AN ESSENTIALLY FLAT SHINING AND/OR UV STRUCTURE

Method for measuring the thickness of a transparent material

FLAT UV DISCHARGE LAMP USES AND MANUFACTURE

L'invention concerne une lampe plane (1) transmettant un rayonnement dans l'ultraviolet, dite lampe UV, comprenant : des première et deuxième parois diélectriques (2, 3) planes en regard, maintenues sensiblement parallèles et scellées entre elles, délimitant ainsi un espace interne (10) rempli de gaz (7), la première paroi diélectrique au moins étant en un matériau transmett ant ledit rayonnement UV; des électrodes constituées des première et deuxièm e électrodes (4, 5), à des potentiels donnés distincts, pour une décharge pe rpendiculaire entre les parois, la première électrode au moins étant à base d'une couche arrangée pour permettre une transmission globale de l'UV; un ga z émetteur ou un revêtement luminophore (6) sur une face principale interne (22, 32) de la première et/ou de la deuxième paroi diélectrique (2, 3), le l uminophore émettant ledit rayonnement UV en étant excité par le gaz. L'inven tion concerne aussi ses utilisations et sa fabrication.

MULTIPLE GLAZING WITH VARIABLE DIFFUSION BY LIQUID CRYSTALS AND METHOD OF MANUFACTURE THEREOF

The present invention provides multiple glazing with variable diffusion by liquid crystals (100), having first and second sheets of flat float glass (1, 2) held on the edge of their internal faces (11, 21) by a seal (7), in particular made of a given seal material, in particular substantially organic, first and second electrodes (3, 4), a layer (5) of liquid crystals of average thickness E between 5 and 15 µm including 5 µm and excluding 15 µm and incorporating spacers (6). The thickness of each of the first and second glass sheets is less than or equal to 6.5 mm and each of the coated internal faces of the first and second electrodes has a dioptric defect rating, expressed in millidiopters, of less than or equal to (I) where the thickness E of liquid crystals is in µm. The invention also relates to a method of manufacturing such glazing.

超导电缆导体组合绕制方法

The present invention relates to a method for winding the combined conductor of the superconductor cable, including the steps: arranging in parallel a plurality of original superconductor tapes into a group of superconductor tapes; making a thin and flexible tape-shaped substrate; attaching the group of superconductor tapes on the substrate and integrating these two as a whole to keep the uniform tension in order to make the combined superconductor tape of the superconductor cable; winding helically the combined superconductor tape of the superconductor cable around a cable core in a winding angular ª’ with respect to the cable core without overlapping to manufacture the combined conductor of the superconductor cable. The method of the invention simplifies the winding process of the conductor of the superconductor cable, reduces the complex of the system technique and protects the superconductor tapes during winding, not requiring high mechanical property of the superconductor tape, reducing ...

Method for separating magnetic substances in waste ash residue of thermal power plant

The invention relates to a method for separating magnetic substances in waste ash residue of a thermal power plant, relates to a method for recycling the waste ash residue, and aims at solving the problems that a great number of technical devices different in usages are adopted, chemical reagents are needed, the efficiency is low, the machining time is long and the separation cost is increased in a traditional separation method for the waste ash residue of the thermal power plant. The method for separating the magnetic substances in the waste ash residue of the thermal power plant comprises the following steps: washing the waste ash residue of the thermal power plant by adopting water, primarily magnetically separating the waste ash residue, crushing the waste ash residue, secondarily magnetically separating the crushed waste ash residue, respectively filtering magnetic solid waste and non-magnetic solid waste obtained in the magnetic separation step, drying, and completing the separation ...

Automatic connection control system for commuting vehicles based on SOA (Service-Oriented Architecture) service

The invention discloses an SOA service-based commuting vehicle automatic connection control system, which comprises a chassis domain controller, an entertainment cabin domain controller and gateway equipment, and is characterized in that data interaction is performed between the chassis domain controller and the entertainment cabin domain controller through the gateway equipment; a commuting connection function application module and an automatic parking service module are arranged in the chassis domain controller; the commuting connection function application module calls the automatic parking service module to drive a vehicle to be automatically parked into a predetermined target parking space; or the commuting connection function application module drives the vehicle to be automatically parked out of the current parking space by calling the automatic parking service module. According to the method, agile development of functions can be realized, the development cost is saved, the function ...

PROCESS AND DEVICE FOR the MEASUREMENT THICKNESS Of a TRANSPARENT MATERIAL

L'invention concerne un procédé et un dispositif pour la mesure d'épaisseur de matériaux transparents. Plus particulièrement, mais non exclusivement, l'invention vise la mesure d'épaisseur de matériaux en verre et plus précisément encore la mesure d'épaisseur de verre plat, notamment de verre flotté. Selon l'invention, on focalise un faisceau lumineux à fréquence modulée, on réceptionne deux faisceaux ou rayons lumineux renvoyés par chacune des surfaces du matériau transparent, on crée une interférence entre eux, on détermine le nombre de battements par période de modulation du signal d'interférence, on déduit la différence de marche (6) entre les deux faisceaux et l'épaisseur (e) du matériau transparent et on détermine le déphasage (T 358>) dudit signal d'interférence. Cette détermination de déphasage entre les deux signaux provenant chacun d'une des surfaces du matériau transparent peut alors être utilisée pour en déduire d'autres caractéristiques dudit matériau. Elle peut notamment être ...

Flat lighting structure for use as e.g. double glazing of vehicle, has switchable unit with reflecting surface arranged opposite to luminous zone arranged on sides of glass panes, and turning into transparent surface in area

The structure (1000) has two glass panes (2, 3) delimiting an inner space (10) receiving transparent photoluminescent materials (6, 7) that are electrically supplied by two electrodes (4, 5). A luminous zone is arranged on sides (21, 22, 31, 32) of the panes. A switchable unit (100) e.g. reversible electrochemical mirror, has a reflecting surface (109) opposite to the zone and turning into a transparent surface in an area. Independent claims are also included for the following: (1) an assembly or kit comprising a lighting structure (2) a double glazing comprising a lighting structure.

Flat lamp for use as e.g. decoration lamp for window of train, has electric conductor connected to power supply with potential and/or frequency adjusted such that peak value of exterior leak current is of low value

The lamp has an electric safety system, in an external covering of an electrode (4), with an electric conductor separated from the electrode by a dielectric (14). The conductor is connected to a power supply with a potential and/or with a frequency adjusted such that the peak value of an exterior leak current is lesser than or equal to 2 mA, if the frequency is null, or lesser than or equal to 0.7 mA when the frequency is non null. An independent claim is also included for a method of electric protection of a luminous lamp.

PLANE LAMP UV HAS DISCHARGE AND USES.

L'invention concerne une lampe plane (1) transmettant un rayonnement dans l'ultraviolet, dit UV, comprenant des première et deuxième parois diélectriques planes (2, 3) en regard, maintenues sensiblement parallèles et scellées entre elles, délimitant un espace interne (10) rempli de gaz émetteur dudit rayonnement UV (7) et/ou susceptible d'exciter un matériau luminophore (6) émettant dudit rayonnement UV, ledit matériau luminophore étant disposé sur une face principale interne (22, 32) de la première et/ou de la deuxième paroi, la première et/ou la deuxième paroi diélectrique étant en un matériau transmettant ledit rayonnement UV, une première électrode (4) étant intégrée à la première paroi ou sur la face principale externe de la première paroi, une deuxième électrode (5) étant sur la face principale interne de la deuxième paroi, la première électrode et/ou la deuxième électrode étant à base d'un matériau transmettant ledit rayonnement UV ou arrangé pour une transmission globale suffisante ...

Method for producing a multiple glazing unit with variable diffusion by PDLC layer and a multiple glazing unit with a PDLC layer produced according to said method

A method for producing a multiple glazing unit with variable diffusion by liquid crystals can include applying a pre-seal on an internal face of a first substrate to form a strip delimiting a space. The method can further include depositing a liquid crystal composition containing liquid crystals in a polymer matrix on the delimited space. In some examples, the first substrate is assembled with a second substrate and calendared or pressed. Thereafter, the resulting assembly is irradiated and/or heated to simultaneously cross-link the pre-seal and polymerize the liquid crystal composition.

ELECTRICAL CURRENT SUPPLY FOR AT LEAST TWO ELECTRODES

Tumor necrosis factor-a humanized antibody

Provided are a tumor necrosis factor- humanized monoclonal antibody and a encoded nucleic acid sequence thereof, a carrier comprising the nucleic acid sequence and a host cell thereof. Also provided are a pharmaceutical composition comprising the humanized antibody and a use thereof in preparing a medicament. The medicament is applicable in diagnosis and treatment of hTNF-related diseases.

METHOD FOR PRODUCING A MULTIPLE GLAZING UNIT WITH VARIABLE DIFFUSION BY PDLC LAYER AND A MULTIPLE GLAZING UNIT WITH A PDLC LAYER PRODUCED ACCORDING TO SAID METHOD

The present invention proposes a method for producing a multiple glazing unit with variable diffusion by liquid crystals (100) comprising glass sheets (1, 2) held in place by an adhesive seal (7), on the inner faces of the electrodes (3, 4), and comprising a PDLC layer (5) in contact with the adhesive seal (7), the method comprising the following steps: (a) applying, to the first electrode (3), a so-called pre-seal material (7) (b) depositing, on the first electrode (3), a liquid crystal composition (5), the order of steps (a) and (b) being interchangeable, (c) assembling the glass sheets (1, 2), with the inner faces facing each other, by calendering or pressing, (d) after assembling, irradiating and/or heating for the polymerisations, the pre-seal and the composition being made from acrylate without epoxy polymer precursor. The invention also concerns the method of producing such a glazing unit with PDLC.

TUMOR NECROSIS FACTOR-A HUMANIZED ANTIBODY

Provided are a tumor necrosis factor-a humanized monoclonal antibody and a encoded nucleic acid sequence thereof, a carrier comprising the nucleic acid sequence and a host cell thereof. Also provided are a pharmaceutical composition comprising the humanized antibody and a use thereof in preparing a medicament. The medicament is applicable in diagnosis and treatment of hTNFa-related diseases.

POWER SUPPLY OF AN ELECTRICALLY CONTROLLABLE LIQUID CRYSTAL GLAZING, AND METHOD FOR POWERING SUCH A GLAZING

The invention concerns an electrically controllable liquid crystal glazing (VITR) comprising a substrate carrying a liquid crystal element disposed between a first electrode and a second electrode connected to an electrical power supply (ALIM), the liquid crystal element being capable of switching: - from a scattering state in which the glazing (VITR) is subjected to a zero voltage, - to a transparent and/or coloured state, in which the glazing (VITR) is subjected to a sinusoidal alternating voltage (Vnom (t)) of so-called operational amplitude (V0), characterised in that the electrical power supply (ALIM) is adapted to apply, to the glazing (VITR), a starting voltage (Ve(t)) of which the amplitude gradually increases from zero to the operational amplitude (V0) during a starting time (Ton) of at least 0.1 second starting after the electrical power supply (ALIM) is activated, and/or a stopping voltage (Vs(t)) of which the amplitude gradually decreases from the operational amplitude (V0) ...

Wide temperature type air-cooled chiller unit and condensing pressure control method thereof

The invention discloses a wide temperature type air-cooled chiller unit and a condensing pressure control method thereof. The condensing pressure is regulated through combining condensing air volume regulation with condenser area regulation, the condensing air volume regulation refers to regulating the rotating speed of condensing fans, and the condenser area regulation refers to selecting the opening or closing number of a plurality of condensers. The wide temperature type air-cooled chiller unit and the condensing pressure control method thereof are suitable for a wide range of temperature, effectively avoid the frequent action of electromagnetic valves of the condensers and the frequent starting or stopping of the condensing fans, enable the service life of the electromagnetic valve of each condenser to be prolonged, and realize to maintain the condensing pressure in a safe range.

Infrared thermal image nondestructive testing method and device based on double-pulse current thermal excitation

In view of various orientations of defects in a component, single pulse current thermal excitation is difficult to effectively generate an electromagnetic heating effect on defects in the same direction or similar direction as current, and a leak detection phenomenon is easily caused. Therefore, according to the infrared thermal image nondestructive testing method and device based on double-pulse current thermal excitation, two paths of pulse current are emitted at the same time, and thermal excitation is formed in two different directions of a metal test piece; the distribution of a temperature field on the surface of the metal test piece is obtained through real-time infrared thermal imaging so as to detect the defects of the test piece. The double pulse current generators are adopted to simultaneously emit two paths of pulse current, thermal excitation is respectively formed in two different directions of the test piece, the problem that one-way thermal excitation is insensitive to defects ...

Radar frequency band fusion extension method based on MP and Root-MUSIC algorithm

The invention belongs to the technical field of radar target identification, and particularly relates to a radar frequency band fusion extension method based on MP and Root-MUSIC algorithms. Comprising the following steps of: 1, setting two adjacent radars with the same observation angle and different working frequencies, so as to establish an all-pole GTD model of low-frequency and high-frequency electromagnetic echoes for a stationary target consisting of scattering centers; step 2, incoherent parameters, namely a linear phase and a fixed phase, are estimated by using the echo data and conjugate data thereof; and step 3, processing the coherent data by using an improved algorithm, estimating a pole and an amplitude of the broadband complete polarization model, and then calculating by using the original data of the low-frequency sub-band and the high-frequency sub-band to obtain a full-band fusion signal. According to the multiband fusion method provided by the invention, the new covariance ...

ELECTRIC POWER SUPPLY FOR AT LEAST TWO ELECTRODES

The invention relates to an electric power supply (1) for supplying energy to a structure (2) comprising at least two electrodes (20, 21) and a space containing a gas (24) to be excited, a device provided with a voltage generator (10), an inductance (41, 42) connected thereto and linked to the structure for supplying alternating specified frequency voltage (V(t)) to said two electrodes. The inventive power supply is characterised in that comprises the resonance means for fixing said frequency essentially to the resonance frequency fof a system consisting of the structure (2) and said inductance (42).R © KIPO & WIPO 2007 ...

PLANAR OR ESSENTIALLY PLANAR ONES SHINING STRUCTURE

Method for measuring the thickness of a transparent material

METHOD FOR TREATING A GLASS-WALLED CONTAINER AND CORRESPONDING APPARATUS

- The invention relates to a method, and to an associated apparatus, for treating a container (1) comprising a glass wall (2) defining a receiving cavity (3) for receiving a product, said glass wall (2) having an inner face (4) and an opposite outer face (5), said glass wall (2) being provided with a first coating that includes a solid residual compound resulting from a step of dealkalization of the glass in the vicinity of the surface of said inner face (4) of said glass wall (2) to which said container (1) had previously been subjected, said method comprising a step of spraying the surface of said glass wall (2) with droplets of a liquid, in order to form on said glass wall (2), starting from said first coating, a second coating which includes said residual compound and which is more transparent and/or more uniform than said first coating. - Treatment of glass-walled containers.

ELECTRICALLY CONDUCTIVE SUPPORT FOR A GLAZING UNIT HAVING LIQUID-CRYSTAL-MEDIATETD VARIABLE SCATTERING PROPERTIES AND SUCH A GLAZING UNIT

The present invention relates to an electrically conductive carrier for a liquid-crystal glazing unit (100) comprising a multilayer (3) containing, in this order: an electrode comprising an electrically conductive transparent oxide based layer, called the TCO layer; a first barrier layer, based on silicon nitride, of thickness e1 of at least 5 nm; and a second barrier layer, based on silicon oxide, of thickness e2 of at least 30 nm; the thickness e1 is smaller than or equal to e2 and/or e1 is smaller than 80 nm, and the cumulative thickness eb of the first and second barrier layers is larger than or equal to 50 nm and smaller than 150 nm.

METHOD FOR MEASURING THE THICKNESS OF A TRANSPARENT MATERIAL

Le procédé se caractérise en ce qu'on émet un faisceau lumineux (4) à fréquence optique modulée, en ce qu'on réceptionne deux faisceaux ou rayons lumineux (i, j) renvoyés par chacune des surfaces (2, 3) d'une paroi (1) du matériau, en ce qu'on crée une interférence entre eux (i, j) et en ce qu'on détermine la différence de marche .delta. du signal d'interférence. On utilise une diode laser comme source d'éclairement, celuici est modulé par une modulation de la fréquence optique du faisceau. Parmi les rayons diffusés par les deux parois, on sélectionne deux rayons parallèles. Le dispositif de l'invention permet d'effectuer sur chaque capteur des mesures espacées de 0,3 msec. On peut ainsi explorer tous les millimètres de la périphérie d'une bouteille en rotation. Application aux bouteilles en verre ou en plastique claires ou colorées et au verre plat.

Preparation method of aryl boric acid

The invention discloses a preparation method of aryl boric acid, the method starts from a halogenated aryl compound, and relates to the preparation of a Grignard reagent, and then through the reaction of the Grignard reagent and alkyl borane and final purification and acidification,the high purity aryl boric acid is obtained. By the way, the method has the advantages of simple synthesis process operation, universality, low cost, high yield and high purity, is suitable for industrial production, and solves the many problems that the synthesis process of the aryl boric acid in the prior art is rigorous in conditions, low in yield, low in purity, high in cost, and not suitable for in industrial production.

Adipic acid reactor reaction heat recovery system rich in hot water

The invention relates to an adipic acid reactor reaction heat recovery system rich in hot water, which comprises an adipic acid reactor, a reactor cooling water tank, an adipic acid water balance system, a hot water recovery storage tank and a delivery pump, a plurality of groups of reactor coils are arranged in the adipic acid reactor, and WPH in the coils absorbs heat to become hot WPH. One part of the hot WPH is cooled by a cooling water tank of the reactor, then directly enters a hot water recovery storage tank, and is conveyed to a recrystallization process and a salt forming system pipeline through a conveying pump to be cleaned and replaced; the adipic acid water balance system comprises a cold mother liquor tank, a hot mother liquor tank, a high-purity water storage tank, a hot soluble water storage tank, a hot mother liquor heater, a hot mother liquor pump and a circulating pipeline. The device is ingenious in design, the purposes of reducing consumption and saving energy are achieved ...

Preparation method and application of magnetic nickel ferrite loaded fir sawdust biochar material

The invention discloses a preparation method and application of a magnetic nickel ferrite loaded fir sawdust biochar material, and relates to a preparation method and application of a biochar material. The invention aims to solve the problems of complex modification method, high cost, poor organic matter degradation effect and incapability of repeated use in the existing biochar modification method. The method comprises the following steps: 1, preparing fir sawdust biochar; and 2, preparing the nickel ferrite loaded fir sawdust biochar. The magnetic nickel ferrite loaded fir sawdust biochar material is used for degrading organic pollutants. According to the invention, the waste fir sawdust biomass is adopted to prepare the composite material with magnetic recovery capability, and the composite material is used for treating organic pollutants in a water body, so that the purpose of treating waste with waste is achieved; the prepared nickel ferrite loaded fir sawdust biochar still shows an ...

PLANAR OR SUBSTANTIALLY PLANAR LUMINOUS STRUCTURE

GLASS BABY BOTTLE COVERED WITH A COATING FOR PROTECTION AGAINST HEAT SHOCK, AND RELATED MANUFACTURE METHOD

A baby bottle and a method of making the bottle are disclosed, the bottle being a glass container, having a protective coating for protection against thermal shocks that covers the outside of at least a fraction of the glass container, the glass container being made of soda-lime glass and the protective coating having at least a first layer of a flexible material adhering to the glass container. A second layer may be applied over the first layer. 112422442. A baby bottle () comprising a glass container () , having a protective coating () for protection against thermal shocks that covers the outside of at least a fraction of said glass container () , said glass container () being made of soda-lime glass and said protective coating () comprising at least a first layer (A) of a flexible material adhering to said glass container ().21. A baby bottle () according to claim in which said flexible material is a material based on a polyurethane.314. A baby bottle () according to claim 1 , in which said flexible material forming the first layer (A) is obtained by extracting solvent from a first composition constituted by a dispersion of a polyurethane-based substance in a solvent.414. A baby bottle () according to claim 3 , in which said solvent is water and said first composition comprises a dispersion in an aqueous phase of a non-reactive polymerized material of molar weight that is sufficiently high for mere evaporation of the aqueous phase resulting from said extraction of solvent leads to the formation of a film forming said first layer (A).51. A baby bottle () according to claim 4 , in which said dispersion is an aqueous emulsion of said polymerized material.614. A baby bottle () according to claim 1 , in which said first layer (A) has a thickness that lies substantially in the range 30 μm to 300 μm claim 1 , preferably substantially in the range 50 μm to 200 μm claim 1 , and more preferably is substantially equal to 100 μm.7144244424. A baby bottle () according to ...

THICKNESS MEASURING PROCEDURE FOR TRANSPARENCY MATERIAL

MULTIPLE GLAZING WITH VARIABLE DIFFUSION BY LIQUID CRYSTALS

The invention relates to liquid-crystal multiple glazing (100) having: - a first glass sheet (1) and a second glass sheet (1') held together by a contact seal (6), - first and second electrodes (3, 3') with first and second electrical supply areas (90, 31, 90', 31'), - a layer (4) of liquid crystals, with spacers, between 5 and 15 µm thick, 15 µm boundary excluded, - the first glass sheet (1) projecting by a first projecting edge (13) and comprising the first electrical supply area, - an electric wiring (9, 9') with a first wiring inlet (90) with a first polymeric electrical insulating material (61).

MULTIPLE GLAZING WITH VARIABLE DIFFUSION BY LIQUID CRYSTALS AND METHOD OF MANUFACTURE THEREOF

The present invention provides multiple glazing with variable diffusion by liquid crystals (100), having first and second sheets of flat float glass (1, 2) held on the edge of their internal faces (11, 21) by a seal (7), in particular made of a given seal material, in particular substantially organic, first and second electrodes (3, 4), a layer (5) of liquid crystals of average thickness E between 5 and 15 µm including 5 µm and excluding 15 µm and incorporating spacers (6). The thickness of each of the first and second glass sheets is less than or equal to 6.5 mm and each of the coated internal faces of the first and second electrodes has a dioptric defect rating, expressed in millidiopters, of less than or equal to (I) where the thickness E of liquid crystals is in µm. The invention also relates to a method of manufacturing such glazing.

Intelligent scene light control system

The utility model relates to the technical field of intelligent lighting, in particular to an intelligent scene light control system, which comprises an acquisition end, a system management end, a client control end, a system control end and an output terminal. The acquisition end is used for acquiring a control signal of an illumination space; the client control terminal is various control devices for controlling the lighting space; the system control end is used for switching value output and switching on or switching off equipment of the output terminal; the system management terminal is connected with the acquisition terminal, the client control terminal and the system control terminal through Wifi and Zigbee dual-mode wireless transmission modes to transmit data. According to the intelligent scene light control system, through cooperation of the collection end, the system management end, the client control end, the system control end and the output terminal, light output control of ...

Primer and probe sequence for detecting dengue virus nucleic acid fragment

The present invention relates to a primer used for detecting the nucleotide fragment of dengue virus, and a probe sequence. A primer sequence comprises a primer pair consisting of an upstream primer denunpf sequence of AAGGACTAGAGGTTAGAGGAGACCC, and a downstream primer denunpr sequence of CGTTCTGTGCCTGGAATGAT. The probe denunpb sequence is ACAGCATATTGACGCTGGGAAAGACCA.

Waste material processing method

The invention relates to a waste material processing method and aims to solve the problems of high energy consumption, complex processing process, low product quality after degradation and environmental pollution of the conventional waste material processing method. According to the waste material processing method, waste materials are liquefied in petroleum under the actions of high temperature and pressure, liquid processed goods are distilled, and solid matters are separated out. Waste material processing is combined with petroleum processing, the waste materials are liquefied under the dissolution action of high-temperature petroleum at 500 DEG C, hot petroleum and a liquid pyrolysis product are mixed and sent to a fractionating column for distillation separation, and the waste material processing method is used for processing the waste materials.

Electrical supply device for flat lamp structure, has control system connected to switch to control its opening and closing based on period with frequency corresponding to resonance frequency of structure and transformer winding

Dispositif d'alimentation électrique (1) destiné à fournir en énergie une structure (2) qui comporte au moins deux électrodes (20, 21) associées respectivement à deux diélectriques (22, 23) mis en regard et écartés de façon à créer un espace dans lequel règne un gaz (24), le dispositif comportant un générateur de tension (10), un transformateur (40) pourvu d'un enroulement primaire (41) et d'un enroulement secondaire (42), l'enroulement primaire étant connecté au générateur (10) et l'enroulement secondaire étant relié aux deux électrodes (20, 21) pour les alimenter en tension, caractérisé en ce que le dispositif comporte un interrupteur (50) disposé sur le chemin du générateur (10) à l'enroulement primaire (41) du transformateur, un système de pilotage (60) relié à l'interrupteur (50) de façon à commander son ouverture et sa fermeture selon une période T telle que T=1/(2fR) pour laquelle fR correspond à la fréquence de résonance du système - structure (2) et enroulement secondaire (42) ...

Humanized anti-TNFalpha antibodies

The present invention provides a humanized anti-TNF monoclonal antibody and the use thereof. The humanized anti-TNF monoclonal antibody significantly reduces the immunogenicity of murine-antibody while retaining the ability of antibody to recognize antigen, compared with conservative mouse chimeric antibody. Therefore, safety of the antibody in clinical applications has been improved.

Multiple glazing with variable diffusion by liquid crystals and method of manufacture thereof

A multiple glazing with variable scattering by liquid crystals can have first and second flat float glass sheets held on the edge of their internal faces by a joint made of a given joint material. In some examples, the glazing also includes first and second electrodes and a layer of liquid crystals with an average thickness E between 5 and 15 μm. The thickness of each of the first and second glass sheets may be less than or equal to 6.5 mm and each of the internal faces coated with the first and second electrodes may have a dioptric defect score, expressed in millidiopters, of less than or equal to 2+2E/3, where the thickness E of the liquid crystals is in μm.

Multi-station alternating-current voltage testing device

The invention relates to a multi-station alternating-current voltage testing device, and belongs to the technical field of electric energy measurement. According to the multi-station alternating-current voltage testing device, a movable trolley is adopted, the movable trolley comprises a high-voltage source, a display detection unit and testing trays, the testing trays are at least two in number and are arranged on different supporting layers of the movable trolley, each testing tray is provided with at least two testing stations, each testing station is provided with a testing clamp corresponding to a product to be tested, the high-voltage source is in parallel connection with power supply terminals of the testing stations, the display detection unit comprises display modules corresponding to the testing stations respectively, and each display detection module is used for displaying an insulation leakage current parameter value measured on the corresponding testing station. By means of ...

Measuring forces in transparent materials, particularly applicable to production of sheet glass for windows

Le dispositif de mesure comprend un dispositif d'émission de lumière monté du côté de la face du vitrage opposée à celle qui est recouverte de la couche opaque, et comprenant une source de lumière mettant un faisceau lumineux monochromatique (42), un polariseur fixe (44), un modulateur photoélastique (46) qui fournit deux fréquences de référence, des moyens de déplacement relatif du faisceau lumineux par rapport à la zone de mesure du vitrage, un dispositif de réception de la lumière diffusée par la couche opaque (41) comprenant un polariseur analyseur (48), une photodiode à avalanche (50), deux amplificateurs à détection synchrone (54, 56) ayant pour références les deux fréquences qui sont fournies par le modulateur, et un banc d'acquisition (58) permettant de calculer la contrainte dans ladite zone de mesure.

Tumor necrosis factor-a humanized antibody

Provided are a tumor necrosis factor-α humanized monoclonal antibody and a encoded nucleic acid sequence thereof, a carrier comprising the nucleic acid sequence and a host cell thereof. Also provided are a pharmaceutical composition comprising the humanized antibody and a use thereof in preparing a medicament. The medicament is applicable in diagnosis and treatment of hTNFα-related diseases.

Special culture medium for culturing yew plant cells to produce taxol

The invention discloses a special culture medium for culturing yew plant cells to produce taxol, which is obtained by taking B5 culture medium as a basic formula and utilizing an orthogonal optimization test. When the basic component comparison production is carried out on the special culture medium and the B5 culture medium, the content of the taxol in the special culture medium is 4.2 times that of the B5 culture medium; when high-density of yew plant cells are planted, a combined test is carried out by adding silver nitrate, salicylic acid, chitosan, methyl jasmonic acid, tribasic ammonium citrate, lanthanum sulfate, phenylalanine, glycine, tryptophan and lysine in the culturing process, which can further improve the content of the taxol and shorten the production period of cells; and when the cells are cultured at the thirty-first day, the highest content of the taxol in the special culture medium is 285.15 mg/L which is 81 times the highest content of the taxol in the B5 culture medium ...

Aluminium harmonica plate type evaporation condenser

The invention discloses an aluminum harmonica plate evaporation type condenser which comprises a fan, a water-retaining plate, a water distributor, a plate heat exchanger group, a pipeline, a water collecting tank, a water pump, a floating ball valve, a liquid collecting pipe and a gas distributing pipe, wherein a plate heat exchanger group is the aluminum harmonica plate heat exchanger group, the aluminum harmonica plate heat exchanger group is divided into a plurality of independent aluminum harmonica plate heat exchangers, each aluminum harmonica plate heat exchanger is formed through that a plurality of aluminum harmonica plate sheet units are brazed with a left-right or up-down aluminum liquid collecting pipe from top to bottom or from left to right, and each aluminum harmonica plate heat exchanger and an inlet and outlet liquid collecting main pipe are connected into a whole to form the aluminum harmonica plate heat exchanger group. In addition, fillers are filled between every two ...

Automobile engine

The invention relates to an automobile engine, belonging to the technical field of reciprocating piston type internal combustion engines. The automobile engine comprises an engine body and a distribution device arranged on the body. The body comprising a cylinder; a slide block is connected on a piston connecting rod reciprocating in the cylinder; a groove slide way is opened on the outer wall of a rotor meshed with a power output shaft; the slide block is positioned in the groove slide way to form linkage between the piston connecting rod and the rotor; the distribution device comprises a valve switch rotating shaft and a valve switch cam which is arranged on the distribution device and control the switch of gas inlet/outlet valves; transmission between the valve switch rotating shaft and the power output shaft is realized by means of engagement system. The automobile engine drives the rotor to rotate by the piston connecting rod, has simple rotating structure, low noise, and small size ...

Substantially flat luminous and/or uv structure

A purpose of the invention is a flat or substantially flat luminous and/or UV (1000) structure comprising first and second dielectric walls (2, 2', 3, 3') facing each other and defining an internal space (10) comprising a light source (6, 7), first and second electrodes (4) for the light source, generating electric field lines with at least one component perpendicular to the first and second electrodes, the first electrode (4) being supplied or capable of being supplied by a high frequency electromagnetic signal f0, and by covering the exterior of the first electrode, an electric safety system that comprises an electric conductor (41) separated from the first electrode by a dielectric (14), said protective conductor being connected to or capable of being connected to a electrical supply source with a potential V and/or with a frequency f adjusted so that the peak value of the leakage current is less than or equal to 2 mA, if f is zero, or less than or equal to 0.7 mA if f is not zero.The ...

Adjustable mold for manufacturing waist beams and using method of adjustable mold

The invention discloses an adjustable mold for manufacturing waist beams and a using method of the adjustable mold. The adjustable mold comprises a first fixed plate, a second fixed plate, a movable plate and adjusting devices, wherein the movable plate comprises a first plate body and a second plate body; each adjusting device comprises a first fixed seat, a second fixed seat and a movable connecting mechanism; each movable connecting mechanism comprises a first connecting piece, a second connecting piece and a length adjusting mechanism; each first connecting piece is rotatably connected with the corresponding first fixed seat, and each second connecting piece is detachably connected with the corresponding second fixed seat; and the length adjusting mechanisms drive the first connectingpieces and the second connecting pieces to move oppositely or reversely so as to adjust the length of the movable connecting mechanisms. The adjustable mold can be adjusted according to different specifications ...

Automatic assembling device for clamping ring

The invention relates to the technical field of transmission shaft assembling and manufacturing, in particular to an automatic clamping ring assembling device which comprises a feeding mechanism, a feeding mechanism, a guide sleeve transferring mechanism and a clamping ring pushing mechanism. The feeding mechanism is used for storing clamping rings to be assembled and placing the clamping rings on the feeding mechanism one by one; the feeding mechanism is used for transferring a clamping ring placed on the feeding mechanism to the clamping ring pushing mechanism, and the guide sleeve transferring mechanism is used for transferring a guide sleeve to the clamping ring pushing mechanism and penetrating the guide sleeve into the clamping ring transferred to the clamping ring pushing mechanism. And the clamping ring pushing mechanism is used for pushing the clamping ring towards the solid shaft in the axial direction of the guide sleeve, so that the clamping ring reaches the clamping ring mounting ...

PROCESS AND DEVICE FOR the MEASUREMENT THICKNESS Of a TRANSPARENT MATERIAL

Measuring forces in transparent materials, particularly applicable to production of sheet glass for windows

Le dispositif pour la mesure des contraintes de forme comprend un dispositif d'émission de lumière disposé d'un côté du matériau transparent (40) et qui comprend une source de lumière monochromatique (42), un polariseur fixe (44) et un modulateur photoélastique (46), qui fournit deux fréquences de référence f0 et 2f0, une bande diffusante (60) placée de l'autre côté du matériau transparent, des moyens de déplacement du faisceau lumineux émis (62) sur toute la longueur de la bande diffusante, et un dispositif de réception de la lumière diffusée (64) se trouvant du même côté que le dispositif d'émission par rapport au matériau transparent et comprenant un analyseur (48), une photodiode à avalanche (50), deux amplificateurs à détection synchrone (54, 56) ayant pour références les deux fréquences qui sont fournies par le modulateur et un banc d'acquisition (58) permettant de déterminer le déphasage du signal électrique recueilli à la sortie de la photodiode, lorsque des contraintes s'exercent ...

PLANE LAMP UV HAS DISCHARGES AND USES.

L'invention concerne une lampe plane (1) transmettant un rayonnement dans l'ultraviolet, dite lampe UV, comprenant : - des première et deuxième parois diélectriques (2, 3) planes en regard, maintenues sensiblement parallèles et scellées entre elles, délimitant ainsi un espace interne (10) rempli de gaz (7), la première paroi diélectrique au moins étant en un matériau transmettant ledit rayonnement UV, - des première et deuxième électrodes (4, 5), à des potentiels donnés distincts, respectivement intégrées aux première et deuxième parois diélectriques ou sur les faces principales externes (21, 31) des première et deuxième parois diélectriques, la première électrode au moins étant à base d'un matériau transmettant ledit rayonnement UV ou arrangé pour permettre une transmission globale de l'UV, - un revêtement luminophore (6) sur une face principale interne (22, 32) de la première et/ou de la deuxième paroi diélectrique (2, 3), le luminophore émettant ledit rayonnement UV en étant excité par ...

Messung interner Spannungen in einem transparenten Material, wie Fensterscheiben

Verfahren und Vorrichtung zur Messung der Dicke von transparenten Materialien

ELECTRICALLY CONDUCTIVE SUPPORT FOR A GLAZING UNIT HAVING LIQUID-CRYSTAL-MEDIATED VARIABLE SCATTERING PROPERTIES AND SUCH A GLAZING UNIT

An electrically conductive support for a glazing unit having liquid crystal scattering properties may include a multilayer of thin films. In one example, the thin films include an electrode comprising a TCO film, a silicon-nitride-based first barrier film having a thickness el of at least 5 nm, and a silicon-oxide-based second barrier film having a thickness e2 of at least 30 nm. The thickness el may be smaller than or equal to e2 and/or smaller than 80 nm. Further, the cumulative thickness of the first and second barrier films may be larger than or equal to 50 nm and smaller than 150 nm.

METHOD FOR PRODUCING A MULTIPLE GLAZING UNIT WITH VARIABLE DIFFUSION BY PDLC LAYER AND A MULTIPLE GLAZING UNIT WITH A PDLC LAYER PRODUCED ACCORDING TO SAID METHOD

A method for producing a multiple glazing unit with variable diffusion by liquid crystals can include applying a pre-seal on an internal face of a first substrate to form a strip delimiting a space. The method can further include depositing a liquid crystal composition containing liquid crystals in a polymer matrix on the delimited space. In some examples, the first substrate is assembled with a second substrate and calendared or pressed. Thereafter, the resulting assembly is irradiated and/or heated to simultaneously cross-link the pre-seal and polymerize the liquid crystal composition.

REMOTE PREHEAT AND PAD STEAM GENERATION

Methods and systems generate steam for injection in a well to facilitate oil recovery. Water is preheated at a central processing facility, transported to a well pad by hot water lines, and converted to steam by a steam generator at the well pad.

Process for preparing miconazole nitrate ointment

A miconazole nitrate ointment is prepared through thermally fusing the octadecanol, hexadecanol and glyceryl monostearate by water bath at 70-80 deg.C, dissolving sodium benzoate in purified water while stirring, adding tween-20, niconazole nitrate and glycerin sequentially while stirring, heating by water bath at 70-80 deg.C, mixing said two liquid phases while stirring until early emulsifying, homogenizing at 1000-1100 rpm for 5-7 min, and degassing. Its advantages are simple preparing process, high uniformity, moderate viscosity and stable content.

Compound medicament of natural plant extract containing paclitaxel and anticancer application thereof

The present invention is the application of yew branch and leaf extract containing taxol in preparing natural compound medicine and orally taken anticancer medicine. The natural compound medicine consists of yew branch and leaf extract with taxol content of 1-6 % as the main anticancer component, and epimedium extract with icariin content of 10-40 % or Huoba tree root extract with total alkaloid content of 2-15 % for inhibiting the outward medicine exhaust of cell to raise the bioavailability and anticancer effect of taxol. Animal experiment shows that the orally taken compound taxol medicine has obvious inhibition on animal's oophoroma, breast cancer, lung cancer, etc.

Application of 23-HBA for preparing drug to reduce cardiotoxicity caused by adriamycin

The invention relates to the field of natural drugs, in particular to the application of 23-hydroxybetulinic acid (23-HBA) for preparing a drug to reduce cardiotoxicity caused by adriamycin. When being combined with adriamycin, the 23-hydroxybetulinic acid can reduce the consistency of the adriamycin in heart tissues of tumor mice, reverse eardiotoxieity caused by the adriamycin and improve cardiac function, thereby being capable of being used as a myocardial protecting agent of the adriamycin as an antitumor drug.

Hoisting device and hoisting method for steel pile shoe of large-diameter tubular pile

The invention discloses a large-diameter pipe pile steel pile shoe hoisting device which comprises two connecting belts, a steel pile shoe hoisting device and a steel pile shoe hoisting device. The connecting belts are connected to the outer side of the end, needing to be welded, of a pipe pile in a sleeving mode; a first sliding rail, a second sliding rail, a third sliding rail, a fourth sliding rail, a fifth sliding rail and a gear guide rail are fixed to the outer side of the connecting belt. The outer sides of the first sliding rail, the second sliding rail, the third sliding rail, the fourth sliding rail, the fifth sliding rail and the gear guide rail are slidably connected with steel rings and roller bearing platforms. A hoisting arm is welded on the steel ring; a pulley is arranged at the end, far away from the steel ring, of the hoisting arm; the roller bearing platform is arranged at the lower end of the inner side of the steel ring; and a first roller is arranged on the roller ...

Flat lamp, for decorative lighting and illumination, has two glass panels with a gas-filled space between them and external insulated electrodes

The flat lamp structure (1) has at least two flat glass panels (2,3) with a space (10) between them filled with a gas, using xenon which can be mixed with neon. Two electrodes (4,5) are at the glass panels, outside the gas-filled space. The inner surface (22,32) of at least one glass panel is coated with a phosphor material (6,7), on the side towards the gas-filled space. At least one electrode is shrouded by a preferably transparent electrical insulator (14-17), which can be secured at least at one glass panel or be connected to it.

PULSE BALLAST FOR PLANAR LIGHTS

L'invention concerne un circuit électrique pour alimenter une lampe à décharge pulsée, qui comporte deux branches de commutation, une branche de lampe, et deux branches d'alimentation, disposées de la manière suivante : (a) la première et la seconde branche de commutation comportent chacune un interrupteur (X1, X2), une auto-inductance (L1, L2) et une diode (D1, D2), de manière à ce que dans chaque branche de commutation l'interrupteur (X1, X2) soit en parallèle avec la diode (D1, D2), et en série avec l'auto-inductance (L1, L2) ; (b) la branche de lampe comprend deux bornes pouvant être reliées à une lampe à décharge (EL), l'une desdites bornes étant également reliée au point commun desdites première et seconde branches de commutation, l'autre étant également reliée aux deux branches d'alimentation ; (c) les branches d'alimentation comprennent chacune une alimentation de tension (V1, V2) chargeant un condensateur (C1, C2), lesdites alimentations de tension (V1, V2) étant mises en série ...

Luminous multiple glazing unit comprising light-emitting diodes

A luminous multiple glazing unit including: first and second flat glass elements; light-emitting diodes located in an internal space; a reflector including a part fixed to the glazing unit in the internal space; and a first luminous zone associated with the first glass element. In a first configuration, the reflector has a central reflective area for reflecting at least 30% of total flux emitted by the diodes in the group onto a first mechanism scattering light, or, in a second configuration, the reflector forms a beam splitter and has a double-image central reflective area of a first central area for reflecting first central rays onto a first mechanism scattering light and a second central area for reflecting second central rays onto a second scattering mechanism, the reflector reflecting at least 30% of total flux emitted by the diodes in the group.

LUMINOUS GLASS ASSEMBLY

La présente invention concerne un ensemble lumineux vitré comportant un premier vitrage (1) avec une première source de lumière (4), couplée au premier vitrage pour émettre à l'instant t0 à ?1 et pour émettre à l'instant t'?t0 à ? 2 distincte de ? 1, des premiers moyens d'extraction de lumière (5) et des premiers moyens de masquage (6) de la lumière extraite côté face interne;en contact optique avec le premier vitrage, un deuxième vitrage (1')avec une deuxième source de lumière (4'), couplée optiquement au deuxième vitrage, pour émettre audit t0 à ? 3 distincte de ?1, des deuxièmes moyens d'extraction de lumière (5') et des deuxièmes moyens de masquage (6') de la lumière côté face de collage; entre les premiers moyens de masquage et les deuxièmes moyens d'extraction, un premier isolateur optique (2), feuilleté par un premier intercalaire de feuilletage (3); entre les premiers moyens de masquage et les deuxièmes moyens d'extraction, un deuxième isolateur optique (2, 2'), confondu avec le ...

Differential pressure casting machine

The invention discloses a counter-pressure casting machine which comprises a machine body frame comprising a bottom plate assembly, a lower supporting column, a middle plate assembly, an upper supporting column and a top plate assembly which are sequentially arranged and connected from bottom to top, and a first mounting hole is formed in the middle plate assembly; the lower die mounting assembly is embedded in the first mounting hole, and the lower die mounting assembly can do lifting motion relative to the middle plate assembly; the upper mold mounting assembly and the lower mold mounting assembly define a cavity capable of being opened and closed, and the upper mold mounting assembly is in transmission connection with the top plate assembly so as to be driven by the top plate assembly to do lifting motion; the holding furnace comprises a furnace body and a furnace cover; the upper die mounting assembly is provided with a lifting mechanism, the lower die mounting assembly is provided ...

New and old combined in-situ reconstruction method for rainwater box culvert traversing subway station

A new and old combined in-situ reconstruction method for a rainwater box culvert transversely penetrating through a subway station comprises the steps that S1, a top pit and a receiving pit of a jacking pipe are formed in the positions, close to an original rainwater box culvert, of the two side portions of a municipal road correspondingly, and after a top pit cover plate is constructed, soil covering and backfilling are conducted till the designed elevation is reached; s2, traffic guidance is carried out, and a traffic lane is guided to the position above the top pit; s3, support piles, station stand column pile foundations and stand columns below the original rainwater box culverts are sequentially constructed, the remaining original rainwater box culverts in the station range are dismantled, and part of station top plate structures below the box culverts are constructed; s4, a temporary rainwater pipe culvert is abandoned, and a supporting structure system is closed; s5, after the construction ...

PLANE LAMP HAS DISCHARGE.

La présente invention porte sur une lampe plane à décharge (1000) transmettant dans le visible et/ou l'UV comportant transmettant dans le visible et/ou l'UV comportant des première et deuxième parois diélectriques (2, 3) en regard, maintenues parallèles et scellées par au moins un joint de scellement périphérique (8), délimitant ainsi un espace interne (10) rempli de gaz plasmagène et comprenant une source de lumière UV et/ou visible (6), des première et deuxième électrodes (4, 5) dans des plans distincts parallèles aux première et deuxième parois, la première électrode (4) étant à un potentiel V0 plus élevé que le potentiel V1 de la deuxième électrode, et la première électrode étant agencée dans l'espace interne et plus proche de la première paroi diélectrique que la deuxième électrode. Et la première électrode est espacée de la première paroi diélectrique, les première et deuxième électrodes sont séparées par un isolant électrique plan (7) avec au moins une face principale (71, 72), dite trouée, dotée des trous débouchants (73), l'une au moins des première et deuxième électrodes est en contact avec la face principale trouée et présente des discontinuités au moins dans le prolongement desdits trous. The present invention relates to a flat discharge lamp (1000) transmitting in the visible and / or the UV having transmitting in the visible and / or the UV having first and second dielectric walls (2, 3) opposite, maintained parallel and sealed by at least one peripheral seal (8), thereby delimiting an internal space (10) filled with plasma gas and comprising a UV and / or visible light source (6), first and second electrodes (4, 5) in distinct planes parallel to the first and second walls, the first electrode (4) being at a potential V0 higher than the potential V1 of the second electrode, and the first electrode being arranged in the internal space and closer to the first dielectric wall as the second electrode. And the first electrode is spaced from ...

FLAT DISCHARGE LAMP

La présente invention porte sur une lampe plane à décharge (1000) transme ttant dans le visible et/ou l'UV comportant transmettant dans le visible et/ ou l'UV comportant des première et deuxième parois diélectriques (2, 3) en r egard, maintenues parallèles et scellées en périphérie (8), délimitant ainsi un espace interne (10) rempli de gaz plasmagène et comprenant une source de lumière UV et/ou visible (6), des première et deuxième électrodes (4, 5) da ns des plans distincts parallèles aux première et deuxième parois, la premiè re électrode (4) étant à un potentiel VO plus élevé que le potentiel Vl de l a deuxième électrode, et la première électrode étant agencée dans l'espace i nterne et plus proche de la première paroi diélectrique que la deuxième élec trode. Et la première électrode est espacée de la première paroi diélectriqu e, par le gaz, les première et deuxième électrodes sont séparées par un isol ant électrique plan (7) avec au moins une face principale (71, 72), dite tro uée, ...

Electric heating plate convenient to install

The utility model discloses an electric heating plate convenient to install. The electric heating plate comprises mounting assemblies, protection assemblies and an electric heating plate body, cornerprotectors are arranged on the two sides of the electric heating plate body at equal intervals. A protection assembly is movably arranged on one side of the protection corner, mounting assemblies aremovably mounted on the two sides of the protection assembly correspondingly, a splicing assembly is fixedly arranged at one end of the protection assembly, positioning assemblies are mounted at the bottom of the electric heating plate body at equal intervals, and a guide plate is fixedly arranged on the surface of the protection assembly. According to the utility model, a series of structures arearranged, so that the positioning seat is mounted by utilizing the positioning holes to be matched with the external positioning bolts in the using process of the device; and then the device is reinforced ...

Host device and computer system

The embodiment of the invention provides a host device and a computer system, the host device comprises a central processing unit and a micro-control unit in communication connection with the central processing unit, the micro-control unit is independent of the central processing unit for independent power supply, and the micro-control unit is in communication connection with a wireless device; the wireless device is used for collecting a voice control signal and sending the voice control signal to the micro-control unit, and the micro-control unit is used for generating a control instruction according to the voice control signal, generating a startup signal when the control instruction comprises a startup instruction and sending the startup signal to the central processing unit. The central processing unit is used for executing startup operation according to the startup signal. According to the host equipment and the computer system provided by the embodiment of the invention, the startup ...

Decorative and illuminating panel with light-emitting diodes

The invention proposes a decorative and illuminating panel with light-emitting diodes (100) which comprises a glazing (1), a first decorative zone (60), visible at the front face (12), a first group of light-emitting diodes (2), on the side of the rear face (11). The beam emitted is divergent. The panel comprises a rail (3) forming a reflector of the light of the diodes (2) and placed rear face side, comprising a main reflecting surface (30) facing the group of diodes, oblique with respect to the rear face and able to receive directly so-called central rays of the said first group of diodes and to return them onto the first diffusing means, and a so-called upper reflecting surface (32) facing the rear face (11) and able to receive directly so-called upper lateral rays (B) of the said first group of diodes deviating from the rear face (11) and to return them onto the first diffusing means (4) or onto the oblique main reflecting surface. The extent of the main reflecting surface (30) and ...

Illuminating laminated glazing comprising light-emitting diodes and its manufacture

The invention provides illuminating laminated glazing comprising light-emitting diodes (100) with a first glass element (1), a second glass element (2) and a first lamination insert (3), with at least one group of light-emitting diodes (5) which are optically coupled to the side (13) of the laminated glazing, a printed scattering layer (4) of given surface area delimited by edges (40) and arranged between the first lamination insert (3) and one of the glass elements, so as to form a first illuminating region (41). The scattering layer (4) is a layer of porous ink deposited by inkjet printing and thus forming a plurality of sub-millimetre dots (14) spaced apart from one another, the porosity being observable using an optical microscope having a magnification of 20 and the scattering layer (4) is encapsulated in the plastic material (3). The invention also provides the method for manufacturing it.

Solid waste treatment system

Disclosed is a solid waste treatment system, comprising a storage device, an intelligent aerobic fermentation treatment device, a retaining wall-type fermentation area, and an aeration platform, wherein the intelligent aerobic fermentation treatment device comprises a traveling trolley, a lifting mechanism, a material pick-and-place mechanism, and a traveling cart linearly moving in a direction away from the storage device towards the retaining wall-type fermentation area; the aeration platform is arranged at the bottom of the retaining wall-type fermentation area; the traveling trolley linearly moves on the traveling cart in a direction perpendicular to the direction away from the storage device towards the retaining wall-type fermentation area; the lifting mechanism is mounted on the traveling trolley; the material pick-and-place mechanism is suspended on the lifting mechanism to be raised and lowered in step with the raising and lowering of the lifting mechanism. The solid waste treatment ...

MULTIPLE GLAZING WITH VARIABLE DIFFUSION BY LIQUID CRYSTALS

A liquid-crystal multiple glazing can have a first glass sheet and a second glass sheet held by a gasket referred to as the contact gasket. In some examples, the multiple glazing includes first and second electrodes with first and second electricity supply zones and a liquid-crystal layer with spacers having a thickness of between 5 and 15 µm. Additionally, the first glass sheet may protrude by a first protruding side and include the first electricity supply zone. Further, the glazing may have electrical cabling with a first cabling input with a first electrically insulating polymer material.

TUMOR NECROSIS FACTOR-A HUMANIZED ANTIBODY

The present invention provides a humanized anti-TNF monoclonal antibody and the use thereof. The humanized anti-TNF monoclonal antibody significantly reduces the immunogenicity of murine-antibody while retaining the ability of antibody to recognize antigen, compared with conservative mouse chimeric antibody. Therefore, safety of the antibody in clinical applications has been improved.

Aluminium harmonica plate type evaporation condenser

The invention discloses an aluminum harmonica plate evaporation type condenser, which comprises a fan, a water-retaining plate, a water distributor, a plate heat exchanger group, a pipeline, a water collecting tank, a water pump, a floating ball valve, a liquid collecting pipe and a gas distributing pipe, wherein a plate heat exchanger group is the aluminum harmonica plate heat exchanger group, the aluminum harmonica plate heat exchanger group is divided into a plurality of independent aluminum harmonica plate heat exchangers, each aluminum harmonica plate heat exchanger is formed through a plurality of aluminum harmonica plate sheet units being brazed with a left-right or up-down aluminum liquid collecting pipe from top to bottom or from left to right, and each aluminum harmonica plate heat exchanger and an inlet and outlet liquid collecting main pipe are connected and integrated to form the aluminum harmonica plate heat exchanger group. In addition, fillers are filled between every two ...

Computer big data storage device

The invention belongs to the technical field of computers, and relates to a computer big data storage device. The computer case comprises a computer, a protective shell and a dustproof plate. And the computer is provided with a slot. A storage cavity is formed in the protective shell, one end of the storage cavity is open, and a strip-shaped groove communicating with the storage cavity is formed in the side face of the protective shell in the length direction of the protective shell. A storage body is slidably arranged in the storage cavity, a plug matched with the slot is arranged at the end, facing the opening, of the storage body, and a push block in sliding fit with the strip-shaped groove is fixedly arranged on the storage body. When the plug is not used, the two dustproof plates abut against each other to cover the opening of the storage cavity, dust or sundries are prevented from entering the plug through the opening, and the storage body is protected. During use, the dustproof plate ...

Management method and system for improving power generation capacity of photovoltaic power station

The invention discloses a management method and system for improving the power generation capacity of a photovoltaic power station, and relates to the related field of photovoltaic power station management, and the method comprises the steps: connecting a simulation platform, obtaining a modeling data set of a target power station, and outputting a power station simulation model; performing a simulation test based on the power station simulation model, and outputting predicted generating capacity; the data acquisition device is connected to output real-time generating capacity; comparing the predicted generating capacity with the real-time generating capacity to determine the lost electric quantity; building a photovoltaic loss algorithm model; and inputting the lost electric quantity as a response target into the photovoltaic loss algorithm model, outputting a plurality of groups of loss results, and analyzing the plurality of groups of loss results to generate a photovoltaic operation ...

DICKENMESSVERFAHREN FÜR TRANSPARENTES MATERIAL

Forward skewed multi-blade impeller with narrow cavity and integral casting technique thereof

The invention relates to a forward skewed multi-blade impeller with a narrow cavity, which is used for a centrifugal fan and is low in noise, and an integral casting technique thereof. The impeller comprises a base plate and a hollow front plate, and narrow blades are installed along the circumference between the base plate and the front plate. The difference lies in that the blades are arc-shaped; the radial length of each blade is 20mm-30mm; the outlet height H of the meridian plane of each blade is 10mm-20mm; the number of the blades distributed along the circumference is 20-60; and the whole impeller is integrally cast. The impeller is compact in structure, low in noise, light in weight, high in structural strength and simple and convenient in maintenance. By adopting a moveable blade mold structure to fabricate an impeller inner core blank removing mold so as to finish the integral casting of the impeller, the invention solves the technical problem of blank removal failure of a closed ...

硝酸咪康唑软膏的制备方法

... 本发明公开了一种硝酸咪康唑软膏的制备方法，硝酸咪康唑软膏由以下原料：硝酸咪康唑2％、十八醇7.8～9％、十六醇5.2～6％、单硬脂酸甘油脂9～10％、吐温#-[20]4～5％、甘油16～18％、苯甲酸钠0.5～0.6％及纯化水49.4～55.5％，经以下方法制成：(1)取7.8～9％十八醇、5.2～6％十六醇、9～10％单硬脂酸甘油脂，置于水浴中加热熔融，温度保持70℃～80℃；(2)取0.5～0.6％苯甲酸钠加入49.4～55.5％纯化水中，搅拌溶解，加入4～5％吐温#-[20]，搅匀，加入2％硝酸咪康唑，搅拌，使之溶解，加入16～18％甘油，搅匀，置于水浴中加热，温度保持70℃～80℃；(3)取(1)液加入(2)液中，边加边搅拌，直至乳化成初乳，然后均质，均质转速1000～1100r/min，均质时间5～7min，脱气，成膏。本发明的硝酸咪康唑软膏具有生产工艺简便，主药(硝酸咪康唑)分散均匀，膏体细腻，黏度适中，易涂布，粒度符合《中国药典》要求，含量稳定的特点。 ...

Interlock control system of van-type vehicle

The invention discloses an interlock control system in a van. The interlock control system comprises a detection device for the state of a van door, an interlock control device and an engine starter; wherein, when the circuit of the detection device for the state of the van door is closed, the interlock control device can cut off the circuit connection of the engine starter so that the engine starter cannot be started when the van door is in a state of open or is opened. Another interlock control system comprises an engine control device, a power supply device, a van door control device and avan door starter; wherein, the power supply device is provided with a first power supply providing power for a front van and a second power supply providing power for opening or closing the van door;when the engine is in running state, the power supply device cuts off the circuit connection between the second power supply and the van door control device; when the engine is stopped, the power supply ...

Production method of metal compounded chromium oxide bricks

The invention discloses a production method of metal compounded chromium oxide bricks. The content of Cr2O3 in chromium oxide bricks is not less than 80%, and a coal water slurry vaporizing furnace liner material having better performances than original chromium oxide bricks is formed through adding one or more of silicon, chromium, aluminum and iron to a formula of present chromium oxide bricks and through compounding. The metal compounded chromium oxide bricks produced in the invention have the characteristics of strong thermal shock resistance, low porosity and strong coal slag corrosion resistance, can meet strict conditions of large scale formation, high pressure, high productivity and high requirements of present coal water slurry vaporizing furnaces, and prolong the service life of the whole vaporizing furnace liner.

Lighting device comprising light-emitting diodes

The invention relates to a lighting device comprising: at least one glass sheet (2, 2A, 2B) having two opposing main faces (20, 21) and a slab (22), light-emitting diodes (3) providing the lighting function, and diffusion means (4) that extract the light on one of the first or second main faces (21). The aforementioned diffusion means define one or more lighting zones and said diffusion means does not form a solid surface covering all of the first glass sheet. The device is characterized in that the diffusion means takes the form of an enamel having a brightness greater than 15 and preferably greater than or equal to 20 or 30.

Interlock control system of van-type vehicle

The invention discloses an interlock control system in a van. The interlock control system comprises a detection device for the state of a van door, an interlock control device and an engine starter; wherein, when the circuit of the detection device for the state of the van door is closed, the interlock control device can cut off the circuit connection of the engine starter so that the engine starter cannot be started when the van door is in a state of open or is opened. Another interlock control system comprises an engine control device, a power supply device, a van door control device and a van door starter; wherein, the power supply device is provided with a first power supply providing power for a front van and a second power supply providing power for opening or closing the van door; when the engine is in running state, the power supply device cuts off the circuit connection between the second power supply and the van door control device; when the engine is stopped, the power supply ...

Pneumatic post drill cutting remove system

The utility model discloses a pneumatic post drill cutting remove system, including air -supply line, inlet tube, unit head, drilling rod and water conservancy diversion dish, air -supply line and inlet tube pass through the three -way valve to be connected with the unit head, and the unit head is connected with the drilling rod top, the lower extreme at rig substructure is installed to the water conservancy diversion dish, and the drilling rod passes rig substructure and water conservancy diversion dish, and the drill bit setting is in the bottom of drilling rod, the inside cavity of rig and drill bit. The utility model discloses the probability of the situation that appears collapsing the hole and block up the drilling rod air vent obviously reduces, worker's intensity of labour greatly reduced. Can discharge to the interior grain slag mixture of drilling being blown through the water conservancy diversion dish, need not to dig again the ditch and discharge the grain slag mixture. It ...

Rotor structure of high-speed permanent-magnet synchronous motor

The invention discloses a rotor structure of a high-speed permanent-magnet synchronous motor. The rotor structure comprises a rotating shaft, end plates, a protective sleeve and magnets. Grooves are formed in the outer surface of a middle segment of the rotating shaft made of magnetism conducting materials, positioning keys are mounted in the grooves to fix the magnets, the end plates made of non-magnetism-conducting materials are fixed on two sides of the middle segment of the rotating shaft, the magnets include permanent magnets made of two different materials, and the protective sleeve is made of composite materials with carbon fibers serving as a base and is bound on the outer surfaces of the magnets. Compared with a surface-mounted rotor magnetic circuit structure adopted by a traditional high-speed permanent-magnet synchronous motor, the rotor structure of the high-speed permanent-magnet synchronous motor has the advantages that the rotor magnetic circuit structure, air-gap magnetic ...

Method for melting ice by utilizing power transmission circuit load current

The invention provides a method for melting ice by utilizing power transmission circuit load current, which belongs to the field of high voltage power distribution, and solves the problem that the existing ice melting device and method cannot ensure normal power supply of a power transmission circuit when being used for melting ice. The method for melting ice by utilizing power transmission circuit load current is characterized in that an ice melting wire comprises a high resistance steel wire and an outer layer conductor, wherein the high resistance steel wire and the outer layer conductor at the tail end of the ice melting wire positioned at the end part of a power transmission circuit are connected with a power transmission line of the existing power transmission circuit after being connected in parallel, the high resistance steel wire and the outer layer conductor at one side of a sectioned tension-resistant rod tower are simultaneously connected with the wire inlet end of a sectioned ...

An auto exhaust muffler device

The utility model discloses an auto exhaust muffler device, including the noise eliminator main part, noise eliminator main part front side is equipped with the intake pipe, and the intake pipe rear side is first anechoic chamber, and first anechoic chamber rear side is equipped with the second anechoic chamber, is equipped with first communicating pipe and second communicating pipe on the first baffle, and second anechoic chamber rear side is equipped with the third anechoic chamber, and third anechoic chamber rear side is equipped with the fourth anechoic chamber, is equipped with third communicating pipe, fourth communicating pipe and the 5th communicating pipe on the third baffle, is equipped with the outlet duct on the fourth anechoic chamber, the utility model discloses novel structure carries out the resistance with the resonant chamber to the automobile exhaust noise and eliminates the noise through setting up expansion room that the multiunit anechoic chamber forms, communicating ...

Mechanical-auxiliary electric dehydration device

The invention relates to a mechanical-auxiliary electric dehydration device which comprises an electric dehydration unit and a pressure supply unit, wherein the electric dehydration unit comprises a reactor, a piston, two electrodes and a filtering medium, and the piston, the two electrodes and the filtering medium are arranged in the reactor; one electrode is a porous conductive plate; the pressure supply unit comprises a pneumatic cylinder with a push rod for applying force to the piston, and the pressure supply unit is arranged above the electric dehydration unit. The invention also provides a method for mechanical-auxiliary electric dehydration by using the device.

Distributed structure control display scheduling method and system

The invention provides a method for controlling display scheduling through a distributed structure, and the method comprises the following steps: obtaining video signal sources of a plurality of places; transmitting the video signal source to a data center server through a network; the central control device obtains a video signal source device list through the data center server and obtains a playing device; the playing device receives the data center server image information processed by the central control device and displays the data center server image information on the display device; transmitting the control instruction data to a data center server; the video signal source receives instruction information of the data center server, and the corresponding system is used for solving the problems that a user can only switch signal sources in a main screen display area and zoom pictures, complete module recording is not carried out on permutation and combination display and historical ...

Timing task processing method and device

The invention discloses a timed task processing method and device, and the method comprises the steps: receiving a to-be-processed timed task which comprises preset delay time; determining target delay time of the to-be-processed timed task according to preset delay time; storing the to-be-processed timed task in a timed task list of a target time grid of the single-layer time wheel according to the target delay time; when the pointer of the single-layer time wheel rotates to the target time grid, the timed tasks in the timed task list of the target time grid are traversed so that the traversed timed tasks can be processed, and the traversed timed tasks comprise the timed tasks to be processed. Whether each task expires or not does not need to be checked by traversing all the timed tasks, and the timed tasks which expire and need to be processed can be determined only through the pointing of the pointer, that is, the timed tasks in the target time lattice pointed by the pointer reach the ...

APPARATUS AND METHOD FOR PERFORMING A CHECK TO OPTIMIZE INSTRUCTION FLOW

Catalyst for preparing methyl ethyl ketone by dehydrogenation of sec-butyl alcohol and preparation method of catalyst

The invention provides a catalyst for preparing methyl ethyl ketone by the dehydrogenation of sec-butyl alcohol and a preparation method of the catalyst. The catalyst is prepared by adding 10 to 40 percent of nickel oxide serving as a main active ingredient, 0.5 to 8 percent of manganese oxide, lanthanum oxide, titanium oxide, cerium oxide and the like serving as accessory ingredients, and 0.5 to 6 percent of alkali metal oxide to modify the catalyst, and performing a parallel-flow precipitation and impregnated mixing method. In a preparation process, a precipitating agent is not required to be used, and acidic and alkali waste liquid are not generated, so that the catalyst is environment-friendly. When the catalyst provided by the invention is applied to the dehydrogenation of the sec-butyl alcohol to prepare the methyl ethyl ketone, the activity and the selectivity are relatively high; the problems that a copper-series catalyst is easy to sinter and poor in stability are solved; moreover ...

Circuits and methods for detecting phase imblance of signals and signal transfer system

Lighting unit made up of an insulating glass panel and light-emitting diodes

A lighting unit includes a glass panel including at least two spaced sheets of glass, and a lighting system based on light-emitting diodes the light-emitting portion of which is disposed facing each of the edge surfaces of the sheets of glass and carried by at least one section associated at least with the edge surface of the glass panel. The section is associated with the edge surface of the glass panel without creating thermal bridges. It is attached against the edge surface of the glass panel or demountably fixed to it.

PLANARE ODER IM WESENTLICHEN PLANARE LEUCHTSTRUKTUR

FLAT LAMP, PRODUCTION METHOD THEREOF AND APPLICATION OF SAME

Beauty tofu

The invention relates to beauty tofu. The preparation method of the beauty tofu comprises the following steps: (1) selecting material and removing impurities; (2) soaking beans and milling to obtain liquor; (3) heating to agglomerate the liquor; (4) filtrating to remove the residue; (5) adding lecithin; (6) adding bittern; and (7) squeezing water to obtain the beauty tofu. The invention has the advantage that eating the beauty tofu can supplement the desired lecithin of human body, avoid the human physiological barrier caused by the lack of lecithin, have the function of protecting the heart and liver, preventing and curing arteriosclerosis (hypertension, myocardial infarction, cerebral hemorrhage), diabetes, gall stone and senile dementia, promoting the brain growth, enhancing memory, improving the symptom of neurasthenia, being the necessity for the nerve growth of fetus and baby, removing acne and ephelis, moisturizing skin and ensuring the body to be more slender, vigorous and graceful ...

LIGHTING UNIT HAVING LIGHT-EMITTING DIODES

A lighting device includes light-emitting diodes as illuminating light sources and arranged on a support, and a receptacle housing the support of the diodes and closed by a glass substrate facing the diodes. The receptacle and the fastener to fasten the support to the receptacle, are made of a thermally conductive material. Furthermore, a scattering device to scatter light is arranged at least in zones located facing the diodes, and a reflector of light is arranged in the receptacle. The lighting device is thus thin, highly effective, and causes very little dazzle. 1. A lighting device comprising a receptacle , light-emitting diodes as illuminating light sources , a support , which is placed in the receptacle and on which the diodes are arranged , and a glass substrate forming the cover of the device , the diodes configured to emit light in the direction of the substrate , wherein:the support of the diodes is fastened to the bottom of the receptacle, the bottom of the receptacle being made of a thermally conductive metallic material and said support incorporating and/or being associated with a heat dissipating device configured to dissipate heat, which heat dissipating device is connected to the bottom of the receptacle;the glass substrate comprises a scattering device configured to scatter light, which scattering device is arranged facing the diodes; anda reflector is placed inside the receptacle so as to reflect light rays in the direction of the substrate.2. The lighting device as claimed in claim 1 , wherein the support of the diodes consists of a sheet having a general area lying substantially parallel to the entire area of the bottom of the receptacle claim 1 , and the reflector consists of a reflective coating added to the side of said sheet facing the substrate.3. The lighting device as claimed in claim 1 , wherein the support of the diodes consists of separate strips that are distributed over the bottom of the receptacle claim 1 , and the reflector is ...

LUMINOUS MULTIPLE GLAZING UNIT COMPRISING LIGHT-EMITTING DIODES

A luminous multiple glazing unit including: first and second flat glass elements; light-emitting diodes located in an internal space; a reflector including a part fixed to the glazing unit in the internal space; and a first luminous zone associated with the first glass element. In a first configuration, the reflector has a central reflective area for reflecting at least 30% of total flux emitted by the diodes in the group onto a first mechanism scattering light, or, in a second configuration, the reflector forms a beam splitter and has a double-image central reflective area of a first central area for reflecting first central rays onto a first mechanism scattering light and a second central area for reflecting second central rays onto a second scattering mechanism, the reflector reflecting at least 30% of total flux emitted by the diodes in the group. 121-. (canceled)22. A luminous multiple glazing unit comprising:a first flat glass element made of mineral or organic glass, with first and second main faces;a second flat glass element made of mineral or organic glass, with a main face, as a third face, lying opposite the first face, and another main face as a fourth face;the first and second glass elements being securely fastened to and spaced apart from each other;an internal space, at least between the first and third faces, the internal space being evacuated or filled with a gas;a spacer separating the first and second glass elements, at a periphery of the glazing unit;at least one group of light-emitting diodes located in the internal space, the diodes being mounted on one or more mountings;the diodes in the group each having a given main emission direction that is substantially parallel the first face;a reflector that reflects the light emitted by the group of diodes, the reflector comprising a part fixed to the glazing unit in the internal space; anda first luminous zone associated with the first glass element, the light originating from the group of diodes; ...

MULTIPLE GLAZING WITH VARIABLE SCATTERING BY LIQUID CRYSTALS AND ITS METHOD OF MANUFACTURE

A multiple glazing with variable scattering by liquid crystals includes first and second flat float glass sheets sealed on the edge of their internal faces by a sealing joint, in particular made of a given sealing material, in particular essentially organic, first and second electrodes, and a layer of liquid crystals with an average thickness E between 15 and 60 μm inclusive of these values and incorporating spacers. The thickness A of each of the first and second glass sheets is less than or equal to 5.5 mm, and each of the internal faces coated with the first and second electrodes has a dioptric defect score, expressed in millidioptres, of less than 12E/15 where the thickness E of the liquid crystals is in μm. 1. A multiple glazing with variable scattering by liquid crystals comprising:first and second flat float glass sheets sealed on the edge of their internal faces by a sealing joint;on the internal faces of the first and second glass sheets, first and second electrodes in the form of transparent electrically conductive layers provided with a power supply;on the first and second electrodes, a layer of liquid crystals adapted to alternate reversibly between a transparent state and a translucent state by application of an alternating electric field, which layer has an average thickness E from 15 to 60 μm and incorporates spacers,wherein a thickness of each of the first and second glass sheets is less than or equal to 5.5 mm, andwherein each of the internal faces coated with the first and second electrodes has a dioptric defect score, expressed in millidioptres, of less than 12E/15 where the thickness E of the liquid crystals is in μm.2. The multiple glazing with variable scattering by liquid crystals according to claim 1 , whereinfor a thickness E of less than 30 μm, the thickness of the first glass sheet and the second glass sheet lies from 3 mm to 5.5 mm, orfor a thickness E greater than or equal to 30 μm, the thickness of the first glass sheet and the second ...

MULTIPLE GLAZING HAVING VARIABLE DIFFUSION BY LIQUID CRYSTALS, AND METHOD FOR MANUFACTURING SAME

A liquid-crystal multiple glazing including a first glass sheet and a second glass sheet that is sealed by a sealing gasket, first and second electrodes with first and second electricity supply zones, a liquid-crystal layer, between 15 and 60 μm, with spacers, the first glass sheet protruding by a first protruding side and including the first electricity supply zone, electrical cabling with a first cabling input with a first electrically insulating polymer material, a third glass sheet laminated with the second glass sheet, the third glass sheet protruding from the second glass sheet by a side covering the first electrically insulating material, referred to as the first covering side. 1. A multiple glazing with variable liquid-crystal-induced scattering , with an edge face , the multiple glazing comprising:a first glass sheet including a first inner face, a first outer face and a first edge,a second glass sheet including a second inner face, a second outer face and a second edge, the first and second glass sheets being sealed by a sealing gasket,first and second electrodes respectively on the first and second inner faces, in the form of transparent electrically conductive layers, which first and second electrodes are provided respectively with first and second electricity supply zones,and, on the first and second electrodes, a layer of liquid crystals adapted to alternate reversibly between a transparent state and a translucent state by application of an alternating electric field, the layer has of liquid crystals having a thickness from 15 to 60 μm and incorporating spacers,the first glass sheet protruding from one side of the second edge by a first protruding side of the first inner face, and comprising the first electricity supply zone,an electrical cabling including a first cabling input in the first electricity supply zone and a second cabling input in the second electricity supply zone,a first electrically insulating polymer material for configured to ...

HYBRID POLYKETIDE SYNTHASES

The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin. 1. A non-naturally occurring polyketide synthase (PKS) capable of synthesizing an even-chain diacid.2. The PKS of claim 1 , wherein the even-chain diacid is not a compound synthesized by a naturally occurring PKS.3. The PKS of claim 1 , wherein the PKS is a hybrid PKS comprising modules claim 1 , domains claim 1 , and/or portions thereof from two or more PKSs.4Saccharopolyspora erythraea. The PKS of claim 3 , wherein the PKS comprises two modules claim 3 , wherein the first module comprises an aspartate-specific adenylation (A) domain claim 3 , modified to load succinate instead of aspartate claim 3 , from the non-ribosomal peptide synthetase (NRPS) pathway for calcium-dependent antibiotic (CDA) from linked to a peptidylcarrier protein (PCP) domain and a second module comprising a PKS ketosynthase (KS) domain claim 3 , wherein the PCP domain is capable of interacting with the KS domain.5Streptomyces verticillus.. The PKS of claim 4 , wherein the PCP and KS domains are the PCP and KS domains from the bleomycin pathway from6. The PKS of claim 4 , wherein the A domain is directly linked to the PCP domain.7. The PKS of claim 4 , wherein the second module comprises the KS domain fused to nystatin module 5 claim 4 , wherein the even-chain diacid produced is adipic acid.8. The PKS of claim 4 , wherein the A domain comprises the conserved aspartate residue (“Asp235”) changed to glutamine.9. The PKS of claim 3 , wherein the PKS comprises the loading domain of the chondrochloren PKS wherein the CoA ligase domain of the loading domain is ...

Solid waste treatment system

An exemplary solid waste treatment system can be provided which can include a storage device, an intelligent aerobic fermentation treatment device, a retaining wall-type fermentation area, and an aeration platform. The intelligent aerobic fermentation treatment device can include a traveling trolley, a lifting mechanism, a material pick-and-place mechanism, and a traveling bridge linearly moving in a direction away from the storage device towards the retaining wall-type fermentation area. The aeration platform can be arranged at the bottom of the retaining wall-type fermentation area. The traveling trolley linearly can move on the traveling bridge in a direction perpendicular to the direction away from the storage device towards the retaining wall-type fermentation area. The lifting mechanism can be mounted on the traveling trolley. The material pick-and-place mechanism can be suspended on the lifting mechanism to be raised and lowered in step with the raising and lowering of the lifting mechanism.

HYBRID POLYKETIDE SYNTHASES

The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin. 1. A non-naturally occurring polyketide synthase (PKS) which synthesizes an even-chain diacid , wherein the PKS is a hybrid PKS comprising domains from two or more PKSs.2. The non-naturally occurring PKS of claim 1 , wherein the PKS synthesizes and even-chain diacid.3. The non-naturally occurring PKS of claim 1 , wherein the PKS comprises a mutant non-ribosomal peptide synthetase (NRPS) domain that loads succinic acid.4. The non-naturally occurring PKS of claim 1 , wherein the PKS synthesizes a 7-keto-8-amino-pelargonic acid (KAPA).5. The non-naturally occurring PKS of claim 1 , wherein the PKS synthesizes malonic acid.6. The non-naturally occurring PKS of claim 1 , wherein the PKS synthesizes claim 1 , wherein the PKS synthesizes a lactam.7. A non-naturally occurring polyketide synthase/non-ribosomal peptide synthetase hybrid (PKS/NRPS) capable of synthesizing a lactam or a diamine.8. A recombinant nucleic acid encoding the polyketide synthase (PKS) of .9. A replicon comprising the recombinant nucleic acid of claim 8 , wherein the replicon is capable of stable maintenance in a host cell.10. The replicon of claim 9 , wherein the replicon is a plasmid or vector.11. The replicon of claim 10 , wherein the vector is an expression vector.12. A host cell comprising the recombinant nucleic acid of .13. A host cell comprising the replicon of .14. The host cell of claim 12 , wherein the host cell when cultured produces the even-chain diacid claim 12 , odd-chain diacid claim 12 , KAPA claim 12 , diamine or lactam.15. The host cell of claim ...

POWER SUPPLY OF AN ELECTRICALLY CONTROLLABLE LIQUID CRYSTAL GLAZING, AND METHOD FOR POWERING SUCH A GLAZING

An electrically-controlled liquid crystal glazing unit can include a substrate carrying a liquid crystal element disposed between a first electrode and a second electrode connected to an electrical power supply. The liquid crystal element can transform from a diffusing state at zero voltage to a transparent and/or colored state at a sinusoidal AC voltage having an operating amplitude (V). In some examples, the electrical power supply is configured to apply a start-up voltage whose amplitude progressively increases from zero up to the operating amplitude (V) and/or a shut-down voltage (V(t)) whose amplitude decreases progressively from the operating amplitude (V) down to zero. 1. An electrically-controlled liquid crystal glazing unit comprising:a substrate carrying a liquid crystal element disposed between a first electrode and a second electrode connected to an electrical power supply, the liquid crystal element being capable of going:from a diffusing state in which the glazing unit is subjected to a zero voltage,{'sub': nom', '0, 'to at least one of a transparent state and a colored state, in which the glazing unit is subjected to a sinusoidal AC voltage (V(t)) having an operating amplitude (V),'}wherein the electrical power supply is configured to apply to the glazing unit at least one of:{'sub': e', '0', 'on, 'a start-up voltage (V(t)) whose amplitude progressively increases from zero up to the operating amplitude (V), over a start-up period of time (T) of at least 0.1 seconds beginning following the activation of the electrical power supply, and'}{'sub': s', '0', 'off, 'a shut-down voltage (V(t)) whose amplitude decreases progressively from the operating amplitude (V) down to zero, over a shut-down period of time (T) of at least 0.1 seconds beginning following the shut-down of the electrical power supply.'}2. The electrically-controlled glazing unit as claimed in claim 1 , wherein the electrical power supply is configured to at least one of linearly increase the ...

LIGHTING UNIT MADE UP OF AN INSULATING GLASS PANEL AND LIGHT-EMITTING DIODES

A lighting unit includes a glass panel including at least two spaced sheets of glass, and a lighting system based on light-emitting diodes the light-emitting portion of which is disposed facing each of the edge surfaces of the sheets of glass and carried by at least one section associated at least with the edge surface of the glass panel. The section is associated with the edge surface of the glass panel without creating thermal bridges. It is attached against the edge surface of the glass panel or demountably fixed to it. 1. A lighting unit comprising:an insulated and illuminated multipart glass panel, the glass panel comprising at least first and second sheets of glass spaced from each other with respective first and second edge surfaces, and associated by a peripheral seal between the first and second sheets of glass,a lighting system comprising at least one support and electrical connection device carrying light-emitting diodes disposed facing the first edge surface, andat least one section comprising a longitudinal base that carries the support and electrical connection device, wherein the section is associated with the glass panel without creating thermal bridges.2. The unit as claimed in claim 1 , comprising a part adapted to maintain a gap between a light-emitting face of the diodes and the glass panel.3. The unit as claimed in claim 1 , comprising a solid surface of a part or the section that is adapted to form a bearing abutment for the glass panel.4. The unit as claimed in claim 3 , wherein the solid surface forming the bearing abutment has a width equivalent to a thickness of the bottom side of the glass panel in its mounted position and is disposed against the whole of a width of an edge surface of the glass panel.5. The unit as claimed in claim 1 , wherein the section forms a support for the lighting system and for an association of said lighting system with the glass panel claim 1 , association of the section with the glass panel consisting in ...

MULTIPLE GLAZING WITH VARIABLE SCATTERING BY LIQUID CRYSTALS AND ITS METHOD OF MANUFACTURE

A multiple glazing with variable scattering by liquid crystals includes first and second flat float glass sheets sealed on the edge of their internal faces by a sealing joint, in particular made of a given sealing material, in particular essentially organic, first and second electrodes, and a layer of liquid crystals with an average thickness E between 15 and 60 μm inclusive of these values and incorporating spacers. The thickness A of each of the first and second glass sheets is less than or equal to 5.5 mm, and each of the internal faces coated with the first and second electrodes has a dioptric defect score, expressed in millidioptres, of less than 12 E/15 where the thickness E of the liquid crystals is in μm. 1100{'b': 1', '2', '11', '12', '7, 'first and second flat float glass sheets (, ) sealed on the edge of their internal faces (, ) by a sealing joint () made of a given sealing material,'}{'b': 3', '4, 'on the internal faces of the first and second glass sheets, first and second electrodes (, ) in the form of transparent electrically conductive layers provided with a power supply,'}{'b': '5', 'and, on the first and second electrodes, a layer () of liquid crystals alternating reversibly between a transparent state and a translucent state by application of an alternating electric field.'}. Multiple glazing with variable scattering by liquid crystals () having: This application is a continuation of U.S. patent application Ser. No. 13/820,467, filed Mar. 1, 2013, which is a U.S. National Stage of PCT/FR2011/051990, filed Aug. 31, 2011, which in turn claims priority to French Application No. 1057005, filed Sep. 3, 2010. The content of these applications are incorporated herein by reference in their entirety.The invention relates to the field of electrically controllable glazing having variable optical properties, and it more particularly concerns glazing with variable scattering by liquid crystals, provided with a layer of liquid crystals between two glass panes ...

MINIMIZING FOULING IN STEAM ASSISTED OIL PRODUCTION

Methods and systems generate steam for heavy oil recovery operations, wherein fouling is limited with the use of wire matrix turbulators in tubes with tendencies to foul. 1. A steam generator system for oil production , comprising a once through steam generator (OTSG) having:an economizer section for pre-heating feedwater and fitted with a wire matrix turbulator;a radiant section for converting said pre-heated feedwater to steam; andan injection system for injecting steam into an oil reservoir, wherein the economizer section, radiant section and injection system are fluidly connected.2. The steam generator system of claim 1 , wherein said wire matrix turbulator comprises a coiled wire claim 1 , wherein subsequent coils are radially shifted around a central axis claim 1 , and wherein all coils slant in a direction of fluid flow.3. The steam generator system of claim 1 , wherein said wire matrix turbulator comprises stainless steel wire.4. The steam generator system of claim 1 , wherein said wherein wire matrix turbulator comprises a polymer coated wire.5. The steam generator system of claim 1 , wherein said wire matrix turbulator comprises a polymeric wire or mesh.6. The steam generator system of claim 1 , wherein said radiant section also includes the wire matrix turbulator.7. The steam generator system of claim 1 , further comprising a water and steam separator in fluid communication between the radiant section and the injection system for injecting separated steam into the oil reservoir.8. An improved method of producing steam for heavy oil production claim 1 , the method comprising heating feedwater in a once-through steam generator (OTSG) sufficiently to make steam to inject into a wellbore and use in mobilizing heavy oil claim 1 , the improvement comprising outfitting tubes in said OTSG with a turbulator and thus reducing fouling in said tubes as compared with the same OTSG lacking said turbulator.9. The method of claim 8 , further comprising preheating ...

MULTIPLE GLAZING WITH VARIABLE DIFFUSION BY LIQUID CRYSTALS

A liquid-crystal multiple glazing can have a first glass sheet and a second glass sheet held by a gasket referred to as the contact gasket. In some examples, the multiple glazing includes first and second electrodes with first and second electricity supply zones and a liquid-crystal layer with spacers having a thickness of between 5 and 15 μm. Additionally, the first glass sheet may protrude by a first protruding side and include the first electricity supply zone. Further, the glazing may have electrical cabling with a first cabling input with a first electrically insulating polymer material. 1. A multiple glazing with variable liquid-crystal-induced scattering , with an edge face , the multiple glazing having:a first glass sheet with a face referred to as a first inner face and another face referred to as a first outer face and an edge referred to as a first edge,a second glass sheet with a face referred to as a second inner face and another face referred to as a second outer face and an edge referred to as a second edge,the first and second glass sheets being held by a gasket referred to as a contact gasket,first and second electrodes respectively on the first and second inner faces, in the form of transparent electrically conductive layers, which first and second electrodes are provided respectively with first and second electricity supply zones,and, on the first and second electrodes, a layer of liquid crystals in a polymer material, the liquid crystals being configured to alternate reversibly between a transparent state and a translucent state by application of an alternating electric field, wherein the layer of liquid crystals in the polymer material incorporates spacers and has a thickness between 5 and 15 μm, including 5 μm and excluding 15 μm,the first glass sheet protruding from one side of the second edge by a first side of the first inner face, referred to as the first protruding side, and comprising the first electricity supply zone,electrical cabling ...

REMOTE PREHEAT AND PAD STEAM GENERATION

Methods and systems generate steam for injection in a well to facilitate oil recovery. Water is preheated at a central processing facility, transported to a well pad by hot water lines, and converted to steam by a steam generator at the well pad. 1) A method of generating steam for use in a well to produce oil , said method comprising:a) heating a boiler feedwater located at a central processing facility (CPF) to produce heated boiler feedwater (HBFW);b) transporting said HBFW to a well pad via hot water lines, wherein said HBFW has a subcool of 5-30° C.;c) feeding said HBFW into a well pad boiler located at said well pad;d) converting said HBFW to steam in said well pad boiler; ande) injecting said steam into a well located at said well pad to produce oil.2) The method of claim 1 , wherein said pad boiler is a water tube drum boiler.3) The method of claim 1 , wherein said heating step a) is by a gas burning water heater.4) The method of claim 1 , wherein said heating step a) is by a gas burning turbine heater that produces electricity and HBFW.5) The method of claim 1 , wherein said heating step a) is by a once through steam generator (OTSG).6) The method of claim 1 , wherein said heating step a) is preceded by a preheating step to preheat said boiler feedwater.7) The method of claim 1 , wherein said feeding step c) is preceded by a preheating step to preheat said HBFW.8) The method of claim 1 , wherein said heating step a) is preceded by a preheating step to preheat said boiler feedwater and wherein said feeding step c) is preceded by a preheating step to preheat said HBFW.9) The method of claim 1 , wherein said subcool is 10-20° C.10) A steam generator system for oil production claim 1 , comprising:a) a water heater located at a CPF to heat boiler feedwater to HBFW, said HBFW having a subcool of 5-30° C.;b) a hot water line for transporting said HBFW with a subcool of 5-30° C. from said CPF to a well pad;c) a steam generator located at said well pad, said steam ...

METHOD FOR PRODUCING A MULTIPLE GLAZING UNIT WITH VARIABLE DIFFUSION BY PDLC LAYER AND A MULTIPLE GLAZING UNIT WITH A PDLC LAYER PRODUCED ACCORDING TO SAID METHOD

A method for producing a multiple glazing unit with variable diffusion by liquid crystals can include applying a pre-seal on an internal face of a first substrate to form a strip delimiting a space. The method can further include depositing a liquid crystal composition containing liquid crystals in a polymer matrix on the delimited space. In some examples, the first substrate is assembled with a second substrate and calendared or pressed. Thereafter, the resulting assembly is irradiated and/or heated to simultaneously cross-link the pre-seal and polymerize the liquid crystal composition. 1. A method for producing a multiple glazing unit with variable diffusion by liquid crystals comprising:applying, on a first electrode arranged on an internal face of a first substrate, a material called pre-seal containing at least one precursor of a crosslinked polymer so as to form a strip, delimiting a space, the pre-seal being applied to form an adhesive seal upon cross-linking;depositing, on the first electrode, a liquid crystal composition containing liquid crystals in a polymer matrix, the polymer matrix comprising the at least one precursor of the crosslinked polymer;assembling the first substrate with a second substrate so the internal face of the first substrate faces opposite an internal face of the second substrate, wherein assembling comprises at least one of calendaring and pressing, such that the pre-seal in the form of the strip is in contact with the liquid crystal composition, thereby providing an assembly; andafter assembling, at least one of irradiating the assembly with ultraviolet radiation (UV) and heating the assembly so as to crosslink the pre-seal and polymerize the liquid crystal composition,wherein the pre-seal is based on acrylate and free from precursor of epoxy polymer and the liquid crystal composition is based on acrylate and free from precursor of epoxy polymer.2. The method for producing a multiple glazing unit with variable diffusion by liquid ...

APPARATUS AND METHOD FOR PERFORMING A CHECK TO OPTIMIZE INSTRUCTION FLOW

An apparatus and method for performing a check on inputs to a mathematical instruction and selecting a default sequence efficiently managing the architectural state of a processor. For example, one embodiment of a processor comprises: an arithmetic logic unit (ALU) to perform a plurality of mathematical operations using one or more source operands; instruction check logic to evaluate the source operands for a current mathematical instruction and to determine, based on the evaluation, whether to execute a default sequence of operations including executing the current mathematical instruction by the ALU or to jump to an alternate sequence of operations adapted to provide a result for the mathematical instruction having particular types of source operands more efficiently than the default sequence of operations. 1. A processor comprising:an arithmetic logic unit (ALU) to execute a plurality of mathematical instructions using one or more source operands;instruction check logic to evaluate the source operands for a current mathematical instruction and to determine, based on the evaluation, whether to execute a default sequence of operations including executing the current mathematical instruction by the ALU or to jump to an alternate sequence of operations adapted to provide a result for the mathematical instruction having particular types of source operands more efficiently than the default sequence of operations.2. The processor as in wherein the current mathematical instruction comprises a division instruction having a numerator and denominator specified by the source operands and wherein the instruction check logic is to cause a jump to the alternate sequence of operations responsive to either of the numerator or denominator being denormalized operands claim 1 , being equal to infinity claim 1 , being not-a-number (NaN) operands claim 1 , and/or resulting in a divide-by-zero.3. The processor as in wherein the instruction check logic is to set one or more exception ...

CELLULAR STRUCTURE OF SILICON CARBIDE UMOSFET DEVICE HAVING SURGE VOLTAGE SELF-SUPPRESSION AND SELF-OVERVOLTAGE PROTECTION CAPABILITIES

The present invention discloses a cellular structure of a silicon carbide UMOSFET device having surge voltage self-suppression and self-overvoltage protection capabilities. A p-well region of the cellular structure is divided into three layers; the top layer is on the left and right sides of a U-shaped trench and in contact with the U-shaped trench; the middle layer and the bottom layer are respectively constituted by two parts on the left and right sides of the cellular structure, and the left and right parts of the two are not in contact; the distances between the left and right parts of the middle layer and the vertical axis of the cellular structure are greater than the distances between the left and right parts of the bottom layer and the vertical axis of the cellular structure; that is, a JFET structure is introduced to a drain current path of the cellular structure. 1. A cellular structure of a silicon carbide UMOSFET device having surge voltage self-suppression and self-overvoltage protection capabilities characterized in that, wherein a p-well region of the cellular structure is divided into three layers; the top layer is on the left and right sides of a U-shaped trench and in contact with the U-shaped trench; the middle layer and the bottom layer are respectively constituted by two parts on the left and right sides of the cellular structure, and the left and right parts of the two are not in contact; the distances between the left and right parts of the middle layer and the vertical axis of the cellular structure are greater than the distances between the left and right parts of the bottom layer and the vertical axis of the cellular structure; that is, a JFET structure is introduced to a drain current path of the cellular structure. This application claims priority to Chinese Patent Application No. 201710177593.2, filed on Mar. 23, 2017, the contents of which are hereby incorporated by reference.The present invention belongs to the technical field of H01L ...

ILLUMINATING PARTITION

An illuminating partition includes lower and upper mounting profiled members, at least the lower profiled member including a carrier element arranged in the internal volume of the profiled member and including a platen, parallel to and at a distance from the central section of the profiled member and disposed between the diodes and the glazing unit, and serving as a support for the edge of the glazing unit, one of the lateral sections of the profiled member being mobile or removable so as to have access to the diodes which are associated with the profiled member in a removable manner. 1. An illuminating partition comprising:at least one glazing unit;diodes disposed on at least one support device of the PCB type, the at least one support device being on or accommodated in a receiving profiled member, the diodes being disposed facing an edge face of the glazing unit;at least one lower mounting profiled member and one upper mounting profiled member, each mounting profiled member comprising a central section, a first lateral section perpendicular to the central section, and a second lateral section perpendicular to the central section, parallel to and spaced from the first lateral section, and the mounting profiled member bounding an internal volume; andat least one carrier element distinct from any element accommodating the diodes, notably distinct from the at least one support device or from the receiving profiled member, said carrier element being arranged in the internal volume of the lower and/or upper mounting profiled member, and comprising a platen which is at a distance from the central section of the mounting profiled member and situated between the edge face of the glazing unit and the diodes,wherein the platen of the carrier element is associated with the first lateral section of the mounting profiled member and has a free edge facing the second lateral section of the mounting profiled member,wherein at a bottom of the partition, the platen supports the ...

LUMINOUS GLAZING ASSEMBLY

A luminous glazing assembly includes a first glazing pane with a first light source coupled to the first pane to emit at instant t0 at λ1 and to emit at t′≠t0 at λ2, λ2 distinct from λ1; a first light-extracting system and first masking arrangement to mask the extracted light from the internal-face side; making optical contact with the first glazing pane, a second glazing pane with a second light source that is optically coupled to the second pane, to emit at t0 at a λ3 distinct from λ1; a second light-extracting system and second masking arrangement to mask the light from the bonding-face side; between the first masking arrangement and the second extracting system, a first optical isolator; and between the first masking arrangement and the second extracting system, a second optical isolator, merged with the first optical isolator or separate and closer to the second extracting system. 2. The luminous glazing assembly according to claim 1 , wherein the first light-extracting system is on the main internal face claim 1 , the first masking arrangement comprising an opaque or a reflective layer in congruence with and on the first light-extracting system claim 1 , and wherein the second light-extracting system is on the main bonding face and the second masking arrangement comprises an opaque or reflective layer in congruence with and on the second light-extracting system.3. The luminous glazing assembly according to claim 1 , wherein the first light-extracting system comprises a scattering enamel layer on the main internal face claim 1 , the first masking arrangement comprises an opaque enamel layer in congruence with and on the scattering enamel layer claim 1 , the second light-extracting system comprises a scattering enamel layer on the main bonding face and the second masking arrangement comprises an opaque enamel layer in congruence with and on the scattering enamel layer.4. The luminous glazing assembly according to claim 1 , wherein the first optical isolator ...

ELECTRICALLY CONDUCTIVE SUPPORT FOR A GLAZING UNIT HAVING LIQUID-CRYSTAL-MEDIATED VARIABLE SCATTERING PROPERTIES AND SUCH A GLAZING UNIT

The present invention relates to an electrically conductive support for a liquid-crystal-comprising glazing unit (), comprising a multilayer () with, in this order: 1. An electrically conductive support for a glazing unit having liquid-crystal-mediated variable scattering properties , the electrically conductive support comprising a first transparent substrate having a main face comprising a multilayer of thin films , the multilayer of thin films having an order extending outwardly from the main face as follows:an electrode comprising a TCO film based on transparent electrically conductive oxide;{'sub': '1', 'a silicon-nitride-based first barrier film having a thickness eof at least 5 nm; and'}{'sub': '2', 'a silicon-oxide-based second barrier film having a thickness eof at least 30 nm,'}{'sub': 1', '2', '1, 'wherein at least one of the thickness eis smaller than or equal to eand eis smaller than 80 nm, and'}{'sub': 'b', 'a cumulative thickness eof the first and second barrier films is larger than or equal to 50 nm and smaller than 150 nm.'}2. The electrically conductive support according to claim 1 , wherein eranges from 30 to 100 nm claim 1 , and eis smaller than or equal to 120 nm.3. The electrically conductive support according to claim 1 , wherein eranges from 35 nm to 80 nm and eranges from 10 nm to 50 nm.4. The electrically conductive support according to claim 1 , wherein the multilayer comprises claim 1 , between the first and second barrier films claim 1 , a barrier film called an additional barrier film claim 1 , the additional barrier film being based on zinc tin oxide and having a thickness eof at least 5 nm and smaller than 50 nm.5. The electrically conductive support according to claim 1 , further comprising claim 1 , on the second barrier film claim 1 , another barrier film called an over barrier film claim 1 , the over barrier film being based on silicon nitride and having a thickness e′of at least 5 nm and smaller than 50 nm.6. The electrically ...

MULTIPLE GLAZING WITH VARIABLE DIFFUSION BY LIQUID CRYSTALS AND METHOD OF MANUFACTURE THEREOF

A multiple glazing with variable scattering by liquid crystals can have first and second flat float glass sheets held on the edge of their internal faces by a joint made of a given joint material. In some examples, the glazing also includes first and second electrodes and a layer of liquid crystals with an average thickness E between 5 and 15 μm. The thickness of each of the first and second glass sheets may be less than or equal to 6.5 mm and each of the internal faces coated with the first and second electrodes may have a dioptric defect score, expressed in millidioptres, of less than or equal to 2+2E/3, where the thickness E of the liquid crystals is in μm. 2. The multiple glazing with variable scattering by liquid crystals according to claim 1 , characterized in thatwhen the average thickness E is less than 8 μm, at least one of the first and second float glass sheets has a thickness of between 4.5 mm and 5.5 mm inclusive of these values, andwhen the average thickness E is greater than or equal to 8 μm, at least one of the first and second float glass sheets has a thickness between 2.5 mm and 5.5 mm inclusive of these values.3. The multiple glazing with variable scattering by liquid crystals according to claim 1 , characterized in that the joint has a given width L and is interrupted in its width by one or more openings each defining lateral joint ends.4. The multiple glazing with variable scattering by liquid crystals according to claim 3 , characterized in that the joint is interrupted in its width by at least two openings facing a first edge of the glazing and by at least two other openings facing a second edge of the glazing opposite the first edge.5. The multiple glazing with variable scattering by liquid crystals according to claim 13 , characterized in that at least one of the joint material and the additional material comprises an epoxy resin.6. A method for producing multiple glazing with variable scattering by liquid crystals comprising:forming a joint ...

Hybrid Polyketide Synthases

The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin. 1. A non-naturally occurring polyketide synthase (PKS) which synthesizes 7 keto-8-amino-pelargonic acid (KAPA) or the odd-chain diacid pimelic acid , wherein the PKS is a hybrid PKS comprising domains from two or more PKSs.23.-. (canceled)4. The non-naturally occurring PKS of claim 1 , wherein the PKS synthesizes a 7-keto-8-amino-pelargonic acid (KAPA).5. (canceled)6. A recombinant nucleic acid encoding the polyketide synthase (PKS) of .7. A replicon comprising the recombinant nucleic acid of claim 6 , wherein the replicon is capable of stable maintenance in a host cell.8. The replicon of claim 7 , wherein the replicon is a plasmid or vector.9. The replicon of claim 8 , wherein the vector is an expression vector.10. A host cell comprising the recombinant nucleic acid of .11. A host cell comprising the replicon of .12. The host cell of claim 10 , wherein the host cell claim 10 , when cultured claim 10 , produces pimelic acid or KAPA.13. The host cell of claim 12 , wherein the host cell further comprises one or more nucleic acids encoding pimelyl-CoA synthetase claim 12 , 8-amino-7-oxononanoate synthase claim 12 , 7 claim 12 ,8-diamino-pelargonic acid (DAPA) synthase claim 12 , dethiobiotin synthase claim 12 , and biotin synthase claim 12 , the PKS synthesizes pimelic acid claim 12 , and when cultured claim 12 , the host cell produces biotin.14. The host cell of claim 12 , wherein the host cell further comprises one or more nucleic acids encoding 7 claim 12 ,8-diamino-pelargonic acid (DAPA) synthase claim 12 , dethiobiotin synthase ...

Host Cell Modified to Produce 2-Pyrrolidone

The present invention provides for a genetically modified host cell comprising a 2-pyrrolidone synthase, or an enzymatically active fragment thereof, heterologous to the host cell. 2. The genetically modified host cell of claim 1 , wherein the 2-pyrrolidone synthase comprises an amino acid sequence having at least 70% identity with SEQ ID NO:1 claim 1 , wherein the amino acid sequence comprises one or more of the following conserved amino acid motifs or sites: acyl-activating enzyme (AAE) consensus motif (residues 137 claim 1 , 140-145 claim 1 , and 147-148) claim 1 , acyl-activating enzyme (AAE) consensus motif (residues 140 claim 1 , 257-258 claim 1 , 279-284 claim 1 , 357 claim 1 , 369 claim 1 , 372 claim 1 , 382 claim 1 , and 458) claim 1 , AMP binding site (residues 140 claim 1 , 180-181 claim 1 , 227 claim 1 , 229-230 claim 1 , 233 claim 1 , 257-258 claim 1 , 279-284 claim 1 , 357 claim 1 , 369 claim 1 , 372 claim 1 , 379-382 claim 1 , and 439) claim 1 , and CoA binding site (residues 180 claim 1 , 229-230 claim 1 , 233 claim 1 , 257 claim 1 , 379-381 claim 1 , 433 claim 1 , and 439).3. The genetically modified host cell of claim 2 , wherein host cell is capable of synthesizing Compound 1 or uptaking Compound 1 from the environment or culture.4. The genetically modified host cell of claim 3 , wherein host cell further comprises one or more enzymes of a pathway for synthesizing Compound 1 from a carbon source.5. The genetically modified host cell of claim 4 , wherein pathway for synthesizing Compound 1 from a carbon source that is native to the host cell.6. The genetically modified host cell of claim 4 , wherein pathway for synthesizing Compound 1 from a carbon source is heterologous to the host cell.7. The genetically modified host cell of claim 1 , wherein host cell lacks betaine-CoA ligase.8. The genetically modified host cell of claim 2 , wherein n is an integer from 1 to 20.9. The genetically modified host cell of claim 8 , wherein n is an integer from 1 ...

SYSTEM AND METHOD OF ROBUST QUANTITATIVE SUSCEPTIBILITY MAPPING

Exemplary quantitative susceptibility mapping methods, systems and computer-accessible medium can be provided to generate images of tissue magnetism property from complex magnetic resonance imaging data using the Bayesian inference approach, which minimizes a cost function consisting of a data fidelity term and two regularization terms. The data fidelity term is constructed directly from the complex magnetic resonance imaging data. The first prior is constructed from matching structures or information content in known morphology. The second prior is constructed from a region having an approximately homogenous and known susceptibility value and a characteristic feature on anatomic images. The quantitative susceptibility map can be determined by minimizing the cost function. Thus, according to the exemplary embodiment, system, method and computer-accessible medium can he provided for determining magnetic susceptibility information associated with at least one structure. 1. A method for generating one or more images of an object , the method comprising: magnitude and phase information or real and imaginary information regarding tissue in the object, and', 'Gaussian noise;, 'receiving magnetic resonance imaging (MR1) data obtained by a magnetic resonance scanner, wherein the MRI data is complex and comprises'}calculating a magnetic field experienced by the tissue in the object based on modeling the complex data according to tissue composition;identifying a region of interest in the tissue that has an approximately uniform susceptibility according to a characteristic feature; determining a cost function, the cost function relating at least a data fidelity term associated with a likelihood function of the Gaussian noise in the MRI data, a first regularization term associated with a structure prior information, and a second regularization term associated with enforcing the known uniform susceptibility value in the region of interest in the tissue;', 'determining a magnetic ...

Host Cell Modified to Produce Lactams

The present invention provides for a genetically modified host cell capable of producing a lactam comprising a 2-pyrrolidone synthase, or an enzymatically active fragment thereof, heterologous to the host cell. 2. The genetically modified host cell of claim 1 , wherein the 2-pyrrolidone synthase comprises an amino acid sequence having at least 70% identity with SEQ ID NO:1 claim 1 , wherein the amino acid sequence comprises one or more of the following conserved amino acid motifs or sites: acyl-activating enzyme (AAE) consensus motif (residues 137 claim 1 , 140-145 claim 1 , and 147-148) claim 1 , acyl-activating enzyme (AAE) consensus motif (residues 140 claim 1 , 257-258 claim 1 , 279-284 claim 1 , 357 claim 1 , 369 claim 1 , 372 claim 1 , 382 claim 1 , and 458) claim 1 , AMP binding site (residues 140 claim 1 , 180-181 claim 1 , 227 claim 1 , 229-230 claim 1 , 233 claim 1 , 257-258 claim 1 , 279-284 claim 1 , 357 claim 1 , 369 claim 1 , 372 claim 1 , 379-382 claim 1 , and 439) claim 1 , and CoA binding site (residues 180 claim 1 , 229-230 claim 1 , 233 claim 1 , 257 claim 1 , 379-381 claim 1 , 433 claim 1 , and 439).3. The genetically modified host cell of claim 2 , wherein host cell is capable of synthesizing Compound 1 or uptaking Compound 1 from the environment or culture.4. The genetically modified host cell of claim 3 , wherein host cell further comprises one or more enzymes of a pathway for synthesizing Compound 1 from a carbon source.5. The genetically modified host cell of claim 4 , wherein pathway for synthesizing Compound 1 from a carbon source that is native to the host cell.6. The genetically modified host cell of claim 4 , wherein pathway for synthesizing Compound 1 from a carbon source is heterologous to the host cell.7. The genetically modified host cell of claim 1 , wherein host cell lacks betaine-CoA ligase.8. The genetically modified host cell of claim 2 , wherein n is an integer from 1 to 20.9. The genetically modified host cell of claim 8 , ...

HYBRID COLORING METHODOLOGY FOR MULTI-PATTERN TECHNOLOGY

In an aspect of the disclosure, a method, a computer-readable medium, and an apparatus for assigning feature colors for a multiple patterning process are provided. The apparatus receives integrated circuit layout information including a set of features and an assigned color of a plurality of colors for each feature of a first subset of features of the set of features. In addition, the apparatus performs color decomposition on a second subset of features to assign colors to features in the second subset of features. The second subset of features includes features in the set of features that are not included in the first subset of features with an assigned color. 1. A method of assigning feature colors for a multiple patterning process , comprising:receiving integrated circuit layout information comprising a set of features and an assigned color of a plurality of colors for each feature of a first subset of features of the set of features; andperforming color decomposition on a second subset of features to assign colors to features in the second subset of features, the second subset of features including features in the set of features that are not included in the first subset of features with the assigned color.2. The method of claim 1 , wherein the multiple pattern process is an n-patterning process with n colors claim 1 , the set of features comprises p features claim 1 , the first subset of features comprises q features claim 1 , the second subset of features includes p−q features claim 1 , and wherein the color decomposition is performed on the p−q features within the second subset of features and with a subset of the n colors.3. The method of claim 2 , wherein the color decomposition is performed on the p−q features within the second subset of features with n colors.4. The method of claim 2 , wherein the first subset of features has m different colors claim 2 , and the color decomposition is performed on the p−q features within the second subset of features with ...

Flat solar heat collector for use in solar energy recovery system mounted on e.g. roof of building, has pipe formed with circular section, where external diameter of circular section is specified, and coolant is circulated in pipe

The collector (1) has walls (2, 3) arranged to face each other, and a housing (4) defined between the walls. One of the walls is transparent and directs solar radiation incidence on a side of the wall to the collector. An energy absorption unit is arranged in the housing to absorb energy from the solar radiation. The energy absorption unit comprises a coolant circuit (6) for coolant e.g. glycol-water mixture, which is circulated in a pipe. The pipe is formed with a circular section whose external diameter is 10 mm. Thickness of the pipe is in a range of about 0.8-1.6 mm. An independent claim is also included for a solar energy recovery system.

Light-emitting structure having leakage current limited by an electrical conductor with an adjustable frequency and an adjustable potential

A flat or substantially flat light-emitting and/or UV (ultraviolet)-emitting structure including first and second dielectric walls facing each other and defining an internal space containing a light source, first and second electrodes for the light source, which generate electric field lines with at least one component perpendicular to the first and second electrodes, the first electrode being supplied or capable of being supplied by a high-frequency electromagnetic signal f 0 , and as an outer cover for the first electrode, an electrical safety system that includes an electrical conductor separated from the first electrode by a dielectric, the protective conductor being connected or capable of being connected to an electrical power supply with a potential V and/or with a frequency f that are adjusted so that the peak value of external leakage current is equal to 2 mA or less if f is zero, or 0.7 mA or less if f is non-zero.

LUMINOUS STRUCTURE PLANE OR SIGNIFICANTLY PLANE

SODA GLASS CONTAINER WITH IMPROVED CHEMICAL RESISTANCE FOR PHARMACEUTICAL OR DIAGNOSTIC SUBSTANCE

Récipient en verre sodocalcique à résistance chimique améliorée pour substance pharmaceutique ou de diagnostic L’invention concerne un récipient (1) comprenant une paroi (2) en verre délimitant une cavité d’accueil (3) pour une substance, en particulier pour une substance pharmaceutique ou de diagnostic, ladite paroi (2) en verre présentant une face interne (4) située en regard de ladite cavité d’accueil (3), ledit récipient (1) étant caractérisé en ce que ladite paroi (2) est en verre sodocalcique, ladite face interne (4) formant une surface en verre nue destinée à venir en contact direct avec ladite substance, ladite paroi (2) en verre présentant une fraction atomique en sodium, mesurée par spectrométrie de photoélectrons induits par rayons X, qui est inférieure à 4 %at jusqu’à une profondeur d’au moins 200 nm à partir de la surface de la face interne (4). Récipients en verre. Figure pour l’abrégé : Fig. 1.

FLASHLIGHT, METHOD OF MANUFACTURE AND APPLICATION

VARIABLE DIFFUSION MULTIPLE GLAZING BY LIQUID CRYSTALS, ITS MANUFACTURING PROCESS

The present invention provides multiple glazing with variable diffusion by liquid crystals (100), having first and second sheets of flat float glass (1, 2) held on the edge of their internal faces (11, 21) by a seal (7), in particular made of a given seal material, in particular substantially organic, first and second electrodes (3, 4), a layer (5) of liquid crystals of average thickness E between 5 and 15 mum including 5 mum and excluding 15 mum and incorporating spacers (6). The thickness of each of the first and second glass sheets is less than or equal to 6.5 mm and each of the coated internal faces of the first and second electrodes has a dioptric defect rating, expressed in millidiopters, of less than or equal to (I) where the thickness E of liquid crystals is in µm. The invention also relates to a method of manufacturing such glazing.

LUMINOUS MULTIPLE GLAZING WITH LIGHT EMITTING DIODES

L'invention propose un vitrage multiple lumineux (100) qui comporte des premier et deuxième éléments verrier (1, 1') plans, des diodes électroluminescentes (3) dans l'espace interne, un réflecteur (5) qui comprend une pièce fixée au vitrage dans l'espace interne, une première zone lumineuse associée au premier élément verrier et dans une première configuration, le réflecteur présente une surface réfléchissante centrale (50) pour renvoyer au moins 30% du flux total d'émission des diodes dudit groupe sur un premier moyen diffusant (11') de lumière, ou dans une deuxième configuration, le réflecteur (5), formant un séparateur de faisceaux, présente une surface réfléchissante centrale dédoublée (50, 51, 52) constituée d'une première surface centrale (51), pour renvoyer des premiers rayons centraux sur un premier moyen diffusant de la lumière (11') et d'une deuxième surface centrale (52) pour renvoyer des deuxièmes rayons centraux sur un deuxième moyen diffusant (13'), et alors renvoyer au moins 30% du flux total des diodes dudit groupe. The invention proposes a luminous multiple glazing (100) which comprises first and second glass elements (1, 1 ') planes, light-emitting diodes (3) in the internal space, a reflector (5) which comprises a piece fixed to the glazing in the internal space, a first light zone associated with the first glass element and in a first configuration, the reflector has a central reflecting surface (50) for returning at least 30% of the total emission flux of the diodes of said group on a first light diffusing means (11 '), or in a second configuration, the reflector (5), forming a beam splitter, has a split central reflective surface (50, 51, 52) consisting of a first central surface (51), ), for returning first central rays to a first light scattering means (11 ') and a second central surface (52) for returning second central rays to a second diffusing means nt (13 '), and then return at ...

LIGHTING ASSEMBLY BASED ON INSULATING WINDOWS AND ELECTROLUMINESCENT DIODES

La présente invention concerne un ensemble éclairant comprenant un vitrage (1) doté d'au moins deux feuilles de verre espacées (10, 11), un système d'éclairage (2) à base de diodes électroluminescentes (20) dont la partie éclairante est disposée en regard de chacune des tranches (10A, 11 A) des feuilles de verre et portées par au moins un profilé (3) associé au moins à la tranche du vitrage. Le profilé (3) est associé à la tranche du vitrage sans créer de pont thermique. Il est rapporté contre la tranche du vitrage ou lui est fixé de manière démontable. The present invention relates to an illuminating assembly comprising a glazing unit (1) provided with at least two spaced apart glass sheets (10, 11), an illumination system (2) based on light-emitting diodes (20), the illuminating portion of which is disposed opposite each of the slices (10A, 11A) of the glass sheets and carried by at least one profile (3) associated at least with the edge of the glazing. The profile (3) is associated with the edge of the glazing without creating a thermal bridge. It is attached against the edge of the glazing or is fixed removably.

Glazing, useful in buildings, comprises antenna includes radiating unit, mass and power supply, where one of mass, radiating unit and power supply includes conducting coating and layering guides that are directly adhered with coating

La présente invention a pour objet un vitrage (2) multiple à antenne (4) incorporée comprenant plusieurs feuilles à fonction verrière (2A, 2B, 2C) superposées et séparées par une ou plusieurs lames de gaz intercalaire (14A, 14B). L'antenne (4) comprend une radiante (12), une masse (8) et une alimentation (10). Au moins l'une de la masse (8), de la radiante (12) et de l'alimentation (10) comprend un revêtement conducteur et un intercalaire de feuilletage (22A, 22B, 22C) colle directement au revêtement conducteur.

VARIABLE DIFFUSION MULTIPLE GLAZING BY LIQUID CRYSTALS, ITS MANUFACTURING PROCESS

BOROSILICATE GLASS CONTAINER WITH IMPROVED CHEMICAL RESISTANCE FOR PHARMACEUTICAL OR DIAGNOSTIC SUBSTANCE

Récipient en verre borosilicate à résistance chimique améliorée pour substance pharmaceutique ou de diagnostic L’invention concerne un récipient (1) comprenant une paroi (2) en verre délimitant une cavité d'accueil (3) pour une substance, en particulier pour une substance pharmaceutique ou de diagnostic, ladite paroi (2) en verre présentant une face interne (4) située en regard de ladite cavité d'accueil (3), ledit récipient (1) étant caractérisé en ce que ladite paroi (2) est en verre borosilicate, ladite face interne (4) formant une surface en verre nue destinée à venir en contact direct avec ladite substance, ladite paroi (2) en verre présentant une fraction atomique en sodium, mesurée par spectrométrie de photoélectrons induits par rayons X, qui est inférieure ou égale à 2,0 %at jusqu'à une profondeur d'au moins 300 nm à partir de la surface de la face interne (4). Récipients en verre. Figure pour l’abrégé : Fig. 1. Borosilicate glass container with improved chemical resistance for a pharmaceutical or diagnostic substance The invention relates to a container (1) comprising a glass wall (2) delimiting a receiving cavity (3) for a substance, in particular for or diagnosis, said glass wall (2) having an internal face (4) located facing said reception cavity (3), said container (1) being characterized in that said wall (2) is made of borosilicate glass , said inner face (4) forming a bare glass surface intended to come into direct contact with said substance, said glass wall (2) having an atomic fraction of sodium, measured by X-ray induced photoelectron spectrometry, which is lower or equal to 2.0% at to a depth of at least 300 nm from the surface of the inner face (4). Glass containers. Figure for abstract: Fig. 1.

LIGHTING ASSEMBLY BASED ON INSULATING WINDOWS AND ELECTROLUMINESCENT DIODES

MIRROR AND LIGHTING PANEL WITH ELECTROLUMINESCENT DIODES

LUMINOUS LIGHT EMITTING LAMINATED GLAZING AND MANUFACTURE THEREOF

DECORATIVE AND LIGHTING PANEL WITH ELECTROLUMINESCENT DIODES

The invention provides an illuminating decorative panel (100) based on light-emitting diodes, which comprises a glazing pane (1), a first decorative area (60), visible as the front face (12), and a first group of light-emitting diodes (2), on the rear face (11) side. The emitted beam is divergent. The panel includes a section strip (3) forming a reflector, which reflects the light from the diodes (2) and is placed on the rear face side, said section strip having a main reflecting surface (30) facing the group of diodes, which is oblique to the rear face and capable of directly receiving rays called the central rays from said first group of diodes and sending them onto the first diffusing means, and a reflecting surface called the upper surface (32) facing the rear face (11) and capable of directly receiving rays called the upper lateral rays (B) from said first group of diodes, diverging from the rear face (11), and sending them onto the first diffusing means (4) or onto the oblique main reflecting surface. The extent of the main reflecting surface (30) and the extent of the upper reflecting surface (32) are such that at least 80% of the upper lateral rays (B) are reflected onto the first diffusing means (4).

GLASS LIGHTING FENCE

Vacuum solar collector, useful for providing thermal energy to refrigeration unit to make air conditioner, comprises chamber delimited by tempered glass sheet comprising first main wall and second main wall that is connected to first wall

The vacuum solar collector comprises a chamber (2) having a thickness of = 10 mm and a pressure that is less than the atmospheric pressure. The chamber is delimited by a tempered glass sheet (3) comprising a first main wall and a second main wall (4) that is connected to the first main wall in a sealed manner by a frame (5), and comprises, at a distance increasing from the tempered glass sheet, a solar radiation absorber (6) in sheet form. The solar radiation absorber is present in contact with pipes (7) for circulating a heat transfer fluid. The vacuum solar collector comprises a chamber (2) having a thickness of = 10 mm and a pressure that is less than the atmospheric pressure. The chamber is delimited by a tempered glass sheet (3) comprising a first main wall and a second main wall (4) that is connected to the first main wall in a sealed manner by a frame (5), and comprises, at a distance increasing from the tempered glass sheet, a solar radiation absorber (6) in sheet form. The solar radiation absorber is present in contact with pipes (7) for circulating a heat transfer fluid. A part of a surface of the tempered glass sheet is directly connected to a metal, due to welding without a filler material, at a temperature of 850[deg] C by laser. The tempered glass sheet is connected to the solar radiation absorber via first spacers. The pipes are connected to the second main wall via second spacers. The metal, which is directly connected to the part of the surface of the glass sheet, has minimum thermal expansion coefficient. A portion of the major surface of the tempered glass sheet, which is oriented outside of the collector and is oriented towards the chamber, is directly connected to the metal. A part of an edge of the glass sheet is directly connected to the metal. The second main wall of the chamber comprises another tempered glass sheet, and a box having edges that protrude from the second main wall of the enclosure and form a part of the frame. A part of the ...

LIGHTING ASSEMBLY BASED ON INSULATING WINDOWS AND ELECTROLUMINESCENT DIODES

LUMINOUS STRUCTURE PLANE OR SIGNIFICANTLY PLANE

PROCESS FOR PROCESSING A GLASS WALL CONTAINER AND RELATED INSTALLATION

L'invention concerne un procédé de traitement d'un récipient (1) comprenant une paroi en verre (2) délimitant une cavité d'accueil (3) pour un produit, ladite paroi en verre (2) présentant une face interne (4) et une face externe (5) opposée, ladite paroi en verre (2) étant pourvue d'un premier revêtement qui inclut un composé résiduel solide résultant d'une étape de traitement de surface de ladite paroi en verre (2) à laquelle ledit récipient (1) a été préalablement soumis, ledit procédé comprenant une étape de projection à la surface de ladite paroi en verre (2) de gouttelettes d'un liquide, afin de former sur ladite paroi en verre (2), à partir dudit premier revêtement, un deuxième revêtement qui inclut ledit composé résiduel et qui est plus transparent et / ou plus uniforme que ledit premier revêtement. Traitement de récipients à paroi en verre. The invention relates to a method for treating a container (1) comprising a glass wall (2) delimiting a receiving cavity (3) for a product, said glass wall (2) having an inner face (4). and an opposite outer face (5), said glass wall (2) being provided with a first coating which includes a solid residual compound resulting from a surface treatment step of said glass wall (2) to which said container (1) has been previously subjected, said method comprising a step of projecting on the surface of said glass wall (2) of droplets of a liquid, so as to form on said glass wall (2), from said first coating a second coating which includes said residual compound and which is more transparent and / or more uniform than said first coating. Treatment of glass wall containers.

DECORATIVE AND LIGHTING PANEL WITH ELECTROLUMINESCENT DIODES

L'invention propose un panneau décoratif et éclairant à diodes électroluminescentes (100) qui comporte un vitrage (1), une première zone décorative (60), visible en face avant (12), un premier groupe de diodes électroluminescentes (2), du côté de la face arrière (11). Le faisceau émis est divergent. Le panneau comporte un profilé (3) formant un réflecteur de la lumière des diodes (2) placé côté face arrière, comportant une surface réfléchissante principale (30) en regard du groupe de diodes, oblique par rapport à la face arrière et apte à recevoir directement des rayons dits centraux dudit premier groupe de diodes et à les renvoyer sur les premiers moyens diffusants, et une surface réfléchissante dite supérieure (32) en regard de la face arrière (11) et apte à recevoir directement des rayons dits latéraux supérieurs (B) dudit premier groupe de diodes s'écartant de la face arrière (11) et à les renvoyer sur les premiers moyens diffusants (4) ou sur la surface réfléchissante principale oblique. L'étendue de la surface réfléchissante principale (30) et de la surface réfléchissante supérieure (32) sont telles qu'au moins 80% des rayons latéraux supérieurs (B) sont réfléchis vers les premiers moyens diffusants (4). The invention proposes a light-emitting diode decorative and illuminating panel (100) which comprises a glazing unit (1), a first decorative zone (60), visible on the front face (12), a first group of light-emitting diodes (2), the side of the back side (11). The emitted beam is divergent. The panel comprises a profile (3) forming a reflector of the light of the diodes (2) placed on the back side, comprising a main reflecting surface (30) facing the group of diodes, oblique with respect to the rear face and able to receive direct so-called central spokes of said first group of diodes and return them on the first diffusing means, and a so-called upper reflective surface (32) facing the rear face (11) and adapted to receive directly so-called ...

LIGHT EMITTING MIRROR WITH LIGHT EMITTING DIODES AND ITS FORMATION

Tubular discharge UV lamp e.g. tanning lamp, for e.g. refrigerator, has two electrodes associated to main faces of one of dielectric tubes, where electrodes are in form of bands that partially occupy, in projection, interelectrode spaces

The lamp (100) has a discharge space formed between sealed dielectric tubes (10, 20), and two electrodes (1, 2) associated to main faces (11, 12) of one of the tubes, where the electrodes are in the form of bands. The bands are separated by interelectrode spaces (5). Third electrode and fourth electrode are in form of bands that partially occupy, in projection, the interelectrode spaces. The third and fourth electrodes are associated to main faces (21, 22) of the other tube, where two absolute value differences are higher or equal to breakdown voltage. The lamp has an additional dielectric element i.e. plastic film e.g. Aclar(RTM: polychlorotrifluoroethylene) film.

COPLANAR DISCHARGE PLANE LAMP AND USES THEREFOR

Lampe plane à décharge (100) transmettant un rayonnement dans l'ultraviolet ou le visible, comprenant :- des premier et deuxième éléments verriers plans (2, 3) ou sensiblement plans maintenus sensiblement parallèles entre eux et délimitant un espace interne (10) rempli de gaz (71), le premier et/ou le deuxième élément verrier étant en un matériau transmettant ledit rayonnement,- au moins une première électrode (41 a) et au moins une deuxième électrode (51a) lesquelles sont susceptibles d'être à des potentiels distincts et d'être alimentées par une tension alternative (V1), les première(s) et deuxième(s) électrodes étant associées à une ou des faces principales (21) du premier élément verrier, les première(s) et deuxième(s) électrodes étant essentiellement allongées et sensiblement parallèles entre elles, et séparées par au moins un espace dit interélectrodes de largeur donnée dite d1 sensiblement constante, caractérisée en ce qu'elle comprend en outre au moins une troisième électrode (42a) susceptible d'être à un potentiel donné (V01), associée à une face principale (31) du deuxième élément verrier et occupant, en projection, au moins partiellement l'espace interélectrodes. Flat discharge lamp (100) transmitting radiation in the ultraviolet or visible, comprising: first and second planar glass elements (2, 3) or substantially planar elements held substantially parallel to each other and delimiting an internal space (10) filled of gas (71), the first and / or the second glass element being made of a material transmitting said radiation, - at least a first electrode (41 a) and at least a second electrode (51a) which are likely to be at least potentials and to be powered by an alternating voltage (V1), the first (s) and second (s) electrodes being associated with one or the main faces (21) of the first glass element, the first (s) and second ( s) electrodes being essentially elongated and substantially parallel to each other, and separated by at ...

LIGHT EMITTING DEVICE LIGHTING DEVICE

LIGHTING

La présente invention se rapporte à une cloison éclairante comprenant des profilés de montage inférieur (2) et supérieur (9), au moins le profilé inférieur comportant un élément porteur (4) agencé dans le volume intérieur dudit profilé et comprenant des moyens de support tels qu'une platine (40) parallèle, à distance de l'âme (20) du profilé et disposé entre les diodes (30) et le vitrage, et servant à supporter le chant du vitrage, l'une des ailes du profilé étant mobile ou amovible pour avoir accès aux diodes qui sont associées au profilé de manière amovible. The present invention relates to an illuminating partition comprising lower (2) and upper (9) mounting profiles, at least the lower profile comprising a carrier element (4) arranged in the interior volume of said profile and comprising support means such as a plate (40) parallel, remote from the core (20) of the profile and disposed between the diodes (30) and the glazing, and serving to support the edge of the glazing, one of the wings of the profile being movable or removable to access the diodes that are associated with the section removably.

BALLAST PULSE FOR FLAT LAMPS

METHOD FOR MANUFACTURING A VARIABLE DIFFUSION MULTIPLE VITRATION BY PDLC LAYER, SUCH A MULTIPLE GLAZING WITH A PDLC LAYER

La présente invention propose un procédé de fabrication d'un vitrage multiple à diffusion variable par cristaux liquides (100) comprenant des feuilles de verre (1, 2) maintenues par un joint adhésif (7), sur les faces internes des électrodes (3, 4), et comprenant une couche PDLC (5) en contact avec le joint adhésif (7), le procédé comportant les étapes suivantes : (a) l'application, sur la première électrode (3), d'une matière (7) dite préjoint (b) le dépôt sur la première électrode (3), d'une composition de cristaux liquides (5), l'ordre des étapes (a) et (b) pouvant être inversé, (c) l'assemblage des feuilles de verres (1, 2), avec les faces internes en regard, par calandrage ou pressage, (d) après l'assemblage, l'irradiation et/ou le chauffage pour les polymérisations, le préjoint et la composition étant à base d'acrylate sans précurseur de polymère époxy. L'invention concerne aussi le procédé de fabrication d'un tel vitrage à PDLC. The present invention provides a method of manufacturing a liquid crystal variable diffusion multiple glazing (100) comprising glass sheets (1, 2) held by an adhesive seal (7) on the inner faces of the electrodes (3, 4), and comprising a PDLC layer (5) in contact with the adhesive joint (7), the method comprising the steps of: (a) applying a material (7) to the first electrode (3) said pre-joint (b) the deposition on the first electrode (3) of a liquid crystal composition (5), the order of the steps (a) and (b) being reversible, (c) the assembly of the sheets of glasses (1, 2), with the internal faces opposite, by calendering or pressing, (d) after assembly, irradiation and / or heating for the polymerizations, the pre-joint and the composition being based on acrylate without precursor epoxy polymer. The invention also relates to the method of manufacturing such a PDLC glazing.

LIGHT EMITTING DEVICE LIGHTING DEVICE

La présente invention concerne un dispositif d'éclairage comportant au moins une feuille de verre (2, 2A, 2B) présentant deux faces principales opposées (20, 21) et une tranche (22), des diodes électroluminescentes (3) fournissant la fonction d'éclairage, et des moyens de diffusion (4) assurant l'extraction de la lumière sur l'une des première ou deuxième faces principales (21), les moyens de diffusion définissant une ou des zones éclairantes, les moyens de diffusion ne recouvrant pas selon une surface pleine la totalité de la première feuille de verre, caractérisé en ce que les moyens de diffusion sont un émail présentant une brillance supérieure à 15, de préférence supérieure ou égale à 20 ou à 30. The present invention relates to a lighting device comprising at least one glass sheet (2, 2A, 2B) having two opposite main faces (20, 21) and a wafer (22), light-emitting diodes (3) providing the function of lighting, and diffusion means (4) ensuring the extraction of light on one of the first or second main faces (21), the diffusion means defining one or more illuminating areas, the diffusion means not covering on a solid surface the entire first sheet of glass, characterized in that the diffusion means are an enamel having a gloss greater than 15, preferably greater than or equal to 20 or 30.

LUMINOUS GLASS ASSEMBLY.

OPTICAL VALVE AND METHOD FOR MANUFACTURING THE SAME

La présente invention propose une valve optique (100), présentant des première et deuxième feuilles de verre plan flotté (1, 2) scellées par un joint (7), des première et deuxième électrodes (3, 4), un système SPD (5) d'épaisseur E inférieure ou égale à 100 µm et incorporant des espaceurs (6). L'épaisseur A1, A2 de chacune des première et deuxième feuilles de verres est inférieure ou égale à 6,5 mm et chacune des faces internes présentent une note de défauts dioptriques, exprimée en millidioptrie, inférieure ou égale à E/3 ou 2E/3 en fonction de la transmission lumineuse TL. L'invention concerne aussi le procédé de fabrication d'une telle valve optique The present invention provides an optical valve (100) having first and second float plane glass sheets (1, 2) sealed by a seal (7), first and second electrodes (3, 4), an SPD system (5), ) of thickness E less than or equal to 100 microns and incorporating spacers (6). The thickness A1, A2 of each of the first and second sheets of glass is less than or equal to 6.5 mm and each of the internal faces have a rating of dioptric defects, expressed in millidiopters, less than or equal to E / 3 or 2E / 3 depending on the TL light transmission. The invention also relates to the method of manufacturing such an optical valve

LUMINOUS GLASS ASSEMBLY.

La présente invention concerne un ensemble lumineux vitré (200) comportant un vitrage feuilleté comportant un premier vitrage (1) un intercalaire de feuilletage et un deuxième vitrage, avec une première source de lumière (4), couplée au premier vitrage pour émettre à l'instant t0 à λ1, et des premiers moyens d'extraction de lumière (5) et avec une deuxième source de lumière (4'), couplée optiquement au deuxième vitrage, pour émettre audit t0 à λ3 distincte de λ1, et des deuxièmes moyens d'extraction de lumière (5'). L'ensemble vitré comprend aussi un film réflecteur ou deux couches réfléchissantes (2, 2') sur les faces internes de deux vitrages et des moyens de masquage opaques (3, 3') entre les premières et deuxièmes couches réfléchissantes. The present invention relates to a glazed light assembly (200) comprising a laminated glazing unit comprising a first glazing unit (1) a lamination interlayer and a second glazing unit, with a first light source (4), coupled to the first glazing unit for emitting to the instant t0 to λ1, and first light extraction means (5) and with a second light source (4 '), optically coupled to the second glazing, for emitting said t0 at λ3 distinct from λ1, and second means d light extraction (5 '). The glazed assembly also comprises a reflective film or two reflecting layers (2, 2 ') on the internal faces of two glazings and opaque masking means (3, 3') between the first and second reflective layers.

LUMINOUS GLASS ASSEMBLY.

La présente invention concerne un ensemble lumineux vitré comportant un premier vitrage (1) avec une première source de lumière (4), couplée au premier vitrage pour émettre à l'instant t0 à λ1 et pour émettre à l'instant t'≠t0 à λ2 distincte de λ1, des premiers moyens d'extraction de lumière (5) et des premiers moyens de masquage (6) de la lumière extraite côté face interne; en contact optique avec le premier vitrage, un deuxième vitrage (1') avec une deuxième source de lumière (4'), couplée optiquement au deuxième vitrage, pour émettre audit t0 à λ3 distincte de λ1, des deuxièmes moyens d'extraction de lumière (5') et des deuxièmes moyens de masquage (6') de la lumière côté face de collage; entre les premiers moyens de masquage et les deuxièmes moyens d'extraction, un premier isolateur optique (2), feuilleté par un premier intercalaire de feuilletage (3) ; entre les premiers moyens de masquage et les deuxièmes moyens d'extraction, un deuxième isolateur optique (2, 2'), confondu avec le premier isolateur optique ou distinct et plus proche des deuxièmes moyens d'extraction, le deuxième isolateur optique (2, 2') est feuilleté au deuxième vitrage au moyen d'un deuxième intercalaire de feuilletage (3'). The present invention relates to a glazed light assembly comprising a first glazing unit (1) with a first light source (4), coupled to the first glazing unit for emitting at time t0 to λ1 and for transmitting at time t '≠ t0 to λ2 distinct from λ1, first light extraction means (5) and first masking means (6) of the extracted light on the internal face side; in optical contact with the first glazing unit, a second glazing unit (1 ') with a second light source (4'), optically coupled to the second glazing, for emitting at said t0 at λ3 distinct from λ1, second light extraction means (5 ') and second masking means (6') of the gluing face side light; between the first masking means and the ...

MULTILIGHTING GLAZING WITH LIGHT EMITTING DIODES

La présente invention concerne un vitrage multiple éclairant à diodes électroluminescentes comportant un premier vitrage (1) et un deuxième vitrage (1'), un premier groupe de diodes électroluminescentes (2, 2a, 2b), pour un éclairage direct via le premier vitrage (1) dans une première bande éclairante (40) avec des premiers moyens diffusants. Le faisceau de chaque diode du premier groupe émis est divergent et défini par un demi-angle à mi-hauteur α d'au moins 30°. La distance H1 entre les diodes et les premiers moyens diffusants est d'au moins 5 mm. Le vitrage comprend un premier profilé à diodes (3) comportant une première base (30) porteuse des diodes (2, 2a, 2b), et une première aile latérale allongée (31) oblique par rapport à la première face pour recevoir des premiers rayons dits latéraux (R1) du premier groupe de diodes d'angles supérieurs ou égaux au demi-angle à mi-hauteur α et les renvoyer sur les premiers moyens diffusants. Et le vitrage multiple comprend une première zone sombre (60), associée au premier vitrage, la première zone sombre étant adjacente à la première bande éclairante (40) et décalée de la surface du premier vitrage en regard de la face avant de la première base (30). The present invention relates to an illuminating multiple glazing with light-emitting diodes comprising a first glazing (1) and a second glazing (1'), a first group of light-emitting diodes (2, 2a, 2b), for direct lighting via the first glazing ( 1) in a first illuminating strip (40) with first diffusing means. The beam of each diode of the first group emitted is divergent and defined by a half-angle at mid-height α of at least 30°. The distance H1 between the diodes and the first diffusing means is at least 5 mm. The glazing comprises a first diode profile (3) comprising a first base (30) carrying the diodes (2, 2a, 2b), and a first elongated side wing (31) oblique with respect to the first face to receive first rays called laterals (R1) of the first ...

LIGHT EMITTING DEVICE LIGHTING DEVICE

Solar panel, particularly vacuum flat solar panel, comprises upper wall and lower wall, where upper spacer and lower spacer are firmly connected with absorption material in height of conduit pipe

The solar panel (1), particularly vacuum flat solar panel, comprises an upper wall (2) and a lower wall (4). An upper spacer (8) and a lower spacer (9) are firmly connected with an absorption material in height of a conduit pipe (7). The upper spacer is arranged on one side of the conduit pipe in direction of the upper wall, where the lower spacer is arranged on other side of the conduit pipe in direction of the lower wall.

VARIABLE DIFFUSION MULTIPLE GLAZING BY LIQUID CRYSTALS, ITS MANUFACTURING PROCESS

La présente invention propose un vitrage multiple à diffusion variable par cristaux liquides (100), présentant des première et deuxième feuilles de verre plan flotté (1, 2) scellées sur le bord de leurs faces internes (11, 21) par un joint de scellement (7), notamment en une matière de scellement donnée, notamment, essentiellement organique, des première et deuxième électrodes (3, 4), une couche (5) de cristaux liquides d'épaisseur moyenne E comprise entre 15 et 60 µm en incluant ces valeurs et incorporant des espaceurs (6). L'épaisseur A de chacune des première et deuxième feuilles de verres est inférieure ou égale à 5,5 mm et chacune des faces internes revêtues des première et deuxième électrodes présentent une note de défauts dioptriques, exprimée en millidioptrie, inférieure à 12E/15 où l'épaisseur E de cristaux liquides est en µm. L'invention concerne aussi le procédé de fabrication d'un tel vitrage

FLASHLIGHT WITH DISCHARGE.

L'invention a pour objet une lampe plane (1, 1') à décharge dans l'UV et/ou le visible comportant des première et deuxième parois diélectriques (2, 3) en regard, maintenues parallèles et scellées par au moins un joint de scellement périphérique (8, 8'), délimitant ainsi un espace interne (10) rempli de gaz plasmagène et comprenant une source de lumière UV et/ou visible (6), des première et deuxième électrodes (4, 5) dans des plans distincts et parallèles aux première et deuxième parois, la première électrode (4) étant à un potentiel VO plus élevé que le potentiel V1 de la deuxième électrode et étant agencée dans l'espace interne (10), la deuxième électrode (5) étant associée à la deuxième paroi (3). Et la première électrode est espacée des première et deuxième parois et la lampe comprend une troisième électrode (5') associée à la première paroi et à un potentiel V1' moins élevé que VO. The invention relates to a plane lamp (1, 1 ') with UV discharge and / or visible having first and second dielectric walls (2, 3) opposite, maintained parallel and sealed by at least one seal sealing device (8, 8 '), thereby delimiting an internal space (10) filled with plasma gas and comprising a UV and / or visible light source (6), first and second electrodes (4, 5) in planes distinct and parallel to the first and second walls, the first electrode (4) being at a potential VO higher than the potential V1 of the second electrode and being arranged in the internal space (10), the second electrode (5) being associated at the second wall (3). And the first electrode is spaced apart from the first and second walls and the lamp comprises a third electrode (5 ') associated with the first wall and a potential V1' less than VO.

LUMINOUS LIGHT EMITTING LAMINATED GLAZING AND MANUFACTURE THEREOF

L'invention propose un vitrage feuilleté éclairant à diodes électroluminescentes (100) avec un premier élément verrier (1), un deuxième élément verrier (2), et un premier intercalaire de feuilletage (3), avec au moins un groupe de diodes électroluminescentes (5), couplées optiquement au chant (13) du vitrage feuilleté, une couche diffusante (4) imprimée, de surface donnée délimitée par des bords (40), agencée entre le premier intercalaire de feuilletage (3) et un des éléments verriers, pour former ainsi une première zone éclairante (41). La couche diffusante (4) est une couche d'encre poreuse, déposée par jet d'encre et formant ainsi une pluralité de plots submillimétriques (14) espacés entre eux, la porosité étant observable au microscope optique avec un grossissement de 20 et la couche diffusante (4) est encapsulée dans de la matière plastique (3). L'invention propose aussi son procédé de fabrication. The invention proposes a light-emitting diode-based laminated glazing unit (100) with a first glass element (1), a second glass element (2), and a first lamination interlayer (3), with at least one group of light-emitting diodes ( 5), optically coupled to the edge (13) of the laminated glazing, a printed diffusing layer (4) of given surface delimited by edges (40), arranged between the first laminating interlayer (3) and one of the glass elements, for thus forming a first illuminating area (41). The diffusing layer (4) is a porous ink layer deposited by ink jet and thus forming a plurality of submillimetric pads (14) spaced apart from one another, the porosity being observable under an optical microscope at a magnification of 20 and the layer diffuser (4) is encapsulated in plastics material (3). The invention also proposes its manufacturing process.

LIGHTING MIRROR

La présente invention concerne un miroir éclairant (1) comprenant une feuille de verre (10) présentant une surface réfléchissante (13) sur sa face arrière (11) pour assurer la fonction de miroir, des diodes électroluminescentes (3) fournissant la fonction d'éclairage, et des moyens de diffusion (16) assurant l'extraction de la lumière, la lumière sortant par la face avant (12) de la feuille de verre. Le miroir comporte au moins un profilé (2) associé à la feuille de verre et disposé contre sa tranche (14), le profilé étant porteur des DEL dont la lumière est injectée par la tranche de la feuille de verre, et le profilé (2) présente une partie (20a), formant extension, et intégrée dans un évidement (15) de la feuille de verre pour être coplanaire avec la face avant (12), fournissant un miroir dont la façade est totalement plane. The present invention relates to an illuminating mirror (1) comprising a glass sheet (10) having a reflective surface (13) on its rear face (11) to provide the mirror function, light-emitting diodes (3) providing the function of lighting, and diffusion means (16) providing the extraction of light, the light exiting through the front face (12) of the glass sheet. The mirror comprises at least one profile (2) associated with the glass sheet and arranged against its edge (14), the profile carrying LEDs whose light is injected by the edge of the glass sheet, and the profile (2 ) has a portion (20a), extending, and integrated in a recess (15) of the glass sheet to be coplanar with the front face (12), providing a mirror whose front is completely flat.

LIGHT EMITTING MIRROR WITH ELECTROLUMINESCENT DIODES

L'invention propose un miroir éclairant et éclairant à diodes électroluminescentes (100) qui comporte un vitrage (1) de façade avec en face arrière une couche miroir (2) (11), un motif diffusant allongé ou en cadre (3), et un entourage réflecteur porteur de diodes complété par un réflecteur de fond. Le miroir éclairant comporte un boitier dédié du motif diffusant ou un boitier commun avec l'alimentation électrique, boitier comportant l'entourage réflecteur fixé par adhésif double-face étanche à l'eau liquide au vitrage de façade d'épaisseur supérieur à 0,6mm. The invention proposes a light-emitting diode illuminating and illuminating mirror (100) comprising a facade glazing (1) with a mirror layer (2) (11), an elongate or in-frame diffusing pattern (3) on the rear side, and a diode-carrying reflective surround supplemented by a bottom reflector. The illuminating mirror comprises a dedicated casing of the diffusing pattern or a box that is common with the power supply, the case comprising the reflective surround fixed by double-sided liquid-tight adhesive to the facade glazing of thickness greater than 0.6 mm. .

VARIABLE DIFFUSION MULTIPLE GLAZING BY LIQUID CRYSTALS, ITS MANUFACTURING PROCESS

L'invention porte sur un vitrage multiple à cristaux liquides (100), avec un chant (1a à 8'c) présentant : - une première feuille de verre (1 et une deuxième feuille de verre scellées par un joint de scellement (6), - des première et deuxième électrodes (3, 3') avec première et deuxième zones d'alimentation électrique (90, 31, 90', 31'), - une couche (4) de cristaux liquides, - la première feuille de verre (1) dépassant par un premier bord dépassant et comportant la première zone d'alimentation électrique, - un câblage électrique (9, 9') avec une première entrée de câblage (90) avec une première matière d'isolation électrique (61) polymérique, - une troisième feuille de verre (8) feuilletée avec la deuxième feuille de verre (1'), la troisième feuille de verre dépassant de la deuxième feuille de verre (1') par un bord couvrant la première matière d'isolation électrique (61), dit premier bord couvrant (83). L'invention porte aussi sur la fabrication d'un tel vitrage à cristaux liquides. A liquid crystal multiple glazing unit (100) with a edge (1a to 8c) having: - a first glass sheet (1 and a second glass sheet sealed with a sealing gasket (6) - first and second electrodes (3, 3 ') with first and second power supply regions (90, 31, 90', 31 '), - a liquid crystal layer (4), - the first glass sheet (1) protruding by a first protruding edge and having the first power supply area, - electrical wiring (9, 9 ') with a first wiring input (90) with a first polymeric electrical insulation material (61) a third glass sheet (8) laminated with the second glass sheet (1 '), the third glass sheet protruding from the second glass sheet (1') by an edge covering the first electrical insulation material ( 61), said first covering edge (83), the invention also relates to the manufacture of n such liquid crystal glazing.

Vacuum solar collector for absorbing solar heat from radiation to heat water in domestic applications, has solar radiation absorber designed as sheet and kept in contact with pipes, where gas traps are arranged between pipes and main wall

The collector (1) has a chamber (2) delimited by a tempered glass sheet (3), where pressure inside the chamber is less than atmospheric pressure, and interior thickness of the chamber is equal to 10 mm. The glass sheet comprises a main wall (4) that is connected to another main wall through a frame (5). The chamber exhibits a large distance from the glass sheet, and a solar radiation absorber (6) is designed as a sheet and kept in contact with metal pipes (7) that circulates coolant i.e. water. Gas traps (20) are arranged between the pipes and the former main wall.

VARIABLE DIFFUSION GLAZING WITH LIQUID CRYSTALS

L'invention porte sur un vitrage multiple à cristaux liquides (100) présentant : - une première feuille de verre (1) et une deuxième feuille de verre (1') maintenues par un joint (6), - des première et deuxième électrodes (3, 3') avec première et deuxième zones d'alimentation électrique (90, 31, 90', 31'), - une couche (4) de cristaux liquides, avec des espaceurs, - la première feuille de verre (1) dépassant par un premier bord dépassant et comportant la première zone d'alimentation électrique, - un câblage électrique (9, 9') avec une première entrée de câblage (90) avec une première matière d'isolation électrique (61) polymérique.

Method for measuring the thickness of a transparent material

Le procédé se caractérise en ce qu'on émet un faisceau lumineux (4) à fréquence optique modulée, en ce qu'on réceptionne deux faisceaux ou rayons lumineux (i, j) renvoyés par chacune des surfaces (2, 3) d'une paroi (1) du matériau, en ce qu'on crée une interférence entre eux (i, j) et en ce qu'on détermine la différence de marche δ du signal d'interférence. On utilise une diode laser comme source d'éclairement, celui-ci est modulé par une modulation de la fréquence optique du faisceau. Parmi les rayons diffusés par les deux parois, on sélectionne deux rayons parallèles. Le dispositif de l'invention permet d'effectuer sur chaque capteur des mesures espacées de 0,3 msec. On peut ainsi explorer tous les millimètres de la périphérie d'une bouteille en rotation. Application aux bouteilles en verre ou en plastique claires ou colorées et au verre plat.

SUPPLYING A LIQUID CRYSTAL ELECTROCOMMANDABLE GLAZING, METHOD FOR SUPPLYING SUCH A GLAZING

L'invention concerne un vitrage (VITR) électrocommandable à cristaux liquides comportant un substrat porteur d'un élément à cristaux liquides disposé entre une première électrode et une deuxième électrode reliées à une alimentation électrique (ALIM), l'élément à cristaux liquides étant apte à passer : - d'un état diffusant dans lequel le vitrage (VITR) est soumis à une tension nulle, - à un état transparent et/ou coloré, dans lequel le vitrage (VITR) est soumis à une tension alternative sinusoïdale (V (t)) d'amplitude dite de fonctionnement (V ), caractérisé en ce que l'alimentation électrique (ALIM) est adaptée pour appliquer au vitrage (VITR) une tension de démarrage (V (t)) dont l'amplitude augmente progressivement de zéro jusqu'à l'amplitude de fonctionnement (V ), pendant une durée de démarrage (T ) d'au moins 0,1 seconde débutant suite à l'activation de l'alimentation électrique (ALIM), et/ou une tension d'arrêt (V (t)) dont l'amplitude diminue progressivement de l'amplitude de fonctionnement (V ) jusqu'à zéro, pendant une durée d'arrêt (T ) d'au moins 0,1 seconde débutant suite à l'arrêt de l'alimentation électrique (ALIM). An electrically controllable liquid crystal glazing (VITR) having a substrate carrying a liquid crystal element disposed between a first electrode and a second electrode connected to a power supply (ALIM), the liquid crystal element being capable of to pass: - a diffusing state in which the glazing unit (VITR) is subjected to a zero voltage, - to a transparent and / or colored state, in which the glazing unit (VITR) is subjected to a sinusoidal alternating voltage (V ( t)) said amplitude of operation (V), characterized in that the power supply (ALIM) is adapted to apply to the glazing (VITR) a starting voltage (V (t)) whose amplitude increases gradually from zero to the operating amplitude (V), during a starting time (T) of at least 0.1 second starting after ...

Planar or substantially planar luminous structure

LIGHTING MIRROR

VARIABLE DIFFUSION MULTIPLE GLAZING BY LIQUID CRYSTALS, ITS MANUFACTURING PROCESS

A multiple glazing with variable scattering by liquid crystals includes first and second flat float glass sheets sealed on the edge of their internal faces by a sealing joint, in particular made of a given sealing material, in particular essentially organic, first and second electrodes, and a layer of liquid crystals with an average thickness E between 15 and 60 mum inclusive of these values and incorporating spacers. The thickness A of each of the first and second glass sheets is less than or equal to 5.5 mm, and each of the internal faces coated with the first and second electrodes has a dioptric defect score, expressed in millidioptres, of less than 12E/15 where the thickness E of the liquid crystals is in mum.

Electrically conductive carrier for a glazing unit with variable liquid-crystal-induced scattering, and such a glazing unit

The present invention relates to an electrically conductive carrier for a liquid-crystal glazing unit (100) comprising a multilayer (3) containing, in this order: an electrode comprising an electrically conductive transparent oxide based layer, called the TCO layer; a first barrier layer, based on silicon nitride, of thickness e 1 of at least 5 nm; and a second barrier layer, based on silicon oxide, of thickness e 2 of at least 30 nm; the thickness e 1 is smaller than or equal to e 2 and/or e 1 is smaller than 80 nm, and the cumulative thickness e b of the first and second barrier layers is larger than or equal to 50 nm and smaller than 150 nm.

METHOD AND DEVICE FOR MEASURING SHAPE CONSTRAINTS IN TRANSPARENT MATERIAL

LIGHT EMITTING DEVICE LIGHTING DEVICE

Plan or essentially plane light structure

Multiple glazing with variable scattering by liquid crystals and its method of manufacture

A multiple glazing with variable scattering by liquid crystals includes first and second flat float glass sheets sealed on the edge of their internal faces by a sealing joint, in particular made of a given sealing material, in particular essentially organic, first and second electrodes, and a layer of liquid crystals with an average thickness E between 15 and 60 μm inclusive of these values and incorporating spacers. The thickness A of each of the first and second glass sheets is less than or equal to 5.5 mm, and each of the internal faces coated with the first and second electrodes has a dioptric defect score, expressed in millidioptres, of less than 12E/15 where the thickness E of the liquid crystals is in μm.

Method and apparatus for measuring the thickness of a transparent material

Light emitted from a diode laser (1) passes through a lens (16) and forms an image of the laser output (A) at a specified position (B). A divergent beam from the position (B) is incident to plate glass (2) and is reflected from both it's surfaces to produce interference. An element of the interference is focused by a further lens (6) to a multimode optical fiber (5) for transmission to a detector and processor which deduce the plate thickness from the beats per modulation period.

LIGHT EMITTING DEVICE LIGHTING DEVICE

La présente invention concerne un luminaire (1) comportant des diodes électroluminescentes (2) en tant que sources lumineuses d'éclairage et agencées sur un support (20), et un caisson logeant le support des diodes et fermé par un substrat verrier (3) en regard des diodes. Le caisson, tout comme les moyens de solidarisation du support au caisson, sont en un matériau thermiquement conducteur. En outre, des moyens de diffusion de la lumière (4) sont agencés au moins dans des zones localisées en regard des diodes, et un réflecteur de lumière est agencé dans le caisson. Le luminaire est ainsi de faible épaisseur, de forte efficacité, et très peu éblouissant. The present invention relates to a luminaire (1) comprising light emitting diodes (2) as light sources of illumination and arranged on a support (20), and a box housing the support of the diodes and closed by a glass substrate (3) next to the diodes. The box, as well as the means for securing the support to the box, are made of a thermally conductive material. In addition, light diffusion means (4) are arranged at least in localized areas facing the diodes, and a light reflector is arranged in the box. The luminaire is so thin, high efficiency, and very dazzling.

ELECTROLUMINESCENT DIODE PANEL

METHOD FOR FORMING A BARRIER COATING ON THE SURFACE OF A CONTAINER AND RELATED INSTALLATION

METHOD FOR MANUFACTURING A VARIABLE DIFFUSION MULTIPLE VITRATION BY PDLC LAYER, SUCH A MULTIPLE GLAZING WITH A PDLC LAYER

Method for measuring the thickness of a transparent material.

A anti-skidding structure for air feed module assembly

本实用新型公开的属于气瓶支架技术领域，具体为一种用于供气模块总成的防滑结构，包括：鞍座、弧形板、箍带和气瓶，所述鞍座的中部上方均匀的焊接有多个加强板，所述鞍座的左右两侧开设有捆绑固定孔，所述鞍座的顶部固定安装有弧形板，所述弧形板的顶部均匀的排列有花纹网格，所述弧形板的左右两端固定安装有箍带连接孔，所述弧形板的顶部卡接有气瓶，所述气瓶的顶部贴合连接有箍带，所述箍带与所述捆绑固定孔相螺接，该实用新型通过使用花纹网格板来制作框架弧板通过增大摩擦系数和有限接触面积来实现防松效果。

Flat coplanar-discharge lamp and uses of same

Lampe plane à décharge (100) transmettant un rayonnement dans l'ultraviolet ou le visible, comprenant : des premier et deuxième éléments verriers plans (2, 3) ou sensiblement plans maintenus sensiblement parallèles entre eux et délimitant un espace interne (10) rempli de gaz (71), le premier et/ou le deuxième élément verrier étant en un matériau transmettant ledit rayonnement ; au moins une première électrode (41a) et au moins une deuxième électrode (51 a) lesquelles sont susceptibles d'être à des potentiels distincts et d'être alimentées par une tension alternative (V1) , les première(s) et deuxième(s) électrodes étant associées à une ou des faces principales (21) du premier élément verrier, les première(s) et deuxième(s) électrodes étant essentiellement allongées et sensiblement parallèles entre elles, et séparée s par au moins un espace dit interélectrodes de largeur donnée dite d1 sensiblement constante, caractérisée en ce qu'elle comprend en outre au moin s une troisième électrode (42a) susceptible d'être à un potentiel donné (V01), associée à une face principale (31) du deuxième élément verrier et occupant, en projection, au moins partiellement l'espace interélectrodes. Flat discharge lamp (100) transmitting radiation in the ultraviolet or visible, comprising: first and second planar glass elements (2, 3) or substantially planes maintained substantially parallel to each other and delimiting an internal space (10) filled with gas (71), the first and / or second glass element being made of a material transmitting said radiation; at least a first electrode (41a) and at least a second electrode (51a) which are likely to be at distinct potentials and to be supplied by an alternating voltage (V1), the first (s) and second (s) ) electrodes being associated with one or more main faces (21) of the first glass element, the first (s) and second (s) electrodes being essentially elongated and substantially parallel to each other, and separated by at ...

Light-emitting diode panel

The invention relates to a light panel (100) comprising: a transparent mineral glass sheet (1) that has a front surface (11), a rear surface (12), and an edge surface; a plurality of light-emitting diodes (2) that are arranged in alignment with the edge surface, or in a hole in the edge of one of the surfaces, so as to propagate the light within the body of the sheet; a means (3) for scattering the guided light so as to extract said light through the front surface (11), said means being a surface scattering means (11), taking up most of the front surface, or a volume scattering means, the surface, projected onto the front surface, of which takes up most of the front surface; and a specular reflector (4) that is located opposite the scattering means and on the rear surface and moreover has a specular reflection coefficient that is at least equal to 80% for all the wavelengths of the emission spectrum of the diodes.

Method for producing a multiple glazing unit with variable diffusion by pdlc layer and a multiple glazing unit with a pdlc layer produced according to said method.

La presente invención propone un método para producir una unidad de acristalamiento múltiple con difusión variable por cristales (100) líquidos que comprende hojas (1, 2) de vidrio mantenidas en su lugar por un sello (7) adhesivo, en las caras internas de los electrodos (3, 4), y que comprende una capa (5) de PDLC en contacto con el sello (7) adhesivo, el método comprende las siguientes etapas: (a) aplicar, al primer electrodo (3), un material (7) denominado de pre-sello; (b) depositar, en el primer electrodo (3), una composición (5) de cristal líquido, el orden de las etapas (a) y (b) son intercambiables, (c) ensamblar las hojas (1, 2) de vidrio, con las caras interiores enfrentadas entre sí, por calandrado o prensado, (d) después de ensamblar, irradiar y/o calentar para polimerizaciones, el pre-sello y la composición se forman a partir de acrilato sin precursor de polímero epoxi. La invención también tiene que ver con el método para producir tal unidad de ventanas con PDLC.

Illuminating wall