Traditional Chinese medicine composition for improving gastrointestinal function and preparation method thereof

The invention discloses a traditional Chinese medicine composition for improving a gastrointestinal function and a preparation method thereof, belonging to the field of traditional Chinese medicines. In the invention, traditional Chinese medicines comprising fomitopsis officinalis ames, fruit of fiverleaf akebia, szechwan chinaberry fruit, Chinese knotweed herb, picria fel-terrae lour and Japanese ardisia are taken as raw materials for combining so as to prepare active ingredients, and then the active ingredients and pharmaceutical common accessories are prepared into an oral preparation. Thetraditional Chinese medicine preparation can be used for improving the gastrointestinal function and has a great therapeutic effect for gastrointestinal dysfunction.

Diketopyrrolopyrrole sulfonate compound as well as preparation method and application thereof

The invention discloses a diketopyrrolopyrrole sulfonate compound and a preparation method and application thereof. The structural formula of the compound is as shown in the following formula A or B. The average particle size of a sample of the diketopyrrolopyrrole sulfonate compound powder is smaller than 100 nm, and the diketopyrrolopyrrole sulfonate compound powder has good dispersing performance on pigment; and after the pigment is mixed with the DPP powder, the crystallinity of the original DPP powder is increased, crystal particles are finer and more concentrated, and the intermolecular acting force between the pigments is stronger, so that the generated dispersion effect is better.

Carbazole coupling compound as well as preparation method and application thereof

The invention discloses a carbazole coupling compound as well as a preparation method and application thereof, and the structure of the compound is shown in the following formula, n is an even number in integers from 0 to 20; x is selected from any one of F, Cl, Br and I. The carbazole coupling compound synthesized by the invention contains N dead center and can be more easily adsorbed on the surface of a copper layer, and the carbazole coupling compound has a large conjugate large plane, so that the carbazole coupling compound can have a larger coverage area on the surface of an electrode and can increase cathode polarization; and copper deposition is inhibited, so that deposited particles of electroplated metal are finer, a copper-plated layer obtains highly preferred crystal orientation, and reduction and deposition of copper ions are more effectively prevented. The carbazole coupling compound is adsorbed to a place with high current density in electroplating, and can be used as an electroplating ...

Drilling construction automatically-monitoring system

The invention discloses a drilling construction automatically-monitoring system. The drilling construction automatically-monitoring system comprises a drilling machine base (10), a feeder (4), a chuck (3), a clamp (2), a drill rod (1), a monitoring microcomputer (20), a signal processor (8), an inclinometer (7), a laser sensor (5) mounted on the side surface and at the rear of a drilling machine, an interruptible circuit device (14) for controlling the laser sensor, and a laser reflector board (6) which is mounted on a movable platform on the side surface of the head portion of the drilling machine and can move forth and backward along with a drill of the drilling machine. The inclinometer is mounted on the side surface of the drill rod and is parallel to the drill rod; the clamp, the chuck and the feeder are connected with the interruptible circuit device respectively through a clam hydraulic pipeline, a chuck hydraulic pipeline and a feeder hydraulic pipeline; the interruptible circuit ...

Yellow liquid crystal display pigment yellow derivative and application thereof

The invention discloses a pigment yellow 138 derivative, the structure of which is shown in the specification. The pigment yellow 138 derivative provided by the invention has good photo-thermal stability and gelling uniformity, and the photo-thermal stability and gelling uniformity of the pigment yellow 138 derivative are verified by ultraviolet-visible absorption spectrum, thermogravimetric analysis and scanning electron microscope.

Molecular marker of corn Opaque1 gene and application thereof

The invention relates to a molecular marker of a corn Opaque1 gene and application thereof. The molecular marker is a codominant molecular marker MYO-PD obtained by amplifying specific primers through PCR (polymerase chain reaction), wherein the specific primers are base sequences shown as SEQ ID NO.1-SEQ ID NO.2. The molecular marker completely linked with an o1 gene can be used to perform genotype identification on DNA (deoxyribonucleic acid) of a corn at any period and in any tissue, thus detecting the existence of the o1 gene in each individual plant of the hybridization breeding filial generation and the heterozygous or homozygotic state thereof. Meanwhile, the molecular marker can be used to distinguish between mutants and 10 main breeding parents in China and can accurately detect the existence of the o1 gene in any breeding background population, and the mischoosing rate is 0. The detection method is high in accuracy and simple to operate, thus providing an important technical means ...

Control method for power adapter of LED lamp without electrolysis capacitor

The present invention adopts digital method to control regulated voltage needed by LED, value of constant current power supply of constant current, adopts singlechip software method to generate multiphase high frequency square-wave pulse, uses a plurality of groups of high frequency square-wave pulses to respectively control the ''ON'' and ''OFF'' of multiphase power electronic switch so as to realize to use the active method of multiphase high frequency rectification to repress ripple, uses high frequency rectification, especially the multiphase high frequency rectification and waveform ninety degrees electrical angle phase shifter to shift the peak and fill the valley, uses active power electronic method to replace the traditional energy storage electrolytic capacitor, uses digital method to provide regulated voltage needed by LED, constant current power supply of constant current, uses the active method of multiphase high frequency rectification to repress the control method of the ripple ...

2-2'-BIS-THIAZOLE DERIVATIVES AS ANTIVIRAL AGENTS

... 2-2`-Bis-Thiazole Derivatives as Antiviral AgentsAbstractThe present invention provides small molecule compounds of bishe erocycle in tandem having the structural formula of This compound may effectively inhibit the replication of influenza virus, the DNA replication of hepatitis B virus (HBV), and the formation of FlBsAg and FIBeAg. These compounds can be used for the preparation of a medicament for viral diseases, and may overcome the limitations of the known nucleosides drugs, including cytotoxicity, the requirement of other drugs having different structures for against the drug-resistant virus variants induced by long-term therapy. The structure of the compounds according to the invention is relatively simple and easy to be prepared.

Traditional Chinese medicinal composite used for improving or preventing perimenopause syndrome

The invention relates to a traditional Chinese medicinal composite used for improving or preventing perimenopause syndrome. The composite consists of the traditional Chinese medicines comprising black pepper and sophora flower bud, or black pepper extract and sophora flower bud extract; and the traditional Chinese medicinal composite can be jointly used with one or more of medicines such as glossy privet fruit or glossy privet fruit extract, Kudzuvine root or Kudzuvine root extract, angelica or angelica extract, the root of rehmannia or the extract of root extract of rehmannia and Chinese wolfberry or Chinese wolfberry extract used for preventing or curing perimenopause syndrome, and can be prepared into any formulation of common oral drugs.

Heterocycle non-nucleosides compound and preparation method thereof, medicament composition and purpose as antivirus antivirus inhibitor

Traditional Chinese medicine composition for improving gastrointestinal function and preparation method thereof

The invention discloses a traditional Chinese medicine composition for improving a gastrointestinal function and a preparation method thereof, belonging to the field of traditional Chinese medicines. In the invention, traditional Chinese medicines comprising fomitopsis officinalis ames, fruit of fiverleaf akebia, szechwan chinaberry fruit, Chinese knotweed herb, picria fel-terrae lour and Japanese ardisia are taken as raw materials for combining so as to prepare active ingredients, and then the active ingredients and pharmaceutical common accessories are prepared into an oral preparation. The traditional Chinese medicine preparation can be used for improving the gastrointestinal function and has a great therapeutic effect for gastrointestinal dysfunction.

Antineoplastic traditional Chinese medicine composition

The invention relates to an antineoplastic traditional Chinese medicine composition belonging to the field of traditional Chinese medicines. The antineoplastic traditional Chinese medicine composition is a traditional Chinese medicine composition prepared by taking traditional Chinese medicinal materials, i.e. potentilla discolor, fomes oficinalis sporophore, schefflera arboricola, japanese ardisia and alpine yallow herbs, as raw materials and a traditional Chinese medicine theory and a modern research result as foundations and plays roles in inhibiting neoplasm and inhibiting the neoplasm through synergistic chemotherapy aiming at the paroxysm of the neoplasm. The antineoplastic traditional Chinese medicine composition can be prepared into various oral dosage forms and is used for antineoplastic therapy.

Method for estimating curative effect of pancreatic cancer chemotherapy medicine

The invention provides a method for evaluating the therapeutic effect of a chemotherapeutic drug for treating pancreatic cancer. The composition difference of serum protein is analyzed by utilizing the surface-enhancement laser desorption ionization-flight time mass-spectrometric technique, and a serum protein finger print of pancreatic cancer is established. The tumor totem of pancreatic cancer with high diagnostic efficiency is screened by utilizing the SELDI-TOF-MS technique and the bioinformatics method, and a mass spectrometric model is formed by the serum protein with two mass/charge ratios at 3879Da and 4772Da. The method is objective and effective for evaluating the curative treatment and prognoses of pancreatic cancer, has high sensitivity, specificity and accuracy, and can improve and modify the protein finger print technique. The method has a reasonable design, and is used for reducing the national fatality rate of pancreatic cancer, improving the curative ratio of pancreatic ...

Method for nonlinearly compensating for current intermittence of AC-AC variable frequency device

The invention provides a method for nonlinearly compensating for current intermittence of an AC-AC variable frequency device. The method includes the following steps of firstly, obtaining an ALP setting value; secondly, obtaining a VCI setting value; thirdly, calculating a trigger offset angle delta alpha according to the current intermittence degree; fourthly, calculating a trigger delay angle alpha* according to the voltage control method used during current continuity; fifthly, adding the trigger offset angle delta alpha and the trigger delay angle alpha* together to obtain a final trigger delay angle alpha, and sending the final trigger delay angle alpha to a trigger device. The method has the advantages that voltage distortion occurring in the current intermittence state is effectively reduced, and voltage harmonic waves are eliminated; compared with a segmented linear compensating method, the method is higher in accuracy, can accurately compensate for current intermittence in real ...

Synchronous motor flux linkage observing method based on proportional resonance controller

The invention provides a synchronous motor flux linkage observing method based on a proportional resonance controller. The synchronous motor flux linkage observing method comprises the steps that a voltage, a current, a rotor position and a rotor speed signal of a motor are sampled, and 3/2 conversion is conducted on the voltage and the current; a current model flux linkage is calculated for standby application; a voltage model flux linkage is calculated for standby application, and a voltage model is a voltage model based on the proportional resonance controller; whether the current model flux linkage or the voltage model flux linkage is used is judged according to rotor angular speed. The synchronous motor flux linkage observing method has the advantages that the flux linkages can be effectively observed within a full-speed range; the synchronous motor flux linkage observing method can be applied to an alternating-current-alternating-current variable frequency electro-magnetic synchronous ...

Thin-walled metal structure and tunnel anchoring surrounding rock coupled anti-scour supporting structure

The invention discloses a thin-walled metal structure and tunnel anchoring surrounding rock coupled anti-scour supporting structure, which is characterized by comprising an anchor and mesh supporting body (3), a rigid supporting body (1) and thin-walled metal members (2); anchor rods of the anchor and mesh supporting body (3) are inserted into surrounding rock (4) for forming a shell bearing structure which is tantamount to reinforced concrete; the thin-walled metal members (2) are positioned between the anchor and mesh supporting body (3) and the rigid supporting body (1) and are fixedly connected with the rigid supporting body (1). With the adoption of the anti-scour supporting structure, the surrounding rock can effectively absorb dynamic energy generated by deformation and motion of an anchorage zone in the process of whole motion and deformation of the surrounding rock towards a tunnel free space, the anchorage surrounding rock can be stabled as soon as possible, an effective supporting ...

Molecular marker of corn Opaque 5 gene and application thereof

The invention relates to a molecular marker of a corn Opaque 5 gene and application thereof. The molecular marker amplifies the special primers and the base sequence of a DNA segment SSR9890 in a way that: the forward primer is amplified from 5' end to 3' end to be CATGCACCCTTTAGTGTAACAC and the reverse primer is amplified from 5' end to 3' end to be GGTACATACATGCAATTTTCGT; and the molecular marker amplifies the special primers and the base sequence of a DNA segment SSR7673 in a way that: the forward primer is amplified from 5' end to 3' end to be GCCGCTTTAATTTGGCTATTAT and the reverse primer is amplified from 5' end to 3' end to be GCATTGGCAAGAGCACACTA. The two molecular markers can identify the gene type of the DNA of any period and any tissue of the corn and can detect whether an O5 gene is in each single strain of the crossbreeding filial generation or not and detect whether the O5 gene is in the heterozygous or homozygous state. And the detection method has high accuracy and simple ...

Multilevel movement indicating device of hoisting machine

The invention relates to a multilevel movement indicating device of a hoisting machine, belonging to the technical field of mine mining. The device comprises a power source, a PLC (Programmable Logic Controller) signal processing module, a photoelectric coupler, a drive circuit, an LED arrow light and a digital display tube. The level depth of a coal mine can be indicated by the device in real time, the reliability and the safe movement of the hoisting machine and the capability on monitoring the hoisting machine are improved, and the safety of underground work is ensured.

Device and method for detecting initial position angle of double fed electric machine rotor

The invention relates to an initial position angle detecting device of a double-feed motor rotor and a method thereof. The device includes voltage detecting circuits that are respectively connected with a stator and a rotor of the doubly-fed machine. The voltage detecting circuits are respectively used for detecting the induced electromotive force which is output by the stator side and the rotor side of the double-feed motor, and converting the induced electromotive force into weak electrical signals. The voltage detecting circuits are respectively connected with zero crossing comparison circuits which convert the detected induced electromotive force output by the stator and the rotor of the voltage detecting circuits into square wave signals; the output ends of the zero crossing comparison circuits are respectively connected with two groups of photoelectric isolation circuits which deliver the square wave signals output by the zero crossing comparison circuits into a main processor circuit ...

Gynaecology warms up palace area

The utility model discloses a gynaecology warms up palace area, including warm palace area body, the positive outer lane evenly distributed of warm palace area body has a plurality of massage balls, and the openly middle part of warm palace area body is equipped with the breach, and the inboard of breach is equipped with insulating layer, hot plate, traditional chinese medicine layer and medical gauze from inside to outside in proper order, and medical gauze's the left and right sides all is equipped with vibrating device on the body of warm palace area, and the left end of warm palace area body is connected with a fixed band through elastic connection band, and the right -hand member of warm palace area body is connected with the 2nd fixed band through elastic connection band. The utility model discloses stable in structure, easily fixed, the adaptation crowd is wide, the treatment during by the cold gynaecology disease that causes in palace the effect obvious, warm palace is effectual ...

Diketopyrrolopyrrole derivative and synthesis method thereof

The invention relates to a diketopyrrolopyrrole derivative and a synthesis method thereof. The diketopyrrolopyrrole derivative is a compound which is shown in a formula I. The method for preparing the compound shown in the formula I comprises the following steps: (1) reacting diisopropyl succinate and R2CN to prepare an intermediate; (2) reacting the intermediate obtained by the step (1) with alkyl halide to prepare a target object. The diketopyrrolopyrrole derivative provided by the invention has higher solid fluorescence in a solid state, the synthesis method of the derivative is easy and convenient, the synthesis yield is higher, and the derivative and the method have broad application prospect in the fields such as ink, fluorescent marks and organic semiconductor photoelectric materials. A formula I is shown in the specification, wherein R1 is C1-C20 straight chain or branched alkyl group, R2 is a substituted phenyl group, and substituent group of the substituted phenyl group is selected ...

HETEROCYCLIC NON-NUCLEOSIDE COMPOUNDS, THEIR PEPARATION, PHARMACEUTICAL COMPOSITION AND THEIR USE AS ANTIVIRAL AGENTS

The invention relates to a kind of antiviral agents, more concretely, relates to a kind of heterocyclic non-nucleoside compounds with the following structures, their preparation and pharmaceutical compositions including the compounds. The said compounds can be used as antiviral agents and as medicaments for treating diseases such as hepatitis B virus, influenza virus, herpes, HIV and so on. © KIPO & WIPO 2009 ...

Boranil compounds based on binaphthol frameworks, and preparation method and application thereof

The invention provides a series of Boranil compounds based on 1,1'-binaphthol parents, a preparation method of the compounds, and application of the compounds on detection of fluorine ions. The compounds meet one of the following general formulas, X is one of O, S, -NH and -N-R, R is one of straight-chain or branch-chain alkyl with the carbon number of 1-10, straight-chain or branch-chain alkenyl with the carbon number of 2-10, a naphthenic base with 3-8 ring carbon atoms, a single-ring or multi-ring aromatic radical with 6-20 carbon atoms, a single-ring or multi-ring miscellaneous aromatic radical with 1-20 carbon atoms, and a single-ring or multi-ring heterocyclic radical with 1-20 carbon atoms, optionally, the R radical is replaced with a substituent group, and the substituent group is alkyl, halogen and/or methoxyl. The formulas are shown in the patent.

Metal complex pigment taking pyrrolo-pyrrole-dione as ligand and preparation method

The invention discloses a metal complex pigment which takes pyrrolo-pyrrole-dione (DPP) as a ligand and a preparation method. The invention is the metal complex pigment which takes DPP as a ligand and has the characteristics of DPP pigment, and also has high fluorescence efficiency and can be used widely in the fields of falsification-resistant ink, fluorescence pigment, painting and plastic and the like. The chemical structure general formula is on the topright.

Controllable impact force physical simulation impact test method and device for impact mine pressure roadway support

The invention relates to a controllable impact force physical simulation impact test method and device for an impact mine pressure roadway support. The method is characterized in that a sleeve and a sliding rod are buried in advance in a physical model, a sliding rod tail of a sliding rod impact component and the sleeve are buried in the physical model, loads in the vertical direction are exerted on the physical model, a roadway is excavated, and a support system is arranged. An impact loading machine is started, and a one-off impact loading or repeated impact loading mode is adopted. A sliding rod head of the sliding rod impact component receives impact loads generated by striking are conducted to the sliding rod tail in the physical model so that the model can generate macroscopic fracture and push peripheral surrounding rocks of the roadway together with the support system to free space of the roadway. Through lifting and incline adjustment of the impact loading machine, destruction ...

Application of diketopyrrolopyrrole-based compound in preparation of pigment dispersant

The invention discloses an application of a diketopyrrolopyrrole-based compound in preparation of a pigment dispersant, the diketopyrrolopyrrole-based compound has the following structural general formula: wherein R is selected from-CF3,-OCH3 or-CHO; and n is an integer of 2-8. The diketopyrrolopyrrole-based compound can be used as a pigment dispersant, and the prepared product has a good dispersion effect.

Rare earth complex red pigment with excellent pigment performance and application thereof

The invention discloses a novel monoazo rare earth complex red pigment and an application thereof. The raw material used for preparing the pigment is easily obtained, the reaction condition is simple and feasible and the yield is high; compared with the similar industrial pigments such as lake pigment P.R.53:1, P.R.57:1, P.R.151, P.R.243 and the like, the rare earth complex red pigment has more excellent pigment performances as follows: excellent water resistance, solvent resistance, fastness to heat, light fastness, fastness to weathering and migration resistance. Simultaneously, compared tothe existing organic pigments that are generated by transitional metal ions such as metal salt or complexes, the rare earth complex red pigment has more flamboyant chromatic light and more satisfactory transparency.

Upper limb traction suspension apparatus

The utility model relates to the technical field of a medical apparatus, in particular to an upper limb traction suspension apparatus, which comprises a panel, a hook and five fixing devices, wherein a hanging hole is formed in the upper side of the panel; the hook is arranged on the hanging hole; five strip-shaped sliding holes are formed in the panel; the sliding holes are distributed from bottom to top in a radial mode; the five sliding devices are respectively slidably arranged on the sliding holes; the fixing devices comprise fixed parts and sliding rods; the fixed parts are arranged at the upper side of the panel; the upper ends of the sliding rods are fixedly arranged on the fixed parts; the lower ends of the sliding rods run through the sliding holes; locating rings are arranged at the bottom ends of the sliding rods; the diameters of the sliding rods are identical with the widths of the sliding holes; the diameters of the locating rings are more than the widths of the sliding holes ...

Application of discolor cinquefoil herb in preparation of medicines for treating hysteromyoma

The invention discloses new application of discolor cinquefoil herb in preparation of medicines for treating hysteromyoma. The discolor cinquefoil herb is a traditional medical Chinese herb without toxic or side effect and can be prepared into medicines for patients with hysteromyoma to take for a long time.

Method and device for processing revolving parts by high-speed jet injection electroforming

The invention provides a method and device for processing revolving parts by high-speed jet injection electroforming. The method is characterized in that an electroforming core mould is partially buried in an electroforming groove which is filled with hard particles or is in direct contact with a plated negative pole surface through a friction piece, so that the defects of accumulated tumors, burrs and the like on a deposition surface can be effectively removed by the friction of the hard particles or the friction piece on an electroforming layer; and a computer is used for controlling a jet nozzle to scan along with a certain track and cooperates with the rotary motion of the electroforming core mould at the same time, so that the exposed electroforming core mould surface is subjected to selective scanning electroforming so as to pile up the required parts layer by layer. The device of the invention mainly comprises a table movement mechanism, a negative pole rotation drive device, a control ...

Maize gene Opaque1 molecular marker and application thereof

The invention relates to a maize gene Opaque1 molecular marker and the application thereof. The specific primer and the base sequence of the augmented DNA fragment IDPg 21 of the molecular marker is that a forward primer is GGGCTTATCTCGCTCTCCA from 5'end to 3'end, and a reverse primer is GGTGCCGGGCATAGTCTAA from 5'end to 3'end; and the specific primer and the base sequence of the augmented DNA fragment IDPg 25 is that the forward primer is CGCTTATTGATGAGCAGTCTG from 5'end to 3'end, and the reverse primer is GGATACTATACTCGATCGCAAT. By utilizing the two molecular markers of the invention, the DNA type of any tissue of maize in any period can be identified, and the existence of 01 gene in each single plant of hybridization breeding offspring and the state of heterozygosis or homozygosis are detected. The detection method has high accuracy, is easy to operate, and provides an important technological measure for the DNA molecular marker assistant breeding utilizing the 01 gene.

Primer pair used for detecting Proline 1 genes of zea mays and application of primer pair

The invention relates to a primer pair used for detecting Proline 1 genes of zea mays and an application of the primer pair. A first base sequence of the primer pair is as follows: a forward primer is CGGTGTCACACACTCCGCATAC from the 5'-terminal to the 3'-terminal, and a reverse primer is GAAGGATAGGGCGTTCTTCGAT from the 5'-terminal to the 3'-terminal; a second base sequence of the primer pair is as follows: a forward primer is GGCCGAGGAGGGATACATCA from the 5'-terminal to the 3'-terminal, and a reverse primer is CAGCCCTCAGGGAAGCGATA from the 5'-terminal to the 3'-terminal. DNA (deoxyribonucleic acid) of any tissue of zea mays in any period can be subjected to gene type identification through two molecular markers, and existence of Proline 1 genes in a single plant of a cross-bred filial generation and a heterozygous or homozygous state can be detected. The detection method is high in accuracy, operation is simple, and an important technical means is provided for breeding assisted by the DNA ...

Metal complex pigment taking pyrrolo-pyrrole-dione as ligand and preparation method

Cut bone bevel protractor

The utility model discloses a cut bone bevel protractor, include last movable chi and lower activity chi, upward movable chi and down movable chi pass through bolt 3 swing joint, and upward movable chi all is the L type with lower activity chi, and four locating holes have been seted up with down movable chi symmetry to the chi that upward moves about, and down movable chi tail end is equipped with the scale, and upward movable chi tail end is equipped with the mark chi. The utility model discloses it is not only small and exquisite to what the ability was accurate makes the judgement to cutting a bone angle, for art person provides the accurate bone angle of cutting in the art, realize anticipated effect, the selector meeting that more have more is provided for the patient, and postpone the joint replacement time.

Planting method for directly sowing early-maturing cotton after wheat

The invention provides a planting method for directly sowing early-maturing cotton after wheat, and belongs to the technical field of agriculture. The method comprises the following steps: selecting a middle-early-maturing wheat variety with the whole growth period of less than or equal to 230 days, selecting an early-maturing cotton variety with the whole growth period of 95-105 days, and directly sowing cotton after wheat is harvested. According to the light, simple, labor-saving and efficient planting method for directly sowing the early-maturing cotton after wheat harvesting, the early-maturing cotton is directly sown after wheat harvesting, whole-process mechanical production can be achieved, a traditional wheat-cotton intercropping mode is innovated, compared with traditional wheat-cotton intercropping, the labor cost is reduced by 60% or above, and the materialization and service cost is reduced by 40% or above; the wheat-cotton double cropping planting method is simple and efficient ...

BISHETEROCYCLE TANDEM COMPOUNDS USEFUL AS ANTIVIRAL AGENTS, THE USES THEREOF AND THE COMPOSITIONS COMPRISING SUCH COMPOUNDS

The present invention provides bisheterocycle tandem small molecule compounds of formula P1-P2, the uses thereof and the compositions comprising such compounds, wherein P1 and P2 each independently represent an unsaturated 5-member heterocyclic ring having one or two heteroatoms. Such compounds can effectively inhibit the replication of influenza virus, the DNA replication of hepatitis B virus (HBV), and the synthesis of HBs Ag and HBe Ag. These compounds can be used in the preparation of a medicament for the treatment of viral diseases, and may overcome the disadvantages of the known nucleosides such as cytotoxicity, the occurrence of drug-resistant virus variants induced by long-term therapy, and the requirement of other drugs having different structure. The structures of compounds according to the invention are more simple and easy to be prepared. © KIPO & WIPO 2008 ...

Method and device for processing revolving parts by high-speed jet injection and electroforming

The invention provides a method and device for processing revolving parts by high-speed jet injection electroforming. The method is characterized in that an electroforming core mould is partially buried in an electroforming groove which is filled with hard particles or is in direct contact with a plated negative pole surface through a friction piece, so that the defects of accumulated tumors, burrs and the like on a deposition surface can be effectively removed by the friction of the hard particles or the friction piece on an electroforming layer; and a computer is used for controlling a jet nozzle to scan along with a certain track and cooperates with the rotary motion of the electroforming core mould at the same time, so that the exposed electroforming core mould surface is subjected toselective scanning electroforming so as to pile up the required parts layer by layer. The device of the invention mainly comprises a table movement mechanism, a negative pole rotation drive device, acontrol ...

Heterocyclic non-nucleoside compounds, their preparation, pharmaceutical composition and their use as antiviral agents

The invention relates a kind of antiviral agents, more concretely, relates to a kind of heterocyclic non-nucleoside compounds with the following structures, their preparation and pharmaceutical compositions including the compounds. The said compounds can be used as antiviral agents and as medicaments for treating diseases such as hepatitis B, influenza, herpes, HIV and so on.

Application of scandent schefflera stem and leaf in preparation of radiation-proof health care products

The invention discloses novel application of scandent schefflera stem and leaf in preparation of radiation-proof health care products. The scandent schefflera stem and leaf is the common traditional Chinese medicine, so the scandent schefflera stem and leaf can be prepared into the health care products for patients who work in a radiation environment for a long term or suffer from cancers before or after radiotherapy.

Application of pig nail and pig nail extract to preparation of medicament for treating hysteromyoma

The invention discloses new application of pig nail and a pig nail extract to the preparation of a medicament for treating hysteromyoma. Since the pig nail and the pig nail extract do not have toxic or side effects, a medicament for a patient suffering from the hysteromyoma to take for a long time can be prepared.

Boost does not have APFC circuit that dc magnetic biasing does not have electrolytic capacitor

The utility model provides a boost does not have APFC circuit that dc magnetic biasing does not have electrolytic capacitor which characterized in that: recommend oscillation circuit including the high frequency self excitation of first group, oscillation circuit is recommended in the high frequency self excitation of second group, MCU, the integrated transformer TR of magnetism and the MCU power supply sampling circuit of " day " style of calligraphy magnetic core, oscillation circuit was recommended in the high frequency self excitation of first group winding N11 and winding N12 wind on the integrated transformer TR's of magnetism a side column respectively, oscillation circuit was recommended in the high frequency self excitation of second group winding N14 and winding N13 wind on another side column of the integrated transformer TR of magnetism respectively, MCU power supply sampling circuit's winding NV is on the center pillar at the integrated transformer TR of magnetism, the MCU ...

Method for detecting blood serum tumor markers

The invention provides a method for detecting the totem of serum tumor. The composition difference of serum protein is analyzed by utilizing the surface-enhancement laser desorption ionization-flight time mass-spectrometric technique, and a serum protein finger print of pancreatic cancer is established. A mass spectrometric model is formed by the serum protein with three mass/charge ratios at 11753Da, 8615Da and 8256Da, and the tumor totem of pancreatic cancer is analyzed by the bioinformatics method. The tumor totem of pancreatic cancer with high diagnostic efficiency is screened by utilizing the SELDI-TOF-MS technique and the bioinformatics method. The method provides an animal experiment base for clinically diagnosing pancreatic cancer, has high sensitivity, specificity and accuracy, and can improve and modify the protein finger print technique. The method has a reasonable design, and is used for reducing the national fatality rate of pancreatic cancer, improving the curative ratio of ...

2-THIOPHEN-2-YL-OXAZOLE, 2-THIOPHEN-2-YL-THIAZOLE AND 2-THIOPHEN-2-YL-1H-IMIDAZOLE DERIVATIVES AS ANTIVIRAL AGENTS AND THE USE THEREOF

... 2-THIOPHEN-2-YL-OXAZOLE, 2-THIOPHEN-2-YL-THIAZOLE AND 2-THIOPHEN-2-YL-1H-IMIDAZOLE DERIVATIVES AS ANTIVIRAL AGENTS AND THE USE THEREOFAbstractThe present invention provides small molecule compounds of bisheterocycle in tandem having the structural formula of[err]This compound may effectively inhibit the replication of influenza virus, the DNA replication of hepatitis B virus (HBV), and the formation of HBsAg and HBeAg. These compounds can be used for the preparation of a medicament for viral diseases, and may overcome the limitations of the known nucleosides drugs, including cytotoxicity, the requirement of other drugs having different structures for against the drug-resistant virus variants induced by long-term therapy. The structure of the compounds according to the invention is relatively simple and easy to be prepared.

Production technology for crystal smelting stone

The invention provides a production technology for crystal smelting stone and relates to the technical field of crystal processing. Natural crystal offcut generated in crystal processing production serves as a raw material, the piezoelectric property of crystal is used, and the crystal smelting stone is obtained through a smashing technology, a magnetic separation technology and a smelting technology. According to the production technology for the crystal smelting stone, the piezoelectric property of the crystal offcut is used, the crystal offcut is smelted in a specially-designed smelting furnace, so that crystal smelting stone blanks capable of being processed and used again are obtained, waste of the crystal processing offcut is avoided, and the production technology has the advantages of being simple and allowing waste materials to be recycled.

Helical involute gear and processing method thereof

The invention relates to a helical involute gear and a processing method thereof. The helical involute gear is characterized in that a tooth surface molded line is a helical involute which is a curve spread by a rack type line straightly moving along the pitch circle tangent line and pure-rolling with a gear pitch circle. The helical involute gear has clear and easy drive principle, can ensure the drive continuity and the drive uniformity, and can realize surface meshing with large meshing area so that the bearing capacity is strong; the helical involute gear has long meshing line and large superposition coefficient, especially, an inclined helical involute conical gear is easy to implement speed reduction at high speed ratio. The helical involute conical gear can realize the expansion processing, thereby having high processing accuracy, low processing cost and high processing tooth surface hardness, improving the motion stability of the gear and the bearing capacity, and prolonging the ...

Azo type pigment containing rare earth elements

The invention relates to an azo type pigment containing rare earth elements, which is mainly prepared by the reaction of azotic barbituric acid and compound containing rare earth elements, wherein themolar ratio of the azotic barbituric acid and the compound containing rare earth elements is 1: (1-2). The azo type pigment containing rare earth elements prepared in the invention achieves the advantages of good flowability, good thermal stability, sunfast, fastness to weathering, brilliant color and light, and no auxiliary agent needed. In addition, XRD detection shows: the azo type pigment containing rare earth elements prepared in the invention has more structured crystal form than the existing azo type pigments.

Traditional Chinese medicine composition for alleviating asthenopia and preparation method thereof

The invention discloses application of a traditional Chinese medicine composition for preparing a medicament for alleviating asthenopia. The preparation method comprises the following steps of: preparing an active component by using the Chinese medicinal herbs of China rose, safflower, meadowrue root and rhizome and Chinese knotweed; and then making the active component and a common medicament auxiliary material into an oral preparation.

Application of myrica nana cheval to preparing traditional Chinese medicines for treating osteoporosis

The invention discloses new application of myrica nana cheval to preparing traditional Chinese medicines for preventing and treating osteoporosis. The myrica nana cheval is singly used or combined with other traditional Chinese medicines with preventing and treating effects to prepare any forms of medicines suitable for oral administration according to the conventional preparation method, wherein other medicines with the effects of preventing and treating osteoporosis include one or two of radix puerariae and epimedium herb. The medicines are suitable for the patients with osteoporosis.

Brush plating cadmium passivating solution as well as preparation method and passivating method thereof

The invention belongs to a surface processing technology, and relates to improvement of a brush plating cadmium passivating solution as well as a preparation method and a passivating method thereof. The formula of the brush plating cadmium passivating solution comprises the following ingredients: 3g/L to 6g/L of chromic anhydride, 0.1ml/L to 0.2ml/L of concentrated sulfuric acid, 4g/L to 5g/L of sodium chloride, and deionized water which is used as a solvent. The preparation method of the brush plating cadmium passivating solution comprises the following steps of burdening and preparing the solution. The passivation method comprises the following steps of washing by adopting the deionized water; grinding; washing by adopting the deionized water; drying; passivating; washing by adopting the deionized water; and drying. By adopting the brush plating cadmium passivating solution as well as the preparation method and passivating method thereof, an ideal iridescent passivating film can be obtained ...

BISHETEROCYCLE TANDEM COMPOUND HAVING ANTIVIRAL AGENT FUNCTION, AND APPLICATION OF COMPOSITION CONTAINING THE SAME IN TREATMENT OF VIRAL DISEASE

PROBLEM TO BE SOLVED: To provide the medical use of a bisheterocycle tandem, small molecular organic compound usable as a non-nucleotide antiviral agent. SOLUTION: There is provided applications of a compound having a structure represented by formula IV in treating the viral diseases caused by influenza virus, hepatitis virus, herpes virus or AIDS virus wherein R2 is H; R3, R6 and R7 have each specific groups; X4 is S; X1 is CH; Y1 is O, S, or NH; and Y4 is N. COPYRIGHT: (C)2011,JPO&INPIT ...

Preparation method of quinoline derivative

The invention relates to a preparation method of quinoline derivative, which mainly comprises the following steps: with the existence of a rare earth catalyst, substitutional aniline reacts with an Alpha, Beta unsaturated aldehyde, ketone or esters compound so as to obtain a target compound. The preparation method has the advantages of being simple and quick in synthetic procedures, mild in synthetic condition, low in synthetic cost, higher in synthetic yield, and applicable to multiple reaction substrates, etc.

Piezoelectric ceramic electric ballast

The invention relates to an electronic ballast of piezoelectric ceramic, which belongs to the technical field of switch power supply. The electronic ballast comprises piezoelectric ceramic; the two input terminals of piezoelectric ceramic are connected with the AC supply of pre-set frequency; a resonance starting circuit composed of serially-connected inductance elements and capacitance elements is connected between the two output ends of the piezoelectric ceramic; the two ends of the capacitance elements are respectively connected with a first lamp connecting terminal (M) and a second connecting terminal (N) of a gas discharge lamp and lantern. The invention adopts a feasible technical proposal where the piezoelectric ceramic is used for achieving the functions of the ballast; the piezoelectric ceramic not only has the advantages of high reliability and high temperature resistance, but also effectively decreases the pre-stage and last stage electromagnetic interference by an electrical ...

Preparation method of quinoline derivative

The invention relates to a preparation method of quinoline derivative, which mainly comprises the following steps: with the existence of a rare earth catalyst, substitutional aniline reacts with an Alpha, Beta unsaturated aldehyde, ketone or esters compound so as to obtain a target compound. The preparation method has the advantages of being simple and quick in synthetic procedures, mild in synthetic condition, low in synthetic cost, higher in synthetic yield, and applicable to multiple reaction substrates, etc.

Application of scandent schefflera stem and leaf in preparation of radiation-proof health care products

The invention discloses novel application of scandent schefflera stem and leaf in preparation of radiation-proof health care products. The scandent schefflera stem and leaf is the common traditional Chinese medicine, so the scandent schefflera stem and leaf can be prepared into the health care products for patients who work in a radiation environment for a long term or suffer from cancers before or after radiotherapy.

Multi-phase electromagnetic induction no-pole fluorescent tube

The invention provides a multiphase electromagnetic induction electrodeless fluorescent lamp, comprising a high frequency multiphase current generation and controlling device, high frequency electromagnetic coupling coils, a fluorescent lamp and closed tubes of the fluorescent lamp, wherein, the high frequency multiphase current generation and controlling device is of the high frequency three phase or the multiphase of which the number of phases is more than three; the number of the high frequency electromagnetic coupling coils, the number of the excitation closed tubes of a fluorescent lamp and the number of the phases of the high frequency multiphase current generation and controlling device are the same; each excitation closed tube of the fluorescent lamp is provided outside with a single phase high frequency electromagnetic coupling coil. The multiphase electromagnetic induction electrodeless fluorescent lamp has the advantages of simple structure and reliable performance; moreover, ...

Long-acting insulin-Fc fusion protein

The invention provides a long-acting insulin-Fc fusion protein and a preparation method thereof. The insulin-Fc fusion protein provided by the invention has reduced insulin receptor affinity, improved selectivity to auxin receptors, prolonged in-vivo half-life period, prolonged in-vivo hypoglycemic maintenance time, reduced insulin use interval time, reduced hypoglycemic risk and other side effects.

Application of discolor cinquefoil herb in preparation of medicines for treating hysteromyoma

The invention discloses new application of discolor cinquefoil herb in preparation of medicines for treating hysteromyoma. The discolor cinquefoil herb is a traditional medical Chinese herb without toxic or side effect and can be prepared into medicines for patients with hysteromyoma to take for a long time.

Centrum fracture struts pincers

The utility model discloses a centrum fracture struts pincers, including binding clip, left side pincers neck, right side pincers neck, left side pincers handle, right forceps handle, articulated shaft no. 1, articulated shaft no. 2, articulated shaft no. 3 and articulated shaft no. 4, left side pincers neck, right side pincers neck are connected through articulated shaft no. 1, articulated shaft no. 3 respectively in the binding clip lower part left and right sides, and left side pincers handle, right forceps handle are connected through articulated shaft no. 2, articulated shaft no. 4 respectively with right side pincers neck bottom to left side pincers neck. The utility model discloses strutting the use, can passing through the pedicle of vertebral arch passageway, insert the bone piece below that sinks that needs strutted, through strutting messenger's reduction of the fracture, the sclerotin resets effectually, resumes fast.

1-(3-benzoylaminobenzyl)-1H-indazole-3-carboxamide compounds, and preparation method and antiviral use thereof

The invention relates to virus inhibitors, and concretely relates to 1-(3-benzyl-benzoylaminobenzyl)-1H-indazole-3-carboxamide organic micro-molecular compounds having a structure represented by general formula 1 and used as non-nucleoside virus inhibitors, pharmaceutically acceptable salts or acceptable hydrates thereof, a preparation method thereof, and an application of the compounds in the preparation of drugs for treating viral diseases comprising hepatitis C, hepatitis B, influenzas, herpes, AIDS and the like, especially an application in the preparation of drugs for treating the hepatitis C. The compounds have the advantages of simple synthesis, easily available raw materials and low toxicity.

Novel portable computer chip heat dissipation of improvement in structure device

The utility model provides a novel portable computer chip heat dissipation of improvement in structure device, including fan base, fan groove, shaft, blade, fan joint, water cooling plant, water -cooled tube and stirrup are buckled, the fan groove the higher authority of being provided the fan base, the shaft install the center in the fan groove, rooting -in of blades in the top of shaft, the fan joint be provided the medial surface of fan base, the water cooling plant pass through the water -cooled tube and install the upper portion at the fan base, the water -cooled tube be provided the intermediate position of water cooling plant and fan base, the stirrup buckle the upper portion of installing at the water -cooled tube. The utility model discloses a setting that fin, water -cooled tube and stirrup were buckled is favorable to increasing heat radiating area, improves the radiating effect for simple to operate is nimble, further is favorable to making the fastening firm, prevents outer ...

Device and method for detecting initial position angle of double fed electric machine rotor

The invention relates to an initial position angle detecting device of a double-feed motor rotor and a method thereof. The device includes voltage detecting circuits that are respectively connected with a stator and a rotor of the doubly-fed machine. The voltage detecting circuits are respectively used for detecting the induced electromotive force which is output by the stator side and the rotor side of the double-feed motor, and converting the induced electromotive force into weak electrical signals. The voltage detecting circuits are respectively connected with zero crossing comparison circuits which convert the detected induced electromotive force output by the stator and the rotor of the voltage detecting circuits into square wave signals; the output ends of the zero crossing comparison circuits are respectively connected with two groups of photoelectric isolation circuits which deliver the square wave signals output by the zero crossing comparison circuits into a main processor circuit ...

Oil and gas mining right database management system

An oil and gas mining right database management system disclosed by the present invention comprises a server body, an interface, a server protection shell, a heat dissipation assembly, a flat cable assembly, a rubber non-slip mat and a first through groove, one side of the server body is provided with the interface, and the outer wall of the server body is provided with the server protection shell. The server protection shell is arranged on the server body and matched with the server body, the server body is arranged in the server protection shell, a heat dissipation assembly is arranged on one side of the server protection shell, and a wire arrangement assembly is arranged on the outer wall of the server protection shell and corresponds to the interface; according to the server, the heat dissipation assembly is arranged, so that the server body can be conveniently subjected to water cooling, the heat dissipation effect on the server body is good, the aging speed of the server body is slowed ...

Phosphorylated dihydroisoquinolone derivative and preparation method thereof

Compared with a traditional preparation method, the phosphorylated dihydroisoquinolone derivative provided by the invention has the advantages that in the preparation process of the phosphorylated dihydroisoquinolone derivative, the raw materials are simple and easy to obtain, the reaction conditions are milder, and the phosphorylated dihydroisoquinolone derivative can be used for preparing the phosphorylated dihydroisoquinolone derivative. According to the method, the reaction is catalyzed by utilizing renewable green electric energy, the participation of a noble metal catalyst is avoided, the call of green chemistry is further responded, the commercialization cost of the dihydroisoquinolone derivative is reduced, and a foundation is laid for the industrial production of the dihydroisoquinolone derivative.

Ester compound based on diketopyrrolopyrrole structure and preparation method and application thereof

The invention discloses an ester compound based on a diketopyrrolopyrrole structure as well as a preparation method and application of the ester compound. The structure is shown as a formula I, wherein R1 is an essence group, and R2 is any one selected from H, F, Cl, Br, I, CH3, OCH3 and C (CH3) 3. The preparation method of the ester compound based on the diketopyrrolopyrrole structure, provided by the invention, is relatively simple, few in synthesis steps and low in raw material cost, has fluorescence performance and perfume slow release performance, and is expected to be further applied to the fields of organic fluorescent dyes and perfume slow release.

Carbazole-containing quaternary ammonium salt compound as well as preparation method and application thereof

The invention discloses a carbazole-containing quaternary ammonium salt compound as well as a preparation method and application thereof, and the structure of the compound is shown in the following formula, n is an even number in integers from 0 to 20; x is selected from any one of F, Cl, Br and I. According to the carbazole quaternary ammonium salt compound synthesized by the invention, through nitrogen positive ions in the structure, namely a quaternization center, a relatively large coverage area can be formed on the surface of an electrode, cathode polarization can be increased, and copper deposition is inhibited, so that electroplating particles are finer, and a copper plating layer obtains high preferred crystal orientation; therefore, the quaternary ammonium salt leveling agent can be used for acidic copper electroplating as a quaternary ammonium salt leveling agent.

Maize gene Opaque1 molecular marker and application thereof

The invention relates to a maize gene Opaque1 molecular marker and the application thereof. The specific primer and the base sequence of the augmented DNA fragment IDPg 21 of the molecular marker is that a forward primer is GGGCTTATCTCGCTCTCCA from 5'end to 3'end, and a reverse primer is GGTGCCGGGCATAGTCTAA from 5'end to 3'end; and the specific primer and the base sequence of the augmented DNA fragment IDPg 25 is that the forward primer is CGCTTATTGATGAGCAGTCTG from 5'end to 3'end, and the reverse primer is GGATACTATACTCGATCGCAAT. By utilizing the two molecular markers of the invention, the DNA type of any tissue of maize in any period can be identified, and the existence of 01 gene in each single plant of hybridization breeding offspring and the state of heterozygosis or homozygosis are detected. The detection method has high accuracy, is easy to operate, and provides an important technological measure for the DNA molecular marker assistant breeding utilizing the 01 gene.

Bisheterocycle tandem compounds useful as antiviral agents, the uses thereof and the compositions comprising such compounds

The present invention provides small molecule compounds of bisheterocycle in tandem having the structural formula of P1-P2, and the use thereof as well as a composition containing the compounds, each of P1 and P2 is an unsaturated 5-member heterocyclic ring having one or two heteroatoms. This compound may effectively inhibit the replication of influenza virus, the DNA replication of hepatitis B virus (HBV), and the formation of HBsAg and HBeAg. These compounds can be used for the preparation of a medicament for viral diseases, and may overcome the limitations of the known nucleosides drugs, including cytotoxicity, the requirement of other drugs having different structures for against the drug-resistant virus variants induced by long-term therapy. The structure of the compounds according to the invention is relatively simple and easy to be prepared.

Seismal wave excitation method for earthquake CT detection and seismal wave excitation device arranged in roadway

Provided are a seismal wave excitation method for earthquake CT detection and a seismal wave excitation device arranged in a roadway. The method and device are characterized in that an earthquake source is fixed between a top plate and a bottom plate of the roadway through a tightening mechanism or fixed to a roadway wall through an anchor rod and an anchor cable end, a gas spring and a metal spring are used to serve as excitation power sources, a coal and rock mass is stricken through the cushion plate by driving a hammer head to strike a cushion plate buried in the bottom plate of the roadway, or the coal and rock mass is stricken through the cushion plate by striking the cushion plate arranged on the surface of the bottom plate of the roadway, and a seismal wave is excited in the coal and rock mass; or explosion of gas or solids is used to serve as the excitation power source, and the seismal wave is excited in the coal and rock mass. The seismal wave excitation device can be applied ...

Control method for electronic ballast of HID light without electrolytic capacitor

The invention provides a method for controlling an electronic ballast which is matched with a HID light and has no electrolytic capacitor, the technical proposal adopts a single chip microcomputer software, to generate a multiphase high-frequency wave pulse packet, a plurality of groups of high-frequency square wave impulse with different phases are used to respectively control the and the of a multi-phase electronic power electronic switch, and to realize an active method for restraining dc bus ripple by using active power differential electric energy to substitute the traditional method of restraining the dc bus ripple through by using passive electrolytic capacitor storage charge through realizing a multi-phase high frequency APFC (active power factor Correction) method. Bu adopting the technical proposal, the reliability of the HID light electronic ballast is greatly improved, and the performance price ratio surpasses the traditional HIG light electronic ballast with electrolytic ...

A cool sugar tablet with fruit flavor and its production process

The invention discloses a fruity sugar-tablet which contains water-soluble bulking agent, right amount of effervescent agent, powder form fruit juice powder, flavoring essence and sweetening agent, when being swallowed in mouth, the sugar-tablet can slowly release carbon dioxide bubbles, thus achieving the goal of promoting the production of the body fluid, and preventing heatstroke.

Knee replacement variable type angle limiting frame

The utility model discloses a knee replacement variable type angle limiting frame which comprises a fixed bottom plate (1). A limiting frame (2) is fixedly arranged on the fixed bottom plate (1); the limiting frame (2) integrally consists of support levers (3) arranged at an equal interval; the support levers (3) integrally are of an inverted concave structure; an included angle of 5 to 20 degrees is formed between the upper top surface of the limiting frame (2) and the fixed bottom plate (1). According to the utility model, labor intensity of medical personnel in the operating process can be effectively reduced; more importantly, the knee replacement variable type angle limiting frame solves the problem of difficulty in keeping and changing a fixed angle in the prior art. A fixed angle is more exact and the angle is variable.

No electrolytic capacitor HID lamp electronic ballast's digital control circuit

The utility model provides a no electrolytic capacitor HID lamp electronic ballast's digital control circuit, including MCU, the MCU sampling circuit that supplies power, the the power adjustment voltage -doubling circuit, incoming signal sampling module, output signal sampling module and qi hui circuit, alternating current power supply UIN provides the electric energy for the the power adjustment voltage -doubling circuit, MCU power supply sampling circuit's induction coil NV corresponds the inductance L1 and the setting of inductance L2 of the power adjustment voltage -doubling circuit, the MCU power supply sampling circuit provide electric energy and sampled singal according to the influence electricity signal that induction coil NV produced for MCU, incoming signal sampling module and output signal sampling module are used for incoming signal and output signal respectively, MCU respectively with MCU power supply sampling circuit, incoming signal sampling module and output signal sampling ...

Traditional Chinese medicinal composite used for improving or preventing perimenopause syndrome

The invention relates to a traditional Chinese medicinal composite used for improving or preventing perimenopause syndrome. The composite consists of the traditional Chinese medicines comprising black pepper and sophora flower bud, or black pepper extract and sophora flower bud extract; and the traditional Chinese medicinal composite can be jointly used with one or more of medicines such as glossy privet fruit or glossy privet fruit extract, Kudzuvine root or Kudzuvine root extract, angelica or angelica extract, the root of rehmannia or the extract of root extract of rehmannia and Chinese wolfberry or Chinese wolfberry extract used for preventing or curing perimenopause syndrome, and can be prepared into any formulation of common oral drugs.

Heterocycle non-nucleosides compound and preparation method thereof, medicament composition and purpose as antivirus antivirus inhibitor

The invention relates to a kind of antiviral agents, more concretely, relates to a kind of heterocyclic non-nucleoside compounds with the following structures, their preparation and pharmaceutical compositions including the compounds. The said compounds can be used as antiviral agents and as medicaments for treating diseases such as hepatitis B virus, influenza virus, herpes, HIV and so on.

Piezoelectric ceramic electric ballast

The invention relates to a piezoelectric ceramics electronic ballast, which belongs to the switch power supply technical field. The ballast comprises piezoelectric ceramics two input ends of which are connected with an AC power supply with a pre-set frequency; a resonance starting circuit composed of a inductor component and an capacitor component which are connected in series is arranged between two output ends of the piezoelectric ceramics; a first connecting end (M) and a second lamp connecting end (N) are respectively led out of two ends of the capacitor component. The invention has a feasible technical proposal, the piezoelectric ceramics contributing to the realization of the function of the ballast, the piezoelectric ceramics having high reliability and high temperature resistance, the pre-drive being electrically isolated from the final stage of load, and the electromagnetic interference between the pre-drive and the final stage of load being effectively reduce, and also the whole ...

Low ripple LED drive power supply's of no electrolytic capacitor intelligent digital control circuit

The utility model provides a low ripple LED drive power supply's of no electrolytic capacitor intelligent digital control circuit, includes that all -wave voltage multiplying rectifier input circuit, high -frequency oscillating circuits, MCU, signal of telecommunication sampling circuit, magnetic core post, ripple press down ordinary telegram way and all -wave voltage multiplying rectifier output circuit, all -wave voltage multiplying rectifier input circuit and high -frequency oscillating circuits electric connection, MCU's signal output part and high -frequency oscillating circuits's switch circuit's control end electric connection, signal of telecommunication sampling circuit and MCU electric connection, signal of telecommunication sampling circuit provides electric energy and sampled singal for MCU, and the ripple presses down the ordinary telegram way and all -wave voltage multiplying rectifier high -frequency oscillating circuits 0 carries the lamp for load LED with rectification, ...

Fluorine-containing diphenyl-pyrrolo-pyrrolidinedione (DPP) pigments and preparation method thereof

The invention relates to fluorine-containing 1,4-dione pyrrolo[3,4,C]pyrrole derivatives with a structure shown as a formula I. The fluorine-containing 1,4-dione pyrrolo[3,4,C]pyrrole derivatives can be used as pigments, and enrich the color spectrum of the conventional DPP pigments. In the formula I, A and B are respectively selected from aromatic radical, heterocyclic radical, fluorine-containing aromatic radical and fluorine-containing heterocyclic group, and at least one of A and B is the fluorine-containing aromatic radical or the fluorine-containing heterocyclic group, wherein the heteroatoms of the heterocyclic group or the fluorine-containing heterocyclic group are selected from one or more of N, O and S, and the number of the heteroatoms is an integer from 1 to 3.

Fluorescent lamp electrodes with long service life

The invention relates to fluorescent lamp electrodes with long service life, which are characterized in that two bunches of hanging electrodes are respectively connected with end parts of two electrode wires arranged inside a fluorescent lamp. The fluorescent lamp electrodes with long service life need no metal plate or metal screen for shielding and need no additional electrode wire but use lightening rod type electrodes to meet the bombard of a fluorescent lamp electric arc and transform a harmful electric arc root hot point so that the hot point is beneficial to the heat emission of triple electric powder, thereby the service life of the fluorescent lamp electrodes is greatly prolonged.

Molecular marker of corn Opaque 5 gene and application thereof

The invention relates to a molecular marker of a corn Opaque 5 gene and application thereof. The molecular marker amplifies the special primers and the base sequence of a DNA segment SSR9890 in a way that: the forward primer is amplified from 5' end to 3' end to be CATGCACCCTTTAGTGTAACAC and the reverse primer is amplified from 5' end to 3' end to be GGTACATACATGCAATTTTCGT; and the molecular marker amplifies the special primers and the base sequence of a DNA segment SSR7673 in a way that: the forward primer is amplified from 5' end to 3' end to be GCCGCTTTAATTTGGCTATTAT and the reverse primeris amplified from 5' end to 3' end to be GCATTGGCAAGAGCACACTA. The two molecular markers can identify the gene type of the DNA of any period and any tissue of the corn and can detect whether an O5 gene is in each single strain of the crossbreeding filial generation or not and detect whether the O5 gene is in the heterozygous or homozygous state. And the detection method has high accuracy and simple ...

Helical involute gear and processing method thereof

The invention relates to a helical involute gear and a processing method thereof. The helical involute gear is characterized in that a tooth surface molded line is a helical involute which is a curve spread by a rack type line straightly moving along the pitch circle tangent line and pure-rolling with a gear pitch circle. The helical involute gear has clear and easy drive principle, can ensure the drive continuity and the drive uniformity, and can realize surface meshing with large meshing area so that the bearing capacity is strong; the helical involute gear has long meshing line and large superposition coefficient, especially, an inclined helical involute conical gear is easy to implement speed reduction at high speed ratio. The helical involute conical gear can realize the expansion processing, thereby having high processing accuracy, low processing cost and high processing tooth surface hardness, improving the motion stability of the gear and the bearing capacity, and prolonging the ...

Control method for electronic ballast of HID light without electrolytic capacitor

The invention provides a method for controlling an electronic ballast which is matched with a HID light and has no electrolytic capacitor, the technical proposal adopts a single chip microcomputer software, to generate a multiphase high-frequency wave pulse packet, a plurality of groups of high-frequency square wave impulse with different phases are used to respectively control the and the of a multi-phase electronic power electronic switch, and to realize an active method for restraining dc bus ripple by using active power differential electric energy to substitute the traditionalmethod of restraining the dc bus ripple through by using passive electrolytic capacitor storage charge through realizing a multi-phase high frequency APFC (active power factor Correction) method. Bu adopting the technical proposal, the reliability of the HID light electronic ballast is greatly improved, and the performance price ratio surpasses the traditional HIG light electronic ballast with electrolytic ...

Gynaecology uses uterine curet

The utility model discloses a gynaecology uses uterine curet, include spoon head, spoon pole, grab handle and inhale the bag, the inside intermediate position level of grab handle is equipped with the pivot, the left end of pivot passes through the bearing rotation and connects on cross bracket, the right -hand member of pivot passes through the bearing rotation and connects in the backup pad, and the output shaft that shaft coupling and motor are passed through to the backup pad is passed in the pivot, be equipped with the auger between cross bracket and the backup pad in the pivot, left side turn -on connection on the grab handle of backup pad has the adapter, can dismantle on the adapter to be connected with and inhale the bag, the left end outer lane of grab handle evenly is equipped with a plurality of LED lamps, the left end middle part of grab handle switches on and is equipped with a spoon pole, the tip of spoon pole is equipped with a spoon head. The utility model discloses stable ...

Multi-phase electromagnetic induction no-pole fluorescent tube

The invention provides a multiphase electromagnetic induction electrodeless fluorescent lamp, comprising a high frequency multiphase current generation and controlling device, high frequency electromagnetic coupling coils, a fluorescent lamp and closed tubes of the fluorescent lamp, wherein, the high frequency multiphase current generation and controlling device is of the high frequency three phase or the multiphase of which the number of phases is more than three; the number of the high frequency electromagnetic coupling coils, the number of the excitation closed tubes of a fluorescent lamp and the number of the phases of the high frequency multiphase current generation and controlling device are the same; each excitation closed tube of the fluorescent lamp is provided outside with a single phase high frequency electromagnetic coupling coil. The multiphase electromagnetic induction electrodeless fluorescent lamp has the advantages of simple structure and reliable performance; moreover, ...

Drop weight type dynamic and static combined load impact experimental device

The invention discloses a drop weight type dynamic and static combined load impact experimental device which is characterized by comprising a body (1) and a sample bearing table (2), wherein the sample bearing table (2) is positioned on the body (1); a sample is arranged on the sample bearing table (2) and is connected with a hydraulic static load pressure mechanism which applies static pressure; an impact mechanism which can move up and down along a guide post (7) is arranged on the upper part of the body (1) and is connected with a lifting mechanism arranged on the lower part of the body. According to the experimental device disclosed by the invention, the coal and rock sample can be dynamically and controllably loaded in different dynamic and static combined forms, and multiple stress wave loading modes of coal and rock materials are simulated, so that the experimental result has the high practical engineering significance. The drop weight type dynamic and static combined load impact ...

Antineoplastic traditional Chinese medicine composition

The invention relates to an antineoplastic traditional Chinese medicine composition belonging to the field of traditional Chinese medicines. The antineoplastic traditional Chinese medicine composition is a traditional Chinese medicine composition prepared by taking traditional Chinese medicinal materials, i.e. potentilla discolor, fomes oficinalis sporophore, schefflera arboricola, japanese ardisia and alpine yallow herbs, as raw materials and a traditional Chinese medicine theory and a modern research result as foundations and plays roles in inhibiting neoplasm and inhibiting the neoplasm through synergistic chemotherapy aiming at the paroxysm of the neoplasm. The antineoplastic traditional Chinese medicine composition can be prepared into various oral dosage forms and is used for antineoplastic therapy.

Diketopyrrolopyrrole (DPP) quaternary ammonium salt compounds, and preparation and application thereof

The invention provides diketopyrrolopyrrole (DPP) quaternary ammonium salt compounds, which are disclosed as the structural formula in the specification, wherein N-R2 is disclosed in the specification, and R1 is Cl, Br, F, I, CF3, CN, tBu, CH3, H, 2,6-F2, NH2, NO2, OH, CHO, COOH, 3,4-Cl2, or 3-F-5-CH3; n is a whole number ranging from 1 to 18; and x is Br, F, Cl, I, HSO3, HSO4, HCO3, CF3CO3, H2PO4, OTf, OTs or BF4. The compounds have stable structure, and can not cause the phenomena of coating fogging and the like at higher temperature; the big conjugate pi bond in the compounds can be adsorbed on the copper layer surface more easily, and the N center can inhibit the deposition of copper ions more efficiently; and thus, the compounds can be used for leveling as an electroplating leveling additive.

Converting conduction monitoring system for insulated gate transistor used in mine hoist

The invention provides a converting conduction monitoring system for an insulated gate transistor used in a mine hoist, and belongs to a converting conduction monitoring system of a hoister. In the invention, an output terminal of a synchronous signal generating circuit U3 of a conduction monitoring device is respectively connected with a Hall current sensor U1 and a pulse detection circuit U2; the Hall current sensor U1 is connected with an analog/digital (A/D) conversion circuit U8; an input terminal of a DSP (digital signal processing) chip U9 is respectively connected with an output terminal of the A/D conversion circuit U8, an output terminal of the pulse detection circuit U2 and the other circuit U4, and an output terminal of the DSP chip U9 is connected with an input terminal of a protective circuit U5; an output terminal of the protective circuit U5 is respectively connected with input terminals of a standby main circuit U6 and a relay U7; and an output terminal of the relay U7 ...

Computer fault alarm device

The utility model discloses a computer fault alarm device, this computer fault alarm device mainly includes: motherboard, BIOS chip, fault detection appearance, analyzer-controller, record storage, comprehensive display screen, megaphone, a sound production section of thick bamboo, warning flash light, remote alarm cell-phone, the motherboard setting at computer fault alarm device's lower extreme, the BIOS chip set up the bottom at the motherboard, the fault detection appearance set up the upper end at the BIOS chip, the analyzer-controller setting on the right side of fault detection appearance, record storage set up the right side at the analyzer-controller, comprehensive display screen setting at the upside of fault detection appearance and analyzer-controller, the remote alarm cell-phone set up within computer fault alarm device's network remote control scope. The utility model discloses possessed the device that fault detection, analysis processes step show, realized remote alarm, ...

Down-hole coal seam earthquake CT detection vibroseis and method based on seismal waves excited by spring

The invention discloses a down-hole coal seam earthquake CT detection vibroseis and method based on seismal waves excited by a spring. The down-hole coal seam earthquake CT detection vibroseis is characterized by comprising a spring striking mechanism and a power mechanism, wherein the spring striking mechanism is installed inside a sleeve (11), the sleeve (11) is fixedly installed in a hole drilled in a roadway wall through a fixing mechanism, the spring striking mechanism comprises the spring (12), a hammerhead (15) and a base plate (16), one end of the base plate (16) is inserted into the sleeve (11), the other end of the base plate (16) is located outside the sleeve (11) and abuts against the bottom of the drilled hole, the spring (12) drives the hammerhead (15) to strike the base plate (16), and the end, outside the sleeve, of the base plate (16) strikes the bottom of the hole, so that the controllable seismal waves are generated in a coal seam; a guide groove is formed in the hammerhead ...

Self-compensating controlled seismic source for seismic wave CT detection of underground coal seam working face impact danger zone and seismic source generation method

The invention discloses a self-compensating controlled seismic source for seismic wave CT detection of an underground coal seam working face impact danger zone and a seismic source generation method. The method comprises the steps that a row of drill holes is constructed in the roadway side of an underground coal seam working face; one controlled seismic source is installed in each drill hole; the seismic source of a hydraulic in-hole tensioning mechanism is locked in the corresponding drill hole in an oil injection expanding mode; the seismic source of a pneumatic in-hole tensioning mechanism is locked in the mode that a hydraulic seam cutting tool is utilized to cut a seam, and an air cylinder drives claw plates to stretch out and make the claw plates abut against the wall faces of the hydraulic cut seam; seismic wave energy and frequency generated by the seismic sources can be adjusted by adjusting gas source parameters and electromagnetic parameters of an impact hammer; when the distance ...

Seed-metering device for precision seeding in rice breeding plots

The present invention relates to a rice breeding plot precision sowing seed-metering device, which comprises a seed box, an adjusting frame and a precision sowing seed-metering device, the lower surface of the seed box is fixedly connected with the adjusting frame, the side surface of the adjusting frame is slidably connected with the precision sowing seed-metering device in a clamping manner, and the device can be connected with any carrier through a connection wing, according to the device, the precise seeding devices are arranged on the adjusting frame, so that the most suitable carrier can be correspondingly selected for operation when seeding is performed on different areas, the number of the precise seeding devices and the distance between the precise seeding devices in the device can be flexibly adjusted according to actual requirements, and the suitable number of precise seeding devices are connected to the adjusting frame according to the actual seeding range; the distance between ...

Data processing method and device based on heterogeneous graph neural network

The invention provides a data processing method based on a heterogeneous graph neural network, and the method comprises the steps: obtaining the heterogeneous graph information of a target service, the heterogeneous graph comprising a plurality of nodes and connection edges representing the connection relation of the plurality of nodes; determining neighbor nodes of the target node corresponding to each meta path based on the multiple meta paths; determining the confidence coefficient of each neighbor node of the target node corresponding to each meta path based on the transition probability of the target node corresponding to each meta path and each neighbor node and the similarity of the target node and each neighbor node; aggregating the neighbor nodes of the target node corresponding to each meta-path with the confidence level reaching the standard, and determining the node-level embedding representation of the target node corresponding to each meta-path; and aggregating the node-level ...

Disposable buckle formula is prevented acupuncture and is hindered type and keep somewhere needle

Disposable buckle formula is prevented acupuncture and is hindered type and keep somewhere needle, including the needle file, the needle tubing, casing seat and sheath, casing seat one end fixed connection is in the sleeve pipe, needle tubing one end fixed connection is in the needle file, the other end passes the casing seat in the sheath is located to the sleeve pipe, be equipped with the extension pipe on the casing seat, other end fixed connection in the various tee bend of extension pipe, be equipped with singlehanded the clamp on the extension pipe, still include the safety clamp cover, the safety clamp cover is fixed to be located between needle file and the casing seat, be equipped with the confined locker room in the safety clamp cover, be equipped with separation blade and stopping piece in the exit in the locker room respectively, be equipped with the mouth of threading a needle on separation blade and the stopping piece respectively, be equipped with first barrier on the stopping ...

Heterocyclic Non-Nucleoside Compounds, Their Preparation, Pharmaceutical Composition And Their Use As Antiviral Agents

The invention relates a kind of antiviral agents, more concretely, relates to a kind of heterocyclic non-nucleoside compounds with the following structures, their preparation and pharmaceutical compositions including the compounds. The said compounds can be used as antiviral agents and as medicaments for treating diseases such as hepatitis B, influenza, herpes, HIV and so on.

Benzohetercyclic compounds, preparation method thereof and applications thereof

The invention provides non-nucleoside antiviral inhibitors, especially benzohetercyclic compounds shown by a general formula I or pharmaceutically acceptable salts thereof or hydrates thereof. The invention further provides a method for preparing the compounds or the pharmaceutically acceptable salts thereof or the hydrates thereof. Pharmacological tests show that the compounds or the pharmaceutically acceptable salts thereof or the hydrates thereof can effectively inhibit replication of hepatitis B virus DNA and hepatitis C virus RNA. Therefore, the invention further provides applications of the compounds in preparation of medicaments preventing and/or treating viral infection, especially the hepatitis B virus (HBV) infection and the hepatitis C virus (HCV) infection.

Hoof nail polypeptide preparation for promoting tissue repair and preparation method thereof

The invention discloses a hoof nail polypeptide preparation for promoting tissue repair and a preparation method thereof. In the method, animal hoof extracts, chrysanthemums, common bletilla pseudo-bulbs, and hairyvein agrimonia herbs are taken as raw materials; and the method comprises the following steps: preparing the raw materials into active ingredients; and then preparing an oral and external preparation from the active ingredients and commonly-used pharmaceutical necessities. The preparation can promote tissue repair.

Mine intrinsic safety electric source interception self-recovery protection device

The invention discloses a mine intrinsic safety electric source interception self-recovery protection device, which consists of a detecting circuit, a monostable circuit, a signal isolation overlapping circuit and a drive accelerating alignment circuit, wherein the detecting circuit is divided into two routes, one route is connected with the monostable circuit, and the other route is connected with the signal isolation overlapping circuit; the output of the monostable circuit is connected with the signal isolation overlapping circuit; and the output of the signal isolation overlapping circuit is connected with the drive accelerating alignment circuit. The device is suitable for mine intrinsic safety electric source output short circuit protection, can thoroughly cut off the output current under the condition of the short circuit of the output end of the mine intrinsic safety electric source, can realize the output voltage self-recovery function when solving the failure, and reduces the ...

Electronic chemical anthraquinone quaternary phosphonium salt compound and application thereof

The invention discloses an anthraquinone quaternary phosphonium salt compound of which the structural general formula is shown in the specification. The anthraquinone quaternary phosphonium salt compound disclosed by the invention has good electroplating performance and can generate a synergistic effect with other electroplating additives, and the electroplating performance of the anthraquinone quaternary phosphonium salt compound is verified through a cyclic voltammetry curve and an actual electroplating test.

Mine intrinsic safety electric source interception self-recovery protection device

The invention discloses a mine intrinsic safety electric source interception self-recovery protection device, which consists of a detecting circuit, a monostable circuit, a signal isolation overlapping circuit and a drive accelerating circuit, wherein the detecting circuit is divided into two routes, one route is connected with the monostable circuit, and the other route is connected with the signal isolation overlapping circuit; the output of the monostable circuit is connected with the signal isolation overlapping circuit; and the output of the signal isolation overlapping circuit is connected with the drive accelerating circuit. The device is suitable for mine intrinsic safety electric source output short circuit protection, can thoroughly cut off the output current under the condition of the short circuit of the output end of the mine intrinsic safety electric source, can realize the output voltage self-recovery function when solving the failure, and reduces the energy released by an ...

Hoof nail polypeptide preparation for promoting tissue repair and preparation method thereof

2-2'-bis-thiazole derivatives as antiviral agents

Heterocyclic non-nucleoside compounds, their peparation, pharmaceutical composition and their use as antiviral agents

The invention relates to a kind of antiviral agents, more concretely, relates to a kind of heterocyclic non-nucleoside compounds with the following structures, their preparation and pharmaceutical compositions including the compounds. The said compounds can be used as antiviral agents and as medicaments for treating diseases such as hepatitis B virus, influenza virus, herpes, HIV and so on.