СПОСОБ ОПРЕДЕЛЕНИЯ УСТОЙЧИВОСТИ ГЕНОТИПОВ ЛЬНА К ИЗМЕНЕНИЮ КИСЛОТНОСТИ ПОЧВЕННОГО РАСТВОРА

Изобретение относится к сельскому хозяйству, в частности к селекции и технологии возделывания льна-долгунца. Выращивают растения на трех фонах с различным уровнем кислотности (pHKCl) - I - 4,5 и ниже (исходная почва) - сильнокислый, II - 5,5 - слабокислый, III - 7,0 - нейтральный, которые создаются путем внесения извести непосредственно под лен и тщательного ее перемешивания с почвой на глубину пахотного слоя, из расчета доведения pHKCl до заданной величины, используя коэффициент, полученный опытным путем для сдвига на 0,1 рН - 0,31 т/га СаСО3 для легкосуглинистых и 0,40 т/га для среднесуглинистых почв. Далее проводят анализ изменчивости основных параметров продуктивности (масса волокна, содержание волокна, масса семян, число семян на одном растении) и ранжирование тестируемых образцов на группы: адаптированные к различной степени кислотности, устойчивые к нейтральной реакции среды, устойчивые к сильнокислой реакции и неустойчивые к изменению степени кислотности. Изобретение позволяет быстро ...

СПОСОБ ВОЗДЕЛЫВАНИЯ ПРОМЫШЛЕННЫХ НАСАЖДЕНИЙ ПЕРСИКА СЕМЕНАМИ

Изобретение относится к области сельского хозяйства. В способе проводят разбивку подготовленного участка под сад. На 3-й год после всходов проводят идентификацию сеянцев, оставляя для массового плодоношения типичные для данного сорта сеянцы. При этом подготовленную почву маркируют по схеме 4×3 м, а посев семян на постоянное место производится осенью на глубину 7-8 см по 4-5 семян в каждое гнездо. Способ позволяет ускорить плодоношение, получить выровненные насаждения при возделывании персика и снизить затраты. 1 з.п. ф-лы.

СПОСОБ ОТБОРА МОРОЗОСТОЙКИХ ФОРМ АЛЛОПЛАЗМАТИЧЕСКОЙ РЖИ

Изобретение предназначено для использования в области селекции растений. Способ включает воздействие на растение отрицательными температурами. При этом воздействию подвергается узел кущения растений гексаплоидного тритикале II-III этапов органогенеза. Последовательно в нескольких генерациях воздействуют критическими температурами вымерзания растений, а в последней - летальными. После этого проводят отбор выживших растений. Изобретение позволяет отобрать аллоплазматическую рожь, характеризующуюся улучшенным по морозостойкости плазмоном пшеницы и ядром ржи. 3 табл.

СПОСОБ ОПРЕДЕЛЕНИЯ ВЫПОЛНЕННОСТИ СЕМЯН ЗЕРНОВЫХ КУЛЬТУР

Изобретение относится к сельскому хозяйству и может быть использовано в селекции и семеноводстве зерновых культур. Способ включает определение среднего коэффициента семян исследуемого образца, при этом образец разделяют на фракции, в которых определяют средний коэффициент выполненности по формуле Кф= Ус/Уц, где Ус - объем семян фракции, помещенных в мерный цилиндр; Уц - объем мерного цилиндра, заполненного семенами. Средний коэффициент выполненности семян для исследуемого образца вычисляют по формуле где ∑ Kф - сумма средних коэффициентов выполненности семян каждой фракции; п - количество фракций в образце. Способ довольно точен, прост, доступен и приемлем как в лабораторных, так и в полевых условиях, позволяет определить выполненность семян как всей партии, так и любой фракции семян, при этом не снижая семенных качеств, что дает возможность использовать их в других исследованиях.

ТРАНСГЕННЫЕ РАСТЕНИЯ

Изобретение относится к генетической инженерии и может быть использовано в селекции растений. Опосредованная Agrobacterium трансформация растения сахарной свеклы, в котором экспрессируется фермент с ср4/epsps-активностью, придает этим растениям устойчивость к обработке гербицидом. 2 с. и 11 з.п. ф-лы, 7 табл.

СПОСОБ ОЗДОРОВЛЕНИЯ РАСТЕНИЙ ОТ ВИРУСОВ

Изобретение предназначено для использования в области сельского хозяйства. Способ включает высадку эксплантов на питательную среду и их культивирование. При этом в питательную среду дополнительно вводят в качестве фенольного соединения гидроксибензойную кислоту. В качестве последней может быть использована салициловая, галловая или сиреневая кислота в концентрации 1×10-4- 6×10-4. Проводят 2-3 последовательных субкультивирования эксплантов на питательной среде. Изобретение позволяет повысить эффективность оздоровления растений от вирусов, удешевить процесс оздоровления, а также снизить опасность для здоровья человека. 4 табл.

СПОСОБ ОЦЕНКИ СКОРОСПЕЛОСТИ РАСТЕНИЙ ФЕЙХОА

Изобретение относится к сельскому хозяйству и может быть использовано в селекции фейхоа, а также с целью получения однородного (по скорости созревания плодов) посадочного материала. Способ состоит в том, что выращивают растения из семян и оценивают их скороспелость путем измерения степени когерентности оптического потока, прошедшего сквозь лист, при этом чем меньше степень ослабления когерентности, тем более скороспелой является форма фейхоа. Целью изобретения является повышение точности оценки скороспелости форм фейхоа и снижение ее трудоемкости. 2 табл.

СПОСОБ ОЦЕНКИ СТРУКТУРЫ УРОЖАЯ

Изобретение относится к растениеводству, а именно к способу оценки структуры урожая. Способ включает отбор сноповых образцов с делянок площадью один квадратный метр контрольного питомника. В средней части контрольной делянки на типичном месте выкапывают растения и у десяти из них без выбора подсчитывают общее число продуктивных и непродуктивных стеблей. Высоту стеблей измеряют на корню в 3-5 типичных местах делянки, выпрямляя полегшие и поникшие растения. Далее срезывают без выбора 30-50 колосьев, которые помещают в бумажный пакет, этикируют и направляют в лабораторию для определения длины колоса, числа колосков и зерен в колосе, массы зерен с колоса и крупности зерен. При этом число колосков в колосе подсчитывают у всех колосьев подряд, определяют суммарную длину всех колосьев путем последовательного накладывания их один за другим на мерную линейку. Затем колосья вместе обмолачивают, зерно взвешивают, число зерен подсчитывают. При этом длину колоса, число колосков в колосе, продуктивность ...

СПОСОБ ОПРЕДЕЛЕНИЯ УРОВНЯ ГОРИЗОНТАЛЬНОЙ (ЧАСТИЧНОЙ) УСТОЙЧИВОСТИ СОРТОВ КАРТОФЕЛЯ К ФИТОФТОРОЗУ ПОУРОВНЮ АГРЕССИВНОСТИ ПАТОГЕНА PHYTOPHTHORA INFESTANS (MONT.) DE BARY

Изобретение относится к области сельского хозяйства, в частности к определению уровня горизонтальной (частичной) устойчивости сортов картофеля к фитофторозу. Проводят заражение листьев каждого сортообразца изолятами P. infestans с дальнейшим подсчетом некрозов и измерением их размеров. Измеряют продуктивность спороношения и определяют фитофтороустойчивость растений картофеля по номограмме. Изобретение позволяет провести оценку при одновременном использовании изолятов патогена из нескольких регионов и получить информацию о восприимчивости изучаемых сортов к P. infestans в различных географических зонах. 1 ил., 1 табл.

СПОСОБ ОПРЕДЕЛЕНИЯ ОТНОСИТЕЛЬНОЙ УСТОЙЧИВОСТИ СОРТОВ ЯРОВОЙ ПШЕНИЦЫ К ОБЫКНОВЕННОЙ КОРНЕВОЙ ГНИЛИ ЗЛАКОВ

Способ относится к сельскому хозяйству, в частности к биофизическим способам оценки растений, и может быть использован для эффективной массовой оценки селекционного материала пшеницы на иммунитет к обыкновенной корневой гнили злаков. Способ заключается в том, что, используя в качестве растительного объекта корни здоровых и инфицированных возбудителем болезни проростков, готовят водные вытяжки корней (корневые экссудаты), регистрируют их собственное и индуцированное перекисью водорода свечение и по изменению этого свечения дифференцируют сорта пшеницы по устойчивости к обыкновенной корневой гнили злаков. При этом проростки выращивают в течение 10-14 суток, после чего корни отделяют от ростков и готовят водные корневые экссудаты, регистрируют их собственное и индуцированное 1-3% раствором перекиси водорода свечение, вычисляют реакцию сорта на заражение по отношению К = Io/Iк, где Iо - индуцированное свечение корневых экссудатов, нормированное к собственному свечению, в опыте; Iк - индуцированное ...

СПОСОБ ПОЛУЧЕНИЯ ФЕРТИЛЬНЫХ ЛИНИЙ СОРГО, ЯВЛЯЮЩИХСЯ ВОССТАНОВИТЕЛЯМИ ФЕРТИЛЬНОСТИ ДЛЯ ЦМС ТИПА 9Е

Изобретение относится к генетике и репродуктивной биологии растений. Изобретение представляет собой способ получения фертильных линий сорго, являющихся восстановителями фертильности для ЦМС типа 9Е, включающий выращивание гибридных растений, полученных от скрещивания ЦМС-линий и фертильных линий, оценку их восстановительной способности в тест-кроссах с ЦМС-линиями, где гибридные растения выращивают в условиях теплицы, способствующих реверсии к мужской фертильности, а их потомство выращивают в полевых условиях, где производят отбор фертильных растений, способных к восстановлению фертильности гибридов FИзобретение позволяет получать линии-восстановители мужской фертильности для стерильной цитоплазмы сорго типа 9Е. 3 ил., 1 табл., 3 пр.

СПОСОБ ФОРМИРОВАНИЯ СОРТОВ КЛЕВЕРА ЛУГОВОГО ЛУГОПАСТБИЩНОГО НАПРАВЛЕНИЯ

Изобретение относится к области сельского хозяйства, в частности к области селекции. Способ включает оценку образцов в травосмесях со злаковыми и разнотравными компонентами и отбор на конкурентоспособность выживших особей более 50%. При этом оценку образцов осуществляют в фазе бутонизации первого укоса 2-3 годов жизни по количеству междоузлий и генеративных стеблей. По наличию междоузлий более семи и стеблей более пяти определяют перспективность исходных образцов для дальнейшей селекционной оценки. Способ позволяет повысить эффективность. 1 табл., 1 пр.

МОРФОТОПОГРАФИЧЕСКИЙ СПОСОБ ОЦЕНКИ УСТОЙЧИВОСТИ СЕЛЬСКОХОЗЯЙСТВЕННЫХ РАСТЕНИЙ К ИОННОЙ ТОКСИКАЦИИ АЛЮМИНИЕМ

Изобретение относится к области селекции зерновых культур. Способ включает асептическое культивирование проростков на голодном агаре (2%) (контроль) и агаре с добавлением 15 мг/л ионов алюминия и водорода (pH 4) (стрессовые условия). Изобретение представляет собой способ оценки устойчивости зерновых культур к ионной токсикации алюминием, включающий культивирование асептически полученных проростков на голодном агаре 2,0% в обычных (контроль) и стрессовых условиях, создаваемых добавлением в подкисленный до рН 4,0 голодный агар 15 мг/л ионов алюминия в форме Al(SO)⋅18HO, где процесс оценки осуществляется с использованием специальной шкалы, путем визуального сравнения корневой системы проростков по комплексу морфотопографических признаков и деформаций корневой системы в стрессовых условиях, с соответствующей им балльностью, и группой устойчивости, и дифференциацией генотипов на высокоустойчивые - 5 баллов, устойчивые - 3-4 балла, чувствительные - 0-2 балла:высокоустойчивые - 5 баллов - снижение ...

СПОСОБ ОЦЕНКИ МОРОЗОСТОЙКОСТИ ОЗИМОЙ ПШЕНИЦЫ

Изобретение предназначено для использования в области сельского хозяйства в селекции. Способ включает трехнедельное проращивание семян в термостате при 25oС на увлажненной фильтровальной бумаге при 12-часовом в сутки освещении 7 тыс. лк. При этом в первые сутки после проращивания осуществляют промораживание растений при 0...-2oС, во вторые сутки при -5...-7oС с последующим определением гидролитической активности фермента - фруктофуранозидазы. Вычисляют индексы стойкости растений, которые выражают отношением гидролитической активности фермента в третьем листе растений после промораживания к исходной, а также выделяют три группы стойкости: морозостойкую (индекс стойкости 3,00 и выше), среднеморозостойкости (1,51-3,00) и слабоморозостойкую (1,5 и ниже). Для сравнительной оценки морозостойкости используют стандартные сорта-классификаторы. Изобретение позволяет ускорить процесс получения результатов оценки, экономно использовать селекционный материал, повысить объективность оценки. 1 табл.

СПОСОБ СОЗДАНИЯ ВОССТАНОВИТЕЛЕЙ ФЕРТИЛЬНОСТИ ЯРОВОГО РАПСА (BRASSICA NAPUS L.)

Изобретение относится к биотехнологии и может быть использовано для получения восстановителей фертильности. Изобретение представляет собой способ создания восстановителей фертильности ярового рапса in vitro. Отбирают донорский материал и проводят предобработку центральных кистей растений ярового рапса со стерильной цитоплазмой и генами восстановления фертильности температурой +4-6°С в течение суток. Вводят в культуру неоплодотворенные семязачатки с бутонов длиной 2-4 мм и культивируют их на питательной среде MS с добавлением 1 мг/л кинетина, 0,2 мг/л НУК и 0,1 мг/л 2,4-Д, осуществляют стабилизацию и микроразмножение гаплоидных линий, диплоидизацию путем добавления 0,005% раствора колхицина в питательную среду. Укорененные растения пересаживают в грунт, где они формируют семена, которые высевают в поле для получения растений-восстановителей фертильности. Изобретение позволяет получить новый исходный материал для гетерозисной селекции на основе ЦМС. 2 ил., 2 табл.

СПОСОБ ОТБОРА РАСТЕНИЙ ГРЕЧИХИ НА УСТОЙЧИВОСТЬ К ПОЛЕГАНИЮ

Изобретение предназначено для использования в сельском хозяйстве в селекции. Способ включает высев гречихи на изолированном участке, отбор образцов и их анализ. Отбор образцов проводят в фазу плодообразования, при этом выделяют растения со светлой окраской корневой системы, с показателем корнеобеспеченности 0, 14 и содержанием рутина в корнях 0,6%. Изобретение позволяет упростить способ, сократить количество образцов и их анализ, снизить трудоемкость и затраты на проведение селекционной работы. 1 табл.

СПОСОБ ОТБОРА УСТОЙЧИВЫХ К СТОЛБЧАТОЙ РЖАВЧИНЕ, МУЧНИСТОЙ РОСЕ И ПОЧКОВОМУ КЛЕЩУ РАСТЕНИЙ СМОРОДИНЫ ЧЕРНОЙ

Изобретение относится к области сельского хозяйства, в частности к селекции. Способ включает выращивание растений и проведение ряда последовательных скрещиваний с донорами, имеющими иммунитет к столбчатой ржавчине, мучнистой росе и почковому клещу. При скрещивании в качестве доноров используют производные смородины клейкой. Причем иммунитет к столбчатой ржавчине имеет олигогенный характер наследования, обеспечиваемый геном, обозначенным символом Ре. Проводят искусственное заражение растений. Отбор и анализ растений проводят на ранних стадиях развития в селекционной школке. Изобретение позволяет ускорить селекционный процесс.

СПОСОБ ДИФФЕРЕНЦИАЦИИ РАСТЕНИЙ МНОГОЛЕТНИХ ТРАВ И НЕКОТОРЫХ ВИДОВ РАСТЕНИЙ - РЕЗЕРВАТОВ ПАТОГЕНОВ ПО ПРИЗНАКУ МАГНИТНОЙ ИНДУКЦИИ

Изобретение относится к области измерения магнитных величин слабых магнитных полей, амплитуда которых сравнима или значительно меньше амплитуды геомагнитного поля, в селекции у растений многолетних трав и некоторых видов растений - резерватов патогенов. В способе дифференцируют генотипы многолетних трав и деревьев по признаку магнитной индукции слабого магнитного поля. При этом измеряют магнитную индукцию у ольхи серой, ивы белой, черемухи с листьями, пораженными болезнями, и без них, у растений клевера гибридного, овсяницы луговой и у стандарта без растений. Превышение уровня магнитной индукции соответствует устойчивым или слабовосприимчивым генотипам многолетних трав. Способ обеспечивает возможность выявления устойчивых к патогенам растений по признаку магнитной индукции. 1 табл.

СПОСОБ ПОЛУЧЕНИЯ ТРАНСГРЕССИВНЫХ РАСТЕНИЙ ОЗИМОЙ РЖИ

Изобретение предназначено для использования в области сельского хозяйства в селекции. Способ включает подбор родительских форм. В качестве материнской используют форму с плазмонным контролем адаптивности и интенсивности роста. В качестве отцовской - источник пониженной пыльцевой продуктивности. Проводят гибридизацию, размножают полученные гибриды, и в гибридах с конкурсным гетерозисом отбирают растения по элементам продуктивности компенсаторного действия. При этом в качестве элементов продуктивности компенсаторного действия используют синхронное колошение, озерненность колоса, крупность, выполненность и выравненность зерна. Изобретение позволяет получить адаптивную продуктивную популяцию озимой ржи. 1 з.п.ф-лы, 1 ил., 6 табл.

СПОСОБ ЭКСПРЕСС-ОЦЕНКИ МОРОЗОСТОЙКОСТИ РАСТИТЕЛЬНОЙ ТКАНИ ПЛОДОВЫХ И ЯГОДНЫХ КУЛЬТУР

Изобретение относится к сельскому и лесному хозяйству. Растительную ткань промораживают при плавном повышении температуры от -90°С до -70°С. Параллельно измеряют характеризующий их состояние показатель. При каждой температуре в тканях материала возбуждают свободнозатухающие крутильные колебания и измеряют динамический модуль сдвига. Затем строят график зависимости динамического модуля сдвига от температуры. При этом порогом морозостойкости считают температуру, соответствующую области наиболее быстрого уменьшения величины динамического модуля сдвига, определяемую как минимум на температурной зависимости первой температурной производной динамического модуля сдвига, либо как точку, соответствующую нулевому значению его второй температурной производной. Данный способ позволяет быстро, достоверно и точно оценить критическую температуру морозостойкости и критерий физической жизнеспособности одревесневшей растительной ткани плодовых и ягодных культур. 3 з.п. ф-лы, 3 ил.

Brassica juncea КАЧЕСТВА ОМЕГА-9

Изобретение относится к области биохимии, в частности к трансгенному растению Brassica juncea, эндогенное содержание жирных кислот семян которого включает от примерно 70% до 78% олеиновой кислоты по массе и от примерно 2% до 3% линоленовой кислоты по массе, где растение содержит fad2 или fad3 аллель, кодирующую мутантный белок дельта-12-десатураз жирных кислот, имеющий аминокислотную последовательность, выбранную из группы, состоящую из SEQ ID NO:5-7, а также к семени вышеуказанного растения и к маслу указанного семени, содержание жирных кислот которого включает от примерно 70,0% до 78% олеиновой кислоты по массе и от примерно 2% до 3% линоленовой кислоты по массе, в остальном имеющее свойства масла семян Brassica juncea. Изобретение позволяет эффективно получать масло семян Brassica juncea, содержание жирных кислот которого включает от примерно 70,0% до 78% олеиновой кислоты по массе и от примерно 2% до 3% линоленовой кислоты по массе. 3 н. и 4 з.п. ф-лы, 4 ил., 6 пр.

СПОСОБ ОТБОРА ВЫСОКОБЕЛКОВЫХ ФОРМ СЕМЯН

Изобретение относится к селекции растений, в частности к оценке селекционного материала бобовых культур на белковость. Замачивают семена в теплой воде с последующим выдерживанием в течение суток в термостате при температуре 45°С. Сравнительную оценку белковости проводят по остаточному объему поглощенной воды. Изобретение позволяет объективно и надежно провести оценку селекционного материала бобовых культур. 1 табл.

СПОСОБ СОЗДАНИЯ И ПОДДЕРЖАНИЯ КОЛЛЕКЦИИ ОЗДОРОВЛЕННЫХ СОРТОВ КАРТОФЕЛЯ В ВИДЕ МОНОКЛОНАЛЬНЫХ МИНИ-КЛУБНЕЙ

Изобретение относится к области биотехнологии и сельского хозяйства, в частности к растениеводству. В способе клональное размножение оздоровленных растений осуществляют путем черенкования. При этом коллекционный материал каждого сорта образован моноклональными мини-клубнями, выращенными в закрытом помещении на аэропонной установке из одного размноженного оздоровленного растения в условиях, характерных для климатической зоны, где районирован сорт. Затем коллекционный материал каждого сорта картофеля хранят и поддерживают в виде генетически однородных моноклональных мини-клубней, продуктивность которых соответствует генетическому потенциалу сорта, путем периодического обновления коллекционного материала данного сорта новым поколением моноклональных мини-клубней, выращенных в закрытом помещении на аэропонной установке из клубней, взятых из коллекции данного сорта. Культивирование черенков при размножении родоначального оздоровленного растения осуществляют в автотрофных условиях на гидропонике ...

СПОСОБ ОТБОРА РАСТЕНИЙ КОНОПЛИ НА СОДЕРЖАНИЕ В НИХ КАННАБИНОИДОВ

Изобретение предназначено для использования в селекции растений. Отбор растений конопли на содержание каннабиноидов проводят посредством визуального анализа по антоциановой окраске черешков и пластинок верхушечных листьев, сформированных до фазы начала цветения. Растения с максимально интенсивной окраской содержат минимальное количество каннабиноидных соединений. В качестве селекционной элиты отбирают растения с темно-красной окраской черешков и пластинок верхушечных листьев. Это позволяет упростить процесс отбора, существенно сократить селекционный процесс, а также затраты труда, времени и материальных средств. 1 з.п. ф-лы, 1 ил., 4 табл.

РАСТЕНИЯ BRASSICA OLERACEA С УСТОЙЧИВОСТЬЮ К MYCOSPHAERELLA BRASSICICOLA

Настоящее изобретение относится к получению растений Brassica oleracea, устойчивых к возбудителю кольцевой пятнистости (Mycosphaerella brassicicola). Описано растение Brassica oleracea, содержащее ген резистентности к М. brassicicola, выделенный из устойчивого к заболеванию растения, семена которого депонированы в АТСС под номером РТА-7413, и располагающийся в геноме растения в окружении, по меньшей мере, двух ДНК-маркеров, выявляемых с помощью раскрытых в изобретении специфических праймеров. Предложен способ получения устойчивого к М. brassicicola растения Brassica oleracea, включающий (а) получение первого растения В. oleracea, принадлежащего к М. brassicicola-устойчивой родительской линии, депонированной в АТСС под номером РТА 7413; (b) скрещивание полученного на стадии (а) резистентного растения с восприимчивым вторым растением В. oleracea; (с) выделение из полученного на стадии (b) потомства геномной ДНК и детекцию интрогрессии гена устойчивости по наличию двух или более специфичных ...

СПОСОБ ОПРЕДЕЛЕНИЯ БИОЛОГИЧЕСКОГО ПОТЕНЦИАЛА КУЩЕНИЯ КУЛЬТУРНЫХ ПШЕНИЦ

Изобретение относится к области сельского хозяйства, биологии, селекции и земледелия. В способе подсчитывают число листьев главного побега с последующим расчетом по уравнению зависимости. При этом осуществляют подсчет числа окончивших рост листьев (X) и еще растущих листьев. Определяют морфофазу возраста главного побега, а биологический потенциал кущения - БПК определяют по числу листьев, окончивших рост, по уравнениям в зависимости от морфофазы: в возрасте четных морфофаз - БПК ч/м=X; в возрасте нечетных морфофаз - БПК н/м=Х-1; где, БПКч/м - биологический потенциал кущения в возрасте четной морфофазы главного побега; БПКн/м - биологический потенциал кущения в возрасте нечетной морфофазы главного побега; Х - число листьев главного побега, окончивших рост; 1 - постоянное число для нечетных морфофаз главного побега. Способ позволяет оптимизировать технологию возделывания пшениц для повышения продуктивности агроценоза. 1 табл.

Способ выведения солеустойчивого сорта риса

Изобретение относится к области биотехнологии, а именно к способу выведения солеустойчивого сорта риса. Способ выведения солеустойчивого сорта риса включает в себя следующие этапы: А) подбирают родительские формы с геном солеустойчивости и с высокой урожайностью, скрещивают их для получения гибридов; Б) анализируют гибриды со второго F2 до шестого поколения F6 на наличие гена Saltol методом ПЦР-анализа, оставляют доминантные гомозиготы и гетерозиготы; В) все гибридные формы, начиная с гибридов второго поколения F2 и заканчивая гибридами шестого поколения F6, подвергают строгому фенотипическому, генотипическому и лабораторному отбору под воздействием стресса с учетом хозяйственно-ценных признаков; отбирают лучшие линии для репродуцирования следующего поколения; Г) все гибриды каждый год изучают на солеустойчивость лабораторным способом: в рулонах из фильтровальной бумаги и полиэтилена, в 1,5% солевом растворе NaCl; отбирают лучшие образцы с солеустойчивостью свыше 70%; Д) в гибридах четвертого ...

СПОСОБ ОТБОРА СЕМЯН ПРИ СЕЛЕКЦИИ ТРИТИКАЛЕ

Изобретение относится к области селекции сельскохозяйственных культур. Способ отбора включает выращивание гибридных поколений и индивидуальный отбор семян. Причем отбор индивидуальных хорошо выполненных семян тритикале производят с гибридных растений первого гибридного поколения. Благодаря данному изобретению обеспечивается уменьшение объема селекционного материала, сокращение площадей селекционных посевов и увеличение вероятности и обоснованности отбора.

Способ получения синтетической CG-богатой генетической последовательности и ее использование в растениях

Изобретение относится к области биохимии, в частности к способу получения синтетической CG-богатой генетической последовательности для синтеза гетерологичных белков. Изобретение позволяет получать более высокий уровень экспрессии мРНК репортерного гена. 8 ил., 1 пр.

СПОСОБ ОЦЕНКИ СЕЛЕКЦИОННОГО МАТЕРИАЛА ОЗИМОЙ ПШЕНИЦЫ НА АДАПТИВНОСТЬ

Изобретение используется в сельском хозяйстве, в частности в селекции. Способ включает определение нитратредуктазной активности (НРА) в фазе 8 -10-дневных проростков и спустя 7-10 дней в фазу колошения после обработки химическими веществами, и по максимальному значению НРА отбирают наиболее адаптивные формы по признакам высокой продуктивности. Изобретение позволяет отобрать наиболее продуктивные и адаптивные формы озимой пшеницы. 1 табл.

СПОСОБ ОЦЕНКИ УСТОЙЧИВОСТИ РАСТЕНИЙ ОГУРЦА К ПАУТИННОМУ КЛЕЩУ

Изобретение предназначено для создания устойчивых к паутинному клещу сортов огурца и может быть использовано в селекции. Способ включает оценку неблагоприятности образцов растений для питания вредителя. Проводят инкубирование ткани лиофильновысушенного листа с ферментным экстрактом из тотального гомогената особей лиофильновысушенных клещей с последующим определением количества гидролизованного крахмала, по которому судят об устойчивости растения огурца к паутинному клещу, причем, чем меньше гидролизуемость крахмала> тем устойчивость сорта выше. Способ позволяет проводить круглогодичную оценку устойчивости образцов к паутинному клещу, требует незначительного количества селекционного материала и ускоряет процесс определения устойчивости. 1 табл.

ТЕХНОЛОГИЯ СЕЛЕКЦИИ ПШЕНИЦЫ НА ПОТЕНЦИАЛЬНУЮ УРОЖАЙНОСТЬ

Технология предназначена для использования в сельском хозяйстве. Скрещивание доноров, имеющих высокую комбинационную способность по длине устьичного аппарата на пластинке первого листа всходов, с другими образцами и последующий отбор в первом поколении гибридов комбинации с наибольшим уровнем гетерозиса обеспечивает получение потомства с крупным устьицем. 2 табл.

Способ оценки селекционного материала гороха посевного на интенсивность фотосинтеза листьев

Изобретение относится к сельскому хозяйству, в частности к области растениеводства и селекции. Изобретение представляет собой способ оценки селекционного материала гороха посевного на интенсивность фотосинтеза листьев, включающий измерение интенсивности поглощения молекул углекислого газа на единицу поверхности листьев первого плодоносящего узла в фазу плодообразования, при этом измерения проводят с 9:00 до 11:00 часов дня с помощью переносного газоанализатора марки LI-6400 XT, который фиксирует и показывает значение интенсивности фотосинтеза на цифровом экране, при этом измерительную камеру прикрепляют к листу растения и в течение 1,5-2 минут ожидают стабилизации газообмена в измерительной камере. Изобретение позволяет сократить временные затраты и повысить точность по сравнению с известными способами. 2 ил., 1 табл., 1 пр.

СПОСОБ ОЦЕНКИ УРОЖАЙНОСТИ СЕМЯН БОБОВЫХ ТРАВ

Использование: сельское хозяйство, в частности в семеноводстве бобовых трав. Сущность изобретения: оценку урожайности семян бобовых трав осуществляют путем определения содержания крахмала на срезе корневой шейки растения по интенсивности окраски при воздействии раствором Люголя по 5-балльной шкале. При этом к высокоурожайным относят посевы, получившие оценку 4-5 баллов. 1 табл.

СПОСОБ ОЦЕНКИ СОЛЕУСТОЙЧИВОСТИ РАСТЕНИЙ

Использование: сельское хозяйство. Сущность изобретения: оценку солеустойчивости растений проводят путем измерения электрического сопротивления листьев растений, находящихся под воздействием солевого стресса и в оптимальных условиях роста. О солеустойчивости судят по величине изменения электрического сопротивления, при этом чем меньше изменяется сопротивление, тем выше солеустойчивость растений. 1 табл.

СПОСОБ ОТБОРА ВЫСОКОПРОДУКТИВНЫХ ФОРМ ОЗИМОЙ РЖИ ПРИ СЕЛЕКЦИИ НА ЗАСУХОУСТОЙЧИВОСТЬ

Изобретение относится к сельскому хозяйству, в частности к селекции озимой ржи. Способ включает отбор высокопродуктивных форм озимой ржи при селекции на засухоустойчивость, выращивание растений и отбор лучших по морфологическим признакам. Для отбора лучших по морфологическим признакам используют величину и ориентацию листьев в пространстве. В качестве высокопродуктивных отбирают крупнолистные формы, у которых лист отходит от стебля под острым углом. Отбор проводят до цветения. Величина и ориентация листьев оценивается визуально. Техническим результатом изобретения является повышение эффективности отбора высокопродуктивных форм озимой ржи и снижение трудозатрат. 1 з.п. ф-лы, 2 табл.

СПОСОБ ПОЛУЧЕНИЯ АПОМИКТИЧНЫХ ГАПЛОИДОВ ЛЬНА

Изобретение может быть использовано при селекции растений, в частности льна, и в практической работе для ускорения процесса создания гомозиготных линий льна путем использования апомиктичных гаплоидов. В данном способе получения апомиктичных гаплоидов льна для повышения выхода гаплоидов растения в фазу появления первого цветка обрабатывают раствором диметилсульфоксида в концентрации 1% из расчета 0,1-0,2 мл на одно растение. Изобретение позволяет получить апомиктические гаплоиды льна в большом количестве (в 5-10 раз) по сравнению с известными способами и при минимальных затратах труда. 1 табл.

СПОСОБ ОПРЕДЕЛЕНИЯ УСТОЙЧИВОСТИ КАРТОФЕЛЯ К КОЛОРАДСКОМУ ЖУКУ

Изобретение относится к сельскому хозяйству и может быть использовано в селекции сортов картофеля для создания устойчивых форм к колорадскому жуку в целях снижения применения пестицидов. Способ заключается в прямой оценке свойств растения, обусловливающих его устойчивость. Оценку осуществляют по устойчивости крахмала листьев к гидролизу пищеварительными ферментами жука и концентрации содержащегося в листьях физиологически активного алкалоида α-томатина, не ухудшающего пищевых качеств клубней. При этом, чем меньше гидролизуется крахмал и выше содержание α-томатина, тем устойчивее сорт. Способ позволяет выявлять конкретные механизмы устойчивости картофеля к колорадскому жуку в лабораторных условиях и вести целенаправленную селекцию устойчивых сортов, обладающих высокими пищевыми и вкусовыми качествами. 1 табл.

СПОСОБ ОПРЕДЕЛЕНИЯ АКТИВНОСТИ ФОТОСИНТЕТИЧЕСКОГО АППАРАТА РАСТЕНИЙ

Использование: сельское хозяйство. Сущность изобретения: активность фотосинтетического аппарата различных сортов растений определяют путем отбора растительных проб без нарушения целостности растений, производят подготовку проб, помещая растения в темновую камеру в условия, обеспечивающие сохранение тургора, после приведения фотосинтетического аппарата в активное состояние выделяют хлоропласты, суспендируют их и определяют их содержание в образцах по оптической плотности суспензии, затем измеряют интенсивность переменной и замедленной флуоресценции в суспензиях, предварительно приведенных к одинаковому числу хлоропластов, и по этим показателям судят об активности фотосинтетического аппарата растений. 1 ил.

СПОСОБ ОБРАБОТКИ ПЫЛЬЦЫ КУКУРУЗЫ

Использование: биотехнология, сельское хозяйство, селекционно-генетические исследования, растениеводство. Сущность изобретения: пыльцу кукуркзы обрабатывают непосредственно в пыльниках метелки электромагнитным излучением миллиметрового диапазона определенных параметров. 4 табл.

Способ отбора гибридов мягкой пшеницы с голубой окраской зерновки

Изобретение относится к области биотехнологии. Белозерные или краснозерные, или фиолетовозерные сорта мягкой пшеницы скрещивают с голубозерными сортами/линиями, несущими ген пырея удлиненного ThMyc4E, контролирующий голубую окраску алейронового слоя зерна, затем из зеленых листьев полученных гибридов второго поколения F2 выделяют ДНК и анализируют ее с помощью набора ПЦР-маркеров, состоящего из внутригенного ПЦР-маркера ТаМус4Е и микросателлитных маркеров Xgwm0251/Xgwm0375 и Xgwm0624, картированных на хромосомах 4В и 4D мягкой пшеницы, соответственно. Применение набора ПЦР-маркеров позволяет идентифицировать присутствие гена ThMyc4E, а также хромосом 4В и 4D в геноме полученных гибридов. По наличию ПЦР-фрагментов каждого из маркеров делают вывод о гомозиготном или гетерозиготном состоянии доминантного аллеля гена ThMyc4E у гибридов, а также о полном замещении хромосом 4В или 4D. 2 ил., 1 табл., 2 пр.

CAPS-маркер для отбора гибридов ячменя, не накапливающих проантоцианидины в зерне

Изобретение относится к области биохимии, в частности к CAPS-маркеру для отбора гибридов ячменя, не накапливающих проантоцианидины в зерне. Изобретение позволяет эффективно отбирать растения ячменя, зерно которых не накапливает проантоцианидиновые соединения. 4 ил., 2 пр.

Способ оздоровления картофеля при клональном микроразмножении

Изобретение относится к области биотехнологии и может быть использовано для оздоровления от вирусов растений картофеля. Изобретение представляет собой способ оздоровления картофеля от вирусов PVS, PVM, PVA, PVY, PVX при клональном микроразмножении, включающий термотерапию микроклубней in vitro при температуре 38,0±0,5°С, фотопериоде 16/8. Изобретение позволяет повысить регенерационную способность эксплантов за счет исключения процесса стерилизации после термотерапии и отсутствия дополнительного метода оздоровления - культуры апикальных меристем, а также усилить эффективность освобождения от вирусов за счет увеличения времени экспозиции высокой температуры до 25 суток. 3 ил., 2 табл.

Беспилотный летательный аппарат для отбора колосьев пшеницы с зернами лучших посевных качеств

Изобретение относится к области робототехники и аграрной техники, в частности к конструкции беспилотного летального аппарата (БПЛА), применяемого в сельском хозяйстве для отбора созревших в полевых условиях колосьев пшеницы с зернами лучших посевных качеств. БПЛА содержит закрепленные в корпусе вычислительный блок, систему передвижения, радиомодуль, навигационную систему, видеокамеру, модуль управления, устройство среза колосьев и их перемещения в емкость сбора колосьев, электронные весы. Емкость сбора колосьев установлена на электронных весах, информационный выход которых подключен к вычислительному блоку, модуль управления выполнен с возможностью управления устройством среза колосьев и их перемещения в емкость сбора колосьев, а также с возможностью подсчета количества колосьев. Реализуется функция отбора колосьев пшеницы с зернами лучших посевных качеств, определяется средний вес колосьев. 1 ил.

Способ определения устойчивости картофеля к листогрызущим вредителям

Изобретение относится к области биотехнологии. Изобретение представляет собой способ определения устойчивости картофеля к листогрызущим вредителям. Предлагаемый способ определения устойчивости картофеля к листогрызущим вредителям включает наблюдение за развитием личинок Henosepi-lachna vigintioctomaculata. Отличительной особенностью способа является то, что при наблюдении проводят визуальную оценку наличия морфологических аномалий развития у имаго картофельной коровки, при этом, чем больше процент тератозов выявлен у вредителя, тем устойчивее сорт. 3 ил.

Способ клонального микроразмножения декении фаргеза (Decaisnea fargesii FRANCH.)

Изобретение относится к области биотехнологии растений. Изобретение представляет собой способ размножения Decaisnea fargesii методом культуры in vitro, включающий вычленение апикальных и латеральных почек, использование фрагментов стебля длиной 1 см с 1-2 пазушными почками в качестве первичных эксплантов, стерилизацию, высаживание на питательные среды, размножение микропобегов, их последующее укоренение, адаптацию растений-регенерантов к условиям ex vitro. После адаптации к нестерильным условиям и доращивания получают стандартные саженцы D. fargesii с закрытой корневой системой. Предлагаемый способ клонального микроразмножения D. fargesii позволяет получить высокий коэффициент размножения и, как следствие, необходимое количество выровненных высококачественных саженцев. Посадочный материал является генетически однородным, сокращается период вегетативного размножения культуры и предоставляется возможность проведения работ в течение года. 7 ил.

СПОСОБ ДИАГНОСТИКИ МОРОЗОУСТОЙЧИВОСТИ ПЛОДОВЫХ КУЛЬТУР

Использование: в сельском хозяйстве, в частности при селекции плодовых культур на морозоустойчивость. Сущность изобретения: диагностику морозоустойчивости плодовых культур проводят путем определения в растительной ткани, в качестве которой используют почки однолетних растений в период относительного покоя, содержания фруктозы до и после промораживания в морозильной камере до критических температур и по отношению содержания фруктозы после промораживания к этому показателю до промораживания судят о морозоустойчивости, при этом к морозоустойчивым относят сорта, имеющие отношение, не превышающее 1,35. 1 табл.

СПОСОБ СОЗДАНИЯ РАЗДЕЛЬНОПЛОДНЫХ МУЖСКО-СТЕРИЛЬНЫХ ГИБРИДОВ САХАРНОЙ СВЕКЛЫ

Изобретение относится к созданию опылителей мужско-стерильных линий и мужско-стерильных гибридов и может быть использовано в сельском хозяйстве, а именно в селекции и семеноводстве сахарной свеклы. Сущность изобретения: проводят самоопыление растений двух раздельноплодных диплоидных сортов, насыщение мужско-стерильных линий полученными линиями-опылителями, скрещивание линий-опылителей с мужско-стерильными линиями и отбор лучших по комбинационной способности. Полученные при этом лучшие линии-опылители скрещивают между собой, в пределах каждого из сортов методом свободного опыления для получения синтетиков, затем мужско-стерильные линии одного сорта скрещивают с линиями опылителями и/или синтетиками другого и наоборот (реципрокно) и проводят реципрокный рекуррентный отбор по меньшей мере дважды до достижения высокой продуктивности мужско-стерильных гибридов.

СПОСОБ РАЗМНОЖЕНИЯ РАСТЕНИЙ ИРГИ ЗЕЛЕНЫМИ ЧЕРЕНКАМИ

Изобретение относится к сельскому хозяйству. Изобретение представляет собой способ размножения растений ирги зелеными черенками в условиях искусственного тумана с применением подогрева субстрата, включающий нарезку черенков, предварительную обработку и укоренение, где предварительно, за 2 дня до черенкования, проводят обильный полив маточных растений, нарезают черенки с боковых побегов длиной 10-15 см, с последующей обработкой их водным раствором регулятора роста «Корнерост П» 2 г на литр воды, с экспозицией обработки 16 ч - в полной темноте, а укоренение проводят при относительной влажности воздуха 85%, температуре воздуха 21-24°C и температуре субстрата выше температуры воздуха на 5°C в кассетах с ячейками, наполненными субстратом, который состоит из нейтрального торфа и песка в соотношении 2:1, причем каждый обработанный черенок помещают в отдельную ячейку на глубину 3,5-4,5 см, после высадки проводят двукратную обработку черенков Фитоспорином-М, ПС. Изобретение позволяет повысить выход ...

СПОСОБ ВЫРАЩИВАНИЯ РАСТЕНИЙ ИЗ ТРУДНОПРОРАСТАЮЩИХ СЕМЯН

Способ предназначен для культивирования in vitro выделенных из семян зародышей и может быть использован для размножения видов растений с плохо прорастающими семенами. Семена разрезают в плоскости поперечного их сечения без повреждения зародыша, или оболочку семени раздавливают без повреждения или с частичным повреждением зародыша. Затем подготовленные таким образом семена культивируют в жидкой или на агаризованной среде in vitro. При культивировании их последовательно пересаживают для дальнейшего их развития и получения из них растений на среды с разными концентрациями регуляторов роста. 1 з.п. ф-лы, 1 табл., 5 ил.

СПОСОБ МАРКИРОВАНИЯ СОРТОВ-ПОПУЛЯЦИЙ ЛЮЦЕРНЫ

Изобретение относится к сельскому хозяйству. Изобретение представляет собой способ маркирования сортов-популяций люцерны, включающий при скрещивании родительских пар удаление верхней части паруса распустившегося цветка, осуществление искусственного триппинга, помещение соцветия в гипотонический водный раствор и нанесение пыльцы после просыхания рыльца пестика, где в качестве отцовской формы используют донор маркерных признаков (аномальных для люцерны типов соцветий - сложная кисть и «цветная капуста») с отличающейся от материнской формы окраской лепестков венчика, последующим отбором в Fрастений с окраской лепестков материнской формы, созданием из них замаркированной гибридной популяции, у которой частота растений с аномальным типом соцветий достаточна для визуального выявления при апробации. Способ позволяет повысить отличимость создаваемых сортов-популяций люцерны. 3 ил., 1 пр.

СПОСОБ ОТБОРА МОРОЗОСТОЙКИХ ФОРМ КЛЕВЕРА ЛУГОВОГО

Использование: изобретение относится к области сельского хозяйства, в частности к селекции клевера лугового. Сущность изобретения: при отборе морозостойких форм клевера лугового анализируют семена растений и как морозостойкие выделяют формы, имеющие фиолетовую окраску семян. 1 табл.

СПОСОБ ОТБОРА РАСТЕНИЙ КАПУСТЫ, УСТОЙЧИВЫХ К СЛИЗИСТОМУ БАКТЕРИОЗУ

Использование: область сельского хозяйства, в частности, селекция капусты на устойчивость к слизистому бактериозу. Сущность: при отборе растений капусты проводят анализ растений по морфологическим признакам, при этом измеряют длину наружной кочерыги, отношение высоты кочана к его диаметру и угол отхождения листьев розетки от качана и как устойчивые выделяют растения с наибольшими значениями длины наружной кочерыги и отношением высоты качана к его диаметру и наименьшей величиной угла отхождения листьев от кочерыги. 2 табл.

СПОСОБ ОБЕЗЗАРАЖИВАНИЯ ГОРОХА В УСЛОВИЯХ ЗАЩИЩЕННОГО ГРУНТА ДЛЯ СЕЛЕКЦИОННЫХ ЦЕЛЕЙ

Изобретение относится к области сельского хозяйства, в частности к селекции и защите растений. Способ включает обработку растений действующим активным веществом, в качестве которого используют озоновоздушную смесь с концентрацией озона 1-5 мг/м. Растения гороха обрабатывают 10-30 минут два раза за светлое время суток через каждые 3 часа, в течение всего периода вегетации. Способ позволяет повысить продуктивность гороха путем дезинфекции патогенной микрофлоры. 5 табл.

СПОСОБ ПОЛУЧЕНИЯ ГЕТЕРОЗИСНЫХ ГИБРИДОВ ОГУРЦА

Использование: область растениеводства, в частности селекция огурца. Сущность: при получении гетерозисных гибридов огурца скрещивают линии, происходящие из разных эколого-географических зон и различающиеся по типу ветвления. 4 табл.

БАЛЛИСТИЧЕСКИЙ СПОСОБ ПОЛУЧЕНИЯ ТРАНСГЕННЫХ РАСТЕНИЙ ПОДСОЛНЕЧНИКА (HELIANTHUS ANNUUS L.)

Изобретение относится к селекции растений. Для получения трансгенных растений подсолнечника их трансформируют экзогенной ДНК, вводимой в растительные клетки на частицах твердого носителя. Затем из клеток регенерируют побеги. Экзогенная ДНК может быть представлена, например, генами устойчивости к антибиотикам или гербицидам. Использование промотора RTL2 для экспрессии гена, определяющего устойчивость к гигромицину, и селекции трансформированных клеток в жидкой фазе позволяют получить высокий процент трансформантов подсолнечника. 5 з.п.ф-лы, 2 ил., 1 табл.

СПОСОБ ОПРЕДЕЛЕНИЯ МОРОЗОСТОЙКОСТИ ОЗИМОГО ЯЧМЕНЯ

Изобретение относится к области физиологии и селекции растений. В способе высевают семена в емкостях, представляющих собой металлические ящики, пластмассовые лотки и контейнеры. Промораживают их в морозильных камерах с автоматическим регулированием температурного режима и оценивают степень морозостойкости. При этом при образовании третьего листа - в фазу кущения растения помещают в холодильную камеру - витрину для закалки и выдерживают при температуре от 0 до +3°С в течение 2 суток. Затем переносят в морозильные камеры и оставляют на 2 суток при температуре - -5°С. Далее температуру снижают на 1°С через каждый час до критической -12°С--13°С и размораживают в обратном порядке на 1°С через каждый час до 0°С. Затем через двое суток отключают морозильные камеры, выгружают емкости с растениями и на 3-й день после выгрузки визуально определяют состояние растений по 9-ти балльной шкале, при этом морозостойкость в баллах: 1 - очень низкая, 5 - средняя, 9 - очень высокая. Способ позволяет уменьшить ...

СПОСОБ ОТБОРА БОБОВЫХ РАСТЕНИЙ НА ХОЗЯЙСТВЕННО-ЦЕННЫЕ ПРИЗНАКИ

Использование: изобретение относится к сельскому хозяйству, в частности к селекции растений. Сущность: перед анализом растения Galeda orientalis Lam. инокулируют активным штаммом Rhizobium, в анализируемых растениях определяют нитрогеназную активность и выделяют биотопы с высокой нитрогеназной активностью. 4 табл.

СПОСОБ ОТБОРА ВЫСОКОПРОДУКТИВНЫХ ФОРМ СОИ

Изобретение относится к области сельского хозяйства, в частности к селекции растений. Способ включает выращивание в поле в составе популяции индивидуальных растений и их браковку - отбор по отношению СП/ФП (селекционный признак/фоновый признак) с учетом характера экологической регрессии. При этом в качестве СП используют массу семян растения. В качестве фонового признака берут массу отрезка нижней части главного побега растения в фазе полного созревания. Длину отрезка нижней части главного побега растения берут равной 7-10 см, начиная от корневой шейки. Получение отрезка нижней части побега растения осуществляют в полевых условиях. Массу семян растения определяют путем обрывания плодов с растения в поле, последующего обмолота плодов и взвешивания полученных семян в лабораторных условиях. Способ позволяет сократить продолжительность процесса учета фонового признака, обеспечить достоверность его изменения и возможность проведения учета в полевых условиях. 3 з.п. ф-лы, 2 табл., 2 пр.

Способ отбора материнских растений Picea pungens Engelm., продуцирующих семенное потомство с разным уровнем стабильности генетического материала и лучшими морфометрическими показателями

Изобретение относится к области биотехнологии. Изобретение представляет собой способ отбора материнских растений Picea pungens Engelm., продуцирующих семенное потомство с разным уровнем стабильности генетического материала, включает сбор и проращивание семян фенотипически здоровых материнских растений Picea pungens Engelm., приготовление из корешка каждого проростка длиной 0,5-1 см постоянно-давленного микропрепарата, анализ не менее 19 (нечетное количество) микропрепаратов и не менее 300 клеток каждого микропрепарата по следующим цитогенетическим показателям каждого микропрепарата: «митотический индекс с учетом стадии профазы», «митотический индекс без учета стадии профазы», «% клеток в профазе», «% клеток в метафазе», «% клеток в анафазе», «% клеток в телофазе», «уровень патологий митоза»; сравнение полученных значений цитогенетических показателей со значениями для мутабильной или слабомутабильной групп; если более 3 показателей оказались в слабомутабильной группе, то и проросток относят ...

СПОСОБ СОЗДАНИЯ ЛИНИЙ МЯГКОЙ ПШЕНИЦЫ, УСТОЙЧИВЫХ К БУРОЙ РЖАВЧИНЕ

Изобретение относится к области биохимии. Представлен способ создания линий мягкой пшеницы, устойчивых к бурой ржавчине, включающий скрещивание коммерческого сорта мягкой пшеницы с гибридной линией 21-4, содержащей новый ген LrN21, самоопыление гибридов первого поколения Fдля получения гибридов второго поколения F, среди которых с помощью молекулярного ПЦР-маркера 34vrn5b и цитологических ДНК-маркеров р8 с119.2 и Spelt1 отбирают растения, содержащие ген устойчивости LrN21, повторное самоопыление отобранных растений для получения растений поколения Fи тестирование последних в полевых условиях на устойчивость к бурой ржавчине. Изобретение позволяет вести отбор растений, содержащих ген устойчивости LrN21 без проведения полевых тестов и сокращает время создания устойчивых линий мягкой пшеницы. 2 ил., 3 табл., 1 пр.

Способ отбора селекционных образцов озимой тритикале

Изобретение относится к области биотехнологии. Изобретение представляет собой способ отбора селекционных образцов озимой тритикале, включающий определение отрастаемости растений, включающий скашивание исследуемых образцов в фазу стеблевания на высоте 5-7 см и определение их зерновой продуктивности после отрастания. Селекционные образцы с большей отрастаемостью (регенерационной способностью) выделяют по отношению зерновой продуктивности отросших растений к продуктивности контрольных, без скашивания, выраженному в процентах. Способ позволяет повысить достоверность отбора перспективных образцов с высокой отрастаемостью (регенерационной способностью) при снижении трудоемкости. 1 табл., 1 пр.

СПОСОБ СОЗДАНИЯ ЛИНИЙ ЯРОВОЙ МЯГКОЙ ПШЕНИЦЫ С УДЛИНЕННЫМ СРОКОМ КОЛОШЕНИЯ И С КОМПЛЕКСНОЙ УСТОЙЧИВОСТЬЮ К ГРИБНЫМ БОЛЕЗНЯМ

Изобретение относится к сельскому хозяйству и биотехнологии. Гибридную линию яровой мягкой пшеницы, содержащую фрагмент хромосомы с двумя генами от Aegilops speltoides: ген, определяющий удлинение срока колошения (VRN-Asp1), и ген устойчивости к бурой ржавчине (LrAsp5), скрещивают с линией, содержащей ген устойчивости к мучнистой росе (Pm) из генома ржи Secale cereale, и растения поколения Fсамоопыляют до поколения F. Из поколения Fс помощью молекулярного ПЦР-маркера Pr1/Pr5 отбирают растения, содержащие гены VRN-Asp1 и LrAsp5 в гомозиготном состоянии. Отобранные с помощью ПЦР-маркера Pr1/Pr5 растения Fс генами VRN-Asp1 и LrAsp5 проверяют ПЦР-маркером SCM009 для выявления растений с геном Pm устойчивости к мучнистой росе. Использование заявленного способа позволяет упростить известный способ и создать линии яровой мягкой пщеницы с удлиненным сроком колошения и с комплексной устойчивостью к грибным болезням. 2 ил., 3 табл.

СПОСОБ ОТБОРА МУТАНТНЫХ ФОРМ КУКУРУЗЫ С ПОВЫШЕННЫМ СОДЕРЖАНИЕМ КАРОТИНОИДОВ

Использование: сельское хозяйство, в частности в селекции кукурузы. Сущность изобретения: отбор мутантных форм кукурузы с повышенным содержанием каротиноидов осуществляют путем получения экстракта обработкой размолотого зерна водонасыщенным н-бутанолом, определением оптической плотности экстракта при 320 и 450 нм, последующего расчета отношения плотностей, при этом к мутантным формам с повышенным содержанием каротиноидов относят формы, имеющие минимальное значение отношения плотностей. 4 табл.

Способ отбора линий яровой мягкой пшеницы с повышенным содержанием антоцианов в зерне

Изобретение относится к области биотехнологии. Перспективный коммерческий сорт яровой мягкой пшеницы, адаптированный к условиям выращивания в конкретном регионе, скрещивают с донором доминантных аллелей генов Рр3 и Pp-D1, контролирующих биосинтез антоцианов фиолетового цвета в перикарпе зерна пшеницы. Растения поколения F1 самоопыляют до поколения F2, отбор растений поколения F2 с гомозиготным состоянием аллелей генов Рр3 и Pp-D1 производят в три этапа: на первом этапе - по темно-красной окраске колеоптиле, на втором и третьем этапе - с помощью ПЦР-маркеров, сцепленных с генами Рр3 и Pp-D1, соответственно, затем отобранные растения F2 с генотипом Pp-D1Pp-D1Pp3Pp3 подвергают однократному возвратному скрещиванию с рекуррентным сортом в ту же вегетацию, когда был сделан их отбор, далее растения на стадии BC1F2-3 отбирают на основе визуальной оценки окраски колеоптиле и зерна, а растения поколения BC1F3 и последующих поколений тестируют в полевых условиях. Изобретение позволяет повысить точность ...

Способ определения жизнеспособности пыльцы in vitro у видов и сортов CLARKIA PURSH

Изобретение относится к области биотехнологии. Изобретение представляет собой способ определения жизнеспособности пыльцы in vitro у видов и сортов Clarkia Pursh, при котором собранную пыльцу каждого вида или сорта культивируют в два этапа, при этом на первом этапе ее сеют на предметное стекло в каплю жидкой среды, содержащей осмотически активное вещество – полиэтиленгликоль с молекулярной массой 6000 – в концентрации 30% и микроэлементы в следующих концентрациях – борная кислота H3BO3 – 10 мг / 100 мл, нитрат кальция CaNO3 – 30 мг /100 мл, сульфат магния MgSO4 – 20 мг / 100 мл, нитрат калия KNO3 – 10 мг / 100 мл, выдерживают 4 часа при постоянной температуре 25°С, а на втором этапе пыльцу выдерживают в данной среде 24 часа, после каждого этапа осуществляют контроль энергетической активности и жизнеспособности пыльцевых зерен под микроскопом и скорости роста пыльцевых трубок, отражающих активность и физиологические качества пыльцы. Изобретение позволяет определить жизнеспособность пыльцы ...

СПОСОБ ОТБОРА РАСТЕНИЙ КОНОПЛИ

Использование: в сельском хозяйстве при селекции растений конопли. Сущность: при селекции растений конопли необходимо сначала отобрать перспективный селекционный материал. Таким материалом являются только те формы, которые состоят преимущественно из растений идеальной однодомной матерки или однодомной матерки с преобладанием доли мужских цветков над женскими. Остальные формы отбраковывают на ранней стадии. С отобранного перспективного материала собирают околоцветники, причем только с женских цветков. Сбор околоцветников проводят только со средней части соцветий, причем только с тех соцветий, которые расположены у оснований ветвей первого порядка, выходящих из пазух листьев. Околоцветники собирают вместе со сформировавшимися в них семенами в фазе созревания 75 % семян.

СПОСОБ СОЗДАНИЯ ЭЛИТНЫХ СЕМЯН ЛЬНА-ДОЛГУНЦА

Способ создания элитных семян льна-долгунца, включающий закладку питомника отбора, отбор исходных (маточных) растений и их оценку по числу коробочек, высоте растений и содержанию волокна в технической части стебля, отличающийся тем, что дополнительно определяют среднюю величину массы семени и выбраковывают те растения, масса семени у которых отклоняется от среднеарифметической на ±10% и более.

СПОСОБ ОТБОРА РАСТЕНИЙ ГРЕЧИХИ НА УСТОЙЧИВОСТЬ К ПОЛЕГАНИЮ

Способ отбора растений гречихи на устойчивость к полеганию, включающий высев на изолированном участке, отбор образцов и их анализ, отличающийся тем, что отбор образцов проводят в фазу плодообразования, при этом выделяют растения со светлой окраской корневой системы, с высоким показателем корнеобеспеченности и высоким содержанием рутина в корнях.

СПОСОБ ОЦЕНКИ ГЕНОТИПОВ ПШЕНИЦЫ НА СТАБИЛЬНОСТЬ ПО СОДЕРЖАНИЮ АНТИОКСИДАНТОВ В ЗЕРНЕ

Способ идентификации сортов малины на основе RAPD-маркеров

... 1. Способ идентификации сортов малины на основе RAPD-маркеров, включающий отбор растительного материала, выделение ДНК из растительного материала, амплификацию ДНК в реакционной смеси с последовательным участием нескольких рандомных праймеров, разделение продуктов амплификации с помощью электрофореза, визуализацию продуктов амплификации под ультрафиолетовым светом и выявление среди продуктов амплификации присущих только для данного сорта профилей, отличающийся тем, что амплификацию ДНК проводят с последовательным участием следующих рандомных праймеров:Oligo 4 - 5'-CAAACGGCAC-3';Oligo 6 - 5'-CACGGCGAGT-3';Oligo 29 - 5'-AAGAGCCCGT-3';Oligo 94 - 5'-GGACGGGTGC-3';Oligo 98 - 5'-GGGTAACGCC-3';Oligo 105 - 5'-AATCGGGCTG-3'.2. Способ по п. 1, отличающийся тем, что для каждого рандомного праймера обеспечивают индивидуальную температуру отжига (°С):Oligo 4 - 34,5;Oligo 6 - 38,3;Oligo 29 - 35,1;Oligo 94 - 41,5;Oligo 98 - 36,7;Oligo 105 - 37,3.3. Способ по п. 1, отличающийся тем, что выделение ДНК осуществляют ...

СПОСОБ СЕЛЕКЦИИ РАСТЕНИЙ КОНОПЛИ

Использование: в сельском хозяйстве. Сущность изобретения: для получения улучшенных форм и сортов растений конопли часть селекционного материала, отобранного в условиях искусственного климата, дополнительно выращивают в условиях искусственного климата, способствующего интенсификации синтеза каннабиноидов в растениях. Отбирают тот материал, который в этих условиях дает потомство со стабильным количеством железистых волосков на прицветниках, причем это количество не превышает 8 штук на 1 мм2 площади прицветников. Такими условиями, стимулирующими синтез каннабиноидов, могут быть следующие: минеральные удобрения вносят в дозе N190-210 P90-110 K230-250, влажность почвы поддерживают на уровне 55-65 % от полной ее влагоемкости, температуру воздуха - на уровне 38-42oС при фотопериоде продолжительностью 11,5-12,5 ч. Выращивание растений в условиях искусственного климата целесообразно осуществлять в осенне-зимний период.

СПОСОБ ОТБОРА ВЫСОКОБЕЛКОВЫХ ФОРМ СЕМЯН

Способ отбора высокобелковых форм семян, отличающимся тем, что 300-граммовые навески семян заливают 500 мл теплой 45-48°С воды, выдерживают в течение суток в термостате при температуре 45°С с последующим определением остаточного объема воды, по которому делают сравнительную оценку белковости селекционных образцов или сортов зерновых бобовых культур.

СПОСОБ ВЫРАЩИВАНИЯ РАСТЕНИЙ ИЗ ТРУДНОПРОРАСТАЮЩИХ СЕМЯН И ОТБОРА УСТОЙЧИВЫХ ГЕНОТИПОВ НА УРОВНЕ ЗАРОДЫШЕЙ

Изобретение относится к сельскому хозяйству, а более конкретно к культивированию in vitro выделенных из семян зародышей и может быть использовано для размножения видов растений с плохо прорастающими семенами, а также в селекции для выращивания сеянцев из семян с недоразвитыми зародышами и эндоспермом, для отбора устойчивых генотипов на уровне зародышей. С целью сокращения трудовых затрат на выделение зародышей, увеличения их приживаемости зародыши культивируют in vitro вместе с оболочкой семени (носики семян), поперечно разрезая семена. У мелких семян раздавливают оболочку без повреждения или с частичным повреждением зародыша. При недоразвитом эндосперме питательная среда выполняет функции эндосперма. Недоразвитые зародыши с частью оболочки семени последовательно пересаживают для развития следующей стадии зародышей и получения из них растений на среды с разными концентрациями регуляторов роста.

СПОСОБ ВЫРАЩИВАНИЯ КОНОПЛИ

Использование: в области сельского хозяйства, в растениеводстве. Сущность изобретения: при выращивании конопли в почву помимо удобрений вносят карбид кальция в дозе 90 - 150 кг/га в период от фазы всходов до фазы бутонизации.

СПОСОБ ОТБОРА ФОРМ ИСКУССТВЕННО СОЗДАННЫХ ПОЛИПЛОИДОВ

... 1. Способ отбора форм искусственно созданных полиплоидов, включающий проращивание семян, определение показателей их силы роста и отбор форм с наилучшими показателями, отличающийся тем, что проращивание семян проводят на растворе осматика, выделяют семена с признаками прорастания и у них определяют силу роста. 2. Способ по п. 1, отличающийся тем, что проращивание проводят на растворе сахарозы с концентрацией 18-20 мас. %.

СПОСОБ ВЫРАЩИВАНИЯ РАСТЕНИЙ

... 1. Способ выращивания растений, включающий внесение удобрений, отличающийся тем, что предварительно определяют оптимальное для выращиваемого вида растений содержание этилена в почвенном воздухе, а при выращивании растений поддерживают это содержание на оптимальном уровне путем отбора и анализа проб почвенного воздуха и дополнительного дробного или одноразового внесения в почву средства обогащения почвенного воздуха этиленом. 2. Применение карбида кальция в качестве средства обогащения почвенного воздуха этиленом.

СПОСОБ ПОЛУЧЕНИЯ ГИБРИДНЫХ СЕМЯН КОНОПЛИ

... 1. Способ получения гибридных семян конопли, включающий выращивание растений на участках гибридизации и на семенных участках, получение семян нулевого поколения и репродукцию гибридов первого поколения, отличающийся тем, что на участках гибридизации в начальной стадии бутонизации удаляют все генеты с полностью андроцейными цветками в метелках и оставляют генеты с полностью гинецейными, субандроцейными, моноцейными и субгинецейными цветками, а на семенных участках удаляют генеты с полностью андроцейными цветками и оставляют только генеты с субандроцейными, моноцейными и субгинецейными цветками. 2. Способ по п.1, отличающийся тем, что в фазе трех пар листьев осуществляют декапитацию всех выращиваемых растений.

Способ оценки генотипов овса на содержание бета-глюканов в зерне

Способ стерилизации семян петунии гибридной in vitro

Способ получения линий яровой мягкой пшеницы с укороченным сроком колошения

Изобретение относится к области биотехнологии. Изобретение представляет собой способ отбора растений яровой мягкой пшеницы с укороченным сроком колошения, включающий скрещивание родительских образцов мягкой пшеницы, самоопыление гибридов первого поколения Fдля получения гибридов второго поколения F, среди которых с помощью молекулярных ПЦР-маркеров отбирают растения с генами, определяющими сроки колошения, повторное самоопыление отобранных растений для получения поколения Fи тестирование последних в полевых условиях на оценку сроков колошения, где сорт яровой мягкой пшеницы «Тулун 15», содержащий аллель нечувствительности к фотопериоду Ppd-D1a, а также аллели Vrn-A1a, Vrn-B1c и Vrn-В3а, определяющие ранние сроки колошения, скрещивают с коммерческим сортом мягкой пшеницы «Обская 2», отбирают из поколения Fс помощью молекулярных ПЦР-маркеров 1а и 1б растения, содержащие в гомозиготном состоянии аллель Ppd-D1a, анализируют растения F, отобранные с помощью молекулярных маркеров 1а и 1б, с помощью ...

СПОСОБ ОЗДОРОВЛЕНИЯ ОТ ВИРУСОВ РАСТЕНИЙ МАЛИНЫ, ВЫРАЩИВАЕМЫХ in vitro

Изобретение относится к области сельского хозяйства и селекции, в частности к оздоровлению от вирусов растений малины, выращиваемых in vitro. Способ включает заготовку эксплантов вегетативных частей растений, высадку их на питательную среду и шестикратную обработку периодической последовательностью разнонаправленных импульсов магнитной индукции. При этом обработку эксплантов проводят через каждые 48 часов импульсами со временем нарастания 0,25 мс и экспоненциальным спадом в течение 3 мс в направлении, перпендикулярном оси эксплантов, при непрерывном линейном нарастании частоты импульсов в диапазоне от 3,2 до 51,2 Гц и квазилинейном изменении амплитудных значений импульсов от 15 до 5 мТл. Далее обработку проводят импульсами с непрерывным линейным спадом частоты в диапазоне от 51,2 до 3,2 Гц и изменении амплитудных значений импульсов от 15 до 5 мТл в течение 8 минут для каждого частотного диапазона соответственно. Способ позволяет повысить эффективность оздоровления от вирусов растений малины ...

СПОСОБ ОЦЕНКИ ПОТЕНЦИАЛА ПРОДУКТИВНОСТИ ГЕНОТИПОВПШЕНИЦЫ ПО БИОТИПИЧЕСКОМУ СОСТАВУ И ОТКЛИКУ БИОТИПОВ СОРТА НА УРОВНИ КАЛИЙНОГО ПИТАНИЯ

Изобретение относится к селекции растений. Из состава сорта пшеницы выделяют биотипы по величине удельной ацидофицирующей активности корневой системы. Каждый выделенный биотип тестируют на высокие уровни калийного и сочетания калийного и азотного питания. По массовости биотипа в составе сорта диагностируются уровень продуктивности и пластичности данного сорта, что дает возможность использовать соответствующий биотип в селекции. 3 ил.

СПОСОБ ПОВЫШЕНИЯ КОЭФФИЦИЕНТА РАЗМНОЖЕНИЯ КАПУСТЫ БЕЛОКОЧАННОЙ В УСЛОВИЯХ IN VITRO

Изобретение относится к области сельского хозяйства, в частности к селекции. Изобретение представляет собой способ повышения коэффициента размножения капусты белокочанной в условиях in vitro, включающий выращивание эксплантов, культирование их на питательной среде Мурасиге-Скуга, внесение в нее регуляторов роста тидиазурон в концентрации 1 мг/л в сочетании с индолил-3-уксусной кислотой - 0,5 мг/л, при использовании цветолож размером 0,2-0,3 мм, изолированных из бутонов длиной 0,5-0,7 мм, где цветоложе используют за 1-2 дня до распускания цветков и после выращивания их на питательных средах культивируют до образования почек в течение 14-21 суток. Способ позволяет получить большое количество растений-регенерантов с признаками ЦМС и получить генетически стабильный урожай селекционных образцов. 3 табл.

СПОСОБ ОПРЕДЕЛЕНИЯ ПРОДУКТИВНОСТИ ФОТОСИНТЕТИЧЕСКОГО ПОТЕНЦИАЛА СОРТОВ СОИ

Изобретение относится к области сельского хозяйства, в частности к физиологии сельскохозяйственных растений и селекции. Способ включает отбор проб, определение площади листьев, биометрических показателей путем определения количества и массы отдельных органов растений по фазам роста и развития, учет накопления вегетативной массы всего растения и семян за период развития, фотосинтетического потенциала. Показатель продуктивности фотосинтетического потенциала рассчитывают по выражению, где БП - биологическая урожайность семян с 1 га; ФП - фотосинтетический потенциал, сформированный за весь период вегетации на 1 га посева. Способ позволяет определять величину накопления органического вещества в вегетативных и репродуктивных органах на единицу фотосинтетического потенциала. 1 ил., 1 табл., 1 пр.

СПОСОБ СЕЛЕКЦИИ ПЕРЕКРЕСТНООПЫЛЯЮЩИХСЯ РАСТЕНИЙ С ОГРАНИЧЕННЫМИ СПОСОБНОСТЯМИ К САМООПЫЛЕНИЮ

Способ селекции перекрестноопыляющихся растений с ограниченными способностями к самоопылению, включающий выращивание растений, отбор и изоляцию до цветения выделившихся по фенотипу растений, отличающийся тем, что опыление изолированных растений производят смесью пыльцы, собранной со всех отобранных растений, полученные семена смешивают, высевают для размножения полученной новой популяции и при необходимости используют для начала нового цикла отборов в следующей генерации.

Способ сокращения срока подготовки селекционного (элитного) образца сельскохозяйственного биологического объекта к проведению Государственных испытаний, а также улучшения семеноводства

... 1. Способ сокращения срока подготовки селекционного образца биологического объекта и его элитных семян к проведению Государственных испытаний включает в себя по окончании селекционной работы отбор наилучшего селекционного образца и немедленной закладки его или семян от него на осенне-зимнее хранение до сева с тем, чтобы селекционный образец тщательно сохранить в 1-й осенне-зимний период в лучшем хранилище, весной посеять сохраненные семена на подготовленной в соответствии с Методикой РАСХН мерной почве-площадочке в соответствии с нормой высева, а осенью полученный урожай элитных семян с этой площадочки пересчитать на урожай, условно полученный с 1 га и принять его за 100%; полученный урожай элитных семян вновь немедленно заложить в хранилище и осуществить хранение их до очередного весеннего сева; весной вновь посеять сохраненные семена также в подготовленную по Методике РАСХН почву, обеспечить требуемый уход за урожаем, осенью собрать урожай без потерь, обмолотить и если требуется из-за ...

РАСТЕНИЯ Brassica oleracea С УСТОЙЧИВОСТЬЮ К Mycosphaerella brassicicola

... 1. Растение Brassica oleracea, содержащее ген устойчивости к Mycosphaerella brassicicola, в котором указанный ген устойчивости обеспечивает моногенную и доминантную устойчивость к М. brassicicola, и в котором ген устойчивости получен из растения В. oleracea, семена которого были депонированы в Американской коллекции типовых культур (АТСС Запатентованный Депозит, 10801 University boulevard, Manassas, VA 20110, United States of America) 1 марта 2006 под номером РТА-7413. ! 2. Растение по п.1, в котором ген устойчивости связан, по меньшей мере, с одним специфичным ДНК-маркером. ! 3. Растение по п.2, в котором ген устойчивости к М. brassicicola связан, по меньшей мере, с двумя ДНК-маркерами, где ДНК-маркеры окружают ген устойчивости. ! 4. Растение по п.3, в котором ген устойчивости к М. brassicicola связан, по меньшей мере, с тремя ДНК-маркерами, где ДНК-маркеры окружают ген устойчивости. ! 5. Растение по п.4, в котором ген устойчивости к М. brassicicola связан, по меньшей мере, с четырьмя ...

СПОСОБ ОЦЕНКИ И УЛУЧШЕНИЯ СОСТОЯНИЯ СРЕДЫ ОБИТАНИЯ РАСТЕНИЙ (ВАРИАНТЫ)

Изобретение относится к сельскому и лесному хозяйству, а именно к способам оценки и улучшения состояния среды обитания растений, например почвы, воздуха, освещенности, и может быть использовано при выращивании растений в условиях открытого и закрытого грунта и на гидропонике. Способ оценки и улучшения состояния среды обитания растений (первый вариант) заключается в том, что проводят испытание, например сортоиспытание, конкретных растений (их вида, сорта, генотипа), при этом определяют минимальные, оптимальные и максимальные параметры факторов среды их обитания. Оптимальным параметрам присваивают высший балл, минимальным и максимальным параметрам - нулевой балл. Эти параметры вводят в оценочную шкалу, для которой при этом по оценочной основе, рассчитываемой по формуле где х - параметр конкретного фактора среды обитания растений; а - оптимальный параметр этого фактора среды обитания растений; в - минимальный или максимальный параметр того же фактора среды обитания растений; у - балл состояния ...

ТЕХНОЛОГИЯ СЕЛЕКЦИИ ПШЕНИЦЫ НА ПОТЕНЦИАЛЬНУЮ УРОЖАЙНОСТЬ И АГРОЭКОЛОГИЧЕСКУЮ ПЛАСТИЧНОСТЬ

Изобретение относится к сельскому хозяйству, в частности к селекции пшеницы, и предназначено для создания потенциально урожайного, экологически пластичного селекционного материала. Указанная цель достигается тем, что популяцию ежегодно пересевают в разных агроэкологических условиях, одновременно проводя массовый, а в F5 - индивидуальный отборы колосьев, у которых 2 - 3 зерна в верхнем колоске (яровые), отсутствие редукции нижних колосков (озимые). Отобранные в F5 колосья до посева их потомств в селекционном питомнике бракуются по размеру устьиц на пластинке первого листа всходов.

СПОСОБ СОЗДАНИЯ САМОФЕРТИЛЬНЫХ АЛЛОПЛАЗМАТИЧЕСКИХ ЗАМЕЩЕННЫХ ЛИНИЙ ПШЕНИЦЫ

Способ используют в селекции и генетики сельскохозяйственных растений. Техническая задача: повышение эффективности способа. Сущность изобретения: культурный ячмень сорта Неполегающий скрещивают с мягкой пшеницей сорта Саратовская 29, молодые гибридные зародыши культивируют на питательной среде с добавлением 0,25-0,5 мг/л кинетина и 0,5-1,0 мг/л ауксина. Далее получают растения-регенеранты и опыляют их сортами пшеницы Мироновская 10 и Ульяновка, проводят отбор самофертильных растений и осуществляют беккроссирование с использованием сортов мягкой пшеницы Мироновская 10, Ульяновка, Саратовская 29 и Пиротрикс 28. При этом первое беккроссное поколение преимущественно получают путем скрещивания гибридов (Неполегающий х Саратовская 29) сортами пшеницы Мироновская 10 или Ульяновка, а второе беккроссное поколение получают на основе гибридной комбинации (Неполегающий x Саратовская 29) х Мироновская 10 путем повторного опыления сортом пшеницы Мироновская 10, а на основе гибридной комбинации (Неполегающий ...

QTL УРОЖАЯ В РАСТЕНИЯХ ОГУРЦА

ДВОЙНЫЕ ГАПЛОИДЫ

Данное изобретение включает в себя применение в скриннинге растений или семян гаплоидов и двойных гаплоидов по меньшей мере одного доминантного гена, выбранного из группы, включающей в себя условно летальные гены, скриннируемые маркерные гены и селектируемые маркерные гены. Гаплоиды индуцируются генами индукции гаплоидов, например "неопределенного гаметофита". Предметом изобретения являются также гаплоидные растения, несущие по меньшей мере один доминантный ген, способ их получения, а также растения, которые получают посредством применения указанного способа.

СПОСОБ СЕЛЕКЦИИ БАКТЕРИЦИДНОГО КУЛЬТУРНОГО ХЛОПЧАТНИКА С ЕСТЕСТВЕННО ОКРАШЕННЫМ КРАСНО-БУРЫМ ВОЛОКНОМ

Изобретение относится к области хлопководства, а более конкретно - к способам получения новых сортов хлопчатника, обладающих волокном, окрашенным биологическими пигментами цвета и совмещающим бактерицидные свойства. Точки роста выделенных гаплоидных форм сорта хлопчатника 3169-И обрабатывают 0,1 % водным раствором колхицина, затем семена полученных диплоидных форм облучают гамма-квантамиСо в течение 25 с при мощности заряда в рабочей камере 350 p/с, после чего проводят посев обработанных семян семей и во втором поколении отбирают элитные растения. Достигаемый технический результат заключается в получении хлопчатника с естественно окрашенным красно-бурым волокном, совмещающим свойства бактерицидности, а также обладающим высокой урожайностью и соответствием требованиям текстильной промышленности.

СПОСОБ ОТБОРА МОРОЗОСТОЙКИХ ФОРМ КЛЕВЕРА ЛУГОВОГО

Изобретение относится к сельскому хозяйству, в частности к селекции клевера лугового. С целью упрощения селекционного процесса и снижения затрат отбор морозостойких форм проводят по фиолетовой окраске семян. После промораживания проростков до -14-16 и -16-18С процент выживших растений клевера лугового из семян с фиолетовой окраской соответственно на 7,8 и 9,3% выше, чем растений из семян с желтой окаской у сорта Ранний 2 и соответственно на 4,2 и 2,3% у сорта ВИК-7.

СПОСОБ ОПРЕДЕЛЕНИЯ ВОЗРАСТА РАСТЕНИЙ МНОГОЛЕТНИХ ЗЛАКОВЫХ ТРАВ В ФИТОЦЕНОЗАХ

Способ определения возраста растений многолетних злаковых трав в фитоценозах, включающий учет фенологических фаз и прирост вегетативной массы, отличающийся тем, что возраст растений определяют спустя 25 - 35 дней после первого укоса в фазе колошения по укороченным недоразвитым побегам, классифицируя их как многолетние, а с цветущими генеративными органами как однолетние.

СПОСОБ ПОЛУЧЕНИЯ НАСЛЕДСТВЕННО ИЗМЕНЕННЫХ ФОРМ ПШЕНИЦЫ

Изобретение относятся к сельскохозяйственной биотехнологии и может быть использовано в генетике и селекции растений. Цель изобретения - увеличение частоты возникновения и спектра наследственных изменений пшеницы. Способ включает культивирование эксплантантов исходных растений на каллусогенной среде в первом пассаже в присутствии фитогормонов ауксинового ряда, получение эмбриогенного каллуса, культивирование его во втором и последующих пассажах на каллусогенной среде, пересадку на среду для регенерации растений, получение регенерантов, доращивание регенерантов до семенного потомства, отбор среди него сомаклональных измененных форм, при этом в каллусогенной среде второго и последующих пассажей используют снижение величины химического потенциала воды до таких величин, при которых последующее культивирование каллусов вызывает появление первых признаков некроза в виде начальной стадии высыхания и побурения при сохранении избирательной способности каллусов регенерировать растения. Способ по сравнению ...

СПОСОБ ПОЛУЧЕНИЯ ТРАНСГРЕССИВНЫХ ФОРМ У ЛЬНА

Изобретение относится к генетике и селекции растений и может применяться в сельском хозяйстве при создании новых сортов льна. Предлагаемый способ получения трансгрессивных форм у льна заключается в том, что гибриды Fвыращиваются в условиях почвенной засухи (40% от ПВ), начиная с фазы "елочка" до появления первого цветка.

СПОСОБ ОПРЕДЕЛЕНИЯ УРОЖАЙНЫХ СВОЙСТВ СЕМЯН

Способ определения урожайных свойств семян разных партий одного сорта пшеницы, включающий получение всходов, отличающийся тем, что замеряют длину устьичного аппарата в средней части, верхней стороны пластинки первого листа всходов и чем устьица крупнее, тем выше урожайные свойства.

Способ ранней диагностики засухоустойчивости деревьев сосны обыкновенной на основе показателя жизнеспособности каллусных культур in vitro

Corn Variety DE811ASR(BC5)

This invention relates to polynucleotide sequences encoding a gene that can confer resistance to the plant pathogen Colletotrichum , which causes anthracnose stalk rot, leaf blight and top dieback in corn and other cereals. It further relates to plants and seeds of plants carrying chimeric genes comprising said polynucleotide sequences, which enhance or confer resistance to the plant pathogen Colletotrichum , and processes of making said plants and seeds. The invention further presents sequences that can be used as molecular markers that in turn can be used to identify the region of interest in corn lines resulting from new crosses and to quickly and efficiently introgress the gene from corn lines carrying said gene into other corn lines that do not carry said gene, in order to make them resistant to Colletotrichum and resistant to stalk rot.

Compositions and methods for enhancing resistance to northern leaf blight in maize

The invention relates to methods and compositions for identifying and selecting maize plants with enhanced resistance to northern leaf blight. Maize plants generated by the methods of the invention are also a feature of the invention.

Plant polymorphic markers and uses thereof

The present invention is in the field of plant genetics. More specifically, the invention relates to nucleic acid markers associated with ecotypes. The invention also relates to methods for detecting polymorphisms. The invention further relates to methods of using nucleic acid markers, for example, for genome mapping, gene identification, gene isolation and gene analysis. 1. (canceled)2Arabidopsis. A collection of non-identical nucleic acid molecules capable of detecting polymorphisms present in an mapping population , wherein said collection of non-identical nucleic acid molecules is capable of detecting at least 25 polymorphisms selected from the group consisting of Table A.3Arabidopsis. The collection of non-identical nucleic acid molecules capable of detecting polymorphisms present in an mapping population according to claim 2 , wherein said collection of non-identical nucleic acid molecules is deposited on a substrate.4. (canceled) This application is a continuation-in-part of application Ser. No. 09/692,412 filed Oct. 20, 2000, and a continuation in part of application Ser. No. 09/534,859, filed Mar. 29, 2000, and a continuation in part of application Ser. No. 09/803,736, filed Mar. 12, 2001, all of which are herein incorporated by reference in their entirety.This application contains a sequence listing, which is contained on three identical CD-Rs: two copies of a sequence listing (Seq. listing: Copy 1 and Seq. listing: Copy 2) and a sequence listing Computer Readable Form (CRF), all of which are herein incorporated by reference. All three CD-Rs each contain one file called “marker patent.txt” which is 13,814,237 bytes in size (measured in MS-DOS) and was created on Dec. 23, 2003.Table A from U.S. application Ser. No. 12/213,777 filed on Jun. 24, 2008, published as US 2009/0215647 A 1 on Aug. 27, 2009, is herein incorporated by reference in its entirety.The present invention is in the field of plant genetics. More specifically, the invention relates to nucleic ...

Endophytes and related methods

The present invention relates to a method for identifying and/or characterising an endophyte strain, said method including providing a plurality of samples of endophytes, subjecting said endophytes to genetic analysis, subjecting said endophytes to metabolic analysis and selecting endophytes having a desired genetic and metabolic profile. 1. A method for identifying and/or characterising an endophyte strain , said method including:providing a plurality of samples of endophytes;subjecting said endophytes to genetic analysis;subjecting said endophytes to metabolic analysis; andselecting endophytes having a desired genetic and metabolic profile.2. A method according to claim 1 , further including assessing geographic origin of the endophytes and selecting endophytes having a desired genetic and metabolic profile and a desired geographic origin.3. A method according to wherein the plurality of samples of endophytes are provided by a method including:providing a plurality of plant samples; andisolating endophytes from said plant samples.4. A substantially purified or isolated endophyte having a desired toxin profile claim 1 , wherein the endophyte produces significantly less toxic alkaloids compared with a control endophyte; and/or significantly more alkaloids conferring beneficial properties compared with a control endophyte.5. An endophyte according to claim 4 , wherein said beneficial properties include improved tolerance to water and/or nutrient stress and/or improved resistance to pests and/or diseases in the plant with which the endophyte is associated.6. An endophyte according to claim 5 , wherein said alkaloids conferring beneficial properties are selected from the group consisting of peramine claim 5 , N-formylloline claim 5 , N-acetylloline and norloline.7. An endophyte according to claim 4 , wherein said toxic alkaloids include ergovaline.8. An endophyte according to claim 4 , wherein said endophyte is isolated from a fescue species.9. An endophyte according ...

NUCLEIC ACIDS AND METHODS FOR DETECTING TURFGRASS PATHOGENIC FUNGI

The present invention relates to the use of at least one nucleic acid comprising or consisting of: 3Ascochyta phleina, Curvularia affinis, Glomerella graminicola, Thanatephorus cucumeris, Pythium ultimum, Gaeumannomyces graminis, Marasmius oreades, Corticium fuciforme, Phytophthora nicotianae. Fusarium culmorum, Bipolaris sorokiniana, Microdochium nivale, Rhizoctonia cerealis, Pythium graminicola, Rhynchosporium secalis, Sclerotinia homoeocarpa, Typhula incarnate, Ustilago striiformis or Septoria macropoda.. The method according to claim 1 , wherein the fungus is4. The method according to claim 1 , wherein the sample is a soil sample taken from which the turfgrass is grown.5. The method according to claim 1 , wherein the sample is a turfgrass sample.6. The method according to claim 5 , wherein the turfgrass sample is a root sample.7. The method according to claim 1 , wherein the turfgrass is Festaceae claim 1 , Aveneae claim 1 , Triticeae claim 1 , Chlorideae claim 1 , Zoysieae claim 1 , Paniceae or Andropogoneae Tribe.8. The method according to claim 1 , wherein the nucleic acid amplification is Amplification Fragment Length Polymorphism (AFLP) or Terminal Restriction Fragment Length Polymorphism (T-RFLP).9. The method according to claim 1 , wherein the primer is used in association with at least one other primer which targets an 18S rDNA/ITS1 region or an ITS2/28S rDNA region of a fungus.10. The method according to claim 9 , wherein the other primer has a nucleic acid sequence of one of SEQ ID NOs: 39 to 42.12. The method according to claim 1 , wherein the primer has a nucleic acid sequence of one of SEQ ID NO: 1 to 38 claim 1 , or a complementary sequence thereof. The present application is a divisional of U.S. application Ser. No. 12/737,006, filed Dec. 1, 2010, which is a U.S. National Phase of PCT Application No. PCT/EP2009/051689, filed May 20, 2009, which claims the benefit of EP Application No. 08104225.1 and U.S. Provisional Application No. 61/059,862, ...

COTTON VARIETY PHY499WRF

The disclosure relates to a cotton variety, designated PHY499WRF, the plants and seeds of the cotton variety PHY499WRF, methods for producing a cotton plant, either varietal or hybrid, produced by crossing the cotton variety PHY499WRF with itself or with another cotton plant, hybrid cotton seeds and plants produced by crossing the variety PHY499WRF with another cotton variety or plant, methods for producing a cotton plant containing in its genetic material one or more transgenes, and the transgenic cotton plants produced by that method. This disclosure also relates to cotton varieties derived from cotton variety PHY499WRF, to methods for producing other cotton varieties derived from cotton variety PHY499WRF, and to the varieties derived by the use of those methods. 1. A seed of cotton variety designated PHY499WRF , or a part thereof , representative seed of the variety having been deposited under ATCC Accession No. PTA-12225 on Nov. 7 , 2011.2. The seed part of selected from the group consisting of hull (seedcoat) claim 1 , germ and endosperm.3. The seed of claim 1 , further comprising a coating.4. A substantially homogenous composition of the cotton seed of .5. A method for producing a seed of a cotton plant claim 1 , comprising:{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, '(a) planting seed of in proximity to itself or to different seed from a same variety;'}(b) growing plants from the seed under pollinating conditions; and,(c) harvesting resultant seed.6. A cotton seed produced by the method of .7. The method of claim 5 , further comprising pre-treating the seed of before performing step (a).8. The method of claim 5 , further comprising treating the growing plants or soil surrounding the growing plants with an agricultural chemical.9. A cotton plant produced by growing the seed of .10. A part of the cotton plant of claim 9 , selected from the group consisting of an intact plant cell claim 9 , a plant protoplast claim 9 , embryos claim 9 , pollen claim 9 , ...

Identification Method of Species of Diatoms in Coast of Korea, and Polynucleotide Probe, DNA Chip and Kit for Identification of Species of Diatoms According to Same

Disclosed is a method for identifying the species of diatoms found in the coastal area of Korea, a polynucleotide probe, a DNA chip and a kit used for identifying the diatom species. The method includes obtaining a PCR product by performing a PCR reaction using the DNA extracted from diatoms, binding the PCR product respectively to a probe which is the same as or complementary to one or more of the nucleotide sequences selected from SEQ. ID. NOs: 3˜51, and identifying the species of a given diatom based on the result of the above binding. More importantly, the present invention enables to identify a given diatom species by analyzing the genotypes of various diatom species found in the coastal area of Korea based on their SNPs in a convenient, fast and accurate way. 1. A method for identifying the diatom species , comprising:obtaining a PCR product by performing a PCR reaction using DNA extracted from diatoms;binding the PCR product respectively to a probe which is the same as or complementary to one or more of the nucleotide sequences selected from SEQ. ID. NOs. 3˜51; andidentifying the species of a given diatom based on the result of the above binding.2. The method for identifying the diatom species according to claim 1 , wherein the diatom species is limited to those having their habitat in the coastal area of Korea.3Achnanthes longipes, AmphoraAsterionella glacialis, Chaetoceros atlanticus, Chaetoceros didymus, Chaetoceros septentrionalis, Chaetoceros vistulae, Chlorella ellipsoidea, C. schroeteri, ChlorophytaCoscinodiscus perforatus, C. rothii. Cylindrotheca closterium, Cylindrotheca fusiformis, Cymstosira lorenziana, Ditylum brightwellii, Gloeocytis gigas, Gyrodimium impudicum, Heterosigma akashiwo, Melosira numnuloides, NaviculaNitzschia pungens, Nitzschia subpacifica, Prorocentrum minimum, Skeletonema costatum, Stephanopyxis turris, Thalassiosira allenii, Thalassiosira baltica. T. decepiens, T. puntigera, Thalassiosira conferta, Thalassiosira nordenskioldi, T ...

INSECT RESISTANT COTTON PLANTS AND METHODS FOR IDENTIFYING SAME

The invention provides specific transgenic cotton plants, plant material and seeds, characterized in that these products harbor a specific transformation event at a specific location in the cotton genome. Tools are also provided which allow rapid and unequivocal identification of the event in biological samples. 1. A method for identifying elite event EE-GH6 in biological samples , which method comprises amplifying a nucleic acid present in said biological samples with at least two primers , wherein one of said primers recognizes the 5′ or 3′ flanking region of EE-GH6 and the other primer recognizes the foreign DNA of EE-GH6 contiguous therewith , said 5′ flanking region having the nucleotide sequence of SEQ ID No. 1 from nucleotide 1 to nucleotide 140 or the nucleotide sequence of SEQ ID No. 11 from position 1 to position 463 and said foreign DNA contiguous with said 5′ flanking region comprises the complement of SEQ ID No. 1 from nucleotide 141 to nucleotide 192 , said 3′ flanking region having the nucleotide sequence of the complement of SEQ ID No. 2 from nucleotide 113 to nucleotide 438 and said foreign DNA contiguous with said 3′ flanking region comprises the nucleotide sequence of SEQ ID No. 2 from nucleotide 1 to nucleotide 112.2. The method of claim 1 , said method comprising amplifying a DNA fragment of between 100 and 500 bp from a nucleic acid present in said biological samples using a polymerase chain reaction with said at least two primers.3. The method of claim 2 , wherein said primer recognizing the 5′ flanking region consists of a nucleotide sequence of 17 to 200 consecutive nucleotides from the nucleotide sequence of SEQ ID No. 1 from nucleotide 1 to nucleotide 140 or the nucleotide sequence of SEQ ID No. 11 from position 1 to position 463 or said primer recognizing the 3′ flanking region of EE-GH6 consists of a nucleotide sequence of 17 to 200 consecutive nucleotides from the nucleotide sequence of the complement of SEQ ID No. 2 from nucleotide 113 ...

Barley lipoxygenase 1 gene, method of selecting barley variety, material of malt alcoholic drinks and process for producing malt alcoholic drink

A selection method for barley lipoxygenase-1 deficient barley, comprising a step of distinguishing the barley lipoxygenase-1 deficient barley by whether or not the guanine at the splicing donor site of the 5th intron of the barley lipoxygenase-1 gene is mutated to a different base; and a method for production of malt alcoholic beverages using a material for malt alcoholic beverages derived from barley obtained by the selection method.

METHODS AND SYSTEMS USEFUL FOR CONTROLLING INVASIVE WATERMILFOIL

Described are methods and systems for managing watermilfoil populations in bodies of water such as lakes. In certain forms, the methods and systems involve the use of genetic analysis to determine whether a watermifoil population targeted for herbicidal control has a genetic relationship with hybrid (e.g. Northern×Eurasian) watermilfoil plants known to exhibit herbicidal tolerance. In one aspect, it has for the first time been discovered that such hybrid watermilfoil plants include significant clustering groups that exhibit herbicide tolerance. This can be used in the design and implementation of herbicidal treatment regimens against a new target watermilfoil population. 1. A method for controlling watermilfoil in a lake , comprising:obtaining samples of target watermilfoil plants living in a lake;obtaining genetic information from the samples;inferring from said genetic information a genetic relationship of the target watermilfoil plants to other watermilfoil plants, wherein at least some of the other watermilfoil plants have confirmed tolerance to at least one chemical herbicidal agent; andtreating the body of water with a selected chemical herbicidal agent in accordance with a treatment regimen based at least in part upon said inferring step.2. The method of claim 1 , wherein said genetic information comprises comparing molecular marker information.3. The method of claim 1 , wherein said obtaining genetic information includes obtaining amplified fragment length polymorphism (AFLP) data from the samples claim 1 , and said inferring comprises comparing said AFLP data to AFLP data from the other watermilfoil plants.4. The method of wherein the selected chemical herbicidal agent is auxin-mimic herbicide.5. The method of claim 1 , wherein said at least one chemical herbicidal agent is 2 claim 1 ,4-D and/or triclopyr.6. The method of wherein the selected chemical herbicidal agent is a phytoene desaturase inhibitor.7. The method of wherein said selected chemical ...

PROBE, PROBE SET, PROBE CARRIER, AND TESTING METHOD

A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 4 and mutated sequences thereof. 17-. (canceled)8Candida glabrata. A probe set for detecting a DNA of which is a pathogenic fungus , comprising four probes consisting of the following base sequences (A) to (D) respectively:(A) ggtgttttatcacacgactcgacact (SEQ ID NO. 1) or the complementary sequence thereof;(B) ggagttctcccagtggatgcaaac (SEQ ID NO. 2) or the complementary sequence thereof;(C) ggccatatcagtatgtgggacacg (SEQ ID NO. 3) or the complementary sequence thereof; and(D) aggttttaccaactcggtgttgatctag (SEQ ID NO. 4) or the complementary sequence thereof.9Candida glabrata.. The probe set according to claim 8 , wherein the probe set does not comprise any other probe to detect10. A probe carrier comprising the probe set according to claim 8 , wherein:the four probes are each immobilized on a carrier; andthe four probes are arranged at intervals.11Candida glabrata. A kit for detecting a DNA of claim 8 , comprising:{'claim-ref': {'@idref': 'CLM-00008', 'claim 8'}, 'the probe set according to ; and'}a reagent for detecting a reaction of a probe with a target nucleic acid.12Candida glabrata. A kit for detecting a DNA of claim 8 , comprising:{'claim-ref': {'@idref': 'CLM-00009', 'claim 9'}, 'the probe set according to ; and'}a reagent for detecting a reaction of a probe with a target nucleic acid.13Candida glabrata. A kit for detecting a DNA of claim 8 , comprising:{'claim-ref': {'@idref': 'CLM-00010', 'claim 10'}, 'the probe carrier according to ; and'}a reagent for detecting a reaction of a probe with a target nucleic ...

Methods to Identify Soybean Aphid Resistant Quantitative Trait Loci in Soybean and Compositions Thereof

The present invention is in the field of plant breeding and aphid resistance. More specifically, the invention includes a method for breeding soybean plants containing quantitative trait loci that are associated with resistance to aphids, . The invention further includes method for monitoring the introgression quantitative trait loci (QTL) conferring aphid resistance into elite germplasm in a breeding program. 1. A method of introgressing an allele into a soybean plant comprising:A) Providing a population of soybean plants,B) Genotyping at least one soybean plant in the population with respect to a soybean genomic nucleic acid marker selected from the group comprising SEQ ID NO: 85 through SEQ ID NO: 120,C) Selecting from the population at least one soybean plant comprising at least one allele associated with aphid resistance.2. The method according to claim 1 , wherein said selected soybean plants exhibit at least partial resistance to aphids.3. The method according to claim 1 , wherein said selected soybean plants exhibit at least substantial resistance to aphids.4. The method of claim 1 , wherein the genotype is determined by an assay which is selected from the group consisting of single base extension (SBE) claim 1 , allele-specific primer extension sequencing (ASPE) claim 1 , DNA sequencing claim 1 , RNA sequencing claim 1 , micro-array based analyses claim 1 , universal PCR claim 1 , allele specific extension claim 1 , hybridization claim 1 , mass spectrometry claim 1 , ligation claim 1 , extension-ligation claim 1 , and Flap-Endonuclease-mediated assays.5. The method of wherein the soybean genomic nucleic acid marker selected from the group consisting of SEQ ID NO: 85 and SEQ ID NO: 86.6. An elite soybean plant obtained by the process of .7. A method of introgressing an allele into a soybean plant comprising:C) crossing at least one aphid resistant soybean plant with at least one aphid sensitive soybean plant in order to form a segregating population,B) ...

Methods and Compositions for Goss' Wilt Resistance in Corn

The present invention relates to the field of plant breeding. More specifically, the present invention includes a method of using haploid plants for genetic mapping of traits of interest such as disease resistance. Further, the invention includes a method for breeding corn plants containing quantitative trait loci (QTL) that are associated with resistance to Goss' Wilt, a bacterial disease associated with spp. 1. A method of identifying a corn plant comprising at least one allele associated with Goss' Wilt resistance in a corn plant comprising:a) genotyping at least one corn plant with at least one nucleic acid marker selected from the group consisting of SEQ ID NOs: 13, 19, 24, 27, 36, 50, 53, 90, 94, 95, 97, 99, 101, 102, 106, 110, 111, 119, 121, 122, 124, 128, 130-132, 136, 138, 141, 146, 153, 158-160, 162, 164, 166, 169, 172, 175, 177, 186, 200, 202, 203, 207, 208, 215, 216, 218, 220, 224, 228, 231-236, 244, 248, 250, 252, 256, 257, 260, 265-267, 271-274, 278, 279, 282, 287, 289, 294-296, 299, 317, 320, 332-334, 337, 347, 355, 362, 363, 366-368, 370, 371, 375, 381, 382, 392, 395, 401, 408, 409, 411, 412, 422, 423, 429, 430, 433, 438, 440, 447, 474, 476, 479, 480, 482, 486, 490, 493, 498, 500, 525, 530, 533, 556, 566, 582, 585, 587, 589, 593, 594, 599, 611, 618, 621, 623, 629, 630, 632, 637, 639, 646, 649, 650, 657, 665, 669, 678, 679, 688, 690, 704, 709, 710, 717, 719-721, 726, 727, 733, 734, 744, 746, 758, 760, 764, 768, 773, 792, 793, 812, 821, 825, 835, 844, 846, 850, 854, 856-858, 874, 876, 880, 882, 885, 893, 896, 897, 915, 926, 940, 942, 949, 951, 957, 963, 964, 974, 976, 981, 983, 990, 997, 999, 1000, 1015, 1016, 1027, 1043, 1049, 1053, 1054, 1056, 1075, 1081, 1087, 1088, 1098-1100, 1104, 1105, 1108, 1110, 1115, 1122, 1131, 1133, 1142, 1143, 1145, 1146, 1148, 1149, 1159, 1168, 1174, 1184, 1186, 1196, 1204, 1212, 1215, 1229, 1234-1302, and 1303, andb) selecting at least one corn plant comprising an allele of at least one of said markers that is associated ...

METHODS OF SEED BREEDING USING HIGH THROUGHPUT NONDESTRUCTIVE SEED SAMPLING

The present invention provides for novel methods to facilitate germplasm improvement activities through the use of high throughput, nondestructive sampling of seeds. A method of evaluating seeds for a desired trait, for example, for facilitating germplasm improvement activities, etc., generally includes removing tissue samples from individual seeds using an automated seed sampler without affecting germination viability of the seeds, analyzing the tissue samples for one or more characteristics indicative of a desired trait, and selecting the sampled seeds that include the desired trait. 1. A method of evaluating seeds for a desired trait , the method comprising:removing tissue samples from individual seeds using an automated seed sampler without affecting germination viability of the seeds;analyzing the tissue samples for one or more characteristics indicative of a desired trait; andselecting the sampled seeds that include the desired trait.2. The method of claim 1 , wherein analyzing the tissue samples for one or more characteristics indicative of a desired trait includes analyzing the tissue samples for the one or more characteristics indicative of the presence of the desired trait.3. The method of claim 1 , wherein analyzing the tissue samples for one or more characteristics indicative of a desired trait includes analyzing the tissue samples for the one or more characteristics indicative of the absence of the desired trait.4. The method of claim 1 , wherein the desired trait is selected from the group consisting of a genetic marker claim 1 , a single nucleotide polymorphism claim 1 , a simple sequence repeat claim 1 , a restriction fragment length polymorphism claim 1 , a haplotype claim 1 , a tag SNP claim 1 , an alleles of a genetic marker claim 1 , a gene claim 1 , a DNA-derived sequence claim 1 , an RNA-derived sequence claim 1 , a promoter claim 1 , a 5′ untranslated region of a gene claim 1 , a 3′ untranslated region of a gene claim 1 , microRNA claim 1 , ...

GENE EXPRESSION SIGNATURE FOR THE SELECTION OF HIGH ENERGY USE EFFICIENT PLANTS

Means and methods are provided to produce abiotic stress tolerant with improved yield based on the specific identification of a gene expression signature in said plants out of a population of said plants. 1. A method for the production of a plant with a high energy use efficiency comprising the steps of:i) providing a population of plants of the same plant species,ii) obtaining a nucleic acid sample from said plants, a. at least two genes comprising a nucleotide sequence having 70%-100% nucleic acid identity to any one of the nucleotide sequences of Seq ID No 1-61; and/or', 'b. at least two genes comprising a nucleotide sequence having 70%-100% nucleic acid identity to any one of the nucleotide sequences of Seq ID No 62-134; and/or', 'c. at least two genes comprising a nucleotide sequence having 70-100% nucleic acid identity to any one of the nucleotide sequences of Seq ID No 147-353;, 'iii) determining a gene expression profile by quantifying the mRNA presence ofiv) identifying at least one plant from said population having an at least increased 1.5 fold mRNA presence of said at least two genes comprising a nucleotide sequence having 70%-100% nucleic acid identity to any one of said nucleotide sequences of Seq ID No 62-134 with respect to the average mRNA presence of said genes in said population and/or having an at least decreased 0.66 fold mRNA presence of said at least two genes comprising a nucleotide sequence having 70%-100% nucleic acid identity to any one of said nucleotide sequences of Seq ID No 1-61 with respect to the average mRNA presence of said genes in said population and/or having an at least 2.0 fold mRNA presence of said at least two genes comprising a nucleotide sequence having 70%-100% nucleic acid identity to any one of said nucleotide sequences of Seq ID No 147-353 with respect to the average mRNA presence of said genes in said population.2. The method of wherein said population of plants are genetically identical.3. The method of wherein said ...

Barley lipoxygenase 1 gene, selection method for barley, materials for malt alcoholic beverages and method for production of malt alcoholic beverages

A barley plant including a mutant LOX-1 protein and that is deficient in lipoxygenase activity.

COMPOSITIONS RELATED TO THE QUANTITATIVE TRAIT LOCUS 6 (QTL6) IN MAIZE AND METHODS OF USE

Compositions related to the quantitative trait locus 6 (QTL6) in maize and methods for their use are provided. The compositions are novel molecular marker loci that are genetically linked with QTL6 and which are associated with increased oil content and/or increased oleic acid content and/or an increased oleic acid/linoleic acid ratio of a plant or plant part thereof. These novel markers are characterized by the presence of at least one polymorphism relative to the corresponding marker locus from the QTL6 region of non-high-oil, non-high-oleic acid maize plants. In some embodiments, the novel marker loci comprise coding sequence for a maize DGAT1-2 polypeptide or biologically active variant thereof. The marker loci of the invention, and suitable fragments thereof, are useful in methods of the invention for manipulating oil and/or oleic acid content and/or oleic acid/lineolic acid ratio of a plant or plant part thereof, for marker-assisted selection of a plant, for example, a maize plant, or plant part thereof, having an increased oil content and/or increased oleic acid content and/or an increased oleic acid/linoleic acid ratio, and for marker-assisted breeding of the high oil and/or high oleic acid trait. 1. A method of identifying a first maize plant or a first maize germplasm that has a phenotype selected from the group consisting of an increased oil content , an increased oleic acid content , an increased oleic acid/linoleic acid ratio , and any combinations thereof , comprising detecting in the first maize plant or the first maize germplasm at least one polymorphism within a marker locus that is associated with said phenotype of said first maize plant or said first maize germplasm , wherein said marker locus is genetically linked with a first QTL6 region that is flanked by a first border sequence that comprises nucleotides 1-20 of SEQ ID:8 and a second border sequence that comprises nucleotides 573-592 of SEQ ID NO:14 , and wherein the first maize plant or a ...

METHODS AND COMPOSITIONS FOR OBTAINING MARKER-FREE TRANSGENIC PLANTS

The invention provides methods and compositions for identifying transgenic seed that contain a transgene of interest, but lack a marker gene. Use of an identification sequence that results in a detectable phenotype increases the efficiency of screening for seed and plants in which transgene sequences not linked to a gene of interest have segregated from the sequence encoding a gene of interest. 1. A method of preparing marker-free seeds from a transgenic plant comprising the steps of:a) obtaining seeds of a transgenic plant comprising a first DNA segment comprising a nucleic acid of interest and a second DNA segment comprising a marker gene physically linked to a DNA cassette that is operably linked to a promoter functional in said seed, wherein the DNA cassette confers a detectable phenotype;b) screening the seeds for the absence of the detectable phenotype; andc) selecting at least a first seed that lacks the detectable phenotype to obtain a seed free of the marker gene.2. The method of claim 1 , wherein step c) further comprises assaying the seed for the presence of the nucleic acid of interest and selecting a seed that comprises the nucleic acid of interest.3. The method of claim 1 , wherein the marker gene is a selectable claim 1 , or screenable marker gene.4. (canceled)5. The method of claim 4 , wherein the DNA cassette encodes an RNA that is translationally or transcriptionally fused to the selectable marker gene.6. The method of claim 1 , wherein the DNA cassette comprises DNA encoding an antisense or sense RNA that silences an endogenous gene to result in the detectable phenotype.7. The method of claim 6 , wherein the DNA cassette comprises a pair of inverted repeats of a DNA fragment homologous to the endogenous gene.8. The method of claim 7 , wherein the inverted DNA fragment repeat is embedded in an intron within the marker gene.9. The method of claim 1 , wherein the first DNA segment and second DNA segment overlap.10. The method of claim 1 , wherein the ...

DNA SEQUENCE THAT CONFERS APHID RESISTANCE IN SOYBEAN

Provided herein are isolated nucleic acid molecules representing a genetically defined region of the genome of the aphid resistant soybean plant () cultivar Dowling that confers resistance to soybean aphid (). Within the region is a gene encoding the aphid resistance protein Rag1. Rag1 aphid resistance amino acid sequences are also provided. Also provided herein are methods for conferring aphid resistance on a plant or enhancing aphid resistance in a plant by transforming it to contain and express such nucleic acid sequences encoding Rag1 aphid resistance or introgressing DNA encoding the trait into the plant by plant breeding. Further provided are polymorphic markers useful for identifying plant germplasm containing aphid resistance, and methods for makings such markers. 23-. (canceled)4Aphis glycines. An isolated polypeptide having at least or about or 95% sequence identity or similarity to a polypeptide encoded by a nucleic acid molecule of claim 1 , wherein the polypeptide is capable of conferring or participating in conferring resistance on a soybean plant.5. The isolated polypeptide of having at least or about 95% sequence identity or similarity to a polypeptide having a sequence selected from the group of amino acid SEQ ID NOS:5-15.6. The isolated polypeptide of having at least or about 95% sequence identity or similarity to a polypeptide having a sequence of amino acid SEQ ID NO:7.7. The isolated polypeptide of having at least or about 95% sequence identity or similarity to a polypeptide having a sequence of amino acid SEQ ID NO:13.8. An isolated claim 5 , synthetic or recombinant nucleic acid molecule encoding a polypeptide of .9. An isolated claim 1 , synthetic or recombinant nucleic acid molecule of encoding a polypeptide having a sequence of amino acid SEQ ID NO:7 or SEQ ID NO:13.10. The nucleic acid molecule of comprising the sequence of SEQ ID NO:17.11. A nucleic acid molecule of wherein said nucleic acid sequence encoding a polypeptide is selected ...

GENETIC LOCI ASSOCIATED WITH RESISTANCE OF CORN TO FIJIVIRUS

The invention relates to methods and compositions for identifying and/or selecting maize plants that have newly conferred resistance or enhanced resistance to, or are susceptible to, a Fijivirus, particularly Mal de Rio Cuarto Virus (MRCV) and/or Maize Rough Dwarf Virus (MRDV). The methods use molecular genetic markers to identify, select, and/or construct resistant plants or to identify and counter-select susceptible plants. Maize plants that display newly conferred resistance or enhanced resistance to a Fijivirus (or an infection or disease caused by the virus) that are generated by the methods of the invention are also a feature of the invention. 1. A method of identifying and/or selecting a maize plant with enhanced resistance to MRCV infection comprising: i. a haplotype consisting of: a “G” at position 324, a “C” at position 345, a “G” at position 504, and an “A” at position 565, relative to SEQ ID NO:44;', 'ii. a haplotype consisting of: an “A” at position 85, a “C” at position 344, and an “A” at position 355 relative to SEQ ID NO:42; or', 'iii. a haplotype consisting of a “G” at position 58, an insertion at position 61, a “C” at position 70, a “C” at position 85, a “T” at position 90, a “G” at position 194, and an “A” at position 287, relative to SEQ ID NO:43; and, 'a. detecting in the maize plant a first marker allele that is linked to and associated withb. identifying and/or selecting said maize plant that has the first marker allele.2. The method of claim 1 , wherein the first marker allele is linked to i) claim 1 , ii) claim 1 , or iii) by 20 cM on a single meiosis map.3. The method of claim 1 , wherein the first marker allele is linked to i) claim 1 , ii) claim 1 , or iii) by 2 cM on a single meiosis map.4. (canceled)5. A method of identifying and/or selecting a maize plant that displays enhanced resistance to MRCV infection claim 1 , the method comprising detecting in the germplasm of the maize plant a haplotype comprising alleles at one or more marker ...

CORN EVENT MZDT09Y

A novel transgenic corn event designated MZDT09Y is disclosed. The invention relates to nucleic acids that are unique to event MZDT09Y and to methods of detecting the presence of event MZDT09Y based on DNA sequences of the recombinant constructs inserted into the corn genome that resulted in the MZDT09Y event and of genomic sequences flanking the insertion site. The invention further relates to corn plants comprising the transgenic genotype of event MZDT09Y and to methods for producing a corn plant by crossing a corn plant comprising the MZDT09Y genotype with itself or another corn variety. Seeds of corn plants comprising the MZDT09Y genotype are also objects of the invention. 1. A pair of polynucleotide primers comprising a first polynucleotide primer and a second polynucleotide primer which function together in the presence of an event MZDT09Y DNA template in a sample to produce an amplicon diagnostic for event MZDT09Y , whereina. the first polynucleotide primer comprises at least 10 contiguous nucleotides of SEQ ID NO: 36 or the complement thereof; andb. the second polynucleotide primer comprises a nucleotide sequence selected from the group comprising SEQ ID NO: 1, SEQ ID NO: 32, or the complements thereof.2. A method of detecting the presence of a nucleic acid molecule that is unique to event MZDT09Y in a sample comprising corn nucleic acids , the method comprising:{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, 'a. contacting the sample with the primer pair of , which when used in a nucleic acid amplification reaction with genomic DNA from event MZDT09Y produce an amplicon that is diagnostic for event MZDT09Y;'}b. performing a nucleic acid amplification reaction, thereby producing the amplicon; andc. detecting the amplicon.3. A kit for detecting nucleic acids that are unique to event MZDT09Y comprising at least one nucleic acid molecule of sufficient length of contiguous polynucleotides to function as a primer or probe in a nucleic acid detection method , ...

Loci Associated Charcoal Rot Drought Complex Tolerance in Soybean

The invention relates to methods and compositions for identifying soybean plants that are tolerant, have improved tolerance or are susceptible to Charcoal Rot Drought Complex. The methods use molecular genetic markers to identify, select and/or construct tolerant plants or identify and counter-select susceptible plants. Soybean plants that display tolerance or improved tolerance to Charcoal Rot Drought Complex that are generated by the methods of the invention are also a feature of the invention.

Oligonucleotides Useful in Methods for Detecting and Characterizing Aspergillus fumigatus

Methods for using oligonucleotides in the detection of are disclosed. The oligonucleotides of the invention have nucleotide sequences derived from the gene encoding the cytochrome P450 14 alpha-sterol demethylase (the cyp51A protein) of . The oligonucleotides include primers capable of producing amplicons specific to cyp51A in polymerase chain reactions using nucleic acids isolated from as templates. The oligonucleotides also include probes capable of detecting these cyp51A-specific amplicons. The oligonucleotides of the invention also include primers for nucleotide sequencing reactions to determine whether an isolate of is more tolerant than wild-type to a triazole. 1Aspergillus fumigatus. A method for determining whether a sample contains comprising:(a) providing a vessel containing a composition, wherein the composition contains a forward primer, a reverse primer, and a nucleic acid from the sample,wherein the composition is capable of amplifying, by a polymerase chain reaction, a segment of the nucleic acid to produce an amplicon,wherein production of the amplicon is primed by the forward primer and the reverse primer, wherein the amplicon encodes at least a portion of a Cyp51A protein,{'i': 'Aspergillus fumigatus', '(b) incubating the vessel under conditions allowing production of the amplicon if the sample contains , wherein, during production of the amplicon, the forward primer is capable of hybridizing to at least a portion of a segment of the antisense strand of the amplicon, and the reverse primer is capable of hybridizing to at least a portion of a segment of the sense strand of the amplicon,'}wherein the segment of the antisense strand of the amplicon consists of nucleotides 1551 through 1574, nucleotides 1304 through 1327, nucleotides 1257 through 1277, nucleotides 1062 through 1084, nucleotides 983 through 1002, or nucleotides 352 through 374 of SEQ ID NO:7, and the segment of the sense strand of the amplicon consists of nucleotides 720 through 743, ...

DISCOVERY AND UTILIZATION OF SORGHUM GENES (MA5/MA6)

Methods and composition for the production of non-flowering or late flowering hybrid. For example, in certain aspects methods for use of molecular markers that constitute the Ma5/Ma6 pathway to modulate photoperiod sensitivity are described. The invention allows the production of plants having improved productivity and biomass generation. 126-. (canceled)27sorghum. A method of screening a plant for a Ma7 allele comprising:{'i': 'sorghum', 'a) obtaining a plant; and'}{'i': 'sorghum', 'b) assaying the plant for a genetic marker genetically linked to the Ma7 allele, wherein said Ma7 allele is located on chromosome 1 between coordinates 6545866 to 8017655.'}2833-. (canceled)34. The method of claim 27 , wherein the genetic marker is selected from the group consisting of sequence variants revealed by direct sequence analysis claim 27 , restriction fragment length polymorphisms (RFLP) claim 27 , isozyme markers claim 27 , allele specific hybridization (ASH) claim 27 , amplified variable sequences of plant genome claim 27 , self-sustained sequence replication claim 27 , simple sequence repeat (SSR) and arbitrary fragment length polymorphisms (AFLP).35. The method of claim 27 , wherein said Ma7 allele is in a gene encoding a polypeptide selected from the group consisting of PhyC claim 27 , a MADS-box 14 protein and AP1.36sorghum. A method of producing plant homozygous for a Ma7 allele comprising:{'claim-ref': {'@idref': 'CLM-00027', 'claim 27'}, 'screening according to the method of a plurality of plants from a segregating population, and'}selecting one or more plants homozygous for the Ma7 allele. This application claims priority to U.S. Provisional Application No. 61/082,388, filed on Jul. 21, 2008. The foregoing application is incorporated herein by reference in its entirety.This invention was made with government support under grant number DBI-0321578 awarded by the U.S. National Science Foundation and grant number DE-FG02-06ER64306 awarded by the U.S. Department of ...

SUGARCANE-SUGAR-YIELD-RELATED MARKER AND THE USE THEREOF

According to the present invention, a sugarcane-sugar-yield-related marker linked to a sugarcane quantitative trait is provided. Such marker is a sugarcane-sugar-yield-related marker, which comprises a continuous nucleic acid region existing in a region sandwiched between the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence shown in SEQ ID NO: 5, a region sandwiched between the nucleotide sequence shown in SEQ ID NO: 6 and the nucleotide sequence shown in SEQ ID NO: 24, or a region sandwiched between the nucleotide sequence shown in SEQ ID NO: 25 and the nucleotide sequence shown in SEQ ID NO: 47 of a sugarcane chromosome. 1. A sugarcane-sugar-yield-related marker , which consists of a continuous nucleic acid region existing in a region sandwiched between the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence shown in SEQ ID NO: 5 , a region sandwiched between the nucleotide sequence shown in SEQ ID NO: 6 and the nucleotide sequence shown in SEQ ID NO: 24 , or a region sandwiched between the nucleotide sequence shown in SEQ ID NO: 25 and the nucleotide sequence shown in SEQ ID NO: 47 of a sugarcane chromosome.2. The sugarcane-sugar-yield-related marker according to claim 1 , wherein the continuous nucleic acid region comprises any nucleotide sequence selected from the group consisting of the nucleotide sequences shown in SEQ ID NOS: 1 to 47.3. The sugarcane-sugar-yield-related marker according to claim 1 , wherein the continuous nucleic acid region is located at a position in a region sandwiched between the nucleotide sequence shown in SEQ ID NO: 3 and the nucleotide sequence shown in SEQ ID NO: 5 claim 1 , a region sandwiched between the nucleotide sequence shown in SEQ ID NO: 7 and the nucleotide sequence shown in SEQ ID NO: 9 claim 1 , or a region sandwiched between the nucleotide sequence shown in SEQ ID NO: 35 and the nucleotide sequence shown in SEQ ID NO: 38 of a sugarcane chromosome.4. A method for producing a ...

SOYBEAN EVENT 3560.4.3.5 AND COMPOSITIONS AND METHODS FOR THE IDENTIFICATION AND/OR DETECTION THEREOF

Compositions and methods related to transgenic glyphosate/ALS inhibitor-tolerant soybean plants are provided. Specifically, soybean plants having a 3560.4.3.5 event which imparts tolerance to glyphosate and at least one ALS-inhibiting herbicide are provided. The soybean plant harboring the 3560.4.3.5 event at the recited chromosomal location comprises genomic/transgene junctions having at least the polynucleotide sequence of SEQ ID NO:10 and/or 11. The characterization of the genomic insertion site of the 3560.4.3.5 event provides for an enhanced breeding efficiency and enables the use of molecular markers to track the transgene insert in the breeding populations and progeny thereof. Various methods and compositions for the identification, detection, and use of the soybean 3560.4.3.5 events are provided. 136.-. (canceled)37. An isolated polynucleotide comprising SEQ ID NO: 11.38. The isolated polynucleotide of claim 37 , wherein said polynucleotide is selected from the group consisting of:(a) a nucleotide sequence set forth in SEQ ID NO: 13, 15, 28, or 42; and,(b) a nucleotide sequence comprising a fragment of SEQ ID NO: 13, 15, 28, or 42.39. A kit for identifying event 3560.4.3.5 in a biological sample claim 37 , said kit comprising a first and a second primer claim 37 , wherein said first and said second primer amplify a polynucleotide comprising a 3560.4.3.5 specific region claim 37 , wherein said 3560.4.3.5 specific region comprises SEQ ID NO: 11.40. The kit of claim 39 , wherein said kit further comprises a polynucleotide for the detection of the 3560.4.3.5 specific region.41. The kit of claim 39 , wherein said first primer comprises a first fragment of SEQ ID NO: 6 and the second primer comprises a second fragment of SEQ ID NO:6 claim 39 , wherein said first and said second primer flank said 3560.4.3.5 specific region and share sufficient sequence homology or complementarity to said polynucleotide to amplify said 3560.4.3.5 specific region.42. The kit of claim ...

SUGARCANE-STALK-SUGAR-CONTENT-RELATED MARKER AND THE USE THEREOF

According to the present invention, a sugarcane-stalk-sugar-content-related marker linked to a sugarcane quantitative trait is provided. Such marker is a sugarcane-stalk-sugar-content-related marker, which comprises a continuous nucleic acid region existing in a region sandwiched between the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence shown in SEQ ID NO: 8 or a region sandwiched between the nucleotide sequence shown in SEQ ID NO: 9 and the nucleotide sequence shown in SEQ ID NO: 16. 1. A sugarcane-stalk-sugar-content-related marker , which consists of a continuous nucleic acid region existing in a region sandwiched between the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence shown in SEQ ID NO: 8 or a region sandwiched between the nucleotide sequence shown in SEQ ID NO: 9 and the nucleotide sequence shown in SEQ ID NO: 16 of a sugarcane chromosome.2. The sugarcane-stalk-sugar-content-related marker according to claim 1 , wherein the continuous nucleic acid region comprises any nucleotide sequence selected from the group consisting of the nucleotide sequences shown in SEQ ID NOS: 1 to 16.3. The sugarcane-stalk-sugar-content-related marker according to claim 1 , wherein the continuous nucleic acid region is located at a position in a region sandwiched between the nucleotidesequence shown in SEQ ID NO: 1 and the nucleotide sequence shown in SEQ ID NO: 2 or a region sandwiched between the nucleotide sequence shown in SEQ ID NO: 13 and the nucleotide sequence shown in SEQ ID NO: 14 of a sugarcane chromosome.4. A method for producing a sugarcane line having an increased stalk sugar content comprising: a step of extracting a chromosome of a progeny plant obtained from parent plants claim 1 , at least one of which is sugarcane; and a step of determining the presence or absence of the sugarcane-stalk-sugar-content-related marker according to in the obtained sugarcane chromosome.5. The method for producing a sugarcane line ...

MOLECULAR MARKERS FOR LOW PALMITIC ACID CONTENT IN SUNFLOWER (HELIANTHUS ANNUS), AND METHODS OF USING THE SAME

This disclosure concerns methods and compositions for identifying sunflower plants that have a low palmitic acid content phenotype. Some embodiments concern molecular markers to identify, select, and/or construct low palmitic acid content plants and germplasm, or to identify and counter-select relatively high palmitic acid content plants. This disclosure also concerns sunflower plants comprising a low palmitic acid content phenotype that are generated by methods utilizing at least one marker described herein. 1. A method for identifying a first sunflower plant or germplasm that comprises low palmitic acid content , the method comprising:detecting in the first sunflower plant or germplasm at least one marker linked to low palmitic acid content, wherein the at least one marker is selected from the group consisting of HA0031B, HA0908, HA1665, HA0304A, HA0850, HA0743, HA0870, HA0907, HA0612A, and a marker linked to at least one of HA0031B, HA0908, HA1665, HA0304A, HA0850, HA0743, HA0870, HA0907, and HA0612A.2. The method according to claim 1 , wherein the method comprises detecting in the first sunflower plant or germplasm a marker linked to at least one of HA0031B claim 1 , HA0908 claim 1 , HA1665 claim 1 , HA0304A claim 1 , HA0850 claim 1 , HA0743 claim 1 , HA0870 claim 1 , HA0907 claim 1 , and HA0612A.3. The method according to claim 2 , wherein the detected marker displays a genetic recombination frequency of less than about 10% with the at least one marker of HA0031B claim 2 , HA0908 claim 2 , HA1665 claim 2 , HA0304A claim 2 , HA0850 claim 2 , HA0743 claim 2 , HA0870 claim 2 , HA0907 claim 2 , and HA0612A.4. The method according to claim 1 , wherein the detected marker of is selected from the group consisting of HA0031B claim 1 , HA0908 claim 1 , HA1665 claim 1 , HA0304A claim 1 , HA0850 claim 1 , HA0743 claim 1 , HA0870 claim 1 , HA0907 claim 1 , and HA0612A.5. The method according to claim 1 , wherein the germplasm is a sunflower line or sunflower variety.6. The ...

NMR SYSTEMS AND METHODS FOR THE RAPID DETECTION OF ANALYTES

This invention features systems and methods for the detection of analytes, and their use in the treatment and diagnosis of disease. 1166-. (canceled)167. A method for detecting the presence of an analyte in a liquid sample , the method comprising:{'sup': 6', '13', '8', '12', '−1', '−1, 'sub': '2', '(a) contacting a solution with magnetic particles to produce a liquid sample comprising from 1×10to 1×10magnetic particles per milliliter of the liquid sample, wherein the magnetic particles have a mean diameter of from 150 nm to 950 nm, a Trelaxivity per particle of from 1×10to 1×10mMs, and have binding moieties on their surface, the binding moieties operative to alter an aggregation of the magnetic particles in the presence of the analyte;'}(b) placing the liquid sample in a device, the device comprising a support defining a well holding the liquid sample comprising the magnetic particles, the multivalent binding agent, and the analyte, and having an RF coil disposed about the well, the RF coil configured to detect a signal produced by exposing the liquid sample to a bias magnetic field created using one or more magnets and an RF pulse sequence;(c) exposing the sample to a bias magnetic field and an RF pulse sequence;(d) following step (c), measuring the signal; and(e) on the basis of the result of step (d), detecting the presence or concentration of an analyte.168. The method of claim 167 , wherein the magnetic particles are substantially monodisperse.169. The method of claim 167 , wherein step (d) comprises measuring the Trelaxation response of the liquid sample claim 167 , and wherein increasing agglomeration in the liquid sample produces an increase in the observed Trelaxation rate of the sample.170. The method of claim 167 , wherein the analyte is a target nucleic acid from a leukocyte.171. The method of claim 167 , wherein the analyte is a target nucleic acid extracted from a pathogen.172. A method for detecting the presence of a pathogen in a whole blood sample ...

DIAGNOSTIC ASSAYS FOR THE DETECTION AND IDENTIFICATION OF ASPERGILLI

Three important species of and are known to contribute to the pathogenicity of allergic and invasive diseases in humans. They are also known to be plant pathogens. Several important ESTs/genes of species are now identified and characterized. Efforts are still needed to explore 30% genes of species for their valuable products which need to be explored. Polyketide biosynthetic pathway in species produce important secondary metabolites like polyketide toxins such as Aflatoxins, drugs such as Lovastatins and several other important pharmaceutically important polyketide compounds etc. With the availability of genome sequences it is possible today to characterize the structure and function of important genes of species. Based on the gene sequence information on PKS enzymes in medically and agriculturally important species such as and sequences of diagnostic use are identified and a multiplex PCR assay is developed using clinical and agricultural samples. 1Aspergillus. An oligonucleotide or set of oligonucleotides useful for the detection of species selected from the group consisting of SEQ ID NOS: 1-12.2Aspergillus. The set of oligonucleotides as claimed in containing oligonucleotides SEQ ID NOS: 1 claim 1 , 2 claim 1 , 4 claim 1 , 5 claim 1 , 7 claim 1 , 8 and 10 as primers for PCR-based detection of species.3Aspergillus. The set of oligonucleotides as claimed in claim 1 , are containing oligonucleotides SEQ ID NOS: 3 claim 1 , 6 claim 1 , 9 claim 1 , and 12 as probes for PCR-based detection of species.47.-. (canceled)8AspergillusAspergillus. A kit for the detection of species claim 1 , said kit comprising as primers the oligonucleotides of SEQ ID NO. 1 claim 1 , 2 claim 1 , 4 claim 1 , 5 claim 1 , 7 claim 1 , 8 claim 1 , 10 and 11 claim 1 , and as probes the oligonucleotides SEQ ID NOS: 3 claim 1 , 6 claim 1 , 9 and 12 claim 1 , along with instructions for use of said oligonucleotides for detection of species.9Aspergillus. A kit for the diagnosis of species claim 1 , ...

NMR SYSTEMS AND METHODS FOR THE RAPID DETECTION OF ANALYTES

This invention features systems and methods for the detection of analytes, and their use in the treatment and diagnosis of disease. 1Candida. A method for detecting the presence of a species in a whole blood sample , the method comprising:(a) providing an extract produced by lysing the red blood cells in a whole blood sample from a subject, centrifuging the sample to form a supernatant and a pellet, discarding some or all of the supernatant, and resuspending the pellet to form an extract, optionally washing the pellet prior to resuspending the pellet and optionally repeating the centrifuging, discarding, and resuspending steps;(b) lysing cells in the extract to form a lysate;{'i': 'Candida', '(c) amplifying a species target nucleic acid in the lysate to form an amplified lysate solution;'}{'sup': 6', '13', '9', '12', '−1', '−1, 'sub': '2', '(d) following step (c), adding to the amplified lysate solution from 1×10to 1×10magnetic particles per milliliter of the amplified lysate solution to form a mixture, wherein the magnetic particles have a mean diameter of from 700 nm to 950-nm and binding moieties on their surface, the binding moieties operative to alter aggregation of the magnetic particles in the presence of a target nucleic acid or a multivalent binding agent, wherein said magnetic particles have a Trelaxivity per particle of from 1×10to 1×10mMs;'}(e) providing the mixture in a detection tube within a device, the device comprising a support defining a well for holding the detection tube comprising the magnetic particles and the target nucleic acid, and having an RF coil disposed about the well, the RF coil configured to detect a signal produced by exposing the mixture to a bias magnetic field created using one or more magnets and an RF pulse sequence;(f) exposing the mixture to a bias magnetic field and an RF pulse sequence;(g) following step (f), measuring the signal from the detection tube;(h) on the basis of the result of step (g), detecting the target ...

GENETIC LOCI ASSOCIATED WITH MECHANICAL STALK STRENGTH IN MAIZE

The invention relates to methods and compositions for identifying and for selecting maize plants with mechanical stalk strength characteristics. The methods use molecular markers to identify and select plants with increased mechanical stalk strength or to identify and counter-select plants with decreased mechanical stalk strength. Maize plants generated by the methods of the invention are also a feature of the invention. 18-. (canceled)9. A method of identifying and selecting a maize plant that displays increased mechanical stalk strength , the method comprising: (i) the marker locus is located within a chromosomal interval comprising and flanked by PHM654 and PHM6727, and', (a) a “G” at PHM5421.5;', '(b) a “G” at PHM3468.1;', '(c) a “T” at PHM3468.4; and', '(d) a “G” at PHM3468.18;, '(ii) the at least one allele is associated with a haplotype comprising], 'a. detecting in the maize plant at least one allele of a marker locus wherein'}b. selecting a maize plant if said at least one allele is detected.1012-. (canceled)13. The method of claim 9 , wherein the marker locus is located within a chromosomal interval comprising and flanked by PHM201 and PHM3323.14. The method of claim 9 , wherein the marker locus is located within a chromosomal interval comprising and flanked by PHM201 and PHM3468.15. The method of claim 9 , wherein said at least one allele is:a. a “C” at PHM201-16-U;b. a “C” or a “G” at PHM201-17-U;c. a “T” or a “G” at PHM4861-20-U;d. an “A” at PHM4861-21-U;e. a “G” at PHM5421-5-V;f. a “G” or a “T” at PHM4115-35-U;g. a “T” at PHM12521-18-U;h. an “A” at PHM12521-19-U;i. a “G” at PHM12521-29-U;j. a “C” at C00386-397-U;k. a “T” at PHM12521.12;l. an “A” at PHM12521.19;m. a “C” at PHM10840.105;n. an “A” at PHM10840.118; oro. a “C” at PHM10840.30.16. A method of identifying and counter-selecting a maize plant that displays decreased mechanical stalk strength claim 9 , the method comprising: (i) the marker locus is located within a chromosomal interval comprising ...

COMPOSITIONS AND METHODS OF PLANT BREEDING USING HIGH DENSITY MARKER INFORMATION

The present invention relates to breeding methods to enhance the germplasm of a plant. The methods describe the identification and accumulation of preferred haplotype genomic regions in the germplasm of breeding populations of maize () and soybean (). The invention also relates to maize and soybean plants comprising preferred haplotypes. 1134-. (canceled)135. A soybean plant , comprising at least 3 haplotypes selected from the group consisting of haplotypes 1262140 , 1263534 , 1262082 , 1262411 , 1263994 , 1264220 , 1264704 , 1262403 , 1263084 , 1264607 , 1264076 , 1262066 , 1262410 , 1264390 , 1263544 , 1263999 , 1264257 , 1261823 , 1264702 , 1264603 , 1263717 , 1264740 , 1263391 , 1262138 , 1262086 , 1264237 , 1264188 , 1264473 , 1262143 , 1261808 , 1262894 , 1264610 , 1262441 , 1264701 , 1263533 , 1262106 , 1264638 , 1264078 , 1263993 , 1262139 , 1262984 , 1263155 , 1262487 , 1263696 , 1262884 , 1264703 , 1264551 , 1264379 , 1262220 , and 1263150.136. A soybean plant of claim 135 , comprising at least 3 haplotypes selected from the group consisting of haplotypes 1262140 claim 135 , 1263534 claim 135 , 1262082 claim 135 , 1262411 claim 135 , 1263994 claim 135 , 1264220 claim 135 , 1264704 claim 135 , 1262403 claim 135 , 1263084 claim 135 , and 1264607.137. (canceled)138. A soybean plant of claim 135 , comprising at least 7 haplotypes selected from the group consisting of haplotypes 1262140 claim 135 , 1263534 claim 135 , 1262082 claim 135 , 1262411 claim 135 , 1263994 claim 135 , 1264220 claim 135 , 1264704 claim 135 , 1262403 claim 135 , 1263084 claim 135 , 1264607 claim 135 , 1264076 claim 135 , 1262066 claim 135 , 1262410 claim 135 , 1264390 claim 135 , 1263544 claim 135 , 1263999 claim 135 , 1264257 claim 135 , 1261823 claim 135 , 1264702 claim 135 , 1264603 claim 135 , 1263717 claim 135 , 1264740 claim 135 , 1263391 claim 135 , 1262138 claim 135 , 1262086 claim 135 , 1264237 claim 135 , 1264188 claim 135 , 1264473 claim 135 , 1262143 claim 135 , 1261808 claim ...

COMPOSITIONS AND METHODS FOR DETECTION OF CANDIDA SPECIES

The invention features compositions and methods for the detection of species in biological samples, such as human tissue samples. The invention features species specific nucleic acid probes that can hybridize to target nucleic acid molecules in species and can be used in a variety of detection assays, such as fluorescence based assays or NMR based assays. The compositions and methods of the invention can be used to rapidly and accurately detect one or more species in patients and can be used to assist in point-of care-decisions for treating infections. 1. A nucleic acid probe comprising the sequence of SEQ ID NO: 1.2. A nucleic acid probe comprising the sequence of SEQ ID NO: 2.3. A nucleic acid probe comprising the sequence of SEQ ID NO: 3.4. A nucleic acid probe comprising the sequence of SEQ ID NO: 4.5. A nucleic acid probe comprising the sequence of SEQ ID NO: 5.6. The nucleic acid probe of claim 1 , wherein said probe comprises a detection moiety that is conjugated to the probe.7. The nucleic acid probe claim 2 , wherein said probe comprises a detection moiety that is conjugated to the probe.8. The nucleic acid probe of claim 3 , wherein said probe comprises a detection moiety that is conjugated to the probe.9. The nucleic acid probe claim 4 , wherein said probe comprises a detection moiety that is conjugated to the probe.10. The nucleic acid probe of claim 5 , wherein said probe comprises a detection moiety that is conjugated to the probe.11. The nucleic acid probe of claim 6 , wherein said detection moiety comprises a fluorescent label.12. The nucleic acid probe of claim 7 , wherein said detection moiety comprises a fluorescent label.13. The nucleic acid probe of claim 8 , wherein said detection moiety comprises a fluorescent label.14. The nucleic acid probe of claim 9 , wherein said detection moiety comprises a fluorescent label.15. The nucleic acid probe of claim 10 , wherein said detection moiety comprises a fluorescent label.16. The nucleic acid probe of ...

SALT TOLERANCE SYDBSP GENE DERIVED FROM SYNECHOCYSTIS, AND USES THEREOF

The present invention relates to a gene encoding putative DNA binding stress protein (SyDBSP protein) derived from cyanobacteria PCC6906; a method for enhancing the salt tolerance of a plant comprising transforming a plant cell with a recombinant vector comprising the SyDBSP gene and overexpressing the SyDBSP gene; a plant having enhanced salt tolerance produced by the aforementioned method, and seed of the plant. 1SynechocystisSynechocystis. A putative DNA binding stress protein (SyDBSP) derived from PCC 6906 which consists of the amino acid sequence of SEQ ID NO: 2.2. A gene that encodes the SyDBSP protein of .3. The gene according to claim 2 , wherein the gene consists of a nucleotide sequence of SEQ ID NO; 1.4. A recombinant vector comprising the gene of .5. A host cell transformed with the recombinant vector of .6. A method for enhancing salt tolerance of a plant claim 4 , comprising:{'claim-ref': {'@idref': 'CLM-00004', 'claim 4'}, 'transforming a plant cell with the recombinant vector according to ; and'}overexpressing the gene.7. A transformed plant having enhanced salt tolerance produced by the method of .8. The transformed plant according to claim 7 , wherein the plant is a dicot plant or a monocot plant.9Arabidopsis thaliana,. The transformed plant according to claim 7 , wherein the plant is tobacco claim 7 , duckweed claim 7 , or poplar.10. Seed of the plant of .11. A transformed plant having enhanced salt tolerance produced by transformation with the recombinant vector of .12. A composition for enhancing salt tolerance of plant comprising the gene of .13. A primer set for amplification of the gene of claim 2 , the primer set consisting of oligonucleotides of SEQ ID NO: 3 and SEQ ID NO: 4. The present invention relates to a putative DNA binding stress protein (SyDBSP) gene derived from cyanobacteria a method of enhancing the salt tolerance of a plant by overexpressing said SyDBSP gene in a plant; a plant having enhanced salt tolerance produced by said ...

Markerless Transformation

Methods for identification of successful transformation without a need for in vitro selection are provided. Direct detection of nucleotide sequences of interest is described which eliminate the need for use of ancillary nucleotide sequences. 18-. (canceled)9. A method for producing a transgenic plant comprising a nucleotide sequence of interest inserted into its genome , where said method comprises:a) transforming a plant tissue or plant cell with said nucleotide sequence of interest, which comprises a gene of interest; wherein said plant tissue or plant cell is not transformed with an ancillary nucleotide sequence comprising a selectable marker;b) regenerating said plant tissue or plant cell without selection for a selectable marker following said transforming to produce a transgenic plant; andc) directly detecting the presence or absence in said transgenic plant of the nucleotide sequence of interest, an encoded product of said nucleotide sequence of interest, or a metabolic product of said encoded product;wherein said transgenic plant comprises the nucleotide sequence of interest introduced by said transforming; andwherein said transforming does not introduce a transposable element into said plant tissue or plant cell.10. The method of claim 9 , wherein directly detecting comprises the use of a method selected from the group consisting of southern hybridization claim 9 , polymerase chain reaction claim 9 , and western hybridization for the nucleotide sequence or encoded protein product claim 9 , and HPLC for a metabolic product of the encoded product.11. The method of claim 9 , wherein directly detecting comprises the use of a method selected from the group consisting of southern hybridization for the nucleotide sequence of interest and HPLC for a metabolic product of the encoded product.12. The method of claim 9 , wherein directly detecting comprises the use of a method selected from the group consisting of polymerase chain reaction for the nucleotide sequence ...

METHODS FOR REMOVAL OF SPECIFIC SEED TISSUE OR STRUCTURE FOR SEED ANALYSIS

A method for reducing resources for selecting seed to be produced in commercial quantities or for research is disclosed. Samples of seed which are candidates for selection are collected and given an identifier. Specific tissue or structure from candidate seed is removed. A test or analysis is performed on the candidate seed or the removed tissue or structure. Results of the test or analysis are recorded and correlated to the seed's identifier. The results are evaluated and a decision is made whether to select a candidate seed for commercial production or for research. Time, space, and labor associated with growing plants in an experimental plot or greenhouse and taking tissue samples from growing plants is saved. 1. A method to decrease time and space needed to sample tissue to allow selection of seed for production in commercial quantities or for research comprising:a. providing a plurality of candidate seed;b. uniquely identifying each of the candidate seed;c. removing specific tissue or structure for each candidate seed;d. performing seed specific analysis of each candidate seed or the removed tissue or structure;e. storing data from the seed specific analysis correlated to the unique identification of each candidate seed; andf. using the data in an evaluation of whether any candidate seed should be selected for production in commercial quantities or for research without growing the seed.2. The method of wherein the step of removing specific tissue or structure is performed automatically on each seed.3. The method of wherein the automatic removing comprises controlling a laser beam relative to each seed.4. The method of wherein the seed specific analysis comprises one or more of genetic claim 3 , non-genetic claim 3 , nanoscale claim 3 , spectroscopic claim 3 , phenotypic claim 3 , or cellular level analysis.5. A method of testing claim 3 , removing claim 3 , or exposing specific seed structure or tissue of a seed comprising:a. non-destructively ablating an outer ...

Methods and Compositions for Detecting and Identifying Species of Candida

Methods and compositions useful in the detection and identifcation of species of are disclosed. The compositions are combinations of oligonucleotides, where the forward primers of the primer pairs have identical sequences, while each reverse primer of the primer pairs has a unique sequence relative to all of the other reverse primers; or the reverse primers of the primer pairs have identical sequences, while each forward primer of the primer pairs has a unique sequence relative to all of the other forward primers. The oligonucleotides also include probes capable of detecting these amplicons, and sequencing primers for determining, in primer extension reactions, the nucleotide sequences contained within the amplicons. The detection of an amplicon indicated that the sample contains at least one isolate of , or , and the nucleotide sequence data is used to determine which of these four species is present. 1Candida albicans, Candida glabrata, Candida parapsilosisCandida tropicalis. A composition useful in determining whether a vaginal sample contains an isolate of or , said composition comprises:(a) a forward primer, said forward primer consisting of nucleotide sequence of SEQ ID NO: 13;(b) a first reverse primer, said first reverse primer consisting of nucleotide sequence of SEQ ID NO: 9;(c) a second reverse primer, said second reverse primer consisting of nucleotide sequence of SEQ ID NO: 10;(d) a third reverse primer, said third reverse primer consisting of nucleotide sequence of SEQ ID NO: 11; and(e) a fourth reverse primer, said fourth reverse primer consisting of nucleotide sequence of SEQ ID NO: 12,{'i': Candida albicans, Candida glabrata, Candida parapsilosis', 'Candida tropicalis, 'claim-text': [{'i': 'Candida albicans,', 'said first reverse primer and said forward primer produces a first amplicon specific for the isolate of'}, {'i': 'Candida glabrata,', 'said second reverse primer and said forward primer produces a second amplicon specific for the isolate of ...

BRASSICA GENOMIC ASSAYS

Methods and compositions for detecting, identifying, and quantifying A genomic DNA are described. The methods are specific to the A genome and do not cross-react with other species, crops or weedy relatives that could contribute to contamination of a canola field. 1Brassica. A method of detecting and quantifying the amount of A genomic DNA in a sample , the method comprising:{'i': 'Brassica', '(a) specifically amplifying a genomic DNA fragment of the A genome, wherein the amplified DNA fragment comprises at least one of the nucleotide sequences of a genomic region selected from the group consisting of SEQ ID NOS: 25, 26, 27, 28, and 35; and'}{'i': Brassica', 'Brassica, '(b) detecting and quantifying the A genome from the amplified fragment of the A genome.'}2Brassica. The method of claim 1 , wherein the amplified fragment of A genome comprises (i) the nucleotide sequence of at least one of SEQ ID NOS: 29 claim 1 , 30 claim 1 , or 31; or (ii) a nucleic acid fragment of at least one of SEQ ID NOS: 29 claim 1 , 30 claim 1 , or 31 claim 1 , wherein the nucleic acid fragment is selected from the group consisting of nucleotide position from about 50 to about nucleotide position 400 claim 1 , 50 to about nucleotide position 100 claim 1 , 50 to about nucleotide position 350 claim 1 , 400 to about nucleotide position 350 claim 1 , 400 to about nucleotide position 200 claim 1 , and 400 to about nucleotide position 100 of SEQ ID NOS: 29 claim 1 , 30 claim 1 , or 31.3. The method of claim 1 , wherein the amplification is performed with a primer pair comprising nucleotide sequences selected from the group consisting of SEQ ID NOS: 17 claim 1 , 18 claim 1 , 19 claim 1 , 20 claim 1 , 21 claim 1 , 22 claim 1 , 23 claim 1 , and 24.4. The method of claim 1 , wherein the genomic DNA comprises a FatA gene.5Brassica. The method of claim 1 , wherein the amplification does not substantially amplify B and C genomic DNA.6Brassica. A method of determining the relative amount of a transgenic ...

AAD-12 EVENT 416, RELATED TRANSGENIC SOYBEAN LINES, AND EVENT-SPECIFIC IDENTIFICATION THEREOF

This invention includes a novel aad-12 transformation event for herbicide tolerance in soybean plants—referred to herein as pDAB4468-0416. This invention includes a heterologous polynucleotide inserted into a specific site within the genome of a soybean cell. In some embodiments, said event/polynucleotide can be “stacked” with other traits, including, for example, other herbicide tolerance gene(s) and/or insect-inhibitory proteins. Additionally, the subject invention provides assays for detecting the presence of the subject event in a sample (a soybean, for example). The assays can be based on the DNA sequence of the recombinant construct, inserted into the soybean genome, and on the genomic sequences flanking the insertion site. Kits and conditions useful in conducting the assays are also provided. 1. A transgenic soybean plant comprising a genome , said genome comprising SEQ ID NO:1.2. A soybean seed comprising a genome comprising AAD-12 event pDAB4468-0416 as present in representative seed deposited with American Type Culture Collection (ATCC) under Accession No. PTA-10442.3. A soybean seed from the plant of claim 1 , said seed comprising said genome comprising SEQ ID NO:1.4. A soybean plant produced by growing the seed of claim 2 , said plant comprising SEQ ID NO:1.5. A progeny plant of the soybean plant of claim 4 , said progeny plant comprising AAD-12 event pDAB4468-0416.6. A herbicide-tolerant progeny plant of the soybean plant of claim 1 , said progeny plant comprising SEQ ID NO:1.7. A transgenic soybean plant comprising a transgene insert in soybean chromosomal target site located on chromosome 4 between SNP markers of SEQ ID NO:29 and SEQ ID NO:30 claim 1 , wherein the target site comprises a heterologous nucleic acid.8. A method of making the transgenic soybean plant of claim 7 , said method comprising inserting a heterologous nucleic acid at a position on chromosome 4 between SNP markers of SEQ ID NO:29 and SEQ ID NO:30 claim 7 , wherein the target site ...

GENETIC LOCI ASSOCIATED WITH SOYBEAN CYST NEMATODE RESISTANCE AND METHODS OF USE

Various methods and compositions are provided for identifying and/or selecting soybean plants or soybean germplasm with improved resistance to soybean cyst nematode. In certain embodiments, the method comprises detecting at least one marker locus that is associated with resistance to soybean cyst nematode. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with resistance to soybean cyst nematode. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with improved resistance to soybean cyst nematode. 1. A method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode , the method comprising detecting in the genome of said first soybean plant or in the genome of said first soybean germplasm at least one marker locus that is associated with the resistance , wherein:(a) the at least one marker locus comprises S08271-1-Q2 or a marker closely linked thereto on linkage group G;(b) the at least one marker locus comprises P7659A-2 or a marker closely linked thereto on linkage group G;(c) the at least one marker locus comprises S08051-1-Q1 or a marker closely linked thereto on linkage group G;(d) the at least one marker locus comprises S07158-1-Q1 or a marker closely linked thereto on linkage group G;(e) the at least one marker locus comprises S07159-1-Q1 or a marker closely linked thereto on linkage group G;(f) the at least one marker locus comprises S06818-3-Q2 or a marker closely linked thereto on linkage group G;(g) the at least one marker locus comprises S06820-1-Q3 or a marker closely linked thereto on linkage group G;(h) the at least one marker locus comprises S06821-1-Q2 or a marker closely linked thereto on linkage group G;(i) the at least one marker locus ...

METHODS FOR SELECTION OF INTROGRESSION MARKER PANELS

This disclosure concerns marker-assisted plant selection and breeding. In specific embodiments, methods of identifying optimized marker panels for predicting the presence of a plant trait of interest, and/or marker panels thereby identified, are provided. 1. A method of determining a set of biological markers for identification of a plant likely to comprise a trait of interest , the method comprising:utilizing an ant colony optimization system to identify an optimized subset of plurality of genetic markers that is predictive of the trait of interest, wherein the optimized subset of the plurality of genetic markers is the set of biological markers for identification of a plant likely to comprise the trait of interest.2. The method according to claim 1 , further comprising:providing an inbred plant that does not comprise the trait of interest, wherein the inbred plant comprises a genotype for the plurality of genetic markers;crossing-a first donor plant comprising a genotype for the plurality of genetic markers with the inbred plant to produce a progeny plant, wherein the progeny plant comprises a genotype for the plurality of genetic markers, and determining whether the progeny plant comprises the trait of interest; andproviding a database comprising a plurality of genotypes for the plurality of genetic markers, wherein each genotype is the genotype of a progeny plant produced by crossing the inbred plant with an additional different donor plant.3. The method according to claim 2 , further comprising:providing a genetic sample from the first donor plant; andgenotyping the first donor plant for the plurality of genetic markers.4. The method according to claim 1 , wherein utilizing an ant colony optimization system comprises:defining a problem space comprised of discrete adjacent subsets of the plurality of genetic markers, and a plurality of agents, wherein the agents choose in successive time steps between the discrete adjacent subsets according to a probability ...

SOYBEAN PLANT AND SEED CORRESPONDING TO TRANSGENIC EVENT MON87712 AND METHODS FOR DETECTION THEREOF

The present invention provides a transgenic soybean comprising event MON87712 that exhibits increased yield. The invention also provides cells, plant parts, seeds, plants, commodity products related to the event, and DNA molecules that are unique to the event and were created by the insertion of transgenic DNA into the genome of a soybean plant. The invention further provides methods for detecting the presence of said soybean event nucleotide sequences in a sample, probes and primers for use in detecting nucleotide sequences that are diagnostic for the presence of said soybean event. 1. A recombinant DNA molecule comprisinga) a polynucleotide molecule having a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2;b) a polynucleotide molecule having a sequence comprising at least from about 51-100 consecutive nucleotides of a sequence selected from the group consisting of SEQ ID NO: 7 and SEQ ID NO: 8;c) a polynucleotide molecule having a sequence complementary to a) or b).2. The DNA molecule of claim 1 , wherein said DNA molecule is derived from event MON87712 claim 1 , a representative sample of seed comprising event MON87712 having been deposited under ATCC Accession No. PTA-10296.3. The DNA molecule of claim 1 , wherein said DNA molecule is comprised in a soybean plant claim 1 , plant cell claim 1 , seed claim 1 , progeny plant claim 1 , plant part claim 1 , or a commodity product.4. The DNA molecule of claim 1 , wherein said DNA molecule is an amplicon produced from a template molecule derived from DNA from event MON87712.5. A polynucleotide probe diagnostic for the presence of event MON87712 DNA claim 1 , wherein said polynucleotide probe is of sufficient length to bind to a nucleic acid molecule comprising SEQ ID NO: 1 claim 1 , SEQ ID NO: 2 claim 1 , or at least from about 51-100 consecutive nucleotides of SEQ ID NO: 7 or of SEQ ID NO: 8 claim 1 , or complements thereof claim 1 , and wherein said polynucleotide probe hybridizes under ...

Methods and Compositions for Gray Leaf Spot Resistance in Corn

The present invention relates to the field of plant breeding. More specifically, the present invention includes a method of using haploid plants for genetic mapping of traits of interest such as disease resistance. Further, the invention includes a method for breeding corn plants containing quantitative trait loci (QTL) that are associated with resistance to Gray Leaf Spot, a fungal disease associated with spp. 1. A method of creating a population of corn plants comprising at least one allele associated with Gray Leaf Spot (GLS) resistance comprising SEQ ID NO: 157 , 167 , or 389 , the method comprising the steps of:a) genotyping a first population of corn plants;b) selecting from said first population one or more corn plants containing said allele; andc) producing from said selected corn plants a second population.2. The method according to claim 1 , wherein the first population of corn plants genotyped in step (a) is a population generated by a cross.3. The method of claim 2 , wherein said cross is effected by mechanical emasculation claim 2 , chemical sterilization claim 2 , or genetic sterilization of a pollen acceptor.4. The method of claim 1 , wherein said genotyping is effected in step (a) by determining the allelic state of at least one corn genomic DNA markers.5. The method according to claim 1 , wherein the selected one or more corn plants exhibit at least partial resistance to a GLS-inducing fungus or at least substantial resistance to a GLS-inducing fungus.6. The method of claim 2 , wherein said population is generated by a cross of at least one Gray Leaf Spot (GLS) resistant corn plant with at least one Gray Leaf Spot (GLS) sensitive corn plant.7. The method of claim 2 , wherein said population is a segregating population.8. The method of claim 2 , wherein said cross is a back cross of at least one Gray Leaf Spot (GLS) resistant corn plant with at least one Gray Leaf Spot (GLS) sensitive corn plant to introgress GLS resistance into a corn germplasm.9. ...

METHOD OF DETECTING AND QUANTIFYING COCCIDIOIDES SPECIES

The present invention provides methods and kits that may be used to detect and quantify the presence of species. The methods include quantification real-time PCR assays, and the kits and compositions include oligonucleotides used as primers and probes. 1Coccidioides. A method of determining the presence or absence of in a DNA-containing sample comprising the steps of:adding a first and a second oligonucleotide capable of binding SEQ ID NO. 1 to a mixture comprising the DNA-containing sample, wherein the first oligonucleotide includes at least one sequence selected from the group consisting of SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 and homologs thereof, having at least 80% sequence identity, and having complementarity under similar stringency, wherein the second oligonucleotide includes at least one sequence selected from the group comprising SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, and homologs thereof having at least 80% sequence identity and complementarity under similar stringency;subjecting the mixture to conditions that allow amplification of nucleic acid comprising the first oligonucleotide;obtaining a result indicating nucleic acid amplification comprising the first oligonucleotide; and{'i': 'Coccidioides', 'determining the presence or absence of in the DNA-containing sample based on the result.'}2. The method of claim 1 , wherein the result comprises a Ct value.3. The method of claim 1 , wherein the first oligonucleotide is capable of hybridizing with complements of SEQ ID NO. 3 claim 1 , and the second oligonucleotide is capable of hybridizing with complements of SEQ ID NO. 6 in the mixture.4. The method of claim 1 , further comprising the step of adding a third oligonucleotide to the mixture claim 1 , wherein the third oligonucleotide binds to its complement included in the amplification products by the first and second oligonucleotides.5. The method of claim 4 , wherein the third oligonucleotide includes sequence selected from the group ...

METHODS TO DETERMINE ZYGOSITY IN A BULKED SAMPLE

Methods of determining the presence or absence of an inserted nucleotide sequence at a particular insertion site in a nucleic acid include: isolating a nucleic acid from the bulked tissue sample; contacting the nucleic acid with a forward primer able to bind to the nucleic acid upstream of the insertion site, a first reverse primer specific for the inserted nucleotide sequence, and a second reverse primer able to bind to the nucleic acid downstream of the insertion site. The primers may be used to reproduce nucleic acids between the primers. The reproduced nucleic acids may be analyzed to determine if an inserted nucleotide sequence is present or absent in the sample. 1. A method of determining the presence or absence of an inserted nucleotide sequence at a particular insertion site in a nucleic acid , the method comprising:isolating nucleic acid from the sample; a forward primer able to bind to the nucleic acid upstream of the insertion site; and', 'a reverse primer able to bind to the nucleic acid downstream of the insertion site;, 'contacting the nucleic acid withusing the primers to reproduce nucleic acids between the primers; andanalyzing the reproduced nucleic acids to determine if inserted nucleotide sequence is present or absent in the sample.2. The method according to claim 1 , further comprising contacting the nucleic acid during or after reproduction with a probe specific for a fragment amplified in the presence of the inserted nucleotide sequence.3. The method according to claim 1 , further comprising contacting the nucleic acid during or after reproduction with a probe specific for a fragment amplified in the absence of the inserted nucleotide sequence.4. The method according to claim 2 , further comprising contacting the nucleic acid during or after reproduction with a probe specific for a fragment amplified in the absence of the inserted nucleotide sequence.5. The method according to claim 1 , wherein the sample comprises more than one iteration of ...

MOLECULAR MARKERS FOR VARIOUS TRAITS IN WHEAT AND METHODS OF USE

This disclosure relates to methods of identifying and/or selecting wheat plants or germplasm by detecting markers associated with flowering date, anther-extrusion, heading date and/or head blight resistance. 1. A method of identifying a first wheat plant or germplasm{'sub': —', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—, 'A) wherein said first wheat plant or germplasm displays a favorable flowering date said method comprises detecting in the first wheat plant or germplasm at least one allele from one of the following marker loci: WSNP_KU_C1654725454123; WSNP_EX_C29205385184; WSNP_EX_C1071717456391; WSNP_JD_C13161891903; WSNP_BG263758B_TA 21; WSNP_EX_C35016408181; WSNP_BE404354B_TA21; WSNP_EX_C1055517237000; WSNP_KU_C675811757213; WSNP_JD_C65447697578; WSNP_EX_C3632544308589; WSNP_EX_C25804800027; WSNP_EX_C1055517235832; WSNP_EX_C2208931270140; WSNP_EX_C659011419735; WSNP_CAP11_C210199161; WSNP_KU_C18183557408; WSNP_EX_REP_C6660664905694; WSNP_EX_REP_C10279587883062; or a maker locus that is closely linked to any one of said marker locus;'}{'sub': —', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', '—', ...

Endpoint Zygosity Assay To Detect RF4 Gene In Maize

A method is provided for determining the zygosity of an Rf4 gene in a corn plant. A method may include performing a first PCR assay, a second PCR assay, quantifying probes used in the first and second PCR assays, and comparing the quantified probes to determine zygosity. 1. A PCR assay method for determining zygosity of an Rf4 gene in a corn plant , the method comprising:performing a first PCR assay using a first probe, a first forward primer, and a first reverse primer on a polynucleotide from a corn plant sample;performing a second PCR assay using a second probe, a second forward primer, and a second reverse primer on the polynucleotide sample;quantifying the first and second probe; and,comparing the quantified first and second probe to determine zygosity.2. The PCR assay method of claim 1 , wherein the PCR assay is a multiplex PCR-format.3. The PCR assay method of claim 2 , wherein the first and second PCR assays are performed in a single PCR assay tube.4. The PCR assay method of claim 1 , wherein the PCR is real-time PCR.5. The PCR assay method of claim 1 , further comprising:loading a PCR reaction mixture in a PCR assay tube;wherein the PCR reaction mixture comprises a polymerase with 5′ to 3′ nuclease activity, deoxynucleotides, a buffer, the first and second forward primer, the first and second reverse primer, the first and second probe, and the polynucleotide sample, andthe first probe and the second probe comprising fluorescent dyes with distinguishable excitation/emission spectra; and{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, 'performing an amplification step under amplification conditions such that the 5′ to 3′ nuclease activity of the polymerase cleaves the first and second probe of , thereby releasing fluorescent dyes comprising distinguishable excitation/emission spectra.'}6. The PCR assay method of claim 1 , further comprising:loading a PCR reaction mixture in a PCR assay tube, whereinthe PCR reaction mixture comprises a polymerase with 5′ to 3 ...

SOY GENE CLUSTER REGIONS AND METHODS OF USE

Methods for conveying pathogen resistance into non-resistant soybean germplasm are provided. In some embodiments, the methods include introgressing pathogen resistance into a non-resistant soybean using one or more nucleic acid markers for marker-assisted breeding among soybean lines to be used in a soybean breeding program, wherein the markers are linked to and/or associated with pathogen resistance. Also provided are single nucleotide polymorphisms (SNPs) associated with resistance to pathogens; soybean plants, seeds, and tissue cultures produced by any of the disclosed methods; seed produced by the disclosed soybean plants; and compositions including amplification primer pairs capable of initiating DNA polymerization by a DNA polymerase on soybean nucleic acid templates to generate soybean marker amplicons. 1. A method of identifying a first soybean plant that displays resistance to a pathogen , the method comprising:(a) detecting in a first soybean plant at least one allele of one or more marker locus associated with the resistance to a pathogen wherein the one or more marker locus is a marker locus localizing withing a chromosomal interval on soy Chromosome 13 flanked by and including Satt 325 and Satt 362;(b) sceen first soybean plant for resistance to a pathogen; and(c) selecting the first soybean plant or selecting a progeny of the first soybean plant whereby the resulting plant displays resistance a pathogen.2Phytophthora.. The method of claim 1 , wherein the resulting plant of (b) is resistant to a pathogen selected from the group consisting of aphids claim 1 , RKN or3. The method of claim 1 , wherein the marker locus comprises a marker associated with any one of SEQ ID NOs: 1-35.4. The method of claim 1 , wherein the marker locus comprises one or more minimum identifiers as represented in Table 3.5. The method of claim 1 , wherein the one or more nucleic acid markers are at least 95% identical to any of SEQ ID NOs: 1-35 or to minimum identifiers as ...

ELITE EVENT A2704-12 AND METHODS AND KITS FOR IDENTIFYING SUCH EVENT IN BIOLOGICAL SAMPLES

Tools are provided which allow rapid and unequivocal identification elite event A2704-12 in biological samples. 1. A method for identifying elite event A2704-12 in biological samples , which method comprises detection of a A2704-12 specific region with a specific primer or probe which specifically recognizes the 5′ or 3′ flanking region of A2704-12.2. The method of claim 1 , said method comprising amplifying a DNA fragment of between 100 and 500 by from a nucleic acid present in said biological samples using a polymerase chain reaction with at least two primers claim 1 , one of said primers recognizing the 5′ flanking region of A2704-12 claim 1 , said 5′ flanking region having the nucleotide sequence of SEQ ID No 1 from nucleotide 1 to nucleotide 209 or the 3′ flanking region of A2704-12 claim 1 , said 3′ flanking region having the nucleotide sequence of the complement of SEQ ID No 2 from nucleotide 569 to nucleotide 1000 claim 1 , the other primer of said primers recognizing a sequence within the foreign DNA having the nucleotide sequence of the complement of SEQ ID No. 1 from nucleotide 210 to nucleotide 720 or the nucleotide sequence of SEQ ID No 2 from nucleotide 569 to nucleotide 1000.3. The method of claim 2 , wherein said primer recognizing the 5′ flanking region consist of a nucleotide sequence of 17 to 200 consecutive nucleotides selected from the nucleotide sequence of SEQ ID No 1 from nucleotide 1 to nucleotide 209 or said primer recognizing the 3′ flanking region of A2704-12 consist of a nucleotide sequence of 17 to 200 consecutive nucleotides selected from the nucleotide sequence of the complement of SEQ ID No 2 from nucleotide 569 to nucleotide 1000 claim 2 , and said primer recognizing a sequence within the foreign DNA consists of 17 to 200 consecutive nucleotides selected from the nucleotide sequence of the complement of SEQ ID No. 1 from nucleotide 210 to nucleotide 720 or the nucleotide sequence of SEQ ID No 2 from nucleotide 569 to nucleotide 1000 ...

Corn Polymorphisms and Methods of Genotyping

Polymorphic corn DNA loci useful for genotyping between at least two varieties of corn. Sequences of the loci are useful for providing the basis for designing primers and probe oligonucleotides for detecting polymorphisms in maize DNA. Polymorphisms are useful for genotyping applications in corn. The polymorphic markers are useful to establish marker/trait associations, e.g. in linkage disequilibrium mapping and association studies, positional cloning and transgenic applications, marker-aided breeding and marker-assisted selection, hybrid prediction and identity by descent studies. The polymorphic markers are also useful in mapping libraries of DNA clones, e.g. for corn QTLs and genes linked to polymorphisms. 1. A library of nucleic acid molecules , said library comprising at least two distinct sets of nucleic acid molecules wherein each of said distinct sets of nucleic acid molecules permits typing of a corresponding-corn genomic DNA polymorphism identified in Table 1 or Table 3.2. The library of claim 1 , wherein said distinct sets of nucleic acid molecules are arrayed on at least one solid support or on at least one microtiter plate.317-. (canceled)18. The library of claim 1 , wherein said corresponding distinct corn genomic DNA polymorphisms identified in Table 3 are selected from the group consisting of SEQ ID NO: 2468 claim 1 , 5407 claim 1 , 287 claim 1 , 574 claim 1 , 3407 claim 1 , 5367 claim 1 , 4566 claim 1 , 2457 claim 1 , 5295 claim 1 , 4548 claim 1 , 5182 claim 1 , 5489 claim 1 , 2714 claim 1 , 2726 claim 1 , 375 claim 1 , 275 claim 1 , 1415 claim 1 , 885 claim 1 , 2067 claim 1 , 4773 claim 1 , 1708 claim 1 , 1479 claim 1 , 3507 claim 1 , 2765 claim 1 , and 1279.1928-. (canceled)29. An isolated nucleic acid molecule for detecting a molecular marker representing a polymorphism in corn DNA claim 1 , wherein said nucleic acid molecule comprises at least 15 nucleotides that include or are immediately adjacent to said polymorphism claim 1 , wherein said ...

Genetic Loci Associated with Fusarium Solani Tolerance in Soybean

The invention relates to methods and compositions for identifying soybean plants that are tolerant, have improved tolerance or are susceptible to infection (the causative agent of sudden death syndrome or SDS). The methods use molecular genetic markers to identify, select and/or construct disease-tolerant plants or identify and counterselect disease-susceptible plants. Soybean plants that display tolerance or improved tolerance to infection that are generated by the methods of the invention are also a feature of the invention. 1Fusarium solani. A method of identifying a first soybean plant or germplasm that displays tolerance , improved tolerance or susceptibility to infection , the method comprising detecting in the first soybean plant or germplasm at least one allele of one or more marker locus that is associated with the tolerance , improved tolerance or susceptibility , wherein the one or more marker locus is selected from the group consisting of:(a) SATT300, SATT591, SATT155, SATT266, SATT282, SATT412, SATT506, S60602-TB, SATT142, SATT181, SATT513, SATT549, SATT660, SATT339 and SATT255;(b) a marker locus closely linked to a marker locus of (a);(c) a marker locus localizing within a chromosome interval flanked by and including SATT300 and SATT155;(d) a marker locus localizing within a chromosome interval flanked by and including SATT282 and SATT506; and(e) a marker locus localizing within a chromosome interval flanked by and including SATT549 and SATT255.2. The method of claim 1 , wherein the closely linked marker locus of (b) displays a genetic recombination frequency of less than about 10% with the marker locus of (a).3. The method of claim 1 , wherein the one or more marker locus associated with tolerance claim 1 , improved tolerance or susceptibility is a plurality of loci selected from the marker loci of (a) and (b).4. The method of claim 1 , wherein the one or more marker locus associated with tolerance claim 1 , improved tolerance or susceptibility is ...

Pongamia Genetic Markers and Method of Use

Primers suitable for nucleic acid sequence amplification of plant genetic markers and a method of genetic analysis of plants are provided. The primers comprise a repeat unit of two or three nucleotides repeated five to ten times together with a three prime extension of two or three nucleotides. Genetic markers amplified by the primers are also provided, from which may be produced further primers for genetic analysis of plants. The primers, genetic markers and methods of genetic analysis may be suitable for selection and breeding of plants having desired traits such as, or relating to, seed size, seed number, seed oil content, seed oil quality, seed flavour and toxicity, disease resistance, water use efficiency, nitrogen use efficiency, precocious flowering, flowering time, tree size, tree shape, growth rate, drought tolerance, salinity tolerance and/or growth in low-nutrient soils. 1Pongamia. A method of producing an isolated nucleic acid suitable for nucleic acid sequence amplification , said method including the steps of: identifying a genomic nucleotide sequence of a plant of the genus according to 5′-(N)(N)-3′ wherein each N is the same or different nucleotide and wherein x=2 , 3 or 4; y=5 , 6 , 7 , 8 , 9 or 10; z=1 , 2 , 3 or 4; and producing an isolated nucleic acid comprising said nucleotide sequence.2Pongamia. An isolated nucleic acid suitable for nucleic acid sequence amplification , said isolated nucleic acid comprising a genomic nucleotide sequence of a plant of the genus according to 5′-(N)(N)-3′ wherein each N is the same or different nucleotide and wherein x=2 , 3 or 4; y=5 , 6 , 7 , 8 , 9 or 10; z=1 , 2 , 3 or 4.3. The method of claim 1 , wherein x=2 or 3.4. The method of claim 1 , wherein y=8.5. The method of claim 1 , wherein z=2 or 3.6. The method of claim 1 , wherein the isolated nucleic acid comprises a nucleotide sequence according to 5′-(N)(N)-3′.7. The method of claim 1 , wherein Nis CA claim 1 , AT claim 1 , CT or GA.8. The method of claim 1 ...

Methods for producing transgenic plants

A method of producing a stably transformed corn plant in a single container is demonstrated. This method allows for the automation of the transformation process and reduces labor, material, and ergonomic costs associated with traditional plant tissue culture systems.

CULTIVAR, METHOD FOR DIFFERENTIATING PLANT CULTIVARS, AND METHOD FOR CAUSING EARLIER MATURING OF RICE INDIVIDUAL

An object of the present invention is to provide a new rice cultivar that matures earlier than the original cultivar, and a method for causing a rice individual to mature earlier. The present invention relates to a rice cultivar Koshihikari kazusa no. 6 having the cultivar registration application number 25587, a progeny individual obtained by crossbreeding two individuals selected from the group consisting of an individual of the aforementioned cultivar and a progeny individual thereof, and a method for causing a rice individual to mature earlier that comprises replacing a region corresponding to a region containing base number 31,720,064 to base number 31,724,043 of the third chromosome of rice cultivar Nipponbare with a chromosome fragment composed of the corresponding region of rice cultivar Koshihikari kazusa no. 6 or rice cultivar Habataki in the third chromosome of the rice individual. 1. A rice cultivar , wherein in a chromosome of rice cultivar Koshihikari ,a region corresponding to a region containing base number 31,689,690 to base number 32,298,686 of the third chromosome of rice cultivar Nipponbare is homo-replaced with a chromosome fragment composed of the corresponding region of rice cultivar Habataki in the third chromosome of the rice individual, and the upstream end of the chromosome fragment is present in a region corresponding to a region containing base number 31,521,443 to base number 31,689,690 of the third chromosome of rice cultivar Nipponbare and the downstream end of the chromosome fragment is present in a region corresponding to a region containing base number 32,298,686 to base number 32,363,156 of the third chromosome of rice cultivar Nipponbare, anda region corresponding to a region containing base number 8,940,503 to base number 9,533,057 of the sixth chromosome of rice cultivar Nipponbare is homo-replaced with a chromosome fragment composed of the corresponding region of rice cultivar Habataki in the sixth chromosome of the rice ...

Methods and Compositions for Selecting an Improved Plant

The invention is directed, in an embodiment, to a method for producing a transgenic plant comprising: providing a substantially homozygous plant line suitable for transformation; selecting a subline of the plant line having reduced heterogeneity; transforming plant materials from the subline with a transgenic construct that confers a desired trait to at least one transformed plant; recovering at least one transgenic event from the transformation step; and selecting a transgenic event exhibiting a desirable level of the desired trait using plants of the subline as control. The invention is also directed to a method for producing a plant having a desired trait. The invention also provides transgenic plants produced according to these methods.

Soybean Event DP-305423-1 And Compositions And Methods For The Identification And/Or Detection Thereor

Compositions and methods related to transgenic high oleic acid/ALS inhibitor-tolerant soybean plants are provided. Specifically, the present invention provides soybean plants having a DP-305423-1 event which imparts a high oleic acid phenotype and tolerance to at least one ALS-inhibiting herbicide. The soybean plant harboring the DP-305423-1 event comprises genomic/transgene junctions having at least the polynucleotide sequence of SEQ ID NO:8, 9, 14, 15, 20, 21, 83 or 84. The characterization of the genomic insertion site of the DP-305423-1 event provides for an enhanced breeding efficiency and enables the use of molecular markers to track the transgene insert in the breeding populations and progeny thereof. Various methods and compositions for the identification, detection, and use of the soybean DP-305423-1 events are provided. 1. An isolated polynucleotide comprising SEQ ID NO:5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 82 , 83 , 84 , 85 , 86 , 87 or 88.2. A soybean plant comprising SEQ ID NO:5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 82 , 83 , 84 , 85 , 86 , 87 or 88.3. A soybean seed comprising SEQ ID NO:5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 82 , 83 , 84 , 85 , 86 , 87 or 88.4. A method for identifying a biological sample comprising:a) contacting said biological sample with a first and a second primer;b) amplifying a polynucleotide comprising any of SEQ ID NO:5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 82, 83, 84, 85, 86, 87 or 88; andc) confirming said biological sample comprises a polynucleotide comprising any of SEQ ID NO:5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 82, 83, 84, 85, 86, 87 or 88.5. The method of claim 4 , further comprising detecting a polynucleotide comprising SEQ ID NO:5 claim 4 , 6 claim 4 , 7 claim ...

OMEGA-9 QUALITY BRASSICA JUNCEA

The invention relates to improved species, including , improved oil and meal from , methods for generation of such improved species, and methods for selection of lines. Further embodiments relate to seeds of comprising an endogenous oil having increased oleic acid content and decreased linolenic acid content relative to presently existing commercial cultivars of , seeds of having traits for increased oleic acid content and decreased linolenic acid content in seed oil stably incorporated therein, and one or more generations of progeny plants produced from said seeds. 1Brassica juncea. An unmodified oil with a fatty acid content comprising at least 70.0% oleic acid by weight and less than 3.0% linolenic acid by weight , wherein the oil comprises a polynucleotide selected from the group consisting of SEQ ID NO:1 , SEQ ID NO:3 , SEQ ID NO:8 , SEQ ID NO:10 , SEQ ID NO:12 , SEQ ID NO:14 , SEQ ID NO:16 , SEQ ID NO:18 , SEQ ID NO:19 , SEQ ID NO:20 , SEQ ID NO:21 , SEQ ID NO:22 , SEQ ID NO:24 , SEQ ID NO:26 , SEQ ID NO:28 , SEQ ID NO:30 , SEQ ID NO:32 , SEQ ID NO:34 , SEQ ID NO:36 , and SEQ ID NO:38.2B. juncea. The unmodified oil of claim 1 , wherein the oil has a fatty acid content comprising 70.0% to 85.0% oleic acid by weight.3B. juncea. The unmodified oil of claim 1 , wherein the oil has a fatty acid content comprising 70.0% to 85.0% oleic acid by weight.4Brassica juncea. An oil extracted from the seeds of a plant that is genetically stabilized for an endogenous fatty acid content comprising at least 70.0% oleic acid by weight and less than 3.0% linolenic acid by weight claim 1 ,wherein the oil comprises a polynucleotide selected from the group consisting of SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, and SEQ ID NO:38.5B. juncea. The seed oil of claim 4 , wherein the oil has a ...

Method for Breeding Hybrid Plants

The present invention relates to a method for breeding hybrid plants, comprising the steps of producing or providing essentially homozygous donor lines from a heterozygous starting population; genetically characterizing each donor line by means of molecular markers to obtain a genetic profile for each line; allowing the plants of the donor lines to intercross to obtain F1 hybrid progeny seed; sowing the F1 hybrid progeny seed while recording the maternal origin for each seed; phenotypically identifying superior F1 hybrid individuals among the progeny; determining the paternity of the superior F1 hybrid individuals for identification of their corresponding pollen donor lines; and crossing the thus identified pollen donor lines with female lines to obtain the hybrid plants. 1. A method for breeding hybrid plants , comprising:a) producing essentially homozygous donor lines from a heterozygous starting population;b) genetically characterizing each donor line by means of molecular markers to obtain a unique genetic profile for each line;c) allowing the plants of the donor lines to intercross to obtain F1 hybrid progeny seed;d) sowing the F1 hybrid progeny seed while recording the maternal origin for each seed;e) phenotypically identifying superior F1 hybrid individuals among the progeny;f) determining the paternity of the superior F1 hybrid individuals for identification of their corresponding pollen donor lines; andg) crossing the thus identified pollen donor lines with female donor lines to obtain the hybrid plants.2. The method of claim 1 , wherein producing essentially homozygous donor lines in step a) is achieved by inbreeding or production of double haploids.3. The method of claim 1 , wherein intercrossing of the lines is achieved by means of hand pollination with a pollen mixture or by a polycross method using natural means claim 1 , such as wind or insects.4. The method of claim 1 , wherein in each plant that is intercrossed at least one flower is protected from ...

IMPROVED VARIETY OF SORGHUM

An object of the present invention is to provide a variety that has higher biomass, and contains a high proportion of sugar raw material (i.e., a higher sugar content). The present invention provides an improved plant derived from variety 74LH3213, wherein chromosome 6 DNA is partially or entirely substituted by a DNA region comprising a high-sugar-content locus qBRX-6 derived from variety SIL-05; and an improved Tentaka variety obtained by crossing the improved 74LH3213 plant with variety MS79A. 1sorghumsorghum. An improved 74LH3213 plant , which is an improved plant of variety 74LH3213 , wherein chromosome 6 DNA is partially or entirely substituted by a DNA region comprising a high-sugar-content locus qBRX-6 , which is derived from variety SIL-05 , and the DNA region is a DNA region ranging from(A) DNA marker SB3412 to(J) DNA marker SB3762.2. (canceled)3. The improved 74LH3213 plant according to claim 1 , wherein the substitution is present on both of a pair of chromosomes 6.4. A seed of the improved 74LH3213 plant according to .5. A method for producing the improved 74LH3213 plant according to claim 1 , comprising the following steps (a) to (d):{'i': sorghum', 'sorghum, '(a) crossing variety 74LH3213 with variety SIL-05 to obtain an F1 individual;'}{'i': 'sorghum', '(b) backcrossing the F1 individual to variety 74LH3213 to obtain a BCH individual (BC stands for backcrossing; BC1 indicates that the number of backcrossings is 1);'}(c) repeating backcrossing several times, as necessary; and{'i': 'sorghum', '(d) confirming that the chromosome 6 DNA in an individual obtained by at least one step selected from the group consisting of steps (a) to (c) is partially or entirely substituted by a DNA region comprising a high-sugar-content locus qBRX-6, which is derived from variety SIL-05.'}6sorghumsorghumsorghum. An improved Tentaka plant claim 1 , which is an improved plant of variety Tentaka claim 1 , the improved Tentaka plant being obtained by crossing the improved ...

BRASSICA OLERACEA PLANTS WITH DOWNY MILDEW RESISTANT CURDS OR HEADS

The present disclosure provides plants having curds or heads exhibiting increased resistance to downy mildew. Such plants may comprise novel introgressed genomic regions associated with disease resistance from MYCOCLP. In certain aspects, compositions, including novel polymorphic markers and methods for producing, breeding, identifying, and selecting plants or germplasm with a disease resistance phenotype are provided. 1Brassica oleracea. A plant of a cultivated variety , the plant comprising a first introgressed allele or a second introgressed allele on chromosome 3 , wherein said first introgressed allele or said second introgressed allele confers to a curd or head of said plant increased resistance to downy mildew compared to a plant not comprising said first introgressed allele or said second introgressed allele.2Brassica oleracea. The plant of claim 1 , wherein said plant comprises a first introgressed allele and a second introgressed allele on chromosome 3 claim 1 , wherein said first introgressed allele and said second introgressed allele confers to a curd or head of said plant increased resistance to downy mildew compared to a plant not comprising said alleles.3Brassica oleracea. The plant of claim 1 , wherein a sample of seed comprising said first introgressed allele and said second introgressed allele was deposited under ATCC Accession Number PTA-124338.4Brassica oleracea. The plant of claim 1 , wherein said first introgressed allele is flanked in the genome of said plant by marker locus M19 (SEQ ID NO:2) and marker locus M20 (SEQ ID NO:3) on chromosome 3 or wherein said second introgressed allele is flanked in the genome of said plant by marker locus M31 (SEQ ID NO:4) and marker locus M44 (SEQ ID NO:16) on chromosome 3.5. (canceled)6Brassica oleraceaBrassica oleracea. The plant of claim 1 , wherein said plant is a broccoli claim 1 , cauliflower claim 1 , sprouting broccoli claim 1 , Brussels sprouts claim 1 , white cabbage claim 1 , red cabbage claim 1 , ...

ACETYL CO-ENZYME A CARBOXYLASE HERBICIDE RESISTANT PLANTS

The present invention provides for compositions and methods for producing crop plants that are resistant to herbicides. In particular, the present invention provides for wheat plants, plant tissues and plant seeds that contain altered acetyl-CoA carboxylase (ACCase) genes and proteins that are resistant to inhibition by herbicides that normally inhibit the activity of the ACCase protein. 154-. (canceled)55. A method for identifying a plant that is resistant to acetyl-CoA carboxylase inhibiting herbicides comprising:a) obtaining a nucleic acid sample from a plant; andb) assaying said nucleic acid sample for the presence of a nucleic acid sequence which encodes an acetyl-CoA carboxylase protein that includes one or more mutations that confer resistance to an acetyl-CoA carboxylase inhibiting herbicide, or assaying said nucleic acid sample for a molecular marker in linkage disequilibrium with said one or more mutations.56. The method of claim 55 , wherein said one or more mutations comprise a mutation at a position corresponding to position 2004 of the black grass reference sequence claim 55 , SEQ ID NOS: 14 or 16.57. The method of claim 55 , wherein said one or more mutations comprise an amino acid substitution Ala2004Val when referenced to black grass claim 55 , SEQ ID NOS: 14 or 16.58. The method of claim 55 , wherein the assaying comprises PCR or DNA hybridization.59. The method of claim 55 , wherein the molecular marker is within 10 cM of said one or more mutations.60. The method of claim 55 , wherein the plant is a monocot cereal plant.61. The method of claim 60 , wherein the monocot cereal plant is selected from wheat claim 60 , barely claim 60 , triticale claim 60 , rice claim 60 , or maize.62. The method of claim 55 , wherein said acetyl-CoA carboxylase inhibiting herbicides are selected from aryloxyphenoxypropionates claim 55 , cyclohexanediones claim 55 , and phenylpyrazolin (DENs).63. A method for identifying a wheat plant that is resistant to acetyl-CoA ...

MAIZE EVENT DP-004114-3 AND METHODS FOR DETECTION THEREOF

The invention provides DNA compositions that relate to transgenic insect resistant maize plants. Also provided are assays for detecting the presence of the maize DP-004114-3 event based on the DNA sequence of the recombinant construct inserted into the maize genome and the DNA sequences flanking the insertion site. Kits and conditions useful in conducting the assays are provided. 1. (canceled)2. (canceled)3. (canceled)4. (canceled)5. A corn plant comprising the genotype of the corn event DP-004114-3 , wherein said genotype comprises the nucleotide sequence set forth in SEQ ID NO: 27 , and SEQ ID NO: 28.6. The corn plant of claim 5 , wherein said genotype comprises the nucleotide sequence set forth in SEQ ID NO: 27.7. The corn plant of claim 5 , wherein said genotype comprises the nucleotide sequence set forth in SEQ ID NO: 28.8. A corn event DP-004114-3 claim 5 , wherein a representative sample of seed of said corn event has been deposited with American Type Culture Collection (ATCC) with Accession No. PTA-11506.9. Plant parts of the corn event of .10. Seed comprising corn event DP-004114-3 claim 8 , wherein said seed comprises a DNA molecule selected from the group consisting of SEQ ID NO: 27 and SEQ ID NO: 28 claim 8 , wherein a representative sample of corn event DP-004114-3 seed of has been deposited with American Type Culture Collection (ATCC) with Accession No. PTA-11506.11. A corn plant claim 10 , or part thereof claim 10 , grown from the seed of .12. A transgenic seed produced from the corn plant of comprising event DP-004114-3.13. A transgenic corn plant claim 12 , or part thereof claim 12 , grown from the seed of .14. (canceled)15. (canceled)16. A biological sample derived from the corn event DP-004114-3 of .17. The biological sample of claim 16 , wherein said biological sample comprise plant claim 16 , tissue claim 16 , or seed of transgenic corn event DP-004114-3.18. (canceled)19. The biological sample of claim 17 , wherein said biological sample is ...

IDENTIFICATION AND USE OF KRP MUTANTS IN WHEAT

The invention provides a wheat cell, part, tissue culture or whole plant comprising at least one disrupted KRP gene of the present invention. The present invention also provides methods of increasing weight, size, and/or number of one or more organs, and/or yield of a wheat plant by utilizing the disrupted KRP genes of the present invention. Furthermore, methods of breeding wheat plants to produce new wheat plants having increased weight, size, and/or number of one or more organs, and/or yield are provided. The present invention provides isolated Kinase Inhibitor Protein (KIP) Related Protein (KRP) polynucleotide sequences and isolated KRP polypeptide sequences and methods of their use. 1Triticum. A method of increasing organ weight , organ size , organ number and/or yield of a wheat plant comprising disrupting one or more KRP2 genes in the plant.2. The method of claim 1 , wherein the KRP in a tetraploid wheat plant is KRP2A or KRP2B claim 1 , and wherein the KRP in a hexaploid wheat is TaKRP2A claim 1 , TaKRP2B claim 1 , or TaKRP2D.3. The method of claim 1 , wherein the KRP gene function is disrupted by nucleotide substitution claim 1 , deletion claim 1 , insertion claim 1 , T-DNA claim 1 , transposon claim 1 , or homologous recombination.4. The method of claim 1 , wherein the wheat plant comprises one or more mutations selected from KRP2A-2241 claim 1 , KRP2B-3004 claim 1 , KRP2D-0905 claim 1 , and combinations thereof.5. A method of producing a wheat plant with increased organ size claim 1 , organ weight claim 1 , organ number and/or yield compared to a wild type plant claim 1 , comprising:{'i': 'Triticum', 'i) making a cross between a first wheat plant and a second wheat plant to produce an F1 plant, wherein the first wheat plant comprises one or more disrupted KRP2 genes.'}6. The method of claim 5 , wherein the method further comprises:ii) backcrossing the F1 plant to the first or the second wheat plant; and{'i': 'Triticum', 'iii) repeating the backcrossing ...

PARTHENOCARPY REGULATION GENE AND USE THEREOF

In order to identify a novel gene responsible for parthenocarpy and to provide use of the gene, the parthenocarpy regulatory gene of the present invention includes a polynucleotide (1) that encodes an amino acid sequence represented by SEQ ID NO: 1, (2) that encodes an amino acid sequence (i) having a sequence identity of 75% or higher relative to the amino acid sequence represented by SEQ ID NO: 1, (3) that encodes an amino acid sequence in which 1 to 98 amino acids are substituted, etc. in the amino acid sequence represented by SEQ ID NO: 1, or (4) that is hybridized with a polynucleotide, which has a sequence complementary to the polynucleotide for encoding the amino acid sequence represented by SEQ ID NO: 1 under a stringent condition. 1. A method for evaluating parthenocarpy of a plant , said method comprising the step of:checking whether or not expression of a parthenocarpy regulatory gene, which includes a polynucleotide recited in any of (1) through (4) below, is inhibited in the plant; orchecking whether or not a function of a polypeptide, which is encoded by the parthenocarpy regulatory gene, is inhibited in the plant.(1) A polynucleotide that encodes a polypeptide having an amino acid sequence represented by SEQ ID NO: 1,(2) a polynucleotide that encodes a polypeptide (i) having a sequence identity of 75% or higher relative to the amino acid sequence represented by SEQ ID NO: 1 and (ii) having a parthenocarpy regulatory activity,(3) a polynucleotide that encodes a polypeptide (i) having an amino acid sequence in which 1 to 98 amino acids are substituted in, deleted from, inserted into, and/or added to the amino acid sequence represented by SEQ ID NO: 1 and (ii) having a parthenocarpy regulatory activity, and(4) a polynucleotide that (i) is hybridized with a polynucleotide, which has a sequence complementary to the polynucleotide recited in the above (1), under a stringent condition and (ii) encodes a polypeptide having a parthenocarpy regulatory activity. ...

Maize event HCEM485, compositions and methods for detecting and use thereof

Maize event HCEM485 is provided, in which plants comprising the event are tolerant to exposure to a glyphosate herbicide. Maize genomic polynucleotides flanking the insert DNA providing glyphosate tolerance are provided. The plant or part thereof having the event comprises a junction region of the insert DNA and maize plant genomic sequences. Methods and primers and probes to detect the presence of the event are provided, as well as kits which employ such primers and probes. 1. A method of identifying event HCEM485 in a biological sample , said method comprising detecting a DNA molecule comprising at least one HCEM485 junction sequence in a biological sample with a specific probe or at least one specific primer which binds or amplifies a DNA molecule comprising said at least one HCEM485 junction sequence , reference seed comprising said HCEM485 event having been deposited under ATCC accession number PTA-12014.2. The method of claim 1 , wherein said DNA molecule detected comprises a junction sequence that is within SEQ ID NO: 4 or the full complement of SEQ ID NO: 4.3. The method of claim 1 , wherein said DNA molecule comprises a junction sequence is selected from the group consisting of 4 claim 1 , 12 claim 1 , 13 claim 1 , 14 claim 1 , 15 claim 1 , 16 and 17.4. The method of claim 1 , wherein said DNA molecule is detected by amplification of a nucleic acid molecule using a primer selected from the group consisting of SEQ ID NO: 5 claim 1 , 6 claim 1 , 10 claim 1 , 11 claim 1 , 18 and 19 or the full length complement thereof.5. The method of claim 1 , wherein said DNA molecule is detected by amplification using a primer pair comprising SEQ ID NO: 5 and 10 or SEQ ID NO: 18 and 19.6. The method of claim 1 , wherein said DNA molecule is detected by a probe selected from the group consisting of SEQ ID NO: 21 and 22.7. A kit for identifying the presence of event HCEM485 in a biological sample claim 1 , said kit comprising a specific probe or at least one specific primer ...

ASSAYS FOR FUNGAL INFECTION

Methods and kits are described for testing for the presence or absence of any fungus in a sample. Examples of fungi that can be detected include, but are not limited to, those belonging to the genera and . The methods include obtaining a sample suspected of containing fungal nucleic acid, including at least one universal region of fungal nucleic acid, and testing for the presence or absence in the sample of the at least one universal region of fungal nucleic acid. Samples may be biological or non-biological. 129.-. (canceled)30Candida. A method for detecting the presence or absence of any species of a fungus belonging to the genus in a sample , comprising:{'i': 'Candida', 'i. obtaining a sample suspected of containing fungal nucleic acid from the genus , and'}{'i': Candida', 'Aspergillus', 'Pneumocystis, 'ii. testing for the presence or absence in the sample of an identifying region of fungal nucleic acid comprising SEQ ID NO: 5, the complement or transcript thereof, or a sequence having 80% or more sequence identity with SEQ ID NO: 5, the complement or transcript thereof, said identifying region being present in species of the genus but not those of the genus of or , and'}{'i': Candida', 'Candida, 'wherein the presence of said identifying region of fungal nucleic acid indicates the presence of any species of a fungus belonging to the genus in the sample, and the absence of said identifying region of fungal nucleic acid in the sample indicates the absence of any species of a fungus belonging to the genus in the sample.'}31. (canceled)32. The method of in which the testing step includes contacting the sample with a probe including SEQ ID NO: 8.33. The method of further comprising amplifying the identifying region of fungal nucleic acid by contacting the sample with a pair of primers including SEQ ID NO: 6 and SEQ ID NO: 7.3454.-. (canceled)55. The method of in which the amplifying step is carried out in the presence of one or more internal PCR amplification controls. ...

TOBACCO PLANT AND PRODUCTION METHOD THEREOF

Provided are (i) a tobacco plant which is suitable for cultivation for harvesting leaf tobaccos, (ii) a method of obtaining the tobacco plant, (iii) a harvest from the tobacco plant, and (iv) a processed product of the harvest. The present invention encompasses (i) a tobacco plant into which a mutation for suppressing the development of primary axillary buds is introduced, (ii) a method of obtaining the tobacco plant, (iii) a harvest from the tobacco plant, and (iv) a processed product of the harvest. 1. A tobacco plant in which a mutation causing functional suppression of at least two genes of the following genes (1) through (3) is introduced into a genome:(1) at least one of: a gene containing, as a coding region, a polynucleotide (a) or a polynucleotide (b); and a gene containing, as a coding region, a polynucleotide (c) or a polynucleotide (d);(2) at least one of: a gene containing, as a coding region, a polynucleotide (e) or a polynucleotide (f); and a gene containing, as a coding region, a polynucleotide (g) or a polynucleotide (h); and(3) at least one of: a gene containing, as a coding region, a polynucleotide (i) or a polynucleotide (j); and a gene containing, as a coding region, a polynucleotide (k) or a polynucleotide (l),the functional suppression suppressing development of primary axillary buds,the polynucleotide (a) being a polynucleotide encoding a polypeptide having a sequence identity of 90% or higher with an amino acid sequence represented by SEQ ID NO: 1,the polynucleotide (b) being a polynucleotide complementary to a polynucleotide which hybridizes with the polynucleotide (a) under stringent conditions,the polynucleotide (c) being a polynucleotide encoding a polypeptide having a sequence identity of 90% or higher with an amino acid sequence represented by SEQ ID NO: 2,the polynucleotide (d) being a polynucleotide complementary to a polynucleotide which hybridizes with the polynucleotide (c) under stringent conditions,the polynucleotide (e) being a ...

ABIOTIC STRESS TOLERANT PLANTS AND METHODS OF USE

Isolated polynucleotides and polypeptides, and recombinant DNA constructs are useful for conferring improved drought tolerance and/or nitrogen stress tolerance. Compositions (such as plants or seeds) comprise these recombinant DNA constructs; and methods utilize these recombinant DNA constructs. The recombinant DNA constructs comprise a polynucleotide operably linked to a promoter that is functional in a plant, wherein said polynucleotides encode drought tolerance polypeptide FTR1. 1. (canceled)2. (canceled)3. (canceled)4. (canceled)5. A modified plant or seed comprising an increased expression of at least one polynucleotide encoding a FTR1 polypeptide compared to a control plant or seed , wherein the polynucleotide comprises: (a) a polynucleotide with a nucleotide sequence of at least 85% identity to SEQ ID NO: 1; (b) a polynucleotide with a nucleotide sequence of at least 85% identity to SEQ ID NO: 2; (c) a polynucleotide encoding a polypeptide comprising an amino acid sequence of at least 90% identity to SEQ ID NO: 3 , wherein said plant exhibits improved drought tolerance and/or improved nitrogen stress tolerance and/or increased yield when compared to the control plant.6. The plant of claim 5 , wherein the plant comprises in its genome a recombinant DNA construct comprising a polynucleotide encoding a polypeptide comprising an amino acid sequence of at least 90% identity to SEQ ID NO: 3 operably linked to at least one regulatory element.7. The plant of claim 5 , wherein the plant comprises in its genome a targeted genetic modification at a genomic locus encoding the polypeptide claim 5 , wherein the targeted genetic modification increases the expression and/or activity of the endogenous polypeptide.8. The plant of claim 5 , wherein said plant is selected from the group consisting of rice claim 5 , maize claim 5 , soybean claim 5 , sunflower claim 5 , sorghum claim 5 , canola claim 5 , wheat claim 5 , alfalfa claim 5 , cotton claim 5 , barley claim 5 , millet ...

SMALL AUXIN UPREGULATED (SAUR) GENE FOR THE IMPROVEMENT OF ROOT SYSTEM ARCHITECTURE, WATERLOGGING TOLERANCE, DROUGHT RESISTANCE AND YIELD IN PLANTS AND METHODS OF USES

Disclosed are modified plants and methods for producing modified plants having a modified 5′-untranslated region of small auxin upregulated protein flooding tolerance (SAUR_FT) gene. Modified plants disclosed herein have at least one of an increased root system architecture, an increased waterlogging tolerance, an increased drought tolerance, and combinations thereof. 1. A modified plant comprising at least one of a modified 5′-untranslated region of small auxin upregulated protein flooding tolerance (SAUR_FT) gene , a modified 5′-untranslated region of SAUR_FT gene homolog , and a SAUR_FT gene ortholog.2. The modified plant of claim 1 , wherein the modified 5′-untranslated region of the SAUR_FT gene comprises a poly-A insertion.3. The modified plant of claim 2 , wherein the poly-A insertion is an 11 base pair insertion.4. The modified plant of claim 1 , comprising at least one trait of increased yield claim 1 , increased root growth claim 1 , increased waterlogging tolerance claim 1 , and increased drought tolerance as compared to a plant not having the modified 5′-untranslated region of small auxin upregulated protein flooding tolerance (SAUR_FT) gene claim 1 , the modified 5′-untranslated region of SAUR_FT gene homolog claim 1 , and the SAUR_FT gene ortholog.5. The modified plant of claim 1 , wherein the plant is a crop plant.6. The modified plant of claim 5 , wherein the crop plant is chosen from soybean claim 5 , corn claim 5 , cotton claim 5 , medicago claim 5 , and canola.7. The modified plant of claim 1 , comprising about 1.5-fold to about 2-fold more adventitious/aerial roots than a plant not comprising the modified 5′-untranslated region of the SAUR_FT gene.8. The modified plant of claim 1 , wherein the plant comprises at least one of an increased total root length and an increased root tip number as compared to a plant not having the modified 5′-untranslated region of the SAUR_FT gene.9. A seed claim 1 , a plant cell claim 1 , or a progeny of the plant ...

Methods for Sequence-Directed Molecular Breeding

The present invention provides breeding methods and compositions to enhance the germplasm of a plant by the use of direct nucleic acid sequence information. The methods describe the identification and accumulation of preferred nucleic acid sequences in the germplasm of a breeding population of plants. 14-. (canceled)5. A method of identifying a phenotypic trait of interest in a plant , the method comprising:providing a plurality of plant DNA samples, wherein at least one of the plant DNA samples comprises a polymorphism associated with a phenotypic trait of interest;amplifying one or more selected loci in the genome of two or more of the plant DNA samples, wherein each of said selected loci is amplified with at least one specific primer and tagged with at least one DNA tag;combining at least two of the amplified DNA samples to create a pool of amplified DNA samples;sequencing the pool of amplified DNA samples;comparing the sequence information from the amplified DNA samples to a consensus sequence to identify the presence or absence of the polymorphism, wherein the individual DNA samples are identified by the DNA tags; andselecting one or more plants based on the presence or absence of the polymorphism in the plant DNA sample.6. The method as set forth in claim 5 , wherein the plant is selected from the group consisting of a forage crop claim 5 , oilseed crop claim 5 , grain crop claim 5 , fruit crop claim 5 , ornamental plants claim 5 , vegetable crop claim 5 , fiber crop claim 5 , spice crop claim 5 , nut crop claim 5 , turf crop claim 5 , sugar crop claim 5 , beverage crop claim 5 , tuber crop claim 5 , root crop claim 5 , and forest crop.7. The method as set forth in claim 5 , wherein the polymorphism is indicative of an economically important trait in a plant and wherein said economically important trait is selected from the group consisting of herbicide tolerance claim 5 , disease resistance claim 5 , insect or pest resistance claim 5 , altered fatty acid ...

METHOD FOR PLANT IMPROVEMENT

The invention relates to the field of plant improvement, in particular of the improvement of yield for cereal plants, by down-regulation of the gene coding for Arf2. 1Brachypodium. A cereal comprising at least one cell which presents inhibition of Arf2 expression , by inhibition of the arf2 gene coding for the Arf2 protein , wherein alleles of said Arf2 protein are depicted by SEQ ID NO 1 (for maize) , SEQ ID NO 3 (for rice) , SEQ ID NO 4 or SEQ ID NO 27 (for barley) , SEQ ID NO 5 (for sorghum) , SEQ ID NO 6 (for ) and SEQ ID NO 7 to SEQ ID NO 9 (corresponding to the Arf2 proteins for the three genomes of wheat).2. The cereal of claim 1 , which is maize claim 1 , and wherein an allele of said Arf2 protein exhibit SEQ ID NO 1.3. The cereal of claim 1 , wherein said Arf2-coding gene is inhibited in specific tissue(s) of said cereal and is not inhibited in other tissues of said cereal.4. The cereal of claim 1 , wherein said inhibition of said Arf2-coding gene is a partial inhibition.5. The cereal of claim 1 , wherein said inhibition of said Arf2-coding gene is a total (full) inhibition.6. The cereal of claim 1 , wherein inhibition of the Arf2 expression is due to a mutation of the arf2 gene through insertion of a transposable element or of a T-DNA or following physical mutagenesis.7. The cereal of claim 1 , wherein inhibition of the Arf2 expression is due to the presence claim 1 , in the genome of said cereal of an antisense claim 1 , or overexpression (leading to co-suppression) claim 1 , or RNAi construct.8. The cereal of claim 7 , wherein inhibition of the Arf2 expression is due to the presence claim 7 , in the genome of said cereal claim 7 , of a RNAi construct claim 7 , wherein said construct is under the control of a constitutive promoter.9. The cereal of claim 8 , wherein said promoter is pCSVMV (represented by SEQ ID NO 17).10. The cereal of claim 4 , wherein said construct comprises a RNAi construct claim 4 , the sequence of which is depicted by SEQ ID NO 18. ...

METHODS AND DEVICES FOR CREATING DOUBLED HAPLOID EMBRYOS USING OIL MATRICES

Methods for preserving viability of plant tissues such as plant embryos are provided herein. Also included are methods for storing genomic DNA and/or molecular marker assay materials in an oil bilayer as part of a high-throughput molecular characterization system. Moreover, plant embryos may be treated while in an oil matrix. The treatment may include chromosome doubling, -mediated transformation, or herbicide selection as part of an embryo rescue process. 1. A method of treating one or more plant haploid embryos with a chromosome doubling agent , said method comprising:a. placing chromosome doubling media between two oils, wherein one of the oils is more dense than water and the other is less dense than water;b. placing one or more plant haploid embryos in the chromosome doubling media;c. selecting one or more plant doubled haploid embryos; andd. transferring the selected plant doubled haploid embryos to media for germination or storage.2. (canceled)3. The method of claim 1 , wherein between steps (c) and (d) cellular material is collected from the one or more plant doubled haploid embryos; DNA is obtained from the cellular material; genotypic information is obtained from the one or more plant doubled haploid embryos; and the plant doubled haploid embryos are selected based on the genotypic information.4. (canceled)5. (canceled)6. (canceled)7. (canceled)8. (canceled)9. (canceled)10. (canceled)11. (canceled)12. (canceled)13. (canceled)14. (canceled)15. (canceled)16. (canceled)17. (canceled)18. (canceled)19. (canceled) This application claims the benefit of U.S. National application Ser. No. 14/473183, filed Aug. 29, 2014, and of U.S. National application Ser. No. 14/473114, filed Aug. 29, 2014, which are incorporated by reference in their entirety.Present conventional seed analysis methods used in genetic, biochemical, or phenotypic analysis, require at least a part of the seed to be removed and processed. In removing some seed tissue, various objectives may need to ...

RESISTANCE TO GEMINIVIRUSES IN WATERMELONS

The present invention is directed to watermelon plant and seed, namely of , which are resistant to geminiviruses, especially to begomoviruses including WmCSV, comprising in their genome introgressed sequences from conferring resistance to said viruses, when present homozygously. The introgressed sequences are preferably characterized by defined alleles of SNPs on chromosome 6. The introgressed sequences can be chosen from those present in the genome of a plant of —WMCSVR accession number NCIMB 42197. The invention is also directed to parts of these resistant plants, as well as progeny, to the use of these plants for introgressing the resistance in another genetic background, as well as to different methods for obtaining resistant watermelon plants or seeds. 1Citrullus lanatusCitrullus colocynthis. A seed having in its genome introgressed sequences from conferring resistance to geminiviruses only when present homozygously , wherein said introgressed sequences are located on homologous chromosome 6 , within the chromosomal region delimited by telomere and SNP#10 (SEQ ID No:10) and comprising SNP#1 (SEQ ID No:1).2C. lanatusC. colocynthisCitrullus lanatus. The seed according to claim 1 , wherein said introgressed sequences conferring the resistance claim 1 , are chosen from the introgressed sequences from present in the genome of a seed —WMCSVR claim 1 , deposited at NCIMB accession number NCIMB-42197 claim 1 , on chromosome 6.3C. lanatus. The seed according to claim 1 , wherein said introgressed sequences are located at one or more of the following loci:locus encompassing SNP#3 (SEQ ID No:3); and/orlocus encompassing SNP#9 (SEQ ID No:9).4C. lanatus. The seed according to claim 1 , wherein said introgressed sequences are in linkage disequilibrium with allele C of SNP#3 (SEQ ID No:3) and/or with allele C of SNP#9 (SEQ ID No:9) claim 1 , preferably with a positive linkage disequilibrium.5C. lanatus. The seed according to claim 1 , wherein said introgressed sequences are ...

CEREAL SEED STARCH SYNTHASE II ALLELES AND THEIR USES

The present invention provides compositions and methods of altering/improving wheat phenotypes. Furthermore, methods of breeding wheat and/or other closely related species to produce plants having altered or improved phenotypes are provided. 2. The high amylose grain of wherein the proportion of starch amylose of said grain is at least 25% higher compared to the starch amylose of a control grain from an appropriate wild type wheat check variety grown under similar field conditions.3. The high amylose grain of wherein said grain has at least a 10% higher seed weight than the grain from an appropriate null wheat check variety grown under similar field conditions.4. The high amylose grain of claim 1 , wherein the wheat plant is a hexaploid wheat comprising a first claim 1 , second claim 1 , and third genome.5. The high amylose grain of claim 4 , wherein the hexaploid wheat comprises homozygous SSII null alleles in the first and second genomes claim 4 , and the SSII leaky allele in the third genome.6. The high amylose grain of claim 5 , wherein the SSII leaky allele is homozygous in the third genome.7. The high amylose grain of claim 5 , wherein the SSII leaky allele comprises a missense mutation encoding for a protein with an SSII-D-E656K and/or SSII-D-A421V amino acid substitution.8. The high amylose grain of claim 5 , wherein the SSII leaky allele encodes the protein of SEQ ID No. 40 or SEQ ID No. 44.9. The high amylose grain of claim 1 , wherein the wheat plant is a tetraploid wheat comprising a first and second genome.10. The high amylose grain of claim 9 , wherein the tetraploid wheat comprises homozygous SSII null alleles in the first genome claim 9 , and the SSII leaky allele in the second genome.11. The high amylose grain of claim 10 , wherein the SSII leaky allele is homozygous in the second genome.12. The high amylose grain of claim 9 , wherein the SSII leaky allele comprises a missense mutation encoding for a protein with an SSII-B-P333L and/or SSII-B-P333S ...

METHODS AND KITS FOR CLASSIFYING CANNABINOID PRODUCTION IN CANNABIS PLANTS

The present disclosure provides methods and kits for characterizing plants. Methods and kits of the present disclosure include detection/amplification of one or more enzymes involved in the production of cannabinoids, such as, for example, tetrahydrocannabinolic acid (THCA) synthase and/or cannabidiolic acid (CBDA) synthase. 134-. (canceled)35Cannabis. A method of detecting whether a tetrahydrocannabinolic acid (THCA) synthase gene sequence is present in a plant , comprising:{'i': 'Cannabis', 'obtaining a sample from the plant that contains nucleic acids;'}contacting the nucleic acids with primers specific for the THCA synthase gene sequence;amplifying the THCA synthase gene sequence when present among the nucleic acids; anddetecting amplicons upon amplification of the THCA synthase gene sequence, wherein:the primers specific for the THCA synthase gene sequence include a primer specific for a promoter sequence of the THCA synthase gene sequence; andamplification of the THCA synthase gene sequence indicates that the THCA synthase gene sequence is at least 2000 nucleotides long.36. The method of claim 35 , wherein the primer specific for the promoter sequence of the THCA synthase gene sequence binds to the promoter sequence at a location that is 200-1000 nucleotides upstream of a THCA synthase open reading frame.37. The method of claim 35 , wherein the THCA synthase gene sequence is between 2100-2200 nucleotides long.38Cannabis. A method of detecting whether a tetrahydrocannabinolic acid (THCA) synthase gene sequence is present in a plant claim 35 , comprising:{'i': 'Cannabis', 'obtaining a sample from the plant that contains nucleic acids;'}contacting the nucleic acids with primers specific for the THCA synthase gene sequence;amplifying the THCA synthase gene sequence when present among the nucleic acids; anddetecting amplicons upon amplification of the THCA synthase gene sequence, wherein:the primers specific for the THCA synthase gene sequence include a primer ...

SOYBEAN VARIETY 01064567

The invention relates to the soybean variety designated 01064567. Provided by the invention are the seeds, plants and derivatives of the soybean variety 01064567. Also provided by the invention are tissue cultures of the soybean variety 01064567 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety 01064567 with itself or another soybean variety and plants produced by such methods. 1. A plant of soybean variety 01064567 , wherein representative seed of said soybean variety have been deposited under ATCC Accession No. PTA-124753.2. A plant part of the plant of claim 1 , wherein the plant part comprises at least one cell of said plant.3. A seed of soybean variety 01064567 claim 1 , wherein representative seed of said soybean variety have been deposited under ATCC Accession No. PTA-124753.4. A method of producing soybean seed claim 1 , the method comprising crossing the plant of with itself or a second soybean plant to produce said soybean seed.5. The method of claim 4 , the method further comprising crossing the plant of soybean variety 01064567 with a second claim 4 , nonisogenic soybean plant to produce said soybean seed.6. An Fsoybean seed produced by the method of .7. A soybean plant produced by growing the Fsoybean seed of .8. A composition comprising the seed of comprised in plant seed growth media.9. The composition of claim 8 , wherein the plant seed growth media is soil or a synthetic cultivation medium.10. A plant of soybean variety 01064567 further comprising a single locus conversion claim 8 , wherein said plant otherwise comprises all of the morphological and physiological characteristics of said soybean variety when grown under the same environmental conditions claim 8 , and wherein representative seed of said soybean variety have been deposited under ATCC Accession No. PTA-124753.11. The plant of claim 10 , wherein the single locus conversion comprises a ...

METHOD FOR IMPROVING PLANT VARIETY

The present disclosure relates to a method for improving a plant variety. The present disclosure relates to a method of plant breeding, the method comprising the following steps: 1. A method of plant breeding , the method comprising the following steps:1) Selecting a background variety and a donor variety,2) Comparing the background variety and the donor variety to identify a module or locus to be improved,3) Crossing the background variety and the donor variety to obtain a hybrid progeny, backcrossing the hybrid progeny to the background variety to obtain a backcross progeny, and constructing a genetic population using the backcross progeny,4) Selecting, using molecular markers or a sequencing method, a backcross progeny having chromosomal regions derived from the background variety except for the module or locus to be improved, the molecular markers comprising genome molecular markers and module or locus molecular markers designed according to the selected module or locus,5) Self-crossing the selected backcross progeny to obtain an improved plant variety.2. The method of claim 1 , wherein step 2) comprises genome sequencing to compare sequences of the module or locus to be improved claim 1 , such as sequences of an allele claim 1 , or performing QTL analysis to identity the module or locus to be improved claim 1 , wherein the module to be improved can be adjusted to a size of claim 1 , for example claim 1 , about 50 kb to 5000 kb.3. The method of claim 1 , wherein the molecular markers comprise RFLP claim 1 , RAPD claim 1 , SSR claim 1 , AFLP and SNP; preferably the molecular markers comprise SNP markers; the module or locus molecular markers comprise at least 3 molecular markers claim 1 , for example 3 claim 1 , 4 claim 1 , 5 claim 1 , 6 claim 1 , 7 claim 1 , 8 claim 1 , 9 claim 1 , 10 or more molecular markers claim 1 , designed at upstream of the module or locus claim 1 , within the module or locus claim 1 , and downstream of the module or locus claim 1 , ...

NOVEL HERBICIDE RESISTANCE GENES

The subject invention provides novel plants that are not only resistant to 2,4-D, but also to pyridyloxyacetate herbicides. Heretofore, there was no expectation or suggestion that a plant with both of these advantageous properties could be produced by the introduction of a single gene. The subject invention also includes plants that produce one or more enzymes of the subject invention “stacked” together with one or more other herbicide resistance genes. The subject invention enables novel combinations of herbicides to be used in new ways. Furthermore, the subject invention provides novel methods of preventing the development of, and controlling, strains of weeds that are resistant to one or more herbicides such as glyphosate. The preferred enzyme and gene for use according to the subject invention are referred to herein as AAD-12 (AryloxyAlkanoate Dioxygenase). This highly novel discovery is the basis of significant herbicide tolerant crop trait and selectable marker opportunities. 1. An expression cassette comprising a polynucleotide operably linked to a promoter that is functional in a plant cell , wherein said polynucleotide encodes a protein that catalyzes degradation of a herbicide selected from the group consisting of a phenoxy auxin and a pyridyloxy auxin , wherein said protein has at least 95% amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NO:2 and SEQ ID NO:4.2. The expression cassette of claim 1 , wherein said polynucleotide comprises plant codons for expression in said plant cell.3Arabidopsis thalianaArabidopsis thalianaArabidopsis thalianaArabidopsis thaliana. The expression cassette of claim 1 , wherein said promoter is selected from a cassava vein mosaic virus promoter claim 1 , CaMV 35S promoter claim 1 , Figwort Mosaic Virus promoter claim 1 , rice actin promoter claim 1 , phaseolin promoter claim 1 , Ubiquitin 10 promoter claim 1 , maize ubiquitin promoter claim 1 , Act2 promoter claim 1 , Ubiquitin 11 ...

REGULATORY POLYNUCLEOTIDES AND USES THEREOF

The present disclosure provides compositions and methods for regulating expression of transcribable polynucleotides in plant cells, plant tissues, and plants. Compositions include regulatory polynucleotide molecules capable of providing expression in plant tissues and plants. Methods for expressing polynucleotides in a plant cell, plant tissue, or plants using the regulatory polynucleotide molecules disclosed herein are also provided. 140-. (canceled)41. A recombinant polynucleotide molecule comprising a regulatory polynucleotide sequence selected from the group consisting of:(a) the sequence of nucleotides 858-1205 of SEQ ID NO: 9;(b) a sequence having at least 95% sequence identity to nucleotides 858-1205 of SEQ ID NO: 9; and(c) a fragment comprising at least 50 contiguous nucleotides of nucleotides 858-1205 of SEQ ID NO: 9, wherein said fragment is capable of regulating transcription of an operably linked transcribable polynucleotide molecule;wherein said regulatory polynucleotide sequence is operably linked to a promoter sequence; and wherein said regulatory polynucleotide sequence is operably linked to a heterologous transcribable polynucleotide molecule.42. The recombinant polynucleotide molecule of claim 41 , wherein the regulatory polynucleotide sequence comprises a sequence having at least 99% sequence identity to nucleotides 858-1205 of SEQ ID NO: 9.43. The recombinant polynucleotide molecule of claim 42 , wherein the regulatory polynucleotide sequence comprises the sequence of nucleotides 858-1205 of SEQ ID NO: 9.44. The recombinant polynucleotide molecule of claim 41 , wherein the transcribable polynucleotide molecule encodes a protein of agronomic interest or a functional RNA.45. The recombinant polynucleotide molecule of claim 44 , wherein the protein of agronomic interest confers herbicide tolerance to plants.46. The recombinant polynucleotide molecule of claim 44 , wherein the protein of agronomic interest confers pest resistance to plants.47. A ...

Plants With Useful Traits and Related Methods

The present invention provides methods for obtaining plants that exhibit useful traits by transient suppression of the MSH1 gene of the plants. Methods for identifying genetic loci that provide for useful traits in plants and plants produced with those loci are also provided. In addition, plants that exhibit the useful traits, parts of the plants including seeds, and products of the plants are provided as well as methods of using the plants. 143.-. (canceled)44. A method for producing a plant exhibiting improved yield comprising the steps of:a. suppressing expression of endogenous MSH1 gene(s) in a plant or plant cell by a genetic manipulation to obtain a first parental plant;b. selfing the first parental plant or crossing the first parental plant to a second parental plant;c. recovering progeny plants or a progeny plant line from the self or cross of the first parental plant of step (b) wherein MSH1 function is restored;and,d. selecting a progeny plant or a progeny plant line from a recovered progeny plant or plant line of step (c) or from a self or outcross of a recovered progeny plant or plant line of step (c), wherein the selected progeny plant, selected plant line, hybrid progeny thereof, or progeny thereof exhibit improved yield in comparison to a control plant, wherein said improved yield is associated with one or more epigenetic changes in the nucleus of the progeny plant cells relative to the corresponding parental chromosomal loci and is heritable.45. The method of claim 44 , wherein at least one of said epigenetic changes is methylation of chromosomal DNA.46. The method of claim 44 , wherein said method further comprises the step of producing seed by i) selfing the selected progeny plant or plant line of step (d) claim 44 , ii) out-crossing the selected progeny plant or plant line of step (d) or claim 44 , iii) both selfing and outcrossing the selected progeny plant or plant line of step (d).47. The method of claim 46 , wherein said method further ...

ENHANCED ADAPTATION OF CORN

Methods and compositions to adapt corn to grow in a geographical location such as northern dry climatic region are disclosed. By modulating phenotypic parameters such as for example flowering time, plant architecture, abiotic stress tolerance in a modular approach, corn is modified to grow in a geographical location that generally does not support growth corn to generate higher yields. Various methods, genes, and compositions are disclosed to improve adaptability and productivity of corn in the desired climatic conditions. 1. A method of increasing yield by adapting corn plant to grow in a crop-growing environment characterized as northern continental dry climatic region having an average annual CHU of about 1700 to 2000 when measured in ° F. or an average annual GDU of about 1400 to about 1700 when measured in ° F. , the method comprises:a. expressing one or more recombinant nucleic acids conferring a frost tolerant phenotype when the plant is exposed to −3° C. for about 3 hours;b. expressing one or more recombinant nucleic acids that reduce maturity of corn to about a comparative relative maturity of about 60-70 or wherein a reduction of about 4-10 days in maturity is achieved when compared to a control plant not having the recombinant nucleic acids; andc. increasing the yield of corn to a yield of at least about 100 bu/acre.2. The method of claim 1 , wherein the corn plant further comprises a recombinant nucleic acid that increases harvest index and optionally reduces plant stature including plant height.3. The method of claim 2 , wherein the corn plant is capable of being planted at a higher population density compared to corn plants not comprising the recombinant nucleic acid.4. The method of claim 1 , wherein the corn plant is chilling tolerant after being exposed to temperatures of less than about 15° C.5. The method of claim 1 , wherein the corn plant is exposed to frost during a seedling stage.6. The method of claim 1 , wherein the corn plant is exposed to ...

RAPID ASSAY FOR IDENTIFYING TRANSFORMANTS HAVING DONOR INSERTION

The present disclosure provides a system and methods for detecting and identifying plant events that contain donor sequences inserted precisely into a targeted genomic loci, and plants and plant cells comprising such targeted genomic loci. The method comprises the steps of amplifying a genomic DNA with a first round of PCR to produce an amplicon from donor sequences inserted in the reverse orientation, wherein the production of the amplicon indicates the presence of the site specific integration event. 1. A system for detecting site specific integration of a polynucleotide donor sequence within a genomic DNA target site of transfected plant cells , said system comprisinga donor vector comprising a polynucleotide donor sequence;a site specific nuclease expressing vector; anda set of PCR primers comprising a first Out-PCR primer designed to bind to the genomic DNA target site and a first In-PCR primer designed to bind the polynucleotide donor sequence, wherein said first Out-PCR primer and said first In-PCR primer pair are selected to amplify only polynucleotide donor sequences that have been inserted into the genomic DNA target site in a reverse orientation relative to the orientation of the polynucleotide donor sequence in the original donor vector.2. The system of claim 1 , wherein the genomic DNA target site further comprises an engineered genomic target site.3. The system of claim 1 , further comprising a second Out-PCR primer and a second In-PCR primer claim 1 , wherein the second Out-PCR primer is designed to bind to the genomic DNA target site of a first amplicon produced by PCR amplification using the first Out-PCR primer and the first Out-PCR primer claim 1 , and the second In-PCR primer is designed to bind the polynucleotide donor sequence of a first amplicon produced by PCR amplification using the first Out-PCR primer and the first Out-PCR primer.4. The system of claim 1 , wherein the site specific nuclease expressing vector expresses a nuclease that ...

Corn Plant Event MON87460 and Compositions and Methods for Detection Thereof

The present invention provides a transgenic corn event MON87460, and cells, seeds, and plants comprising DNA diagnostic for the corn event. The invention also provides compositions comprising nucleotide sequences that are diagnostic for MON87460 in a sample, methods for detecting the presence of MON87460 event polynucleotides in a sample, and probes and primers for use in detecting nucleotide sequences that are diagnostic for the presence of MON87460 in a sample. The present invention also provides methods of breeding with MON87460 to produce water deficit tolerance corn plants. 133-. (canceled)34. A probe comprising the polynucleotide of SEQ ID NO: 2 or a complement thereof , wherein a detectable label or a reporter molecule is attached to said polynucleotide.35. The probe of claim 34 , wherein said polynucleotide further comprises SEQ ID NO: 4 claim 34 , SEQ ID NO: 6 claim 34 , or SEQ ID NO: 7.36. A corn seed comprising the polynucleotide of SEQ ID NO: 2 or a complement thereof.37. The corn seed of claim 36 , wherein said polynucleotide further comprises SEQ ID NO: 6.38. A processed food or feed commodity comprising the polynucleotide of SEQ ID NO: 2 or a complement thereof.39. The processed food or feed commodity of claim 38 , wherein said food or said feed commodity comprises corn meal claim 38 , corn flour claim 38 , corn gluten claim 38 , corn oil claim 38 , or corn starch.40. The processed food or feed commodity of claim 38 , wherein said polynucleotide further comprises SEQ ID NO: 6 or SEQ ID NO: 7.41. A corn plant comprising the polynucleotide of SEQ ID NO: 2 or a complement thereof.42. The corn plant of claim 41 , wherein said polynucleotide further comprises SEQ ID NO: 6 or SEQ ID NO: 7. This application is a continuation of U.S. application Ser. No. 13/866,651, filed Apr. 19, 2013, which is a divisional application of U.S. application Ser. No. 12/919,845, now U.S. Pat. No. 8,450,561, which was the National Stage of International Patent Application No. ...

PLANT WITH INCREASED SILICON UPTAKE

The invention relates to nucleic acid sequences defining a genomic region conferring high silicon (Si) accumulation as discovered in the soybean () cultivar Plants having this region, named HiSil, introduced in its nucleic acid exhibit increased Si uptake. Furthermore, markers associated with high Si accumulation and 5 methods of identifying high Si accumulating plants using the markers are provided. The method provided by the invention can be used to develop new plants with high Si accumulation capacity, through breeding, genetic modification or any other forms of plant propagation. 1161-. (canceled)162Glycine maxGlycine max. An elite HiSil plant , wherein said elite HiSil plant comprises in its genome a chromosomal interval comprising a H1 haplotype.163Glycine maxHikmok soripHikmok sorip. The elite HiSil plant of claim 162 , wherein said chromosomal interval corresponds to a genomic region or portion thereof from chromosome 16 at about 92.6 cM to about 132 cM distance as indicated on a genetic linkage map from (PI372415A).164Glycine maxHikmok sorip. The elite HiSil plant of claim 162 , wherein said chromosomal interval corresponds to a genomic region or portion thereof from chromosome 16 corresponding to physical positions 31.15M base-pairs to 36.72 M base-pairs of Williams82 reference genome.165Glycine maxGlycine max. The elite HiSil mcix plant of claim 162 , wherein the elite is a commercially elite variety having a commercially significant yield.166. The plant of claim 162 , wherein the chromosomal interval comprises any one of claim 162 , or a portion of nucleotide base pairs corresponding to positions: 1-2658341 of SEQ NO:1; 567613-569933 of SEQ ID NO:1; 564:321-567612 of SEQ ID NO:1 577172-579696 of SEQ ID NO:1; or 573723-577171 of SEQ NO:1.167. The plant of claim 162 , wherein said plant has increased Si accumulation in any one of the plant leaves claim 162 , plant stem or plant parts as compared to a LoSil plant.168. The plant of claim 167 , wherein said ...

GENOME EDITED FINE MAPPING AND CAUSAL GENE IDENTIFICATION

The field is molecular biology, and more specifically, methods for editing the genome of a plant cell to identify causal alleles of a desired trait or to fine map a desired trait to small region of the genome for gene identification. 1. A method for fine mapping a desired trait comprising:a) introducing a site-specific modification in at least one target site in an endogenous genomic locus in a plant;b) obtaining the plant having a modified nucleotide sequence; andc) screening for the site-specific modification; andd) screening for an increase or decrease in a phenotype of the desired trait.2. The method of claim 1 , further comprising introducing at least a second site-specific modification in the endogenous genomic locus claim 1 , wherein said site-specific modification comprises at least one nucleic acid deletion claim 1 , insertion claim 1 , or polymorphism compared to the endogenous genomic sequence claim 1 , allele claim 1 , or genomic locus.3. The method of claim 1 , wherein the site-specific modification is induced by a nuclease selected from the group consisting of: a TALEN claim 1 , a meganuclease claim 1 , a zinc finger nuclease claim 1 , and a CRISPR-associated nuclease.4. The method of claim 1 , wherein said method further comprises selecting a plant having the modified nucleotide sequence.5. The method of claim 1 , wherein the endogenous genomic locus is located within a known QTL.6. The method of claim 5 , wherein the genomic locus is at least partially sequenced claim 5 , and wherein the site-specific modification occurs within the at least partially sequenced genomic locus.7. The method of claim 1 , wherein the endogenous genomic locus encompasses a random mutation fine-mapping.8. The method of claim 1 , wherein the plant exhibits either increased or decreased disease resistance.9. The method of claim 1 , wherein the plant either increased or decreased soybean protein concentration.10. The method of claim 1 , wherein the plant either increased or ...

METHODS AND SYSTEMS FOR EXTRACTING DICOT EMBRYOS

Methods and systems are provided which permit extraction of a dicot embryo of a dicot seed without damage to the dicot embryo. Methods disclosed herein provide embryos for uses in plant breeding and research procedures. 1. A method of manually or automatically isolating a dicot embryo from an immature dicot seed having a proximal end and an opposed distal end , wherein , prior to removal of the immature dicot seed from its biological carrier , the proximal end of the immature dicot seed is attached to the biological carrier and the distal end of the immature dicot seed is spaced from the biological carrier , the method comprising:a. providing an isolated immature dicot seed having an opening or hole in the proximal end of the dicot seed, wherein the isolated immature dicot seed is provided following removal of the immature dicot seed from the biological carrier; andb. extracting the dicot embryo through the opening or hole in the proximal end of the isolated immature dicot seed, wherein the dicot embryo is undamaged following extraction.2. The method of claim 1 , wherein claim 1 , following extraction of the dicot embryo claim 1 , the dicot embryo retains an ability to grow with full viability and vigor.3. The method of claim 1 , wherein the step of providing the dicot seed comprises removing at least a portion of the proximal end of the dicot seed without damage to the dicot embryo.4. The method of claim 1 , wherein the immature dicot seed is a sunflower seed.5. The method of claim 1 , wherein the immature dicot seed comprises side portions extending between its proximal and distal ends claim 1 , and wherein the step of extracting the dicot embryo through the hole comprises applying pressure to at least one side portion of the dicot seed to force the dicot embryo through the hole in the proximal end of the dicot seed.6. The method of claim 1 , further comprising forming the opening or hole in the proximal end of the dicot seed.7. The method of claim 1 , wherein ...

Quartet breeding

The invention relates to a method for the production of a set of seeds which are genetically identical to the male gametes from which they arise, which may comprise placing a limited number of paternal gametes that have the form of tetrads or dyads on the stigma of a flower to fertilize maternal egg cells to obtain a number of zygotes; and inducing the loss of maternal chromosomes from the zygotes to obtain a seed set containing a limited number of seeds in which the maternal chromosomes are absent. In a preferred embodiment the father plant exhibits suppression of chromosome recombination or second division restitution (SDR) during meiosis.

PLANTS WITH AN INTENSE FRUIT PHENOTYPE

The present invention relates to plants comprising a modified amount, activity or function of AGL11-like protein, wherein the plant is a member of plant family Cucurbitaceae or of species characterized in that the plant is not a plant having a deletion from nucleotide 1042 to nucleotide 637 upstream of the ATG start codon of SEQ ID NO: 1. 122-. (canceled)23Solanum lycopersicum. A plant comprising a reduced amount , activity or function of AGL11-like protein , or plant cell , tissue or plant part thereof , wherein the AGL11-like protein has at least 95% amino acid sequence identity to SEQ ID NO: 3 , wherein said plant produces fruits having an intense phenotype and having an average fresh weight of at least about 120 g.24. The plant according to claim 23 , wherein the plant produces fruits having an average fresh weight of at least about 150 g claim 23 , 200 g claim 23 , 250 g claim 23 , 300 g or even up to 600 g.25. The plant according to claim 23 , wherein the plant produces fruits having a round type.26. The plant according to claim 23 , wherein the plant has a mutation in the promotor sequence of the AGL11-like gene sequence.27. The plant according to claim 26 , wherein the plant has a deletion from nucleotide 1042 to nucleotide 637 upstream of the ATG start codon of SEQ ID NO: 1.28. The plant according to claim 23 , wherein the plant comprises the intense allele as found in seeds deposited under accession number NCIMB 42161 or NCIMB 42162.29. The plant according to claim 23 , wherein the reduced amount claim 23 , activity or function of AGL11-like protein can be determined during fruit formation.30. The plant according to claim 23 , wherein the plant further comprises an allele conferring the ogc fruit phenotype.31. The plant according to claim 30 , wherein the plant comprises the ogc allele as found in seeds deposited under accession number NCIMB 42161 or NCIMB 42162.32Oidium. The plant according to claim 23 , wherein the plant further comprises an allele ...

PEPPER PLANTS AND FRUITS WITH IMPROVED NUTRITIONAL VALUE

The present invention concerns plants producing pepper fruits, exhibiting new physicochemical characteristics of the pepper fruit in relation with chlorophyll A & B, lutein as well as violaxanthin. The pepper fruits of the plants according to the present invention also exhibit a characteristic extreme dark green color at immature stage which color is linked to the content in pigment of the said fruit. The present invention also relates to QTL alleles directing the expression of the pigment content of those pepper fruits as well as molecular markers associated with these QTL alleles. 1Capsicum annuum. A blocky fruit type pepper plant bearing extreme dark green color fruit at immature harvestable stage , said plant comprising two genetic determinants directing or controlling expression of said extreme dark green color in the pepper fruit of the pepper plant wherein said two genetic determinants are represented by two QTL ,{'i': 'Capsicum annuum', 'wherein the said genetic determinants are the genetic determinants of ancho ‘San Luis’,'}wherein the first QTL, QTL1, is genetically or physically linked to at least one of marker loci SP436 and SP626,wherein marker locus SP436 can be identified in a PCR by amplification of a DNA fragment with a pair of oligonucleotide primers: forward primer of SEQ ID NO: 1 and reverse primer of SEQ ID NO: 2 and probe of SEQ ID NO: 9, andmarker locus SP626 can be identified in a PCR by amplification of a DNA fragment with a pair of oligonucleotide primers: forward primer of SEQ ID NO: 3 and reverse primer of SEQ ID NO: 4 and probe of SEQ ID NO: 10,and wherein the second QTL, QTL2, is genetically or physically linked to at least one of marker loci SP693 and SP694,wherein marker locus SP693 can be identified in a PCR by amplification of a DNA fragment with a pair of oligonucleotide primers: forward primer of SEQ ID NO: 5 and reverse primer of SEQ ID NO: 6 and probe of SEQ ID NO: 11, andmarker locus SP694 can be identified in a PCR by ...

CANOLA OIL COMPOSITIONS WITH PARTICULAR TRIACYLGLYCEROL DISTRIBUTIONS

This application relates to canola oils comprising triacylglycerols (TAGs), wherein 11-16% of the total TAGs in the oil comprise one saturated fatty acid and two unsaturated fatty acids and wherein 82-88% of total TAGs comprise three unsaturated fatty acids, and wherein 81-91% of the total TAGs comprise at least one oleic acid and wherein 7-12% of the total TAGs comprise at least one linolenic acid. In some embodiments, the oils have a low saturated fatty acid content of 3.5-5.5%, such as 3.5-4.5%, or 3.5-4.0%. 130- (canceled)31. A canola oil comprising triacylglycerols (TAGs) , wherein 11-16% of the TAGs comprise one saturated fatty acid and two unsaturated fatty acids and wherein 82-88% of the TAGs comprise three unsaturated fatty acids , and wherein 81-91% of the TAGs comprise at least one oleic acid and wherein 7-12% of the TAGs comprise at least one linolenic acid.32. The canola oil of claim 31 , wherein the oil comprises 3.5% to 5.5% saturated fatty acids.33. The canola oil of claim 32 , wherein the oil comprises 3.5% to 4.5% saturated fatty acids.34. The canola oil of claim 32 , wherein the oil comprises 62-74% oleic acid and 2.5-5.0% linolenic acid.35. The canola oil of claim 32 , wherein 11-13% of TAGs in the oil comprise one saturated fatty acid and two unsaturated fatty acids.36. The canola oil of claim 32 , wherein the oil does not contain detectable levels of TAGs comprising two or three saturated fatty acids.37. The canola oil of claim 32 , wherein 3-5% of TAGs comprise two oleic acids and one palmitic acid.38. The canola oil of wherein 1-2% of TAGs comprise two oleic acids and one stearic acid.39. The canola oil of claim 32 , wherein 1-3% of TAGs comprise three linoleic acids.40. The canola oil of claim 32 , wherein 10-14% of TAGs comprise one oleic acid and two linoleic acids.41. The canola oil of claim 31 , wherein the oil comprises phospholipids including phosphatidyl choline claim 31 , phosphatidyl ethanolamine claim 31 , and phosphatidyl inositol ...

PLANT TRANSFORMATION WITHOUT SELECTION

The invention provides methods for identifying regenerated transformed plants and differentiated transformed plant parts, obtained without subjecting plant cells to selective conditions prior to regenerating the cells to obtain differentiated tissues. In particular embodiments, the plant cells are corn plant cells. Methods for growing and handling plants, including identifying plants that demonstrate specific traits of interest are also provided. 1. A method for identifying transgenic corn plants , comprising:(a) obtaining corn plant cells transformed with a DNA segment comprising a nucleic acid sequence of interest;(b) regenerating a plurality of corn plants or differentiated corn plant parts from the cells without first selecting for the presence of said DNA segment;(c) identifying at least a first transgenic corn plant or transgenic differentiated plant part from the plurality of corn plants or differentiated corn plant parts.2. The method of claim 1 , wherein the DNA segment does not comprise a selectable marker or visual marker gene.3. The method of claim 1 , wherein the plants are regenerated by growth on solid media claim 1 , liquid media claim 1 , or a combination of solid and liquid media.4. The method of claim 3 , wherein the plants are regenerated by growth solely on liquid media prior to identifying the transgenic corn plant or transgenic differentiated plant part.5. The method of claim 4 , wherein the transformation frequency of cells grown solely in liquid media subsequent to contacting the cells with a GOI and prior to identification of transgenic plants or transgenic plant parts is enhanced relative to the transformation frequency observed when cells are grown in solid media claim 4 , semi-solid media claim 4 , soil claim 4 , or a combination of solid media claim 4 , semi-solid media claim 4 , liquid media claim 4 , and/or soil claim 4 , subsequent to contacting the cells with a GOI and prior to identification of transgenic plants or transgenic plant ...

BACCATUM CYTOPLASMIC MALE STERILITY WITH FEMALE FERTILE FLOWERS IN CAPSICUM ANNUUM

The present disclosure provides BCMS plants exhibiting uniform female fertility. Such plants comprise novel introgressed genomic regions associated with uniform female fertility from on chromosome 6. In certain aspects, compositions and methods for producing, breeding, identifying, and selecting plants or germplasm with a uniform female fertility phenotype are provided. 1Capsicum annuumCapsicum baccatumCapsicum annuumCapsicum baccatum. A plant comprising a chromosomal segment from on chromosome 6 , wherein said chromosomal segment comprises an allele that confers female fertility in a male sterile plant having a cytoplasm relative to a plant lacking said chromosomal segment.2. The plant of claim 1 , wherein said chromosomal segment is further defined as:(a) flanked by Marker M12 (SEQ ID NO: 12) and Marker M36 (SEQ ID NO: 36) in said plant; or(b) located between 428,143 bp and 3,500,133 bp on the public pepper CM334 v1.55 map.3. The plant of claim 2 , wherein said chromosomal segment is flanked by Marker M7 (SEQ ID NO: 7) and Marker M17 (SEQ ID NO: 17) in said plant.4. A seed that produces the plant of .5. A plant part of the plant of .6. The plant part of claim 5 , wherein the plant part is a cell claim 5 , a seed claim 5 , a root claim 5 , a stem claim 5 , a leaf claim 5 , a flower claim 5 , a fruit claim 5 , or pollen.7Capsicum annuumCapsicum annuumCapsicum baccatumCapsicum baccatumCapsicum annuumCapsicum baccatum. A method for producing a plant that confers uniform female fertility in a male sterile plant having a cytoplasm claim 5 , comprising introgressing into said plant a chromosomal segment from on chromosome 6 that confers uniform female fertility in a male sterile plant having a cytoplasm relative to a plant lacking said chromosomal segment.8. The method of claim 7 , wherein said introgressing comprises:{'i': 'Capsicum annuum', 'a) crossing a plant comprising said chromosomal segment with itself or with a second plant of a different genotype to produce one ...

HERBICIDE-RESISTANT SUNFLOWER PLANTS, POLYNUCLEOTIDES ENCODING HERBICIDE-RESISTANT ACETOHYDROXYACID SYNTHASE LARGE SUBUNIT PROTEINS, AND METHODS OF USE

Herbicide-resistant sunflower plants, isolated polynucleotides that encode herbicide-resistant and wild-type acetohydroxyacid synthase large subunit 1 (AHASL1) polypeptides, and the amino acid sequences of these polypeptides, are described. Expression cassettes and transformation vectors comprising the polynucleotides of the invention, as well as plants and host cells transformed with the polynucleotides, are described. Methods of using the polynucleotides to enhance the resistance of plants to imidazolinone herbicides, and methods for controlling weeds in the vicinity of herbicide-resistant plants are also described. 1. A method for treating sunflower , comprising:providing a sunflower crop plant and at least one AHAS-inhibiting herbicide;applying an effective amount of the at least one AHAS-inhibiting herbicide to the sunflower crop plant, post-emergence, thereby creating a treated sunflower plant; andgrowing the resulting treated sunflower plant.2. The method of claim 1 , further comprising harvesting seed from the treated sunflower plant.3. The method of claim 1 , wherein the sunflower crop plant comprises in its genome at least one copy of a sunflower acetohydroxyacid synthase large subunit (AHASL) polynucleotide that encodes a herbicide-tolerant AHASL1 protein claim 1 , and wherein said herbicide-tolerant AHASL1 protein provides the sunflower crop plant with increased tolerance to at least one AHAS-inhibiting herbicide as compared to a wild-type sunflower crop plant.4. The method of claim 3 , wherein said herbicide-tolerant AHASL1 protein provides the sunflower crop plant with tolerance to at least a 2× treatment rate of the at least one AHAS-inhibiting herbicide.5. The method of claim 4 , wherein the at least one AHAS-inhibiting herbicide comprises imazamox.6. The method of claim 4 , wherein the at least one AHAS-inhibiting herbicide comprises imazapyr.7. The method of claim 3 , wherein the AHASL1 protein comprises a threonine substitution at a position ...

OBTAINING THE GENOTYPE OF A MALE GAMETIC CELL

Methods and compositions to genotype microspores and/or pollen grains are provided. Methods provided include using meiotically-related products to non-destructively determine the genotype of one of the meiotically-related products such that it can be further used. For example, methods to obtain a genotype of a microspore are provided. The methods include: isolating tetrads, separating the tetrads to obtain four tetrad microspores; genotyping three of the four tetrad microspores, and inferring the genotype of the fourth tetrad microspore. Methods are also provided for generating doubled haploid plants from the microspores that are selected for further analysis based on inferred genotypes. Viable genotyped pollen produced by these methods, as well as seed, cells, plants, germplasm, progeny, and plant parts derived therefrom are also provided. 120-. (canceled)21. A method for making a doubled haploid plant , said method comprising:a. isolating a microspore tetrad;b. separating the microspore tetrad to obtain four tetrad microspores;c. genotyping three of the four tetrad microspores;d. inferring the genotype of the fourth tetrad microspore from the genotypes obtained in (c);e. culturing the fourth tetrad microspore;f. contacting the cultured fourth tetrad microspore with a chromosome doubling agent;g. producing a doubled haploid embryo from the doubled microspore; andh. generating a doubled haploid plant from the doubled haploid embryo.22. A method for making a doubled haploid plant , said method comprising:a. isolating a microspore tetrad;b. separating the microspore tetrad to obtain four tetrad microspores;c. genotyping three of the four tetrad microspores;d. inferring the genotype of the fourth tetrad microspore from the genotypes obtained in (c);e. producing a haploid embryo from the fourth tetrad microspore;f. contacting the haploid embryo with a chromosome doubling agent; andg. growing the doubled haploid embryo into a doubled haploid plant.23. The method of claim ...

MOLECULAR MARKERS ASSOCIATED WITH CHLORIDE TOLERANT SOYBEANS

The present invention provides methods and compositions for the identification and selection of loci modulating phenotypic expression of a chloride tolerant trait in plant breeding. In addition, methods are provided for screening germplasm entries for the performance and expression of this trait. 16.-. (canceled)7. A method for obtaining a soybean plant comprising in its genome at least one chloride tolerance locus , compromising the steps of:a. genotyping a plurality of soybean plants with respect to at least one genetic locus on chromosome 3 flanked by loci NGMAX006180041 (SEQ ID NO: 4) and NGMAX006184463 (SEQ ID NO:34); andb. selecting a soybean plant comprising in its genome at least one genetic locus comprising a genotype associated with chloride tolerance.8. The method of claim 7 , wherein said genotype associated with chloride tolerance comprises at least one polymorphic allele of at least one marker selected from the group consisting of NS0096117 (SEQ ID NO:8) claim 7 , NS0205902 (SEQ ID NO: 13) claim 7 , and NS0203171 (SEQ ID NO: 31).9. The method of claim 8 , wherein said marker comprises a GG allele of NS0203171 (SEQ ID NO: 31).10. The method of claim 8 , wherein said marker comprises a TT allele of NS0205902 (SEQ ID NO: 13)11. The method of claim 7 , wherein said plurality of soybean plants comprises a population that is obtained by: i) crossing a parent plant comprising at least one chloride tolerance locus with a parent plant comprising at least one chloride sensitivity locus; or claim 7 , ii) obtaining seed or progeny from a parental plant segregating for at least one chloride tolerance locus.12. The method of claim 7 , wherein said population contains plants that contain a transgene that confers resistance to dicamba and/or a transgene that confers resistance to glyphosate.13. The method of claim 7 , further comprising the step of assaying for the presence of at least one additional marker claim 7 , wherein said additional marker is either linked or ...

QTLs ASSOCIATED WITH AND METHODS FOR IDENTIFYING WHOLE PLANT FIELD RESISTANCE TO SCLEROTINIA

Markers associated with Sclerotinia whole plant field resistance are provided. Methods of identifying Sclerotinia resistant and susceptible plants, using the markers are provided. Methods for identifying and isolating QTLs are a feature of the invention, as are QTLs associated with Sclerotinia whole plant field resistance.

PLANTS COMPRISING EVENTS PP009-401, PP009-415, AND PP009-469, COMPOSITIONS, SEQUENCES, AND METHODS FOR DETECTION THEREOF

The invention provides glyphosate tolerant transgenic turfgrass plants, plant material, and seeds that have a specific transformation event. Also provided are assays for detecting the presence of the event. The invention also provides sequences for a variant EPSPS gene and a GAO2X gene, cassettes, and plants comprising the variant EPSPS gene and a GAO2X gene. 1. Seed of Kentucky bluegrass comprising event Pp009-401 , event Pp009-415 , or event Pp009-469 , a representative sample of seed comprising event Pp009-401 , event Pp009-415 , and event Pp009-469 having been deposited under ATCC Accession Nos. PTA-120354 , PTA-120353 , and PTA-120355 , respectively.2. A Kentucky bluegrass plant claim 1 , or part thereof claim 1 , produced from the seed of .3. The part of claim 2 , wherein said part is a cell claim 2 , pollen claim 2 , ovule claim 2 , seed claim 2 , root claim 2 , or leaf.4. Progeny of the Kentucky bluegrass plant of claim 2 , wherein said progeny comprise event Pp009-401 claim 2 , event Pp009-415 claim 2 , or event Pp009-469.5. A method for producing Kentucky bluegrass plant or seed comprising crossing a Kentucky bluegrass plant comprising event Pp009-401 claim 2 , event Pp009-415 claim 2 , or event Pp009-469 with a plant lacking event Pp009-401 claim 2 , event Pp009-415 claim 2 , or event Pp009-469 claim 2 , and planting seed obtained from said cross claim 2 , wherein said seed comprises event Pp009-401 claim 2 , event Pp009-415 claim 2 , or event Pp009-469.6. The method of claim 5 , further comprising selecting progeny plants tolerant to glyphosate.7. The method of claim 6 , further comprising backcrossing said progeny plants with a Kentucky bluegrass plant comprising event Pp009-401 claim 6 , event Pp009-415 claim 6 , or event Pp009-469.8. A plant or seed obtained from the method of claim 7 , wherein said plant or seed comprises event Pp009-401 claim 7 , event Pp009-415 claim 7 , or event Pp009-469.9. Kentucky bluegrass genomic DNA comprising event Pp009- ...

GENETIC MARKERS ASSOCIATED WITH DROUGHT TOLERANCE IN MAIZE

The presently disclosed subject matter relates to methods and compositions for identifying, selecting, and/or producing drought tolerant maize plants or germplasm. Maize plants or germplasm that have been identified, selected, and/or produced by any of the methods of the presently disclosed subject matter are also provided. 1Zea mays. An inbred or hybrid plant the genome of which comprises at least three , four , five , six , seven , eight , or nine of haplotypes A-M , wherein haplotypes A-M are associated with water optimization.2Zea maysZea mays. The inbred or hybrid plant of claim 1 , wherein the inbred or hybrid plant comprises a genome comprising Haplotypes C claim 1 , D claim 1 , and G; Haplotypes C claim 1 , D claim 1 , and L; Haplotypes C claim 1 , G claim 1 , and H; Haplotypes C claim 1 , G claim 1 , and I; Haplotypes C claim 1 , I claim 1 , and L; Haplotypes E claim 1 , G claim 1 , and I; Haplotypes F claim 1 , G claim 1 , and H; Haplotypes A claim 1 , C claim 1 , F claim 1 , and G; Haplotypes C claim 1 , E claim 1 , H claim 1 , and I; Haplotypes C claim 1 , G claim 1 , H claim 1 , and I; Haplotypes C claim 1 , H claim 1 , I claim 1 , and K; Haplotypes C claim 1 , H claim 1 , I claim 1 , and L; Haplotypes E claim 1 , F claim 1 , G claim 1 , and H; Haplotypes A claim 1 , C claim 1 , G claim 1 , H claim 1 , and I; Haplotypes B claim 1 , C claim 1 , D claim 1 , G claim 1 , and L; Haplotypes C claim 1 , E claim 1 , G claim 1 , H claim 1 , and I; Haplotypes C claim 1 , G claim 1 , H claim 1 , I claim 1 , and L; Haplotypes A claim 1 , C claim 1 , G claim 1 , H claim 1 , I claim 1 , and K; and Haplotypes C claim 1 , E claim 1 , F claim 1 , G claim 1 , H claim 1 , I claim 1 , J claim 1 , K claim 1 , and L.3Zea maysZea mays. The inbred or hybrid plant of claim 1 , wherein the inbred or hybrid plant is a hybrid plant that is homozygous for at least one of Haplotypes A-M.4Zea maysZea mays. The inbred or hybrid plant of claim 3 , wherein the hybrid or inbred plant ...

METHODS FOR INCREASING GRAIN PRODUCTIVITY

The invention relates to methods for increasing plant yield, and in particular grain yield by reducing or abolishing the expression and/or activity of OTUB1 in a plant. Also described are genetically altered plants characterised by the above phenotype and methods of producing such plants. 1. A method of increasing grain yield in a plant , the method comprising reducing the expression of at least one nucleic acid encoding a otubain-like protease (OTUB1) and/or reducing the activity of OTUB1.2. (canceled)3. The method of claim 1 , wherein the method comprises introducing at least one mutation into at least one nucleic acid sequence encoding a OTUB1 polypeptide and/or the promoter of the OTUB1 polypeptide.4. (canceled)5. (canceled)6. The method of claim 1 , wherein the nucleic acid encodes a OTUB1 polypeptide wherein the OTUB1 polypeptide comprises SEQ ID NO: 1 or a functional homologue or variant thereof and wherein the nucleic acid encoding a OTUB1 promoter comprises SEQ ID NO: 6 or a functional variant or homologue thereof.7. (canceled)8. (canceled)9. (canceled)10. (canceled)11. The method of claim 1 , wherein the method comprises using RNA interference to reduce the expression of a least one OTUB1 nucleic acid.12. (canceled)13. (canceled)14. The method of claim 1 , wherein the plant is selected from rice claim 1 , wheat claim 1 , maize claim 1 , sorghum claim 1 , barley claim 1 , soybean claim 1 , and brassica.15. (canceled)16. A genetically altered plant claim 1 , part thereof or plant cell claim 1 , wherein said plant comprises at least one mutation in at least one nucleic acid encoding an OTUB1 polypeptide and/or the OTUB1 promoter or wherein the plant comprises an RNA interference construct that reduces the expression of an OTUB1 polypeptide.17. (canceled)18. (canceled)19. (canceled)20. (canceled)21. (canceled)22. (canceled)23. (canceled)24. (canceled)25. The genetically altered plant of claim 16 , wherein claim 16 , the nucleic acid encoding a OTUB1 ...