Measuring apparatus for assessing performance of antisludging agent based on light transmittance ratio method

This invention relates to a measurement mechanism to assess the performance of anti-encrustation agent based on luminousness method, equipped with a darkroom, titration solution container, constant-current dosing pump, magnetic stirring apparatus, electric heating rods, measuring pool, Na2CO3 in the titration container was pumped into measuring pool by constant-current dosing pump, in the measuring pool was CaCl2 and anti-encrustation agent to be measured, through photoelectric sensor and its switching circuit to make a transducer, computer and supporting software to realize the luminousness automatic checkout system, the amount of agents, magnetic stir, solution temperature automatic checkout system; in the beginning, the luminousness of solution was invariant, then suddenly dropped when the titration was added to a certain amount, the computer record corresponding volume of titration to assess the performance of different anti-encrustation agent under the same condition. This device was ...

Indirect air cooling method and system for working medium adopting parallel-connection positive and reverse refrigeration cycle

The invention discloses an indirect air cooling method and a system with the working fluid of parallel-connected obverse and inverse refrigeration cycles. Based on the phase transition in the working fluid cooling process, a double-phase transition heat exchanger and a single-phase transition heat exchanger are respectively coupled with an obverse refrigeration cycle and an inverse refrigeration cycle which are connected in parallel; the saturated gaseous refrigerant from the phase-transition heat exchangers is compressed, boosted and then sent to an air-cooled radiator for exothermic condensation, then the condensed refrigerant enters a liquid storage tank and is decompressed through a throttle valve and sent to the phase-transition heat exchangers so as to complete the obverse refrigeration cycle; or the saturated gaseous refrigerant from the phase-transition heat exchangers is throttled and decompressed through a thermal expansion valve and then sent to the air-cooled radiator and the ...

Indirect air cooling method and system for working medium adopting parallel-connection positive and reverse refrigeration cycle

The invention discloses an indirect air cooling method and a system with the working fluid of parallel-connected obverse and inverse refrigeration cycles. Based on the phase transition in the working fluid cooling process, a double-phase transition heat exchanger and a single-phase transition heat exchanger are respectively coupled with an obverse refrigeration cycle and an inverse refrigeration cycle which are connected in parallel; the saturated gaseous refrigerant from the phase-transition heat exchangers is compressed, boosted and then sent to an air-cooled radiator for exothermic condensation, then the condensed refrigerant enters a liquid storage tank and is decompressed through a throttle valve and sent to the phase-transition heat exchangers so as to complete the obverse refrigeration cycle; or the saturated gaseous refrigerant from the phase-transition heat exchangers is throttled and decompressed through a thermal expansion valve and then sent to the air-cooled radiator and the ...

Measuring apparatus for assessing performance of antisludging agent based on light transmittance ratio method

Detection method and dynamic-static state combined simulation multifunctional experimental system based on conductometric titration dirt property parameters

The invention provides a detection method and a dynamic-static state combined simulation multifunctional experimental system based on conductometric titration dirt property parameters. The conductometric titration based dirt property parameter detection method can accurately control the concentration of calcium ions or carbanions in water solution to further control the forming time of calcium carbonate crystallization dirt, is convenient to accurately measure the induction period of the crystallization dirt, continuously compares the alternating impedance of horizontal electrode pairs with vertical electrode pairs on line, can accurately measure the induction period of particle dirt under the same condition, can obtain the dirt thermal resistance which is the most true to the actual operation condition and is measured at the dynamic station and can simultaneously measure the dirt amount, the dirt layer thickness and various parameters while detecting the induction period; and the system ...

Molecular marker SA7 for detecting rice blast resistant gene Pi25(t)

Said invention provides molecule mark SA7 and specific PCR primer for detecting paddy rice anti ear blast gene Pi25(t), whose nucleotide sequence from 5'end to 3'end of upstream end is CAGCTGTGGACTCAGACCTCTC, nucleotide sequence from 5'end to 3'end of downstream end is GCGAACAAGCGATGAATCTATC. Said invention can mark and identify the extracted DNA in seedling of paddy rice whether it has anti leaf and ear blast gene Pi25(t) or not. Said invention has high accuracy and simple operation and can be used as identify tool for breeding material using Gumei No.2 as parent strain.

Molecular marker SK17 for detecting rice blast resistant gene Pi25(t)

Said invention provides molecule mark SK17 and specific PCR primer for detecting paddy rice anti ear blast gene Pi25(t), whose nucleotide sequence from 5'end to 3'end of upstream end is CAGCTGTGGACTCAGACCTCTC, nucleotide sequence from 5'end to 3'end of downstream end is GCGAACAAGCGATGAATCTATC. Said invention can mark and identify the extracted DNA in seedling of paddy rice whether it has anti leaf and ear blast gene Pi25(t) or not. Said invention has high accuracy and simple operation and can be used as identify tool for breeding material using Gumei No.2 as parent strain.