the temperature of the tip is lower than a melting point of the solder.4. The method of claim 3 , wherein controlling the current further comprises:coupling the heating element to a temperature ...

Подробнее
Номер записи: 73
15-03-2018 дата публикации

SYSTEMS AND METHODS FOR CONSTANT CURRENT CONTROL WITH PRIMARY-SIDE SENSING AND REGULATION IN VARIOUS OPERATION MODES

Номер: US20180076717A1
Автор: Fang Lieyi, Lin Guo Wei
Принадлежит:

System and method for regulating a power converter. The system includes a first signal processing component configured to receive at least a sensed signal and generate a first signal. The sensed signal is associated with a primary current flowing through a primary winding coupled to a secondary winding for a power converter. Additionally, the system includes a second signal processing component configured to generate a second signal, an integrator component configured to receive the first signal and the second signal and generate a third signal, and a comparator configured to process information associated with the third signal and the sensed signal and generate a comparison signal based on at least information associated with the third signal and the sensed signal. 125.-. (canceled)26. A system for regulating a power converter , the system comprising:a first sampling-and-holding and voltage-to-current-conversion component configured to receive at least a sensed signal and generate a first current signal, the sensed signal being associated with a primary current flowing through a primary winding coupled to a secondary winding for a power converter;a second sampling-and-holding and voltage-to-current-conversion component configured to receive at least the sensed signal and generate a second current signal;a current-signal generator configured to generate a third current signal;a capacitor coupled to the current-signal generator and coupled, through a switch, to the first sampling-and-holding and voltage-to-current-conversion component and the second sampling-and-holding and voltage-to-current-conversion component, the capacitor being configured to generate a voltage signal;a comparator configured to process information associated with the voltage signal and a ramping signal and generate a comparison signal based on at least information associated with the voltage signal and the ramping signal;a modulation-signal generator configured to receive at least the comparison ...

Подробнее
Номер записи: 74
17-03-2016 дата публикации

SECURITY INFORMATION INTERACTION SYSTEM, DEVICE AND METHOD

Номер: US20160080503A1
Автор: Chen Chengqian, GUO Wei, Zhou Yu
Принадлежит: CHINA UNIONPAY CO., LTD.

The invention discloses a security information interaction system, apparatus and method, the method comprising the following steps: establishing a first communication channel and a second communication channel between a security information interaction terminal and a security carrier; the security carrier actively sending a command to the security information interaction terminal via the first communication channel and the second communication channel so as to complete a corresponding security information interaction procedure. With the security information interaction system, apparatus and method disclosed by the invention, the security carrier can send a command to the security information interaction terminal flexibly and actively on its own, and thus greatly improving the efficiency of the security information interaction system. 1. A security information interaction system comprising a security information interaction terminal and a security carrier , wherein the security carrier actively sends a command to the security information interaction terminal via a first communication channel and a second communication channel established between the security information interaction terminal and the security carrier so as to complete a corresponding security information interaction procedure.2. The security information interaction system according to claim 1 , characterized in that when the security carrier need to actively send a command to the security information interaction terminal claim 1 , the security carrier sends a notification event message to the security information interaction terminal via the first communication channel so as to initiate a session between the security information interaction terminal and the security carrier.3. The security information interaction system according to claim 2 , characterized in that after receiving the notification event message claim 2 , the security information interaction terminal sends a command reading instruction ...

Подробнее
Номер записи: 75
26-03-2015 дата публикации

Display Device Settings

Номер: US20150084976A1
Автор: GUO Wei, He Yi, Tantasirikorn Thitipant
Принадлежит: MICROSOFT CORPORATION

Display device settings are described. In one or more implementations, an apparatus includes a display device and a display settings control module. The display device has a plurality of display settings, at least one of the display settings is adjustable to one of a plurality of different display setting levels. The display setting control module is implemented at least partially in hardware and configured to expose functionality having a plurality of different user selectable levels, the user selectable levels arranged in a plurality of intervals in which, user selectable levels in a corresponding said interval are successively spaced apart from each other at increasing amounts, one to another. 1. An apparatus comprising:a display device having a plurality of display settings, at least one said display setting adjustable to one of a plurality of different display setting levels; anda display settings control module implemented at least partially in hardware, the display settings control module configured to expose functionality having a plurality of different user selectable levels, the user selectable levels arranged in a plurality of intervals in which, user selectable levels in a corresponding said interval are successively spaced apart from each other at increasing amounts, one to another.2. An apparatus as described in claim 1 , wherein the at least one said display setting is brightness.3. An apparatus as described in claim 1 , wherein the at least one said display setting is contrast claim 1 , color claim 1 , tint claim 1 , or sharpness.4. An apparatus as described in claim 1 , wherein the plurality of user selectable levels that are exposed for user selection have a lesser amount than the plurality of display setting levels available to adjust the display device.5. An apparatus as described in claim 1 , wherein the plurality of display setting levels include an amount from zero to 255 and an amount of the plurality of user selectable levels is less than ...

Подробнее
Номер записи: 76
12-03-2020 дата публикации

DISPLAY DEVICE WITH THIN THICKNESS AND SLIM BEZEL AND OUTER BEZEL FRAME THEREOF

Номер: US20200081482A1
Автор: Chou Chih-Chou, Huang Guo-Wei, HUANG Wei-Chia, Yang Yao-Chen
Принадлежит:

A display device includes a backlight module, a rear casing, an outer bezel frame, and a panel module. The backlight module includes a back plate and a light emitting assembly disposed on the back plate for emitting light. The rear casing covers the backlight module. The outer bezel frame includes a bezel body, a first fixing portion and a second fixing portion. The first fixing portion and the second fixing portion are disposed on a rear side of the bezel body and spaced apart from each other in a lateral direction. The second fixing portion is located at a side of the first fixing portion away from the backlight module. The first fixing portion and the second fixing portion are respectively fixed to the back plate and the rear casing in the lateral direction. The panel module is fixed on a front side of the bezel body for displaying images. 1: A display device comprising:a backlight module comprising a back plate and a light emitting assembly disposed on the back plate and configured to emit light beams;a rear casing covering the backlight module;an outer bezel frame comprising a bezel body, at least one first fixing portion and at least one second fixing portion, the at least one first fixing portion and the at least one second fixing portion being disposed on a rear side of the bezel body and spaced apart from each other, the at least one first fixing portion being fixed to the back plate in a lateral direction, the at least one second fixing portion being located at a side of the at least one first fixing portion away from the backlight module and fixed to the rear casing in the lateral direction; anda panel module fixed on a front side of the bezel body opposite to the rear side of the bezel body and configured to display images.2: The display device of claim 1 , wherein the back plate comprises a back plate back portion and a back plate lateral portion claim 1 , the back plate lateral portion is connected to the back plate back portion and adjacent to an ...

Подробнее
Номер записи: 77
02-04-2015 дата публикации

PROCESS OF FORMING SEED LAYER IN VERTICAL TRENCH/VIA

Номер: US20150093893A1
Автор: CHEN GUO-WEI, Chen Hsin-Yu, Cheng Tsun-Min, Hsu Chi-Mao, Hsu Ching-Wei, Kung Yung-Chien, LI JIA-RONG, Tao Yi-Fang, Tsai Huei-Ru
Принадлежит: UNITED MICROELECTRONICS CORPORATION

In a process of forming a seed layer, particularly in a vertical trench or via, a semiconductor substrate having a dielectric structure and a hard mask structure thereon is provided. An opening is formed in the hard mask structure, and a trench or via is formed in the dielectric structure in communication with the opening, wherein an area of the opening is greater than that of an entrance of the trench or via. A seed layer is then deposited in the trench or via through the opening, and then subjected to a reflow process. 1. A process of forming a seed layer , comprising:providing a semiconductor substrate having a dielectric structure and a hard mask structure thereon, an opening being formed in the hard mask structure, a trench or via being formed in the dielectric structure in communication with the opening, and an area of the opening being greater than that of an entrance of the trench or via;depositing a seed layer in the trench or via through the opening; andreflowing the seed layer, a silicon oxynitride (SiON) layer formed over the semiconductor substrate;', 'a titanium (Ti) layer overlying the SiON layer; and', 'a titanium nitride (TiN) layer overlying the Ti layer,, 'wherein the hard mask structure includes partially removing the SiON layer, the Ti layer and the TiN layer to form a trench-defining opening; and', 'performing a pull back procedure to partially remove the TiN layer and the Ti layer of the hard mask structure in the trench-defining opening after completing the formation of the trench or via, thereby forming the opening having the area thereof greater than that of the entrance of the trench or via and rendering a rounded corner of the TiN layer while retaining a sham corner of the SiON layer in the opening., 'wherein the opening is formed in the hard mask structure by2. The process according to wherein the dielectric structure includes a first layer formed over the semiconductor substrate claim 1 , and a second layer overlying the first layer ...

Подробнее
Номер записи: 78
05-05-2022 дата публикации

POLYPEPTIDE CONJUGATES AND METHODS OF USES

Номер: US20220133856A1
Автор: Chen Xu, GUO Wei, JIN Yaoguang, WANG Zuobin, Wu Bo, Wu Xinle, ZENG Lingli, ZHAI PENG, ZHANG Yuanyuan, Zhao Xinyu, ZOU Haixia
Принадлежит:

The present disclosure provides a polypeptide conjugates comprising GLP-1 receptor agonist and a peptide linker, and pharmaceutical compositions comprising the same. Methods of using such for treating diseases are also provided.

Подробнее
Номер записи: 79
19-03-2020 дата публикации

Macrocyclic indole derivatives

Номер: US20200087322A1
Автор: Amaury Fernandez-Montalvan, Arne Scholz, Chris Lemke, Christopher Nasveschuk, Clara CHRIST, David McKinney, GUO Wei, Joachim Kuhnke, Kai Thede, Kiel LAZARSKI, Knut Eis, Laura Furst, Manfred Moewes, Mark Fitzgerald, Michael H. Serrano-Wu, Nicolas WERBECK, Patrick R. McCarren, Philip Lienau, Philipp BUCHGRABER, Sarah Anna Liesa Johannes, Steven James Ferrara, Ulrich Klar, Ulrike SACK, Ursula Moenning
Принадлежит: Bayer AG, Bayer Pharma AG, Broad Institute Inc

in which R1, R2, R3, R4, R5, R6, A and L are as defined herein, methods of preparing said compounds, intermediate compounds useful for preparing said compounds, pharmaceutical compositions and combinations comprising said compounds, and the use of said compounds for manufacturing pharmaceutical compositions for the treatment or prophylaxis of diseases, in particular of hyperproliferative disorders, as a sole agent or in combination with other active ingredients.

Подробнее
Номер записи: 80
12-05-2022 дата публикации

Biocontrol Strain YW-1 and Preparation Method and Application of Biocontrol Agent Thereof

Номер: US20220142171A1
Автор: Dong Guanghui, GUO Wei, Li Shimo, Luo Yuming, Qiu Yusheng, Yan Haixia, Yang Wei, ZHANG LEI, ZHANG ZI, Zhu Yuelong
Принадлежит:

A biocontrol strain YW-1, a preparation method and application of a biocontrol agent thereof are provided. The strain is with the preservation number of CGMCC NO. 20620. The biocontrol agent of the biocontrol strain YW-1 is obtained by the following steps: oscillating culture the biocontrol strain YW-1 in a LB culture medium at 30 Celsius degrees and 180 rpm for 12-16 hours until a total concentration of living bacteria in a bacterial suspension is 1×10-1×10CFU/mL; centrifuging the bacterial suspension at 6000 rpm for 10 minutes to collect thalli; and diluting the thalli with sterilized water to obtain a concentration of 100 CFU/milliliter. By irrigating the root of every plant with 20 milliliters of the biocontrol agent when host plants are transplanted, it can effectively prevent soil-borne diseases such as wilt of melons, bacterial wilt of tomatoes and peppers, and 1Myroides odoratimimus. A biocontrol strain YW-1 , wherein the strain is , and the preservation number of the strain is CGMCC NO. 20620.2. A method for preparing a biocontrol agent prepared by using the biocontrol strain YW-1 according to claim 1 , wherein the biocontrol strain YW-1 is cultured in a Luria-Bertani (LB) culture medium claim 1 , and then thalli are collected and diluted with sterilized water to prepare the biocontrol agent with a total concentration of 10colony-forming units per milliliter (CFU/mL).3. The method according to claim 2 , wherein a total concentration of viable bacteria in a bacterial suspension obtained by culturing the biocontrol strain YW-1 in the LB culture medium is 1×10-1×10CFU/mL.4. An application method of a biocontrol agent prepared by using the biocontrol strain YW-1 according to claim 1 , wherein the biocontrol agent is applied in controlling soil-borne diseases of plants.5fusariumphytophthora capsici.. The application method according to claim 4 , wherein the soil-borne diseases of plants are one or more selected from the group consisting of wilt of melons claim 4 ...

Подробнее
Номер записи: 81
19-03-2020 дата публикации

METHOD FOR OBTAINING INTERNET PROTOCOL HEADER REPLACEMENT MAPPING AND NETWORK NODE

Номер: US20200092401A1
Автор: GUO Wei, GUO Xiaolong, LI Yue, Zhu Song
Принадлежит:

The present invention discloses a method for obtaining an Internet protocol header replacement mapping, which belong to the field of communications technologies. The method includes: obtaining, by a network node, fixed IP header information which is bound to a UE, where the network node is an MME or an eNB or a PGW or an SGW; establishing an IP header replacement mapping according to the fixed IP header information, where the IP header replacement mapping is correspondence between the fixed IP header information and an index or a bearer; and performing data transmission with the UE according to the IP header replacement mapping. In the present invention, the network node establishes the IP header replacement mapping according to the obtained fixed IP header information which is bound to the UE, the method is more flexible. 1. A communication method performed by a mobility management entity , comprising:receiving, from a user equipment (UE), a fixed part of an Internet protocol (IP) header;establishing an IP header replacement mapping according to the fixed part of the IP header, wherein the IP header replacement mapping is correspondence between the fixed part of the IP header and an index;sending the IP header replacement mapping to the UE; andsending a first data packet to the UE, wherein the fixed part of the IP header is substituted with the index in the first data packet.2. The method according to claim 1 , wherein the method further comprises:receiving a second data packet from the UE, wherein the second data packet includes the index corresponding to the fixed part of the IP header; andobtaining, based on the IP header replacement mapping, the fixed part of the IP header that corresponds to the index in the second data packet.3. The method according to claim 2 , wherein the method further comprises:substituting the index in the second data packet with the fixed part of the IP header; andforwarding the second data packet including the fixed part of the IP ...

Подробнее
Номер записи: 82
28-03-2019 дата публикации

CONTENT PATTERN BASED AUTOMATIC DOCUMENT CLASSIFICATION

Номер: US20190095439A1
Автор: Cai Daran, Dobrzynski Michael, GARG Nakul, Guo Wei-Qiang, KHANNA Amit, Xu Ning
Принадлежит:

Computer systems, devices, and associated methods of content pattern based automatic document classification are disclosed herein. In one embodiment, a method includes receiving a document and a sequence of words corresponding to a document class having a class label from a network storage. The method also includes determining a longest common subsequence of words between the words in the document and the sequence of words and calculating a similarity percentage between the document and the sequence of words based on the determined longest common subsequence. When the calculated similarity percentage is above a threshold, the class label corresponding to the document class is automatically applied to the received document in the network storage. 1. A method for content pattern based document classification in a computer system having a network storage containing multiple documents accessible to multiple members via a computer network , the method comprising:receiving, from the network storage, data representing a first document and a second document, both the first and second documents containing words in sequences; computing a longest common subsequence of words of the first and second documents, the longest common subsequence having a number of words shared by the first and second documents;', 'determining whether the number of words of the computed longest common subsequence is above a threshold; and', indicating that the first document and the second document belong to a document class having the computed longest common subsequence as a content pattern; and', 'automatically classifying additional documents in the network storage as belonging to the same document class when a longest common sequence between the individual additional documents relative to the content pattern is above the threshold., 'in response to determining that the number of words is above the threshold,'}], 'in response to receiving the first and second documents,'}2. The method of claim 1 , ...

Подробнее
Номер записи: 83
14-04-2016 дата публикации

METHOD FOR USING SHARED DEVICE IN APPARATUS CAPABLE OF OPERATING TWO OPERATING SYSTEMS

Номер: US20160103716A1
Автор: Chai Hongfeng, Chen Chengqian, GUO Wei, He Shuo, Lu Zhijun, Zhou Yu
Принадлежит:

The invention discloses a method for using a shared apparatus in a device capable of running two operating systems, which includes using a first application in a first operating system to communicate with the share apparatus, and when the first operating system is switched to a second operating system, sending associated information on the shared apparatus to a second application in the second operating system so that the second application can use the associated information to communicate with the shared apparatus. 1. A method for using a shared apparatus in a device capable of running two operating system , characterized inusing a first application in a first operating system to communicate with the share apparatus, andwhen the first operating system is switched to a second operating system, sending associated information on the shared apparatus to a second application in the second operating system so that the second application can use the associated information to communicate with the shared apparatus.2. A method according to claim 1 , characterized in that the second application directly sends a result of the communication with the shared apparatus to an external terminal via the shared apparatus.3. A method according to claim 1 , characterized in that the associated information includes one or more of the followings: shared apparatus identifier claim 1 , shared apparatus transmission-reception data interface address claim 1 , shared apparatus configuration information claim 1 , and a connection channel between the first application and the shared apparatus.4. A method according to claim 1 , characterized in that the shared apparatus is NFC chip. The invention relates to a method for using a shared apparatus in a device capable of running two operating systems.In the prior art such as mobile payment technology, for security purpose, the operating mode in a mobile device is classified into two modes: a normal mode and a secure mode. In the normal mode, the ...

Подробнее
Номер записи: 84
28-03-2019 дата публикации

PACKAGE STRUCTURE OF DISPLAY PANEL AND DISPLAY DEVICE

Номер: US20190097174A1
Автор: CAO Zhonglin, Chen Shiqi, GUO Wei, He Jing, LI Ting, SONG Wenhua, XU Yuanjie, ZANG Pengcheng
Принадлежит:

A package structure of a display panel and a display device are provided. The package structure of the display panel includes: a first substrate and a second substrate opposite to each other; and a display component, a drying layer, and a supporting layer, located between the first substrate and the second substrate; wherein, the supporting layer is configured to support the first substrate and the second substrate to maintain an interval between the first substrate and the second substrate, the drying layer and the supporting layer are directly connected with each other, the supporting layer includes a first sub-supporting layer, and the first sub-supporting layer is located on a side of the drying layer away from the display component. 1. A package structure of a display panel , comprising:a first substrate and a second substrate opposite to each other; anda display component, a drying layer, and a supporting layer, located between the first substrate and the second substrate;wherein, the supporting layer is configured to support the first substrate and the second substrate to maintain an interval between the first substrate and the second substrate, the drying layer and the supporting layer are directly connected with each other, the supporting layer includes a first sub-supporting layer, and the first sub-supporting layer is located on a side of the drying layer away from the display component.2. The package structure of a display panel according to claim 1 , wherein claim 1 , the supporting layer further includes at least one of a second sub-supporting layer or a third sub-supporting layer claim 1 ,in a direction perpendicular to the first substrate, the second sub-supporting layer is located between the first substrate and the drying layer, the third sub-supporting layer is located between the second substrate and the drying layer.3. The package structure of a display panel according to claim 2 , wherein claim 2 , the drying layer is spaced apart from the ...

Подробнее
Номер записи: 85
26-06-2014 дата публикации

CAPACITY-BASED MULTI-TASK SCHEDULING METHOD, APPARATUS AND SYSTEM

Номер: US20140181839A1
Автор: GUO Wei, HONG Kungan, LI JUN, XU Zhao, ZHANG Shubin, Zhao Wei, ZHAO Yanrong
Принадлежит: TENCENT TECHNOLOGY (SHENZHEN) COMPANY LIMITED

The present disclosure is applied to the technical field of data processing, and provided are a capacity-based multi-task scheduling method, apparatus and system. The method comprises: a scheduling node receiving a request for acquiring a task sent by a task executing node, the request carrying with a current load value and an available memory space of the task executing node; and the scheduling node deciding whether the current load value is less than a threshold, and carrying out task scheduling for the task executing node according to the available memory space of the task executing node if the current load value is less than the threshold. The present disclosure can effectively avoid the problems of overload, load, in sufficient memory, etc. of the task execution node, and increase the resource utilization rate of the task execution node and the task scheduling and executing efficiency. 1. A multi-task scheduling method , comprising:receiving, by a scheduling node, a request for acquiring a task sent by a task executing node, the request carrying with a current load value and an available memory space of the task executing node; anddeciding, by the scheduling node, whether the current load value is less than a threshold, and carrying out task scheduling for the task executing node according to the available memory space of the task executing node if the current load value is less than the threshold.2. The method according to claim 1 , wherein the scheduling node carrying out task scheduling for the task executing node according to the available memory space of the task executing node comprises:deciding, by the scheduling node, whether there is a task to be assigned whose amount of memory requirement is less than or equal to the available memory space of the task executing node in the scheduling nodes;assigning, by the scheduling node, the task whose amount of memory requirement is less than or equal to the available memory space of the task executing node to the ...

Подробнее
Номер записи: 86
02-06-2022 дата публикации

BRANCH OPTIMIZATION METHOD FOR EXECUTION OF BIG DATA ETL (EXTRACT-TRANSFORM-LOAD)

Номер: US20220171786A1
Автор: Du Zhiqiang, FAN Yaxin, GUO Wei, GUO Yuda
Принадлежит: Nanjing Beidou Innovation and Application Technology Research Institute Co., Ltd.

The present invention discloses a branch optimization method for execution of a big data ETL model. The necessity of model execution can be analyzed according to the update characteristics of raw data sets and the characteristics of the ETL model; and optimization judgment is carried out on a plurality of operator branches of the ETL model, and for branches with lower update frequency, a middle repeated calculation process is skipped in a manner of reconstructing a cache table, so that the repeated execution rate is reduced from the operator aspect, the execution efficiency of the ETL model is improved, and the big data analysis is carried out more efficiently. 1. A branch optimization method for execution of a big data ETL model , wherein the necessity of model execution is analyzed according to the update characteristics of raw data sets and the characteristics of the ETL model; optimization judgment is carried out on a plurality of operator branches of the ETL model; and for branches with lower update frequency , a middle repeated calculation process is skipped in a manner of reconstructing a cache table , so that the repeated execution rate is reduced from the operator aspect , the execution efficiency of the ETL model is improved , and the big data analysis is carried out more efficiently.2. The branch optimization method for execution of the big data ETL model according to claim 1 , wherein the branch optimization comprises two phases; ETL analysis results to be cached are determined in a first phase; and execution states of ETL operators are marked according to cached results in a second phase claim 1 , and redundant operators are skipped.3. The branch optimization method for execution of the big data ETL model according to claim 2 , wherein the first phase comprises the following specific steps:S1, disassembling the ETL analysis model into a plurality of ETL branches by taking data sources as starting points and taking analysis results as end points;S2, ...

Подробнее
Номер записи: 87
02-06-2022 дата публикации

SHIP WANDERING DETECTION METHOD BASED ON AIS DATA

Номер: US20220171796A1
Автор: Du Zhiqiang, FAN Yaxin, GUO Wei, YAN Baoqi
Принадлежит: Nanjing Beidou Innovation and Application Technology Research Institute Co., Ltd.

The present invention discloses a ship wandering detection method based on AIS (Automatic Identification System) data. According to acquired AIS trajectory data of a ship, wandering behaviors of the ship are detected according to the massive trajectory data, the wandering behaviors of the ship are classified, and relationships between trajectories of four typical abnormal movement behaviors of the ship and defined variables are summarized. The detection for the wandering behaviors of the ship can provide decision support for maritime safety supervision, so as to enhance the safety of maritime traffic and ensure the safe navigation of the ship, which has great significance to promote the safety, efficiency and smoothness of maritime transportation. 1. A ship wandering detection method based on AIS data , comprising the following steps:S1: acquiring a space range of a key research area, i.e. a longitude and latitude range;S2: calculating a grid code area covered by the space range according to the longitude and the latitude of the space range after the space range of the key research area is determined and obtaining a grid code set in the space range;S3: calculating and outputting a row and column number range according to the grid code range;S4: screening original movement trajectories of the ship, acquiring trajectory data in a set time range and a set space range and converting a result data set into a corresponding grid code set;S5: traversing the grid code set of the movement trajectory of the ship and counting the valid grid quantity nValid in the set;S6: determining the range of the valid grids in each row according to the row and column number range, i.e., the grid code range with a valid counting variable more than or equal to 1, and calculating the approximate area s;S7: calculating the row number and the column number of the center of the trajectory by the grid codes of the trajectory of the ship, determining the grid code of the center of the trajectory ...

Подробнее
Номер записи: 88
29-04-2021 дата публикации

ROBOT

Номер: US20210122031A1
Автор: GUO Wei
Принадлежит: FANUC Corporation

Provided is a robot that includes one or more rotary joints, each of the rotary joints including a motor, a reducer that reduces the rotational speed of the motor, and a first member and a second member that are connected by the reducer and that are supported so as to be rotatable about a center axis of the reducer, wherein the first member of at least one of the rotary joints is provided with a flange securing portion that secures a flange of the motor at an eccentric position with respect to the center axis of the reducer, and bolts that secure the first member to the reducer are also disposed in a region in which the flange is disposed when viewed from a direction along the center axis. 1. A robot comprising one or more rotary joints ,each of the rotary joints including a motor, a reducer that reduces a rotational speed of the motor, and a first member and a second member that are connected by the reducer and that are supported so as to be rotatable about a center axis of the reducer,wherein the first member of at least one of the rotary joints is provided with a flange securing portion that secures a flange of the motor at an eccentric position with respect to the center axis of the reducer, andbolts that secure the first member to the reducer are also disposed in a region in which the flange is disposed when viewed from a direction along the center axis.2. The robot according to claim 1 , wherein the bolts are inserted into one or more through-holes that pass through the flange securing portion in the direction along the center axis.3. The robot according to claim 2 ,wherein the flange securing portion includes a cylindrical portion that has a center hole through which a shaft of the motor passes, and a securing portion that is disposed at one end of the cylindrical portion and that secures the flange, andthe through-hole is disposed at a position overlapping with the cylindrical portion when viewed from the direction along the center axis.4. The robot ...

Подробнее
Номер записи: 89
21-04-2016 дата публикации

Real-Time Media Optimization Over Remoted Sessions

Номер: US20160112468A1
Автор: Iyer Subhashri, Khan Humayun, Mahajan Rajneesh, Sheih Guo-Wei, Srinivisan Srivatsa K., Velayutham Senthil K.
Принадлежит: Microsoft Technology Licensing, LLC

Real-time media optimization may be provided. First, a remote session may be established with a remote computing device. Then, during the remote session, non-real-time media data may be exchanged with the remote computing device over a server path. Moreover, real-time media data may be exchanged with the remote computing device over a media path during the remote session. 120-. (canceled)21. A system for providing real-time media optimization , the system comprising:a memory storage; and establish a remote session with a remote computing device;', 'establish a media path, during the remote session, between a local computing device and the remote computing device, wherein the media path is established without involving a server;', 'exchange, during the remote session, non-real-time media data with the remote computing device via the server over a server path;', 'exchange, during the remote session, real-time media data with the remote computing device over the media path without involving the server; and', 'synchronize the real-time media data from the media path and the non-real-time media data from the server path., 'a processing unit coupled to the memory storage, wherein the processing unit is operative to22. The system of claim 21 , wherein establish the remote session comprises establishing a hop between a client running on the local computing device and an application running on the server claim 21 , the established hop being in the server path.23. The system of claim 21 , wherein the media path is between a remote media manager running in a client running on the local computing device and the remote computing device.24. The system of claim 21 , wherein the exchange of the non-real-time media data with the remote computing device over the server path comprises passing non-real-time information to the server in the server path.25. The system of claim 21 , wherein the exchange of the non-real-time media data with the remote computing device over the server path ...

Подробнее
Номер записи: 90
21-04-2016 дата публикации

SECURE ELEMENT OPERATING SYSTEM AND METHOD

Номер: US20160112874A1
Автор: Chai Hongfeng, GUO Wei, He Shuo, Lu Zhijun, Yu Bin, Zhou Yu
Принадлежит: CHINA UNIONPAY CO., LTD.

The invention discloses a secure element (SE) operating system and method. The system comprises a SE configurator and a protocol converter disposed inside a mobile communication device, wherein the SE configurator communicates with one or more SEs on the mobile communication device via the protocol converter, and the SE configurator comprises a SE list for storing information on said one or more SEs. 1. A secure element (SE) operating system characterized by comprising a SE configurator and a protocol converter disposed inside a mobile communication device , wherein ,the SE configurator communicates with one or more SEs on the mobile communication device via the protocol converter, andthe SE configurator comprises a SE list for storing information on said one or more SEs.2. The system according to claim 1 , characterized in that the SE configurator is used to acquire the information on said one or more SEs on the mobile communication device via the protocol converter claim 1 , and to add the information to the SE list claim 1 ,the SE configurator is further configured to present the information on said one or more SEs via the mobile communication device based on the SE list, andthe SE configurator is further configured to delete the information on said one or more SEs based on the SE list.3. The system according to claim 2 , characterized in that the SE configurator verifies said one or more SEs before acquiring the information on said one or more SEs.4. The system according to claim 1 , characterized in that said one or more SEs is a physical SE or a virtual SE.5. The system according to claim 1 , characterized in that the system further comprises a SE management backstage for forwarding information between the SE configurator and a trusted service management (TSM) platform.6. A system according to claim 7 , characterized in that the SE management backstage is used for acquiring the information on a designated SE from the SE configurator and sending the information ...

Подробнее
Номер записи: 91
02-04-2020 дата публикации

TOOL MONITORING SYSTEM AND TOOL MONITORING METHOD

Номер: US20200103845A1
Автор: CHANG Yu-Ling, Chang Yung-Sheng, HSU CHIH-YUAN, Liang Shuo-Peng, TSENG YU-AN, WANG GUO-WEI
Принадлежит:

A tool monitoring method and a tool monitoring system are provided. The tool monitoring method includes extracting a first data and a second data of a tool of a machine tool, simulating and analyzing the first data to generate a comparison value, calculating the second data to obtain an actual value, and integrating and comparing the comparison value with the actual value to produce a comparison result for monitoring the operating condition of the tool. 1. A tool monitoring system connectible to a machine tool equipped with a controller and a tool , the tool monitoring system comprising:an extracting portion configured for extracting a first data and a second data from the controller;an analysis portion configured for simulating and analyzing the first data to generate a comparison value;a calculating portion configured for calculating the second data to obtain an actual value; andan integration portion configured for integrating and comparing the comparison value with the actual value to produce a comparison result for monitoring an operating condition of the tool.2. The tool monitoring system of claim 1 , wherein the first data includes coordinates claim 1 , a feed rate claim 1 , and a spindle rotational speed of the tool.3. The tool monitoring system of claim 1 , wherein the second data includes a spindle load of the tool.4. The tool monitoring system of claim 1 , wherein the analysis portion is a virtual machine of the machine tool or the controller.5. The tool monitoring system of claim 1 , wherein the extracting portion converts the first data into a path of the tool claim 1 , and the analysis portion uses the path in simulating and analyzing a reference value of a spindle load of the tool to be used as the comparison value.6. The tool monitoring system of claim 1 , wherein the calculating portion calculates a spindle load value of the tool using the second data and uses the spindle load value as the actual value.7. The tool monitoring system of claim 6 , ...

Подробнее
Номер записи: 92
10-07-2014 дата публикации

Signal transmission method, signal receiving method, passive optical network pon device, and pon system

Номер: US20140193152A1
Автор: Botao LIU, Chao Lv, Dawei Wang, GUO Wei, LEI Zhou
Принадлежит: Hong Kong Polytechnic University HKPU, Huawei Technologies Co Ltd

Embodiments of the present disclosure relate to a signal transmission method The signal receiving method includes: receiving a first transmit signal, where the first transmit signal includes a first polarized optical signal and a second polarized optical signal that are perpendicular to each other, where the first polarized optical signal is loaded with first data, the first transmit signal is an uplink signal, and the first data is uplink data, or, the first transmit signal is a downlink signal, and the first data is downlink data; splitting the first transmit signal into a first signal and a second signal according to power; separately rotating a first polarized optical signal and a second polarized optical signal of the second signal by 90 degrees; and performing coherent mixing on the rotated second signal and the first signal to obtain the first data.

Подробнее
Номер записи: 93
29-04-2021 дата публикации

SEMICONDUCTOR DEVICE AND METHOD

Номер: US20210125875A1
Автор: Guo Wei-Ting, Ku Shu-Yuan, Tsai Ya-Yi, YANG I-Wei
Принадлежит:

A method includes forming a first fin and a second fin on a substrate; forming a dummy gate material over the first fin and the second fin; etching the dummy gate material using a first etching process to form a recess between the first fin and the second fin, wherein a sacrificial material is formed on sidewalls of the recess during the first etching process; filling the recess with an insulation material; removing the dummy gate material and the sacrificial material using a second etching process; and forming a first replacement gate over the first fin and a second replacement gate over the second fin, wherein the first replacement gate is separated from the second replacement gate by the insulation material. 1. A method comprising:forming a first fin and a second fin protruding from a semiconductor substrate;forming a dummy gate extending over the first fin and the second fin;forming a patterned mask over the dummy gate, the patterned mask comprising an opening between the first fin and the second fin;etching the dummy gate through the opening in the patterned mask to form a recess in the dummy gate, the etching comprising a plasma etching process, the plasma etching process using process gases comprising one or more etching gases and one or more polymer-forming gases, wherein during the etching the process gases react with the material of the dummy gate to form reaction products that deposit on sidewalls of the recess;depositing an insulation material to fill the recess, the insulation material covering the reaction products;removing the dummy gate and the reaction products; andforming a first gate structure extending over the first fin and a second gate structure extending over the second fin, wherein the insulation material extends from the first gate structure to the second gate structure.2. The method of claim 1 , wherein the reaction products are formed having a first thickness on sidewalls near the top of the recess that is greater than a second thickness ...

Подробнее
Номер записи: 94
28-04-2016 дата публикации

ESTABLISHMENT OF COMMUNICATION CONNECTION BETWEEN MOBILE DEVICE AND SECURE ELEMENT

Номер: US20160119334A1
Автор: Chai Hongfeng, GUO Wei, He Shuo, Li Dingzhou, Lu Zhijun, Zhou Yu
Принадлежит: CHINA UNIONPAY CO., LTD.

The invention relates to communication technology, and in particular, to a method of establishing communication connection between a mobile device and a secure element as well as a mobile device for implementing the method. The method comprises the following steps: when the mobile device detects that there is a secure element which establishes a physical connection with it, the mobile device performs a secure authentication on the secure element; if the secure authentication passes, the mobile device determines whether there is configuration information inside it which is required for establishing the communication connection between the mobile device and the secure element; and if there is the required configuration information inside the mobile device, the mobile device uses the configuration information to establish the communication connection with the secure element; otherwise, the mobile device obtains required configuration information from the secure element to establish the communication connection with the secure element. 1. A method of establishing communication connection between a mobile device and a secure element , characterized by comprising the following steps:when the mobile device detects that there is a secure element which establishes a physical connection with it, the mobile device performs a secure authentication on the secure element;if the secure authentication passes, the mobile device determines whether there is configuration information inside it which is required for establishing the communication connection between the mobile device and the secure element; andif there is the required configuration information inside the mobile device, the mobile device uses the configuration information to establish the communication connection with the secure element; otherwise, the mobile device obtains required configuration information from the secure element to establish the communication connection with the secure element.2. The method according ...

Подробнее
Номер записи: 95
28-04-2016 дата публикации

MOBILE DEVICE-BASED AUTHENTICATION METHOD AND AUTHENTICATION APPARATUS

Номер: US20160119786A1
Автор: Chai Hongfeng, Chen Chengqian, GUO Wei, He Shuo, Lu Zhijun, Zhou Yu
Принадлежит: CHINA UNIONPAY CO., LTD.

The invention discloses an authentication method based on mobile. The method comprises the following steps: providing an authentication apparatus in a mobile device; using the authentication apparatus to conduct authentication on an application and/or secure element in the mobile device in a secure operating system of the mobile device. 1. An authentication method based on mobile device , characterized by comprising the following steps:providing an authentication apparatus in a mobile device; andusing the authentication apparatus to conduct authentication on an application and/or secure element in the mobile device in a secure operating system of the mobile device.2. A method according to claim 1 , characterized in that claim 1 ,the authentication apparatus conducts authentication on the application and/or secure element according to a specific authentication solution.3. A method according to claim 1 , characterized in that claim 1 ,the authentication apparatus is configured with an authentication list for recording applications and/or secure elements that have successfully passed the authentication so that a mutual authentication between the applications and/or secure elements in the authentication list is not required.4. A method according to claim 1 , characterized in that claim 1 ,the authentication apparatus is also used for conducting an authentication on an authentication aggregation which comprises a plurality of applications; andwhen the authentication aggregation has successfully passed the authentication conducted by the authentication apparatus, the authentication apparatus records the plurality of applications contained in the authentication aggregation in the authentication list.5. An authentication apparatus based on mobile device claim 1 , characterized in that claim 1 , the authentication apparatus is disposed in the mobile device claim 1 , andthe authentication apparatus is used for conducting authentication on an application and/or secure element ...

Подробнее
Номер записи: 96
27-05-2021 дата публикации

APPLICATION MANAGEMENT METHOD FOR TERMINAL, APPLICATION SERVER, AND TERMINAL

Номер: US20210157922A1
Автор: Chen Chengqian, GUO Wei, Zhou Yu
Принадлежит:

Embodiments of the present invention disclose an application management method for terminals, including: after receiving the application download request sent by the terminal, the application server sends the corresponding application installation package to the terminal. Then, the first verification message sent by the terminal is received, and the first verification message is generated by the terminal according to the content of the received application installation package. After determining that the first verification message is consistent with a stored second verification message, the application server sends an permit-to-install message to the terminal, so that the terminal installs the application according to the received application installation package. Because the application server determines the legitimacy of the application package, it does not need the terminal to verify by using the certificate, thereby reducing the certificate work management for the terminal and improving the efficiency of application installation. 1. An application management method of a terminal , comprising:receiving, by an application server, an application download request sent by the terminal;sending, by the application server, an application installation package corresponding to the application download request to the terminal, the application installation package having passed a security check by the application server;receiving, by the application server, a first verification message sent by the terminal, wherein the first verification message is generated by the terminal according to content of the received application installation package;comparing, by the application server, the first verification message with a stored second verification message, wherein the second verification message is generated by the application server according to content of the application installation package having passed the security check; andafter determining that the first verification ...

Подробнее
Номер записи: 97
25-08-2022 дата публикации

POWER SOURCE SWITCHING CONTROL SYSTEM AND POWER SOURCE SWITCHING CONTROL METHOD

Номер: US20220271562A1
Автор: GUO Wei, LIANG Zehua, YANG Yanxing, Yang Zezhou, YE Wanxiang
Принадлежит:

In the power source switching control system, a circuit breaker includes a controller and an on/off apparatus. The controller controls, based on a signal of a monitor, the on/off apparatus to adjust an on/off state of a power source connected to the circuit breaker, that is, adjust, from an on state to an off state based on a switch-off signal of the monitor, a working power source that is currently working, and adjust a backup power source from an off state to an on state based on a switch-on signal of the monitor, to implement a process of power source switching between the working power source and the backup power source. 1. A system , comprising:a monitor;a first circuit breaker connected to a working power source, wherein the first circuit breaker comprises a first controller and a first on/off apparatus that are connected to each other, the first controller is connected to the monitor, and the first controller is configured to control the first on/off apparatus to adjust an on/off state of the working power source from an on state to an off state; anda second circuit breaker connected to a backup power source, wherein the second circuit breaker comprises a second controller and a second on/off apparatus that are connected to each other, the second controller is connected to the monitor, and the second controller is configured to control the second on/off apparatus to adjust an on/off state of the backup power source from an off state to an on state.2. The system according to claim 1 , wherein the system further comprises a logic control apparatus;the first controller is connected to the monitor through the logic control apparatus, and the second controller is connected to the monitor through the logic control apparatus; andafter the logic control apparatus determines that the on/off state of the working power source is adjusted from an on state to an off state.3. The system according to claim 2 , wherein the logic control apparatus is configured to send claim ...

Подробнее
Номер записи: 98
02-05-2019 дата публикации

Hipbone Prosthesis

Номер: US20190125539A1
Автор: GUO Wei, JI Tao, WANG Caimei
Принадлежит:

The present disclosure provides a hipbone prosthesis, comprising: a prosthesis main body (), the prosthesis main body () being of an arched structure, the prosthesis main body including a first end portion () and a second end portion, and the first end portion () being contacted and matched with a sacrum (); and an acetabular cup () and a connecting device (), the acetabular cup () being connected with the second end portion in a position adjustable manner via the connecting device (). According to the technical solutions of the present disclosure, the problems of unreliable supporting and easy fatigue break of a screw-rod system in the related technology are effectively solved. 1. A hipbone prosthesis , comprising:{'b': 10', '10', '10', '11', '11', '1, 'a prosthesis main body (), the prosthesis main body () being of an arched structure, the prosthesis main body () comprising a first end portion () and a second end portion, and the first end portion () being contacted and matched with a sacrum (); and'}{'b': 20', '30', '20', '30, 'an acetabular cup () and a connecting device (), the acetabular cup () being connected with the second end portion in a position adjustable manner via the connecting device ().'}23020. The hipbone prosthesis as claimed in claim 1 , wherein the connecting device () comprises a first connection portion and a second connection portion; a central line of the first connection portion and a central line of the second connection portion form an angle; the second end portion is provided with a third connection portion connected with the first connection portion; and the acetabular cup () is provided with a fourth connection portion connected with the second connection portion.3415142524142103051522030. The hipbone prosthesis as claimed in claim 2 , wherein the first connection portion is a first axial tooth portion (); the second connection portion is a second axial tooth portion (); the third connection portion is a third axial tooth portion (); ...

Подробнее
Номер записи: 99
10-05-2018 дата публикации

SYSTEMS AND METHODS FOR FLYBACK POWER CONVERTERS WITH SWITCHING FREQUENCY AND PEAK CURRENT ADJUSTMENTS

Номер: US20180131284A1
Автор: Fang Lieyi, Lin Guo Wei
Принадлежит:

System and method for regulating a power converter. The system includes a comparator configured to receive a first signal and a second signal and generate a comparison signal based on at least information associated with the first signal and the second signal. The first signal is associated with at least an output current of a power converter. Additionally, the system includes a pulse-width-modulation generator configured to receive at least the comparison signal and generate a modulation signal based on at least information associated with the comparison signal, and a driver component configured to receive the modulation signal and output a drive signal to a switch to adjust a primary current flowing through a primary winding of the power converter. The modulation signal is associated with a modulation frequency corresponding to a modulation period. 125.-. (canceled)26. An apparatus for a power converter , the apparatus comprising:a first comparator configured to receive a first signal and a second signal and generate a first comparison signal based at least in part on the first signal and the second signal, the first signal being associated with at least an output current of a power converter;a second comparator configured to receive a third signal and a fourth signal and generate a second comparison signal based at least in part on the third signal and the fourth signal, the third signal being related to the first signal, the fourth signal being associated with a current flowing through a primary winding of the power converter; anda modulation signal generator configured to receive the first comparison signal and the second comparison signal, generate a modulation signal based at least in part on the first comparison signal and the second comparison signal, and output the modulation signal for adjusting the current flowing through the primary winding of the power converter.27. The apparatus of and further comprising:a first resistor including a first resistor ...

Подробнее
Номер записи: 100
03-06-2021 дата публикации

ASSAYS TO DETERMINE DNA METHYLATION AND DNA METHYLATION MARKERS OF CANCER

Номер: US20210164031A1
Автор: GUO Wei, JIA Xi-Yu, PIATTI Paolo, YANG Xiaojing
Принадлежит:

Methods are provided for determining a genomic methylation profile in a DNA sample. In certain aspects, the methods can be used to determine if a subject has, or is at risk for developing, a bladder cancer or other cancers of the urinary tract. Methods for treatment of such subjects are likewise provided. 1. A method for determining a genomic DNA methylation profile in a sample comprising:(a) obtaining a substantially purified test genomic DNA sample;(b) contacting a portion test genomic DNA of the sample with: (I) the first genomic region is a cleavage control that is known to be unmethylated;', '(II) the second genomic region is a copy number control that does not include any cut sites for the methylation sensitive restriction endonucleases of the first reaction mixture; and', '(III) the third genomic region is a test region having an unknown amount of methylation and including at least three cut sites for the methylation sensitive restriction endonucleases of the first reaction mixture;, 'a first reaction mixture comprising: (i) at least two methylation sensitive restriction endonucleases; (ii) a hot-start DNA polymerase; (iii) a pH buffered salt solution; (iv) dNTPs; (v) DNA primer pairs for polymerase chain reaction (PCR) amplification of at least a first, second and third different genomic region in the DNA sample; and (vi) fluorescent probes complementary to sequences in said first, second and third different genomic regions for quantitative detection of amplified sequences from the first, second and third different genomic regions, wherein each of the probes comprises a distinct fluorescent label, wherein(c) subjecting the first reaction mixture to digestion and thermal cycling, while detecting fluorescent signals from the fluorescent probes, thereby performing real time PCR on the samples in the first and second reaction mixtures;(d) using the detected fluorescent signals to determine the genomic DNA methylation profile in a sample.2. The method of claim 1 ...

Подробнее
Номер записи: 101
17-05-2018 дата публикации

SURGICAL INSTRUMENT WITH REMOVABLE CLAMP ARM ASSEMBLY

Номер: US20180132883A1
Автор: Asher Ryan M., Boudreaux Chad P., DENNIS Joseph, GUO Wei, Heitman Bryce L., McCrea James A., Minnelli Patrick J., Yu Yachuan, Zeckel Monica L., ZHU Junhua
Принадлежит:

A surgical instrument has a first modular assembly and a second modular assembly. The first modular assembly has a body, an ultrasonic waveguide, an ultrasonic blade connected to a distal end of the ultrasonic waveguide, and a coupling member that movably couples with the body. The second modular assembly has a clamp arm assembly with a first pivot coupling, a clamp pad assembly with a second pivot coupling, and a distal outer sheath that selectively couples to the body of the first modular assembly via the coupling member. The distal outer sheath has an interior surface that houses a portion of the ultrasonic waveguide, and this interior surface also houses the first pivot coupling and the second pivot coupling. 1. A surgical instrument , comprising: (i) a body,', '(ii) an ultrasonic waveguide configured to couple with an ultrasonic transducer,', '(iii) an ultrasonic blade connected to a distal end of the ultrasonic waveguide, and', '(iv) a coupling member configured to movably couple with the body; and, '(a) a first modular assembly comprising (i) a clamp arm assembly comprising a first pivot coupling,', '(ii) a clamp pad assembly comprising a second pivot coupling, and', '(iii) a distal outer sheath configured to selectively couple to the body of the first modular assembly via the coupling member, wherein the distal outer sheath comprises an interior surface configured to house a portion of the ultrasonic waveguide, wherein the interior surface of the distal outer sheath is configured to house the first pivot coupling and the second pivot coupling., '(b) a second modular assembly comprising2. The surgical instrument of claim 1 , wherein the distal outer sheath comprises a U-shaped body.3. The surgical instrument of claim 1 , wherein the body comprises a recess claim 1 , wherein the distal outer sheath comprises a proximal protrusion configured to be inserted into the recess.4. The surgical instrument of claim 3 , wherein the proximal protrusion comprises a ...

Подробнее
Номер записи: 102
17-05-2018 дата публикации

SURGICAL INSTRUMENT WITH REMOVABLE PORTION TO FACILITATE CLEANING

Номер: US20180132884A1
Автор: Denzinger Kristen G., GU QINLIN, GUO Wei, Holland Timothy S., Minnelli Patrick J., Mumaw Daniel J., Yu Yachuan, Zeckel Monica L.
Принадлежит:

A surgical instrument has an ultrasonic blade that connects to a distal end of an ultrasonic waveguide. A clamp arm assembly is moveable from an opened position for receiving a tissue, toward a closed position for clamping the tissue. A clamp arm actuator connected to the clamp arm assembly directs the clamp arm assembly from the opened position toward the closed position. An outer sheath surrounds at least a portion of the ultrasonic waveguide. The outer sheath includes a cover removably received against a sheath body, and a sheath securement feature able to detachably couple the cover to the sheath body such that the cover can be detached from the sheath body for accessing the ultrasonic waveguide within the outer sheath. 1. A surgical instrument , comprising:(a) a body assembly;(b) an ultrasonic waveguide extending through the body assembly along a longitudinal axis;(c) an ultrasonic blade connected to a distal end of the ultrasonic waveguide; (i) a clamp body, and', '(ii) a clamp pad connected to the clamp body facing the ultrasonic blade;, '(d) a clamp arm assembly configured to move from an opened position for receiving a tissue toward a closed position for clamping the tissue relative to the ultrasonic blade, wherein the clamp arm assembly includes(e) a clamp arm actuator operatively connected to the clamp arm assembly and configured to selectively move from a first position toward a second position relative to the body to thereby respectively direct the clamp arm assembly from the opened position toward the closed position; and (i) a sheath body operatively connected to the body assembly and affixed relative to the ultrasonic waveguide,', '(ii) a cover removably received against the sheath body, and', '(iii) a sheath securement feature configured to detachably couple the cover to the sheath body such that the cover is configured to be selectively detached from the sheath body for accessing the ultrasonic waveguide within the outer sheath., '(f) an outer ...

Подробнее
Номер записи: 103
23-04-2020 дата публикации

INFORMATION GENERATION, ACQUISITION, AND PROCESSING TO IMPROVE SERVICE EFFICIENCY

Номер: US20200126084A1
Автор: GUO Wei
Принадлежит: ALIBABA GROUP HOLDING LIMITED

An instruction to generate target information is received by a server and from a first user. The instruction includes two or more pieces of user identity information associated with two or more different users. The two or more pieces of user identity information are combined, by the server and in a predetermined method, into continuous text information. The two or more pieces of user identity information in the continuous text information are separated by one or more separation strings. The target information is generated, by the server, based on at least a predetermined algorithm and the continuous text information. 1. A computer-implemented method , comprising:receiving, by a server and from a first user, an instruction to generate target information, wherein the instruction includes two or more pieces of user identity information associated with two or more different users;combining, by the server and in a predetermined method, the two or more pieces of user identity information into continuous text information, wherein the two or more pieces of user identity information in the continuous text information are separated by one or more separation strings; andgenerating, by the server, the target information based on at least a predetermined algorithm and the continuous text information.2. The computer-implemented method of claim 1 , wherein the two or more pieces of user identity information are associated with the first user and one or more users different from the first user claim 1 , and user identity information associated with each particular user includes at least one of account information claim 1 , account number information claim 1 , and bank card number information associated with the particular user.3. The computer-implemented method of claim 1 , wherein the predetermined method combines the two or more pieces of user identity information into the continuous text information in an order that is based on at least priorities of the two or more pieces of ...

Подробнее
Номер записи: 104
19-05-2016 дата публикации

METHOD FOR INDICATING OPERATING ENVIRONMENT OF MOBILE DEVICE AND MOBILE DEVICE CAPABLE OF INDICATING OPERATING ENVIRONMENT

Номер: US20160140342A1
Автор: Chai Hongfeng, Chen Chengqian, GUO Wei, He Shuo, Lu Zhijun, Zhou Yu
Принадлежит: CHINA UNIONPAY CO., LTD.

The invention discloses a method for indicating an operating environment of a mobile device and a mobile device capable of indicating an operating environment. The method comprises the following steps: generating personalized information and storing the personalized information in a storage area that can be only accessed by a secure operating system, and displaying the personalized information on a display area of the mobile device when the mobile device enters the secure operating system so as to inform the user of the currently running operating system 1. A method for indicating an operating environment of a mobile device , characterized by comprising the following steps:generating personalized information and storing the personalized information in a storage area that can be only accessed by a secure operating system; anddisplaying the personalized information on a display area of the mobile device when the mobile device enters the secure operating system so as to inform the user of the currently running operating system.2. A method according to claim 1 , characterized by further comprising the following step:generating the personalized information based on an input from the user, the personalized information comprising text, image or a combination of text and image.3. A method according to claim 2 , characterized by further comprising the following step:generating the personalized information when the mobile device is started for the first time.4. A method according to claim 1 , characterized by further comprising the following step:further displaying a final credibility level of the currently operating application on the display area of the mobile device when the mobile device is running in the secure operating system so as to inform the user of the security of the currently operating application.5. A method according to claim 4 , characterized in that:the final credibility level of application is generated based on the credibility level of application and the ...

Подробнее
Номер записи: 105
19-05-2016 дата публикации

DISPLAY DEVICE WITH A DETACHABLE SPEAKER MODULE

Номер: US20160143160A1
Автор: Chiang Ho-Tang, Dai Shu-hua, Huang Guo-Wei, Su Ji-Lian, Yang Liang
Принадлежит:

A display device includes a monitor, a stand, and a speaker module. The monitor includes a first side and a second side. An accommodating groove is formed on the first side, and a slot is formed on the second side. The stand is selectively installed inside the accommodating groove for being stored in the first side of the monitor or inserted into the slot for supporting the monitor on a supporting surface. The speaker module is installed inside the stand for outputting an audio signal transmitted from the monitor. 1. A display device comprising:a monitor comprising a first side and a second side, an accommodating groove being formed on the first side, and a slot being formed on the second side;a stand selectively installed inside the accommodating groove for being stored in the first side of the monitor, or inserted into the slot for supporting the monitor on a supporting surface; anda speaker module installed inside the stand for outputting an audio signal transmitted from the monitor.2. The display device of claim 1 , wherein the stand comprises:a base for accommodating the speaker module; anda supporting frame comprising a first end and a second end, the first end being detachably connected to the base, and the second end being inserted into the slot.3. The display device of claim 2 , further comprising a fixing member for fixing the supporting frame on the monitor.4. The display device of claim 3 , wherein a shape of the accommodating groove of the monitor is corresponding to a shape of the base claim 3 , the base is formed in a V shape claim 3 , and the accommodating groove is formed in a V shape.5. The display device of claim 2 , further comprising a bridging member for connecting the base to the first side of the monitor claim 2 , so as to fix the base inside the accommodating groove.6. The display device of claim 5 , wherein a shape of the accommodating groove of the monitor is corresponding to a shape of the base claim 5 , the base is formed in a V shape ...

Подробнее
Номер записи: 106
08-09-2022 дата публикации

Macrocyclic fluorine substituted indole derivatives

Номер: US20220281891A1
Автор: Amaury Ernesto FERNANDEZ-MONTALVAN, Anne Mengel, Chris Lemke, Christopher Nasveschuk, Clara CHRIST, David McKinney, GUO Wei, Joachim Kuhnke, Kai Thede, Kiel LAZARSKI, Laura Furst, Mark Fitzgerald, Michael H. Serrano-Wu, Nicolas WERBECK, Patrick Ryan Mccarren, Philipp BUCHGRABER, Sarah Anna Liesa Johannes, Stefan KAULFUSS, Steven J. Ferrara, Ulrich Klar, Ulrike Rauh, Ursula MÖNNING
Принадлежит: Bayer AG, Bayer Pharma AG, Broad Institute Inc

The present invention relates to macrocyclic indole derivatives of general formula (I): in which R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , A and L are as defined herein, methods of preparing said compounds, intermediate compounds useful for preparing said compounds, pharmaceutical compositions and combinations comprising said compounds, and the use of said compounds for manufacturing pharmaceutical compositions for the treatment or prophylaxis of diseases, in particular of hyperproliferative disorders, as a sole agent or in combination with other active ingredients.

Подробнее
Номер записи: 107
08-09-2022 дата публикации

LUBRICATION SYSTEM

Номер: US20220282832A1
Автор: WANG GUO-WEI
Принадлежит:

A lubrication system includes a lubricator. A detecting unit includes an oil introducing part, multiple chambers, multiple blockage detectors and a processor. The oil introducing part is connected between the detecting unit and the lubricator. The oil introducing part communicates with the chambers. The blockage detectors are electrically connected to the processor and monitor transportation status of lubrication oil of the chambers. The processor judges the transportation status of the lubricating oil of the chambers by results from the blockage detectors. The lubrication system finds out blockage in the oil paths immediately so as to remove the blockage timely. 1. A lubrication system comprising:{'b': '1', 'a lubricator (), and'}{'b': 2', '21', '221', '23', '24', '21', '2', '1', '21', '221', '23', '24', '221', '24', '221', '23, 'a detecting unit () having an oil introducing part (), multiple chambers (), multiple blockage detectors () and a processor (), the oil introducing part () connected between the detecting unit () and the lubricator (), the oil introducing part () communicating with the chambers (), the blockage detectors () electrically connected to the processor () and monitoring transportation status of lubrication oil of the chambers (), the processor () judging the transportation status of the lubricating oil of the chambers () by results from the blockage detectors ().'}2322132424221243. The lubrication system as claimed in further comprising a blockage removal unit () that communicates with the chambers () claim 1 , the blockage removal unit () connected to the processor () claim 1 , when the processor () judges that the transportation status of the lubricating oil of one of the chambers () is abnormal claim 1 , the processor () activates the blockage removal unit ().33313232321322333213223222212322323. The lubrication system as claimed in claim 2 , wherein the blockage removal unit () includes an air compressor () and a box () claim 2 , the box () ...

Подробнее
Номер записи: 108