СПОСОБ ЛЕЧЕНИЯ ДЕТЕЙ С ЗАБОЛЕВАНИЯМИ ВЕРХНИХ ОТДЕЛОВ ПИЩЕВАРИТЕЛЬНОГО ТРАКТА, АССОЦИИРОВАННЫХ С Helicobacter pylori

Изобретение относится к медицине, а именно к детской гастроэнтерологи, и может быть использовано для лечения заболеваний верхних отделов пищеварительного тракта, ассоциированных с Helicobacter pylori. Для этого в курс лечения, включающий лекарственные средства, направленные на эрадикацию Helicobacter pylori, дополнительно включают препарат Веторон. При этом детям в возрасте от 7 до 12 лет Веторон вводят в дозе 6-8 капель, в возрасте от 13 до 17 лет - 8-10 капель 1 раз в сутки в течение 7-10 дней. Изобретение позволяет снизить мутагенный эффект антихеликобактерной терапии у детей. 3 табл.

СРЕДСТВО ХРОНОБИОЛОГИЧЕСКОЙ КОРРЕКЦИИ (ВАРИАНТЫ) И СПОСОБ ХРОНОБИОЛОГИЧЕСКОЙ КОРРЕКЦИИ

Изобретение относится к медицине и может быть использовано для коррекции десинхроноза функций различных органов и систем организма человека, вызванного профессиональными и техногенными факторами. Предложены варианты средства хронобиологической коррекции с учетом органотропности проявления десинхроноза. Все варианты заявляемого средства хронобиологической коррекции состоят из двух комплексов. Утренний комплекс включает растительные компоненты мягкого тонизирующего и биостимулирующего действия и комплекс растительных адаптогенов, вечерний комплекс включает растительные компоненты мягкого успокаивающего и седативного действия и стимулирующие восстановление клеточных ресурсов. Кроме того, утренний и вечерний комплексы включают витамины, минеральные вещества, антиоксиданты и специфические биологически активные вещества, направленные на коррекцию специфических органных или системных нарушений, развивающихся вследствие хронического десинхроноза. Предложен способ хронобиологической коррекции с ...

КОМПОЗИЦИИ, СОДЕРЖАЩИЕ ФЕРМЕНТЫ, ПОЛУЧАЕМЫЕ ИЗ НИХ ДИЕТИЧЕСКИЕ ПИЩЕВЫЕ ПРОДУКТЫ И ЛЕКАРСТВЕННЫЕ СРЕДСТВА И ИХ ПРИМЕНЕНИЕ ДЛЯ МЕДИЦИНСКИХ ЦЕЛЕЙ

Изобретение относится к химико-фармацевтической промышленности, а именно к созданию средств и биологически активных добавок на основе веществ природного происхождения. Композиции содержат одну или несколько гидролаз и один или несколько антиоксидантов, выбираемых среди антиокислительно действующих витаминов, каротиноидов, селенсодержащих веществ, убихинонов. Композиции являются компонентом пищевых продуктов или лекарственных средств, которые находят применение, в частности, для диетической пищевой добавки, в особенности для дополнительной сбалансированной диеты, и для лечения дисрегуляций иммунной системы. 9 н. и 16 з. п. ф-лы.

НУТРИЦЕВТИЧЕСКАЯ ОФТАЛЬМОЛОГИЧЕСКАЯ КОМПОЗИЦИЯ ДЛЯ ЛЕЧЕНИЯ ПАТОЛОГИЙ СЕТЧАТКИ С НЕОВАСКУЛЯРНЫМ КОМПОНЕНТОМ

Изобретение относится к области медицины, а именно к офтальмологии и терапии, и предназначено для лечения заболевания глаз у субъекта, получающего средство лечения, противодействующее VEGF. Применяют офтальмологическую нутрицевтическую композицию при лечении заболевания глаз у субъекта, получающего средство лечения, противодействующее VEGF. Указанная композиция содержит ресвератрол, витамин C, витамин E, цинк, медь, лютеин, зеаксантин и омега-3-жирные кислоты из рыбьего жира. Использование изобретения позволяет повысить эффективность лечения заболевания глаз у субъекта, получающего средство лечения, противодействующее VEGF. 20 з.п. ф-лы, 1 ил., 2 табл.

КОМПОЗИЦИЯ ОБОГАТИТЕЛЯ ГРУДНОГО МОЛОКА

Группа изобретений относится к композиции обогатителя человеческого грудного молока и ее применению. Композиция обогатителя человеческого грудного молока содержит: медь, селен, цинк, альфа-лактальбумин, казеин, лактоферрин, альфа-токоферол, гамма-токоферол, никотиновую кислоту, ретинол, DFSLTHN, FSLTNH3, GSLT6, LnNT, LNT, 6’-SL и SLTNTC. Раскрыты также упаковка, содержащая указанную композицию, и применение указанной композиции для оптимизации роста и развития или для поддержания здорового роста младенцев, родившихся преждевременно, с крайне низким весом при рождении (КНВР) и/или очень низким весом при рождении (ОНВР), а также для профилактики и/или лечения состояния, выбранного из группы, состоящей из недостаточности роста и/или развития, замедления роста, инфекции, заболевания легких, задержек в развитии, слепоты и/или метаболического заболевания костей. Изобретение обеспечивает оптимизированный состав композиции обогатителя грудного молока для недоношенных детей. 7 н. и 10 з.п. ф-лы, ...

Продукт для пероральной доставки

Изобретение относится к композиции для пероральной доставки витаминов и минеральных веществ субъекту, содержащей витамины, минеральные вещества, ароматизаторы или вкусовые агенты, связывающее вещество, которое включает сахарный спирт, представляющий собой изомальт, и экспициенты, выбранные из прежелатинизированного крахмала и карбоксиметилцеллюлозы, где композиция может растворяться во рту указанного субъекта или может быть пережевана и проглочена указанным субъектом и где калорийность композиции составляет приблизительно 5 калорий, а твердость композиции составляет от 17 кгс до 28 кгс. 7 з.п. ф-лы, 8 пр., 10 табл.

ИММУНОТРОПНЫЙ ПРЕПАРАТ "ВИТУЛИН А"

Изобретение относится к фармакологии, а именно к средствам для профилактики и лечения острых инфекционных заболеваний вирусной и бактериальной природы. Предложен иммунотропный препарат, представляющий собой экспрессный мед, полученный путем скармливания пчелам состава, включающего монофлерный мед семейства сложноцветных, содержащий 3-окси-флавон-силибин, флавоноидные фракции прополиса, экстракт листьев мать-и-мачехи, экстракт цветущего горца птичьего, экстракт цветочных корзинок арники в определенном соотношении. Препарат индуцирует эндогенный α-, β- и γ-интерферон, повышает активность фагоцитоза, способствует нормализации самочувствия больного в короткий срок. 3 з.п. ф-лы, 1 табл.

КОМПОЗИЦИЯ, ВКЛЮЧАЮЩАЯ ДИИНДОЛИЛМЕТАН И РЕТИНОИД ДЛЯ ЛЕЧЕНИЯ КОЖНОЙ ПАТОЛОГИИ

Изобретение относится к способу лечения акне у субъекта, нуждающегося в этом, включающему введение композиции, включающей: (а) первый компонент, включающий 3,3' дииндолилметан, имеющий следующую структуру,и (b) второй компонент, включающий соединение витамина А. Изобретение оказывает синергетическое действие при лечении и предотвращении кожных патологий. 21 з.п. ф-лы, 4 ил., 2 табл.

СПОСОБ КОРРЕКЦИИ НЕДИФФЕРЕНЦИРОВАННОЙ ДИСПЛАЗИИ СОЕДИНИТЕЛЬНОЙ ТКАНИ

Изобретение относится к медицине, в частности к терапии, и касается лечения недифференцированной дисплазии соединительной ткани. Для этого в дополнении к витамину В6 и магнию вводят витамины А, Е, С, D, B1, В2, В12, пантотеновую кислоту, фолиевую кислоту в комплексе с кальцием, причем введение всех витаминов и микроэлементов осуществляют в дозах, не превышающих суточной потребности организма, в течение двух-четырех недель, курс лечения повторяют не менее 2 раз в год. Такое выполнение способа обеспечивает эффективное лечение при отсутствии побочных эффектов за счет коррекции метаболизма коллагена - снижения скорости его образования и деградации. 2 табл.

СПОСОБ ЛЕЧЕНИЯ ДИСБАКТЕРИОЗОВ КИШЕЧНИКА У ДЕТЕЙ И ВЗРОСЛЫХ

Изобретение относится к области медицины, а именно лечению дисбактериозов, развивающихся у человека вследствие интенсивной лекарственной терапии. Предложено вводить в комплексную терапию дисбактериозов кишечника пектин в виде 3 - 5% водного раствора, который проявляет бактерицидное действие на патогенную и условно-патогенную микрофлору кишечника. Взрослые и дети получают пектин двумя циклами: 4 дня - перерыв 5 дней - 4 дня, в возрастной дозировке, через 4 ч с перерывом на сон. Способ позволяет стабильно устранить состояние дисбактериоза (санация желудочно-кишечного тракта) в более короткие сроки и удешевлении курса лечения за счет устранения из схемы антидиарейных и антибактериальных препаратов последних поколений.

СПОСОБ КОМПЛЕКСНОГО ЛЕЧЕНИЯ ГЛАУКОМЫ

Изобретение относится к медицине, к офтальмологии, к способам лечения глаукомы. Вводят мономинерал селен, экстракт листьев "Гинкго-Билоба", принимают продукты, богатые селеном, выводят из организма токсичный металл алюминий препаратом "Биопротект" на фоне приема в терапевтических дозах витамина А, С, Е, пчелиной перги и рутина. Данный способ позволяет повысить терапевтический эффект, улучшить микроциркуляцию сосудистого русла глаз, добиться длительной ремиссии заболевания и стабилизации состояния.

Способ комплексного лечения паразитарных болезней домашних северных оленей

Изобретение относится к ветеринарии и может быть использовано для лечения паразитарных заболеваний молодняка северных оленей. Для этого животному 3 дня проводят подкормку смесью комбикорма с минерально-витаминной добавкой. Одна доза смеси содержит 150 г комбикорма, 15 г цеолита, 5-7 г кемпендяйской соли, 30000 ME витамина А, 40000 ME витамина D, 20 мг витамина Е. На 4-й день дополнительно в смесь добавляют антигельминтный препарат «Альбен» в дозе 7,5 мг/кг и продолжают подкормку смесью комбикорма с минерально-витаминной добавкой в течение 7-10 дней. Изобретение позволяет снизить токсический и иммуноподавляющий эффект препаратов при лечении паразитарных заболеваний молодняка северных оленей.

СРЕДСТВО, ОБЛАДАЮЩЕЕ ОБЩЕУКРЕПЛЯЮЩИМ, АДАПТОГЕННЫМ И ПРЕПЯТСТВУЮЩИМ СНИЖЕНИЮ ИММУНИТЕТА ДЕЙСТВИЕМ, И СПОСОБ ЕГО ПОЛУЧЕНИЯ

Изобретение относится к фармацевтической промышленности, а именно к лекарственному средству, обладающему общеукрепляющим, адаптогенным и препятствующим снижению иммунитета действием. Композиция, обладающая общеукрепляющим, адаптогенным и препятствующим снижению иммунитета действием, содержит экстракты шиповника, эхинацеи, подсластитель, ароматизатор, карнитин, инозитол, магния глюконат, магния цитрат, аскорбиновую кислоту (витамин С), витамин Е, цинка глюконат, витамин А, фруктозу, консервант и воду, взятые в определенном соотношении. Способ получения композиции, обладающей общеукрепляющим, адаптогенным и препятствующим снижению иммунитета действием. Вышеописанное средство обладает эффективным общеукрепляющим, адаптогенным и препятствующим снижению иммунитета действием. 2 н.п. ф-лы, 5 пр.

СПОСОБ ПОДГОТОВКИ СВИНОМАТОК К ОПОРОСУ

Изобретение относится к области животноводства и представляет собой способ подготовки свиноматок к опоросу, включающий использование витаминно-минеральных препаратов, отличающийся тем, что свиноматкам за 45 дней до опороса вводят внутримышечно однократно комплексный витаминный препарат Аквитин в дозе 0,35 мл на 10 кг и одновременно дополнительно в основной рацион вводят препарат Алексанат Зоо в дозе 40 мл на голову на 1 л воды в течение 14 дней. Заявленное изобретение эффективно для профилактики и предупреждения стресса у свиноматок перед опоросом и после, позволяет получить здоровых поросят и повысить их сохранность. 4 ил., 3 табл.

НОВЫЙ СОСТАВ ДЛЯ МЯГКИХ ЖЕЛАТИНОВЫХ КАПСУЛ, СОДЕРЖАЩИХ РЕТИНОИД

Изобретение относится к фармакологии. Фармацевтический состав ретиноидов включает мягкую желатиновую капсулу, заполненную наполнителем, содержащим ретиноид в качестве действующего вещества, от 50 до 80 мас.% натурального растительного масла, от 15 до 35 мас.% частично гидрогенизированного натурального растительного масла и от 3 до 20 мас.% среднецепочечных триглицеридов, причем наполнитель дополнительно включает от 1 до 10 мас.% натурального воска. В особо предпочтительном варианте осуществления изобретения мягкая желатиновая капсула содержит комбинацию вышеуказанного состава и оболочки капсулы, содержащей свиной желатин. Изобретение обеспечивает улучшение растворимости состава. 16 з.п. ф-лы, 1 табл., 3 ил.

СПОСОБ ЛЕЧЕНИЯ ДИАБЕТИЧЕСКИХ РЕТИНОПАТИЙ

Изобретение относится к медицине, а именно к офтальмологии, и касается лечения диабетической ретинопатии. Для этого проводят спектрометрический анализ волос и ногтей для определения дефицита микроэлементов хрома, магния, цинка, селена, кальция и наличия токсичных металлов алюминия и свинца, а затем осуществляют индивидуальную коррекцию этого дефицита мономинералами указанных микроэлементов и лечебным питанием, а также выведение токсичных металлов препаратом "Биопротект", одновременно проводят сахароснижающую терапию, вводят препараты ванадил-сульфат, липоевую и фолиевую кислоты, инозит, никотинамид, лизин, таурин, биотин, кофермент Q-10, витамины и экстракты лечебных трав. Способ позволяет повысить эффективность лечения диабетической ретинопатии за счет нормализации общего состояния организма.

СОДЕРЖАЩИЕ РЕТИНОИД ФАРМАЦЕВТИЧЕСКИЕ КОМПОЗИЦИИ ДЛЯ МЕСТНОГО ПРИМЕНЕНИЯ ТИПА ЭМУЛЬСИИ "МАСЛО В ВОДЕ"

Группа изобретений относится к химико-фармацевтической промышленности и представляет собой фармацевтическую композицию для лечения дерматологических заболеваний типа эмульсии "масло в воде", содержащую: масляную фазу, содержащую 3"-трет-бутил-4'-(2-гидроксиэтокси)-4"-пирролидин-1-ил-[1,1';3',1"]-терфенил-4-карбоновую кислоту, феноксиэтанол и масляные вспомогательные растворители; водную фазу, содержащую поверхностно-активное вещество из группы сложных эфиров сахарозы, полиол и очищенную воду. Данная фармацевтическая композиция пригодна для лечения угрей и ихтиозов. Группа изобретений позволяет получить физически и химически стабильные фармацевтические композиции, которые демонстрируют лучшую переносимость и легко наносятся на кожу пациента, обеспечивая постепенное проникновение активных веществ. 3 н. и 15 з.п. ф-лы, 3 ил., 16 табл., 13 пр.

ПЕННАЯ КОМПОЗИЦИЯ ДЛЯ УХОДА ЗА ВОЛОСАМИ

Изобретение относится к пенной композиции для мытья и обработки волос и/или кожи головы, отличающейся тем, что она содержит в водной среде по меньшей мере одно активное начало, выбранное из кортикоидов и ретиноидов, по меньшей мере одно анионное ПАВ, по меньшей мере одно амфотерное ПАВ, по меньшей мере один пропиточный агент. Технический результат: композиция позволяет улучшить проникновение активного начала, сохраняя при этом легкость применения и обладая хорошими косметическими свойствами. 29 з.п. ф-лы.

Диета, имитирующая голодание (FMD), в качестве иммунорегуляторного лечения желудочно-кишечных аутоиммунных/воспалительных заболеваний

Группа изобретений относится к медицине и касается способа лечения желудочно-кишечного воспалительного заболевания, выбранного из группы, состоящей из болезни Крона (CD), язвенного колита (UC), синдрома раздражённого кишечника, целиакии, микроскопического колита и болезни Бехчета, включающего введение диеты, имитирующей голодание (FMD), субъекту, имеющему указанное желудочно-кишечное воспалительное заболевание, в течение 1, 2, 3, 4, 5, 6, 7, 8, 9 или 10 суток. Группа изобретений также касается применения диетического набора для введения диеты, имитирующей голодание, для лечения желудочно-кишечного воспалительного заболевания, выбранного из группы, состоящей из болезни Крона (CD), язвенного колита (UC), синдрома раздражённого кишечника, целиакии, микроскопического колита и болезни Бехчета, где набор содержит набор рационов для диеты, имитирующей голодание (FMD), и инструкции по введению диетического набора субъекту для лечения указанного желудочно-кишечного воспалительного заболевания, включающие ...

ЖИДКИЙ ЛЕЧЕБНЫЙ СОСТАВ ДЛЯ ВНУТРИВЕННОГО ВВЕДЕНИЯ, СОДЕРЖАЩИЙ ДЕКСТРОЗУ И ИНСУЛИН

Жидкий лечебный состав применяется в области медицины и предназначен для вывода пациента из критического состояния. Жидкий состав для лечения способом внутривенного введения содержит инсулин от 16 до 40 I.U. на 500 мл воды, раствор декстрозы от 10 до 20%, воду, от 0,6875 до 1,375 г глюконата кальция и от 0,75 до 1,5 г хлорида калия. Состав может содержать дополнительно витамины, гепарин, аминокислоты, липиды и другие жизненно необходимые вещества. Применение жидкого состава позволяет минимизировать последствия повышенного метаболизма, который развивается в организме в состоянии стресса и при критических условиях. 16 з.п. ф-лы, 19 табл.

СПОСОБ КОМПЛЕКСНОЙ СТИМУЛЯЦИИ СПЕРМАТОГЕНЕЗА

Изобретение относится к медицине, а именно к урологии и андрологии, и может быть использовано для комплексной стимуляции сперматогенеза. Для этого на фоне проведения медикаментозной терапии воздействуют лазером контактно на область мошонки. Лазерное воздействие осуществляют низкоинтенсивным лазерным излучением с длиной волны 0,63 мкм выходной мощностью 30 мВт. При этом разовая доза воздействия составляет 0,2 Дж/см2. Процедуры проводят ежедневно. Курс лечения составляет 10-15 процедур. Способ позволяет повысить антиоксидантный статус в тканях, снизить уровень перекисного окисления липидов, нормализовать микроциркуляцию яичек, улучшить внутриорганную гемодинамику, и за счет этого стимулировать сперматогенез, также способ позволяет обеспечить эффективное лечение больных как в ранние послеоперационные сроки, так и при любой урологической патологии, осложненной нарушением сперматогенеза.

МАЗЬ ДЛЯ ЛЕЧЕНИЯ ВОСПАЛИТЕЛЬНЫХ И АЛЛЕРГИЧЕСКИХ ПОРАЖЕНИЙ КОЖИ

Изобретение относится к медицине, а именно касается создания мази для лечения воспалительных и аллергических поражений кожи. Сущность изобретения состоит в том, что мазь содержит бета-каротин - 1 - 8%, облепиховое масло - 0,5 - 1,5% и в качестве носителя содержит суспензию метилцеллюлозы и пропиленгликоля в воде. Мазь подавляет каррагенин и ПАФ индуцированные отеки, а также реакцию пассивной кожей анафилаксии.

МУЛЬТИВИТАМИННЫЙ СИРОП-СПРЕЙ

Настоящее изобретение относится к области лекарственных средств, в частности к мультивитаминному сиропу-спрею в аэрозольной упаковке, содержащему витамины A, D3, Е, С, В1, В2, В6, ниацинамид (витамин В3), В12, фолиевую кислоту, биотин, витамин В5, мальтит, сорбит. Спрей в аэрозольной упаковке содержит необходимые для человека витамины и позволяет эффективно доставлять их в организм человека, витамины попадают в кровь прямо из слизистой оболочки рта, минуя разрушительное действие желудочных кислот.

СПОСОБ ПОВЫШЕНИЯ ПРИВЕСОВ ПРИ ОДНОВРЕМЕННОЙ ПРОФИЛАКТИКЕ ОКСИДАТИВНОГО СТРЕССА У ЦЫПЛЯТ-БРОЙЛЕРОВ

Изобретение относится к области птицеводства и ветеринарии и может быть использовано как способ повышения привесов цыплят-бройлеров, профилактики оксидативного стресса и, как следствие, увеличения их продуктивности. Способ включает пероральное введение птицам с 3-суточного возраста кормовой добавки «Абиовит» с водой для поения в дозе 1 мл/л воды каждые 5 суток до 33-суточного возраста и кормовой добавки «Абиопептид» с водой для поения в дозе 1 мл/л воды через день до 35-суточного возраста. Осуществление данного изобретения обеспечивает повышение привесов и профилактику оксидативного стресса у цыплят-бройлеров. 2 табл.

Композиция для повышения физической выносливости и работоспособности

Изобретение относится к фармацевтической и пищевой промышленности и может быть использовано для приготовления энергетического продукта, в частности композиции функционального назначения, повышающей работоспособность и физическую выносливость, необходимую, например, для лиц, специализирующихся в силовых видах спорта или занятых тяжелым физическим трудом. Создана композиция для повышения физической выносливости и работоспособности, содержащая альфа-токоферола ацетат, ретинола ацетат, янтарную кислоту и шоколадную массу при следующем соотношении компонентов, мас.%: ретинола ацетат - 2,1-4,5; альфа-токоферола ацетат - 0,35-0,75; янтарная кислота - 0,25-0,65; шоколадная масса - остальное. Композиция по изобретению обладает хорошими вкусовыми качествами, имеет удобную форму для приема, а также обеспечивает в течение короткого времени повышение работоспособности и физической выносливости за счет приема комплекса активных веществ, оптимально подобранных и в количестве, достаточном для достижения ...

СПОСОБ ПОЛУЧЕНИЯ СФЕРИЧЕСКИХ ЧАСТИЦ НА ОСНОВЕ АКТИВНОГО НАЧАЛА

Изобретение относится к медицине и биотехнологии и касается нового способа получения сферических частиц на основе одного или нескольких активных начал. Способ состоит в том, что на первом этапе формируют частицы при регулируемом смешивании первичной эмульсии масло в воде с растворителем, не смешиваемым с водой, затем на втором этапе отделяют полученные частицы. В качестве активного начала выбирают один или несколько витаминов А, Е, D3, В12, Н, К3, РР, В1, B2, B3, B5, B6, а также каротиноидов или энзимов. Технический результат изобретения состоит в стабилизации активных компонентов пищевого или лечебного назначения. 11 з. п. ф-лы, 3 ил.

СПОСОБ ПОЛУЧЕНИЯ β КАРОТИНА, ДИСПЕРГИРУЕМОГО В ВОДЕ

Способ заключается в том, что производят смешивание сухих исходных компонентов - каротиноида и эмульгатора, взятых в соотношении 1-10 : 100 г, в одну стадию при одновременном нагревании до температуры 130-180oС в течение 20-60 мин до получения твердого продукта. В качестве эмульгатора используют пищевые производные полиоксиэтилена. Использование изобретения позволит упростить технологический процесс получения препарата β -каротина, исключить использование дефицитного и дорогостоящего сырья. 1 табл.

КОМБИНАЦИЯ КОМПОНЕНТОВ ДЛЯ УЛУЧШЕНИЯ ФИЗИЧЕСКИХ ПОКАЗАТЕЛЕЙ У ЛИЦ, ЗАНИМАЮЩИХСЯ ТЯЖЕЛЫМИ ФИЗИЧЕСКИМИ НАГРУЗКАМИ

Изобретение относится к фармацевтической промышленности и представляет собой композицию для поддержания и/или восстановления организма во время и/или после тяжелых физических нагрузок, содержащую L-таурин, L-лейцин, L-изолейцин, L-валин, экстракт листьев зеленого чая, йохимбин гидрохлорид, элеутерококка колючего корневищ и корней экстракт, левзеи сафлоровидной корневищ с корнями экстракт, родиолы розовой корневищ с корнями экстракт, экстракт кожуры горького апельсина, рибофлавина натрия фосфат, холина альфосцерат, пантотенат кальция, пиридоксина гидрохлорид, фолиевую кислоту, цианокобаламин, биотин, никотинамид, L-карнитин, бета-аланин, калия оротат, метилурацил, инозин, кофеин, экстракт листьев, соцветий и корневищ иван-чая, креатина моногидрат, L-тирозин, аскорбиновую кислоту, магний в форме бис-глицината, медь в форме бис-глицината, цинк в форме бис-глицината, L-глутамин, тиамина гидрохлорид, холекальциферол 5000 МЕ, кальция малат, натрия дигидрофосфат, альфа-токоферола ацетат, L-селенметионин ...

СПОСОБ ЛЕЧЕНИЯ И ПРОФИЛАКТИКИ ДИСМЕТАБОЛИЧЕСКОЙ НЕФРОПАТИИ У ДЕТЕЙ, АССОЦИИРОВАННОЙ С ТОКСИЧЕСКИМ ДЕЙСТВИЕМ КАДМИЯ, СВИНЦА, ХРОМА И ФЕНОЛА ТЕХНОГЕННОГО ПРОИСХОЖДЕНИЯ

Изобретение относится к медицине, и предназначено для лечения и профилактики токсической дисметаболической нефропатии у детей, проживающих в зоне влияния промышленных предприятий в условиях загрязнения атмосферного воздуха кадмием, свинцом, хромом и фенолом. Лечение проводят в два этапа. На первом этапе осуществляют сочетанное применение детьми: поливитаминов с микро- и макроэлементами из серии «Витрум» перорально курсом 21 день по 1 таблетке 1 раз в день после еды: «Витрум-беби» - дети 3-4 года; «Витрум-кидс» - дети в возрасте 4-7 лет; «Витрум-юниор» - дети старше 7 лет, и препарата «Элькар» перорально курсом 10 дней в возрастной дозировке детям в возрасте 3-6 лет - в разовой дозе 0,1 г - 5 капель 2-3 раза в день или в суточной дозе 0,2-0,3 г - 11-16 капель; в возрастной дозировке детям в возрасте старше 6 лет - в разовой дозе 0,2-0,3 г - 11-16 капель 2-3 раза в день или в суточной дозе 0,4-0,9 г - 22-48 капель. На втором этапе, после завершения приема «Элькара», вводят в схему лечения ...

СПОСОБ ОЗДОРОВЛЕНИЯ ОРГАНИЗМА ДЕТЕЙ 7-10 ЛЕТ В УСЛОВИЯХ ОБЩЕОБРАЗОВАТЕЛЬНОЙ ШКОЛЫ

Изобретение относится к медицине, а именно к педиатрии, в частности к физическому воспитанию детей 7-10 лет в условиях школы. Для этого во время проведения урока по физическому воспитанию выполняют упражнения в условиях насыщения помещения спортивного зала аэрозолем морской воды. Подбор физических упражнений осуществляют в зависимости от сезонов года. В осенний период упражнения, развивающие выносливость, составляют 30-40% от общего числа упражнений. В зимний период упражнения, развивающие скоростно-силовые способности, составляют не менее 30% от общего числа; упражнения, развивающие гибкость, составляют не менее 20%; упражнения, развивающие координационные способности, составляют не менее 30%. В весенний период упражнения, развивающие скоростные способности, составляют 30-40% от общего числа упражнений. Насыщение спортивного зала аэрозолем морской воды осуществляют в два этапа. Первый этап проводят в конце осеннего и начале зимнего периода в ходе заключительной части каждого урока, продолжительностью ...

Способ лечения хронического пародонтита

Изобретение относится к медицине, а именно, к стоматологии, и может быть использовано при лечении хронического пародонтита. Способ включает введение лекарственного препарата в виде масляного раствора на основе биологически активной добавки «Ягель», витамина «А» и экстракта шалфея, получаемого смешиванием компонентов при следующем составе, в масс.%: биологически активная добавка «Ягель», сухой остаток – 54-55, масляный раствор витамина «А» – 33-35, экстракт шалфея – 10-13. Далее приготовленный раствор вводят непосредственно в патологический пародонтальный карман с последующей фиксацией нанесением антисептической самотвердеющей пасты. При этом дневная процедура включает в себя одноразовое введение раствора и нанесение пасты, курс лечения составляет 7-10 процедур. Изобретение обеспечивает эффективное лечение хронического пародонтита и способствует предупреждению осложнений патологических процессов в тканях пародонта. 3 табл., 6 ил.

ЛЕКАРСТВЕННОЕ СРЕДСТВО ДЛЯ ПРОФИЛАКТИКИ И ЛЕЧЕНИЯ ГИПОАВИТАМИНОЗОВ И НОРМАЛИЗАЦИИ ОБМЕНА ВЕЩЕСТВ У ПТИЦ

Изобретение относится к области фармацевтики и предназначено для профилактики и лечения гипоавитаминозов и нормализации обмена веществ. Лекарственное средство содержит витамин А, витамин D, витамин Е, витамин С, а в качестве соединения селена содержит ДАФС-25 при следующем соотношении ингредиентов в 1 л раствора: витамин А - 25,0-35,0 мл, витамин D- 0,03-0,05 мл, витамин Е - 55,0-65,0 г, витамин С - 90,0-110,0 г, ДАФС-25 - 0,2-0,4 г, полисорбат-80 - 190,0-210,0 мл, 2-пирролидон 39,0-41,0 мл, вода дистиллированная - до литра. Использование заявленного средства позволяет значительно повысить иммунный статус птицы, нормализовать деятельность ее антиоксидантной и детоксирующей систем, увеличить сохранность птицы, повысить яйценоскость и мясную продуктивность при снижении затрат корма на единицу продукции/ 3 табл., 3 пр.

СПОСОБ УСКОРЕНИЯ ОКИСЛЕНИЯ ОКСИДА АЗОТА (NO) В ГЕТЕРОГЕННОЙ СРЕДЕ

Изобретение относится к ускорению реакции оксида азота в гетерогенных средах, в т.ч. плазме крови, добавкой гидрофобных фторсодержащих соединений и может найти применение в медицине для коррекции состояний, связанных с нарушением метаболизма оксида азота. Сущность изобретения состоит в том, что в реакционную смесь вводят компонент(ы), вызывающие образование одной или нескольких новых фаз, так чтобы значение выражения где Н - ускорение реакции; ki - константа скорости реакции в i-й фазе, QNO,i, - равновесные коэффициенты распределения NO и O2 в i-й фазе; xi - доля i-й фазы в общем объеме, возросло, при этом добавляемый компонент(ы) содержи(а)т перфторуглеводород, или галогензамещенное производное перфторуглеводорода, или перфторалкиламин, или раствор белка, солюбилизировавшего фторсодержащее органическое вещество со значением QNO и/или в двухфазной системе с водой, более высоким, чем максимальное из значений QNO и/или для произвольной пары фаз реакционной смеси до добавления, а гетерогенной ...

СПОСОБ ПРОФИЛАКТИКИ СЕЗОННЫХ ЗАБОЛЕВАНИЙ ОСТРЫХ РЕСПИРАТОРНЫХ ИНФЕКЦИЙ - ОРИ И ПОВЫШЕНИЯ ЗАЩИТНЫХ СИЛ ОРГАНИЗМА

Изобретение относится к медицине и может быть использовано для профилактики сезонных заболеваний ОРИ и повышения защитных сил организма в целом. Для этого включают в пищевой рацион бета-каротин в дозе 20 мг/сут в течение 40 дней. Способ достоверно повышает защитные свойства организма и снижает сезонную заболеваемость ОРИ. 2 табл., 4 ил.

КОМПЛЕКСНОЕ ИММУНОМОДУЛИРУЮЩЕЕ СРЕДСТВО ДЛЯ ПРОФИЛАКТИКИ НАРУШЕНИЙ И РЕГУЛЯЦИИ РАБОТЫ ИММУННОЙ СИСТЕМЫ (ВАРИАНТЫ)

Изобретение относится к медицине и касается комплексного иммуномодулирующего средства для профилактики нарушений и регуляции работы иммунной системы (варианты). Предложено комплексное средство для профилактики нарушений и регуляции работы иммунной системы, характеризующееся тем, что оно выполнено в виде капсул и содержит интерферон человеческий рекомбинантный альфа, и/или бета, и/или гамма типов, ретинола пальмитат, цинка сульфат моногидрат, вспомогательное вещество - до 0,1 г. Предложено также комплексное иммуномодулирующее средство для профилактики нарушений и регуляции работы иммунной системы, характеризующееся тем, что оно выполнено в виде суппозиториев на гидрофильной основе и содержит интерферон человеческий рекомбинантный альфа, и/или бета, и/или гамма типов, ретинола пальмитат и/или вещества, выбранные из числа альфа, бета, гамма каротинов, цинка сульфат моногидрат, а также вспомогательные вещества. Изобретение обеспечивает расширение возможности профилактики и коррекции иммунологических ...

Способ комплексного последовательного применения патогенетических средств в лечении детей с туберкулёзной инфекцией

Настоящее изобретение относится к медицине, а именно к фтизиатрии, и касается комплексного последовательного применения патогенетических средств для лечения детей с туберкулезной инфекцией. Для этого ежедневно однократно водят веторон по 0,5-0,6 мл, разведенный в 100 мл кипяченой воды, после еды, курсом 1-3 месяца с повтором через 1 месяц. Дополнительно при развитии дисбактериоза кишечника 2-3 степени тяжести назначают ежедневный однократный прием кумыса через 2 часа после приема медикаментов, медленными глотками, при этом разовая питьевая доза кумыса составляет 100-150 мл, а курс приема – 3 месяца. Такая последовательность введения витаминных и кисломолочных средств обеспечивает повышение эффективности лечения туберкулезной инфекции за счет повышения иммунного статуса и устранения побочных реакций гепатотоксического характера, развивающихся в процессе лечения противотуберкулезными препаратами. 2 пр.

СПОСОБ ПОЛУЧЕНИЯ ЭРГОСТЕРИНА

Способ получения эргостерина из дрожжей позволяет повысить выход целевого продукта до 85 - 93% с чистотой не менее 88%. Способ включает выделение сопутствующих продуктов переработки дрожжей с последующим сольволизом липидно-жирового концентрата 1 - 2% спиртовым раствором щелочи при их соотношении не менее 1 : 12 и выделением целевого продукта кристаллизацией.

ВАГИНАЛЬНАЯ КОМПОЗИЦИЯ

... 1. Вагинальная композиция, включающая жизнеспособные микроорганизмы лактобациллы и/или бифидобактерии, предпочтительно Lactobacillus bifidus, не жизнеспособные культуры сахаромицеты, предпочтительно Saccharomyces cerevisiae, сахарид(ы), витамин А ретинол и цинк. 2. Вагинальная композиция по п.1, отличающаяся тем, что она дополнительно содержит селен, особенно селенсодержащие дрожжи, предпочтительно в количестве 0,001-0,06 вес.% селена. 3. Вагинальная композиция по п.1 и/или 2, отличающаяся тем, что она дополнительно содержит Melaleuca aetheroleum, предпочтительно в количестве от 0,5 до 10 вес.%, и/или экстракт из цветов ромашки, предпочтительно в количестве от 0,01 до 5 вес.%. 4. Вагинальная композиция по п.1 или 2, отличающаяся тем, что она дополнительно содержит D-альфа-токоферол, предпочтительно в количестве от 0,5 до 5 вес.%, и/или пантотенат, предпочтительно в количестве от 0,1 до 3 вес.%. 5. Вагинальная композиция по п.3, отличающаяся тем, что она дополнительно содержит D-альфа-токоферол ...

ФАРМАЦЕВТИЧЕСКИЕ КОМПОЗИЦИИ МЕСТНОГО ПРИМЕНЕНИЯ, СОДЕРЖАЩИЕ ПРОТИВОУГРЕВОЕ СОЕДИНЕНИЕ И АНТИБИОТИЧЕСКОЕ СОЕДИНЕНИЕ

... 1. Фармацевтическая композиция для местного применения, включающая (a) терапевтически эффективное количество адапалена или его фармацевтически приемлемой соли или сложного эфира; (b) клиндамицин или его фармацевтически приемлемую соль или сложный эфир; и (c) гидрофильную матрицу, способную обеспечивать постоянное и равномерное высвобождение активных фармацевтических ингредиентов.2. Фармацевтическая композиция для местного применения по п.1, где адапален или его фармацевтически приемлемая соль или сложный эфир присутствует в количестве от примерно 0,01 мас.% до примерно 0,2 мас.% и клиндамицин или его фармацевтически приемлемая соль или сложный эфир присутствует в количестве от примерно 0,5 мас.% до примерно 5 мас.%.3. Фармацевтическая композиция для местного применения по п.1 или 2, где гидрофильная матрица включает полиалкиленоксид, имеющий среднемассовую молекулярную массу, равную, по меньшей мере, примерно 100000.4. Фармацевтическая композиция для местного применения по п.1 или 2, где ...

СРЕДСТВО ДЛЯ ПОВЫШЕНИЯ УРОВНЯ ЛАКТОФЕРРИНА В СЫВОРОТКЕ КРОВИ ЧЕЛОВЕКА

МАЗЬ ДЛЯ ЛЕЧЕНИЯ ЗАБОЛЕВАНИЙ С НАРУШЕНИЕМ КОРОТИНИЗАЦИИ И ЦЕЛОСТНОСТИ КОЖИ

Мазь для лечения заболеваний с нарушением керотинизации и целостности кожи, содержащей эфиры витамина А, эмульгатор и актиоксиданты, отличающаяся тем, что она дополнительно содержит в качестве активного ингредиента ретинола пальмитат, а в качестве эмульгатора - эмульгатор N 1, при следующем соотношении компонентов, мас.%: Ретинола пальмитат - 0,3 - 0,7 Вазелиновое масло - 9,5 - 10,5 Эмульгатор N 1 - 9,5 - 10,5 Cмесь антиоксидантов - 0,18 - 0, 22 Глицирин - 9,5 - 10,5 Этиловый спирт 96oC - 9,5 - 10,5 или Сорбиновая кислота - 0,098 - 0,102 Вода дистиллированная - До 100, ...

СПОСОБ ПРОФИЛАКТИКИ НАРУШЕНИЯ БЕЛКОВО-МИНЕРАЛЬНОГО ОБМЕНА У ТЕЛЯТ ПРИ МАРГАНЦЕВОЙ НЕДОСТАТОЧНОСТИ

Способ профилактики нарушения белково-минерального обмена у телят при марганцевой недостаточности, включающий комплексное использование микродобавок, одна из которых марганец, отличающийся тем, что животным дополнительно внутримышечно вводят тетравит с интервалом в 2-3 недели в дозе, мг/гол: с 1 по 3 месяц 1,5, от 3 до 5 месяцев 2,0 и в 5-6 месячном возрасте 3, при этом микродобавки к рациону задаются ежедневно с учетом их дефицита.

НОВЫЙ СОСТАВ ДЛЯ МЯГКИХ ЖЕЛАТИНОВЫХ КАПСУЛ, СОДЕРЖАЩИХ РЕТИНОИД

... 1. Фармацевтический состав ретиноидов, содержащий мягкую желатиновую капсулу, заполненную наполнителем, содержащим ретиноид в качестве действующего вещества, натуральное растительное масло и среднецепочечные триглицериды. 2. Фармацевтический состав по п.1, в котором наполнитель дополнительно содержит натуральный воск. 3. Фармацевтический состав по п.1 или 2, в котором наполнитель дополнительно содержит антиоксидант. 4. Фармацевтический состав по п.1 или 2, в котором натуральное растительное масло выбирают из соевого масла, кукурузного масла, подсолнечного масла, рапсового масла, льняного масла, конжутного масла, оливкового масла, кокосового масла, арахисового масла, сафлорового масла, касторового масла и хлопкового масла или смеси двух или более этих масел. 5. Фармацевтический состав по п.4, в котором натуральное растительное масло представляет собой соевое масло. 6. Фармацевтический состав по п.1 или 2, в котором среднецепочечные триглицериды выбирают из триглицеридов насыщенных жирных ...

СРЕДСТВО ДЛЯ ЛЕЧЕНИЯ ЗАБОЛЕВАНИЙ ПЕЧЕНИ У КРУПНОГО РОГАТОГО СКОТА И СВИНЕЙ, ПОВЫШЕНИЯ ИХ СОХРАННОСТИ И ПРОДУКТИВНОСТИ

Изобретение относится к ветеринарии и предназначено для лечения заболеваний печени у сельскохозяйственных животных. Средство включает растворенные в растительном масле (мас. %) ди-ацетофенонилселинид - 0,05-0,1; бета-каротин 0,09-0,18 и эссенциальные фосфолипиды - 5,5-6,0. Средство позволяет сократить сроки лечения при патологии печени у крупного рогатого скота и свиней, а также повысить их сохранность и продуктивность. 4 табл., 2 пр.

Способ получения нанокапсул витаминов в пектине

Изобретение относится в области нанотехнологии, медицины и пищевой промышленности. Описан способ получения нанокапсул витаминов А, С, Е, D или Qв оболочке из низкоэтерифицированного или высокоэтерифицированного яблочного или цитрусового пектина. Для получения нанокапсул согласно способу по изобретению к суспензии указанного пектина в гексане с 0,01 г Е472с в качестве поверхностно-активного вещества медленно прибавляют 1 г указанного витамина при перемешивании 1000 об/мин. Затем добавляют хлороформ. Полученную суспензию нанокапсул отфильтровывают, сушат при комнатной температуре, при этом массовое соотношение в нанокапсулах ядро:оболочка составляет 1:3. Процесс получения нанокапсул осуществляется при 25С в течение 15 минут. Способ по изобретению обеспечивает упрощение и ускорение процесса получения нанокапсул и увеличение выхода по массе. 20 пр.

СПОСОБ ЛЕЧЕНИЯ РАН И ТРОФИЧЕСКИХ ЯЗВ

Изобретение относится к медицине и фармацевтической промышленности, а именно к способу лечения ран и трофических язв. Способ лечения ран и трофических язв, заключающийся в том, что в течение 8-15 суток с условием ежедневной однократной замены на рану или трофическую язву выполняют аппликации, пропитанные композицией из 0,9% масляного раствора бета-каротина и 10% масляной вытяжки прополиса в соотношении компонентов 10:1 соответственно, при этом через каждые 4-5 дней и по окончании курса лечения осуществляют контроль наличия микрофлоры в ране или трофической язве путем анализа мазков-отпечатков с раны и пробы с раневой поверхности. Вышеописанный способ позволяет обеспечить излечение или длительную ремиссию во всех фазах раневого процесса благодаря сочетанию антибактериальных, защитных и регенераторных свойств ее компонентов. 4 ил., 2 пр.

РЕЖИМЫ ДОЗИРОВАНИЯ ТРАНС-КЛОМИФЕНА

... 1. Композиция, включающая от 0 до примерно 29 мас.% цис-кломифена и примерно от 100 до примерно 71 мас.% транс-кломифена или его аналогов для использования при получении лекарственного средства для введения пациенту в качестве однократной дозы для достижения фармакологически эффективной концентрации тестостерона в крови пациента на перед 3-30 суток. ! 2. Применение по п.1, в котором композиция состоит преимущественно из транс-кломифена или его аналога. ! 3. Применение по п.1, в котором однократная доза составляет примерно от 5 до примерно 100 мг. ! 4. Применение по п.3, в котором однократная доза составляет примерно он 12,5 до примерно 50 мг. ! 5. Применение по п.4, в котором однократная доза составляет 12,5, 25 или 50 мг. ! 6. Применение по п.1, в котором время составляет примерно от 7 до примерно 15 суток. ! 7. Применение по п.6, в котором период времени составляет примерно от 10 до примерно 12 суток. ! 8. Применение по п.1, в котором лекарственное средство предназначено для повышения ...

СПОСОБ ПОЛУЧЕНИЯ НАНОКАПСУЛ ВИТАМИНОВ

Изобретение относится к химико-фармацевтической промышленности и представляет собой способ инкапсуляции препарата методом осаждения нерастворителем, в котором согласно изобретению в качестве ядер нанокапсул используются витамины, в качестве оболочки - натрий карбоксиметилцеллюлоза, которую осаждают из суспензии в изопропиловом спирте путем добавления хлороформа в качестве нерастворителя с последующей сушкой при комнатной температуре. Изобретение обеспечивает упрощение и ускорение процесса получения нанокапсул, уменьшение потерь при получении нанокапсул (увеличение выхода по массе). 7 пр.

КОМПОЗИЦИЯ, ВКЛЮЧАЮЩАЯ ДИИНДОЛИЛМЕТАН И РЕТИНОИД ДЛЯ ЛЕЧЕНИЯ КОЖНОЙ ПАТОЛОГИИ

... 1. Композиция для применения при лечении кожной патологии, композиция, включающая:(a) первый компонент, включающий замещенное или незамещенное соединение дииндолилметана; и(b) второй компонент, включающий замещенное или незамещенное ретиноидное соединение.2. Композиция по п.1, в котором композиция включает дополнительный компонент, выбранный из одного или более из следующих: дополнительное замещенное или незамещенное ретиноидное соединение, антибиотическое соединение, замещенное или незамещенное соединение азелаиновой кислоты, противозачаточное соединение для перорального введения, сера, серосодержащее соединение, замещенное или незамещенное соединение салициловой кислоты, замещенное или незамещенное соединение резорцина, растительный продукт, минерал, витамин и нутрицевтический продукт.3. Композиция по п.1 или 2, в котором первый компонент включает соединение дииндолилметана, обладающее следующей структурой:,в которой группы R могут одинаковыми или различными и выбранными из атомов водорода ...

КОМПОЗИЦИЯ, ВКЛЮЧАЮЩАЯ РЕТИНОЛ, ЕГО ПРЕДШЕСТВЕННИК ИЛИ ПРОДУКТ ЕГО РЕАКЦИИ И ЭКСТРАКТ ИЗ ПО МЕНЬШЕЙ МЕРЕ ОДНОГО РАСТЕНИЯ CHAMOMILLA, ДЛЯ ЛЕЧЕНИЯ РАКА

... 1. Композиция, включающая(i) витамин А, продукт его реакции, его метаболит или предшественник, выбранные из витамин А, ретиноевой кислоты, полностью транс-ретиноевой кислоты, 13-цис-ретиноевой кислоты, сложных эфиров витамина А, в частности, ретинилпальмитата, ретинола, ретиналя, ретинилацетата, алитретиноина, бета-каротина, альфа-каротина, гамма-каротина, бета-криптоксантина, и провитамина А, и(ii) экстракт из растения ромашки, выбранного из водного экстракта, спиртового жидкого экстракта и безводного спиртового жидкого экстракта,для применения для предупреждения, лечения или улучшения ракового или опухолевого заболевания, в которой компоненты (i) и (ii) представляют собой единственные активные ингредиенты.2. Композиция по п.1, характеризующаяся тем, что экстрактом из растения предпочтительно является эфирное масло ромашки, предпочтительно Matricaria recutita.3. Композиция по п.1 или 2, характеризующаяся тем, что экстрактом из растения является ромашковый экстракт, приготовленный из трубчатых ...

СРЕДСТВО ДЛЯ ЛЕЧЕНИЯ КЛИНИЧЕСКОГО МАСТИТА

Средство для лечения клинического мастита, включающее в себя тривит, цефотаксим, преднизолон, нистатин в следующем соотношении:тривит - 10,0 мл;цефотаксим - 750 мг;преднизолон - 10,0 мг;нистатин - 325,0 мл.

РАДИОПРОТЕКТОР

Изобретение относится к экспериментальной и клинической медицине и касается средств, защищающих живой организм от воздействия ионизирующей радиации. Цель изобретения - изыскать радиопротектор, сохраняющий достоинства бета-каротина и одновременно обладающий повышенной радиопротекторной активностью. Сущность изобретения состоит в том, что в качестве радиопротектора предложен ликопин, обладающий искомыми свойствами.

Водорастворимые композиции с биологически активными липофильными соединени ми

... 1. Водорастворимая композиция, содержащая биологически активное липофильное соединение и солюбилизирующий агент общей формулы где Х - остаток гидрофобной части молекулы, выбранной из группы, состоящей из стеринов, токоферолов и их производных, Y - остаток гидрофильной части молекулы, выбранной из группы, состоящей из полимерных спиртов, полиэфиров и их производных, р = 1 или 2, m = 0 или 1, и n - целое число в интервале: 0≤n≤18, при условии, что если р и m равны 1, а гидрофобная часть молекулы является α-(+)-токоферолом, то n не равно 2. 2. Композиция по п.1, отличающаяся тем, что биологически активное липофильное соединение выбрано из группы, состоящей из убихинонов, убихинолей, витаминов, провитаминов, полиеновых макролидных антибиотиков и их смесей, при условии, что если биологически активное липофильное соединение - убихинон, а гидрофобная часть молекулы - холестерин, то n не равно 8. 3. Композиция по п.1, отличающаяся тем, что гидрофобная часть молекулы выбрана из группы, состоящей ...

СУБЛИНГВАЛЬНОЕ ИЛИ БУККАЛЬНОЕ ВВЕДЕНИЕ DIM ДЛЯ ЛЕЧЕНИЯ ЗАБОЛЕВАНИЙ КОЖИ

КОМБИНИРОВАННЫЕ КОМПОЗИЦИИ, СОДЕРЖАЩИЕ ЭКСТРАКТЫ ИЗ РАСТЕНИЙ И МОРСКИХ ЖИВОТНЫХ

... 1. Композиция, содержащая i) хрящевой экстракт, полученный путем ферментативного протеолитического гидролиза, или синтетические формы соединений, экстрагируемых из хряща путем ферментативного протеолитического гидролиза; ii) один или несколько гидрофильных антиоксидантов, где указанные гидрофильные антиоксиданты экстрагированы из семян винограда или представляют собой синтетические формы антиоксидантов, экстрагируемых из семян винограда; и iii) один или несколько липофильных антиоксидантов, где одним из указанных антиоксидантов является ликопен, и где указанные липофильные антиоксиданты экстрагированы из природных источников или представляют собой синтетические формы липофильных антиоксидантов, экстрагируемых из природных источников. 2. Композиция по п.1, содержащая i) хрящевой экстракт, полученный путем ферментативного протеолитического гидролиза; ii) один или несколько гидрофильных антиоксидантов, где указанные гидрофильные антиоксиданты экстрагированы из семян винограда или получены ...

ДЕПИГМЕНТИРУЮЩИЙ ВОДНО-СПИРТОВОЙ ГЕЛЬ

... 1. Депигментирующая композиция, содержащая в физиологически приемлемой среде фенольное производное, ретиноид, в частности, диспергированный, и, в известных случаях, солнцезащитный фильтр, отличающаяся тем, что она представляет собой водно-спиртовой гель. 2. Композиция по п.1, отличающаяся тем, что водно-спиртовой гель содержит от 1 до 30% спирта. 3. Композиция по п.1, отличающаяся тем, что спирт представляет собой этанол. 4. Композиция по п.1, отличающаяся тем, что водно-спиртовой гель содержит, равным образом, один или несколько из следующих ингредиентов: а) карбомер, б) другой желирующий компонент, в) антиоксидант, г) и хелатирующую добавку. 5. Композиция по одному из пп.3 или 4, отличающаяся тем, что водно-спиртовой гель содержит 4,00% фенольного производного, 0,10% ретиноида, 20,00% этанола, 0,40% карбомера, 0,60% другого желирующего компонента, 0,40% солей сернистой кислоты, 0,10% ЭДТК (EDTA). 6. Композиция по п. 1, отличающаяся тем, что фенольное производное представляет собой гидрохинон ...

РАСТВОРИМЫЕ В МАСЛЕ КОМПОЗИЦИИ

... 1. Способ получения масляного раствора физиологически приемлемой пигментной добавки, который включает a) получение твердой композиции, содержащей каротиноид, и растворение композиции в физиологически приемлемом масле или смеси масел; или b) получение раствора, содержащего каротиноид и органический растворитель, и смешивание раствора с физиологически приемлемым маслом или смесью масел с последующим необязательным удалением органического растворителя. 2. Способ по п.1, который включает получение твердой композиции по п. а) растворением каротиноида в смешивающемся с водой органическом растворителе; примешиванием липофильного диспергирующего агента с необязательным добавлением дополнительных добавок; и удалением растворителя. 3. Способ по п.1, который включает получение твердой композиции по п.а) растворением каротиноида в органическом растворителе; примешиванием липофильного диспергирующего агента, выбранного из группы, состоящей из этилцеллюлозы, смолы даммара, смолы бату, копала конго, смолы ...

РАНОЗАЖИВЛЯЮЩЕЕ СРЕДСТВО

Изобретение относится к медицине, а именно к фармакологии. Цель изобретения - исключение побочного действия, увеличение стабильности препарата при одновременном придании средству разнопротекторных свойств. Средство представляет собой масляно-витаминный препарат для лечения ран и язв слизистых оболочек в гастроэнтерологии, проктологии, гинекологии. Средство содержит следующие компоненты, г: раствор ретинола ацетата в масле 8,6% -ный, содержащий 282608 МЕ, витамина А или раствор ретинола пальмитата в масле, содержащий 282603 МЕ витамина А 0,283, альфа - токоферола ацетата 0,18; 2-метил-1,4-нафтохинон 0,05; бутилокситолуол 0,02 г; каротин микробиологический - до 100 мл. Средство обладает ранозаживляющим и разнопротекторным действием, высокой стабильностью. При его применении отсутствует жжение и изменения в тромбоцитарном аппарате, характерные для действия препарата Аекол. 3 табл.

Способ лечения ишемической болезни сердца

Изобретение относится к медицине, а именно кордиологии, и может быть использованно при лечении больных ишемической болезнью сердца (ИБС) для исключения ее обострения наблюдаемого при лазеротерапии гелий - неоновым лазером (ГНЛ). Целью изобретения является удлинение сроков ремиссии заболевания за счет исключения обострения ИБС при лечении больных с помощью ГНЛ. Поставленная цель достигается тем, что одновременно с началом процедур облучения известных рефлексогенных зон монохроматическим ГНЛ вводят капсулированный препарат "Аевит" в ежедневной дозе 600 мг и в курсовой дозировке, соответствующей индивидуальному количеству сеансов ГНЛ - терапии. Способ позволяет исключить обострение ИБС на фоне проводимой лазеротерапии. Преимуществами способа является также то, что он прост в выполнении, не требует дорогостоящих оборудования и преператов, безопасен.

Средство для купирования бальнеореакции

Изобретение относится к курортологии и касается применения α-токоферола в качестве средства для купирования больнеореакции у гинекологических больных. Целью изобретения является снижение степени обострения хронических воспалительных заболеваний внутренних половых органов женщины. Применяют α-токоферола в суточном дозе 300-500 мм с момента выявления бальнереакции в течение 1-5 сут /лечебный вариант/ и в суточной дозе 200-300 мг с 5 дня курортной терапии в течение 7-10 дней /профилактический вариант/.

Способ лечения псориаза

Изобретение относится к медицине , а именно к дерматологии, и может быть использовано при ле 1ении псориаза . Целью изобретения является сокращение числа рецидивов, сокращение сроков стационарного лечения путем введения веществ, регулирующих кальциевый обмен. Для этого больному вводят перорально финоптин по 40 мг 3 раза в день при ограниченной и распространенной формах в прогрессивной и стационарных стадиях без выраженных признаков эксудации и инфильтрации. В случаях с эксудативным компонентом финоптин вводят внутривенно по 2,5 мг/мл 1 раз в сутки в комплексе с витаминами А и Е по 20 мг, включая и артропатические фбрмы. (Л ...

Препарат дл лечени акнэ

Способ получения сухих водо-растворимых стабильных препаратов витамина А

Phenylacetate und Derivate, allein oder in Kombination mit anderen Verbindungen, zur Behandlung von neoplastischen und anderen Erkrankungen

Zusammensetzungen, welche ein RAR alpha spezifischer Liganden und mindestens eine Fettsäure enthalten

WUNDHEILENDE ZUSAMMENSETZUNGEN ZUR BEHANDLUNG VON AKNE,DIE EIN PYRUVATE,EIN ANTIOXIDANT UND EINE FETTSÄUREMISCHUNG ENTHALTEN

Verfahren zur Herstellung von Mikroperlen die fettlösliche Substanzen enthalten

Verwendung von Retinoiden zur Verringerung von Hautbeschädigung

Verwendung von 9-cis-Retinsäure sowie ihre Salze und Ester, zur Behandlung von Epitheltumore

Lutein-enthaltende Zusammensetzung

Lutein-enthaltende Zusammensetzung, dadurch gekennzeichnet, dass die Zusammensetzung Lutein sowie Zink- und Kupferverbindungen, vorzugsweise in Form von Zinkgluconat und Kupfer(II)-gluconat, umfasst.

VERWENDUNG VON HEXATRIENDERIVATEN ZUR HERSTELLUNG VON MITTELN GEGEN AKNE, PSORIASIS UND LICHTSCHÄDEN DER HAUT.

Orale Zusammensetzungen umfassend pulverförmige Pflanzenextrakte

Trockene fließfähige Zusammensetzung umfassend Granulatpartikel, wobei die Granulatpartikel umfassen (a) einen pulverförmigen Pflanzenextrakt, (b) eine Trägermischung umfassend eine wasserlösliche Substanz, die ausgewählt ist aus einem Zucker und/oder Zuckeralkohol, und ein trennendes Agens in einem Gewichtsverhältnis von 1:1 oder höher und wahlweise (c) ein Netzmittel.

Mundspülöl mit Tocotrienol zur Pflege von Zahnfleisch, Zähnen und Mundhöhle

Mittel, bestehend aus einer lipophilen Substanz, die mittelkettige Fettsäuren enthält oder freisetzen kann mit 0,1% bis 70% Tocotrienolen, Derivaten von Tocotrienolen, Tocotrienol-reichen Fraktionen von Naturprodukten oder Mischungen davon für die Einbringung in die Mundhöhle zum Zweck der Pflege des Mund und Rachenraumes, der Gesundheit des Zahnfleisches und der Zähne und zur Behandlung von entzündlichen und anderen Erkrankungen in der Mundhöhle.

ZUSAMMENSETZUNG ENTHALTEND EIN ENZYM UND EINEN STAILITÄT DES ENZYMS ZU VERBESSERN, SEINEN ABBAU ZU VERHINDERN, UM ES ZU SCHÜTZEN UND/ODER UM ES ZU IMMOBILISIEREN

Verfahren zur Gewinnung einer angereicherten Population von siRNA-exprimierenden Zellen

Verfahren zur Verhütung der Hautalterung mittels Retinoiden

Oil-in-water-emulsion, useful e.g. in the non-therapeutic treatment of wrinkle, acne and impure skin, comprises a retinoid, a wax component, preferably pentaerythritol ester and/or dipentaerythritol ester, an oil component and water

Oil-in-water-emulsion (I) comprises at least a retinoid; 0.1-40 wt.% of at least a wax component with a melting point of at least 30[deg] C, preferably pentaerythritol ester, dipentaerythritol ester and/or tripentaerythritol ester; 1-30 wt.% of at least an oil component, which is liquid at 25[deg] C; and 40-95 wt.% of water.

GALENISCHE FORMULIERUNG

Ester des Retinols und/oder der Retinsäure enthaltende Aerosol-Inhalate.

Stabile Emulsionen und Trockenpulver von Mischungen fettlöslicher Vitamine, deren Herstellung und Verwendung

Zusammensetzung zur topischen Anwendung

Verwendung einer Zusammensetzung mit Vitaminen und anorganischen Salzen zur Verminderung des Haarausfalls und/oder zur Förderung des Nachwachsens des Haars

Kosmetische und/oder dermatologische Wirkstoffkombination

Kosmetische und/oder dermatologische O/W-Emulsion mit einem Gehalt an Retinoiden, Glycerylstearat und Cyclodextrinen.

Verwendung von Wirkstoffkombinationen zur Bekämpfung durch Propionibacterium acnes hervorgerufener unreiner Haut sowie leichter Formen der Akne

STERILES RETINOID ENTHALTENDES BIODEGRADIERBARES IMPLANTAT MIT VERBESSERTER BIOCOMPATIBILITÄT UND VERFAHREN ZU DESSEN HERSTELLUNG

PHARMACEUTICAL PREPARATIONS CONTAINING VITAMIN A DERIVATIVES

Pharmaceutical formulation for treating liver disorders

A pharmaceutical formulation comprising (a) an inorganic or organic selenium compound, preferably L-seleno-methionine; (b) ascorbic acid (Vitamin C) or a salt or ester thereof; (c) -tocopherol (Vitamin E) or derivative thereof; (d) methionine or cysteine or N-acetyl-cysteine or S-adenosyl-methionine; (e) Co-enzyme Q10 (Ubiquinone); (f) #-carotene and/or (g) Vitamin A (retinol) has been found to be an effective treatment for the symptoms of primary biliary cirrhosis (PBC). A preferred formulation comprising L-seleno-methionine, ascorbic acid, vitamin E, L-methionine, Co-enzyme Q10 and #-carotene was prepared in a gelatin capsule form and was tested clinically as a treatment for PBC. This formulation may also be useful in the treatment of other diseases besides PBC where an excess of free radicals may also play a causative role such as myocardial infarction or arthritis. It may also be useful in the treatment of inflammatory bowel diseases such as colitis, mitochondrial diseases such as Huntingdon's ...

Composition for the treatment of HIV and AIDS

A pharmaceutical composition for use in the treatment of the HIV virus or AIDS, for combined, sequential or simultaneous administration, in any form, via any biological route, comprising Vitamin A, Vitamin C, Vitamin E, and an average daily dosage of more than 20mcg of Selenium. In its optimal embodiment the composition consists of average daily dosages of approximately 1500mcg Vitamin A, 6mg Betacarotene, 15mg Vitamin B1, 10mg Vitamin B2, 20mg Vitamin B5, 20mg Vitamin B6, 15mcg Vitamin B12, 500mcg Folic acid, 300mg Vitamin C, 10mcg Vitamin D, 120mg Vitamin E, 95mcg Vitamin K, 6mg Iron, 100mg Magnesium, 15mg Zinc, 200mcg Iodine, 2mg Copper, 4mg Manganese, 200mcg Selenium, 100mcg Chromium, 40mg Cystine, 40mg Methionine, and 30mg Bioflavanoids.

VITAMIN COMPOSITIONS

IMPROVEMENTS IN OR RELATING TO ORGANIC COMPOUNDS

MEDICINAL COMPOSITION FOR THE TREATMENT OR PREVENTION OF ACNE BY ORAL ADMINISTRATION

PCT No. PCT/FR85/00011 Sec. 371 Date Jul. 11, 1985 Sec. 102(e) Date Jul. 11, 1985 PCT Filed Jan. 24, 1985 PCT Pub. No. WO85/03226 PCT Pub. Date Aug. 1, 1985.This composition contains, by way of main active principle, in a pharmaceutically acceptable carrier, at least one substance belonging to the carotenoid family and chosen, in particular, from the group consisting of alpha -carotene, delta -carotene, gamma -carotene, +62, beta -carotene-4,4'-dione, ethyl 8'-apo- beta -caroten-8'-oate, beta -apo-8'-carotenal, psi , psi -carotene, psi , psi -carotene-16,16'-diol and psi , psi -caroten-16-ol. This composition preferably contains from 0.001 to 10% by weight of active principle relative to the total weight of the composition and takes the form of a suspension, tablets or gelatin capsules. The pharmacological activity of this drug is an activity which inhibits comedo formation, the latter being due to an irritation caused by an excess of lipid oxide (oxidized squalene).

Pharmaceutically-active carotenoid antioxidants

Lutein and other hydrophillic carotenoids are disclosed for use in treatment by therapy or prophylaxis of diseases having an oxygenation mechanism. The carotenoids disclosed are especially useful in treatment of coronary heart disease and may be combined with eg aspirin.

COMPOSITION AND METHOD FOR TREATING ALCOHOL AND DRUG ADDICTS

Novel compounds

Prevention and/or treatment of neurodegenerative disease

A composition comprising at least one carotenoid selected from the group consisting of lutein, zeaxanthin and meso-zeaxanthin; and a composition comprising at least one omega-3 fatty acid; for use in the prevention and/or treatment of dementia in a human subject is provided. The omega-3 fatty acid is preferably docosahexaenoic acid (DHA). A further omega-3 fatty acid, preferably eicosapentaenoic acid (EPA) may be present. The omega-3 fatty acid is preferably provided as a component of fish oil. The composition comprising at least one carotenoid may contain each of lutein, zeaxanthin and meso-zeaxanthin. The compositions may be formulated for oral consumption, preferably in the form of a capsule or tablet. The form of dementia is preferably Alzheimer’s disease.

Vitamin compositions

A vitamin or mineral composition with enhanced bioavailability is disclosed including at least one vitamin or mineral, a polyoxyethylene sorbitan ester, and a diluent, such as polyols or vegetable oils.

COSMETIC COMPOSITION

Isomerization of Vitamin A Compounds

... 1,176,244. Isomerizing Vitamin A compounds. CHAS. PFIZER & CO. Inc. 17 May, 1967 [8 Nov., 1966], No. 22987/67. Addition to 1,053,574. Heading C2V. Isomers of Vitamin A, and esters thereof, of low biological activity, namely 9 cis, 9, 13dicis, 11cis and 11, 13di-cis isomers, are converted to mixtures of increased activity, mainly Vitamin A and neo-Vitamin A, and esters thereof, by reaction with iodine and a basic amine at 0‹ to 115‹ C. in an inert solvent. The basic amine may be used as a solvent. The iodine may be removed from the reaction mixture with a reducing agent, preferably an alkali metal borohydride. The reaction with the iodine and basic amine also improves the colour, odour and stability of the products of subsequent esterification or transesterification of Vitamin A compounds. In examples, Vitamin A acetate isomers are reacted with iodine and pyridine, the iodine being reduced with sodium borohydride.

Bioisosteric thyroid receptor ligands and method

DERMATOLOGICAL COMPOSITION

... 1487543 Dermatological compositions DSO PHARMACHIM 7 May 1976 [11 May 1975] 18963/76 Heading A5B A dermatological composition comprises from 5 to 10 parts by weight of ichthyol, from 0.05 to 0.1 part by weight of dexamethasone, from 0.5 to 1 part by weight of salicylic acid, from 0.1 to 0.3 part by weight of Vit. A, palmitate and, in an amount to make the composition up to 100 parts by weight, an ointment base.

COMPOSITIONS AND METHODS FOR TREATING METABOLIC DISEASES

In one aspect of the present invention, a pharmaceutical composition for treating a metabolic disease in a mammalian subject includes a therapeutically effective amount of (R)-all-trans-13,14-dihydroretinol and a pharmaceutically acceptable carrier or diluent. In another aspect of the present invention, pharmaceutical composition for treating a metabolic disease in a mammalian subject includes a therapeutically effective amount of (S)-all-trans-13,14-dihydroretinol and a pharmaceutically acceptable carrier or diluent. In a further aspect of the present invention, a method is provided for treating a metabolic disease in a mammalian subject. The method includes administering to the subject a pharmaceutical composition comprising at least one all-trans-13,14-dihydroretinoid, all-trans-13,14-dihydroretinoid derivative, or agent capable of modulating the level of at least one all-trans-13,14-dihydroretinoid or all-trans-13,14-dihydroretinoid derivative in the subject. 123-. (canceled)24. A method of treating obesity or an obesity related condition in a mammalian subject , the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising at least one all-trans-13 ,14-dihydroretinoid , all-trans-13 ,14-dihydroretinoid derivative , all-trans-retinol:all-trans-13 ,14-dihydroretinol saturase or a compound that modulates the level and/or activity of all-trans-retinol:all-trans-13 ,14-dihydroretinol saturase , wherein the obesity or obesity related condition is associated with improved glucose tolerance , abnormal fasting response manifested by visceral fat retention , or decreased hepatic triglyceride levels.25. The method of claim 24 , the pharmaceutical composition being administered to at least one cell expressing G-protein-coupled receptor 40 (GPR40) and/or a polynucleotide encoding GPR40.26. The method of claim 24 , the pharmaceutical composition promoting lipolysis in the subject.27. The method of claim 24 , ...

TRANSDERMAL ABSORPTION PROMOTER, AND EXTERNAL SKIN FORMULATION THEREOF

The present invention provides a substance which promotes the transdermal absorption of a pharmacologically active component while little irritating the skin. The present invention relates to a transdermal absorption promoter which comprises, as the active component, at least one member selected from among isopulegol, 2-(menthoxy)ethanol and 2-methyl-3-(menthoxy)propane-1,2-diol; and an external skin formulation which comprises a pharmacologically active component such as a psychotropic component, an anti-inflammatory component, an analgesic component, an antipyretic component, a whitening component or a hair growth-promoting component, together with the aforesaid transdermal absorption promoter. 1. A transdermal absorption promoter , comprising , as an active component , at least one member selected from the group consisting of isopulegol , 2-(menthoxy)ethanol and 2-methyl-3-(menthoxy)propane-1 ,2-diol.2. The transdermal absorption promoter according to claim 1 , which further comprises at least one component selected from the group consisting of menthol claim 1 , menthone claim 1 , camphor claim 1 , pulegol claim 1 , cineole claim 1 , 3-menthoxypropane-1 claim 1 ,2-diol claim 1 , N-alkyl-p-menthane-3-carboxamide claim 1 , 3-menthoxy-2-methylpropane-1 claim 1 ,2-diol claim 1 , p-menthane-3 claim 1 ,8-diol claim 1 , 3-menthoxypropan-1-ol claim 1 , 4-1-menthoxybutan-1-ol (menthyl 3-hydroxybutanoate) claim 1 , menthyl 3-hydroxybutanoate claim 1 , 1-(2-hydroxy-4-methyl-cyclohexyl)ethanone claim 1 , menthyl lactate claim 1 , menthol glycerol ketal claim 1 , N-methyl-2 claim 1 ,2-isopropylmethyl-3-methylbutaneamide claim 1 , menthyl glyoxylate claim 1 , menthyl succinate claim 1 , menthyl glutarate claim 1 , peppermint oil claim 1 , spearmint oil claim 1 , eucalyptus oil and mint oil.3. The transdermal absorption promoter according to claim 1 , which further comprises at least one warming substance selected from the group consisting of vanillyl ethyl ether claim 1 , ...

COSMETIC COMPOSITION CONTAINING RETINOL STABILIZED BY POROUS POLYMER BEADS AND NANOEMULSION

The present invention relates to a method for stabilizing retinol (Vitamin A), an unstable fat-soluble material, to use the same in cosmetics. The present invention provides an anti-inflammatory and skin wrinkle reducing cosmetic composition containing retinol stabilized by nano-emulsification, wherein a retinol polymer nanocapsule formed by capturing retinol with porous polymer particles is nano-emulsified by a mung bean MCT (medium chain triglyceride) extract and lecithin for stabilizing retinol. 1. An anti-inflammatory and skin wrinkle reducing cosmetic composition containing retinol stabilized by nano-emulsification , wherein a retinol polymer nanocapsule formed by adsorbing retinol with mesoporous polymer beads is nano-emulsified to a size of 50˜200 nm using a mung bean MCT (medium chain triglyceride) extract and lecithin to stabilize the retinol.2. The cosmetic composition of claim 1 , wherein the mesoporous polymer beads are made of polymethylmethacrylate crosslinked with ethyleneglycol dimethacrylate.3. The cosmetic composition of claim 1 , wherein the retinol claim 1 , an active ingredient claim 1 , is included in the retinol polymer nanocapsule in an amount of 0.5˜10 wt %.4. The cosmetic composition of claim 1 , wherein the lecithin is at least one selected from the group consisting of hydrogenated lecithin claim 1 , phosphatidylcholine claim 1 , phospholipid claim 1 , hydrogenated lysophosphatidylcholine claim 1 , hydrogenated lysolecithin claim 1 , hydroxylated lecithin claim 1 , and unsaturated lecithin.5. The cosmetic composition of claim 1 , wherein the stabilized retinol is included in an amount of 0.0001 wt %˜50 wt % based on a total amount of the cosmetic composition.6. The cosmetic composition of claim 1 , wherein the formulation of the cosmetic composition is soft wash claim 1 , nutritive wash claim 1 , massage cream claim 1 , nutritive cream claim 1 , skin packs claim 1 , gel claim 1 , skin cream claim 1 , lipstick claim 1 , makeup base claim 1 ...

Compositions and methods for treating Alzheimer's disease and related disorders and promoting a healthy nervous system

Methods of inhibiting the onset and progression of Alzheimer's disease (AD), mild cognitive impairment (MCI), and related neurodegenerative disorders involving amyloidosis are provided. The methods involve administering a composition comprising a therapeutically effective amount of D-pinitol to individuals who are at risk of developing the disease or have one or more symptoms of the disease. Also provided are methods of treating or preventing Alzheimer's disease or MCI that involve the use of such compositions. Also provided are methods of using D-pinitol to promote a healthy nervous system and as a food supplement. 1. A method of promoting a healthy nervous system comprising administering D-pinitol to an individual in an amount and for a period of time , to promote said healthy nervous system in said individual.2. The method of wherein said D-pinitol administered in said amount and said time to achieve a concentration of D-pinitol in blood or plasma of about 1 to 19 μM.3. The method of wherein said D-pinitol is administered to said individual at a daily dose of over 10 mg/kg.4. The method of wherein said D-pinitol is administered to said individual at a daily dose of about 80 to 100 mg/kg.5. The method of wherein said D-pinitol is administered orally.6. The method of wherein said D-pinitol is administered in a tablet.7. The method of wherein said D-pinitol is administered in a single claim 6 , daily dose.8. The method of wherein said D-pinitol is administered in two or more doses per day.9. The method of wherein said D-pinitol is administered in a food item.10. The method of further comprising restricting the caloric intake of said individual.11. The method of wherein said individual is a human.12. A method of supplementing a diet comprising ingesting D-pinitol at a predetermined interval and in an amount and for a period of time to achieve a concentration of D-pinitol in blood or plasma of about 1 to 19 μM claim 1 , to supplement said diet.13. The method of ...

MIR27B IS A NOVEL TARGET FOR TREATMENT OF LIVER FIBROSIS

Methods are provided for treating fibrosis of a tissue, including fibrosis of the liver, using combinations of antagomirs and/or locked nucleic acids. Compositions therefor are also provided. 1. A method of treating fibrosis of a tissue in a subject , or of reducing development of fibrosis of a tissue in a subject at risk of fibrosis of a tissue , comprising administering to the subject an amount of a combination of three different molecules , each molecule being , independently , a nucleic acid or nucleic acid analogue directed to microRNAs chosen from miR-23b , miR-27b and miR-24 , effective to treat fibrosis of the tissue or to reduce development of fibrosis of the tissue.2. The method of claim 1 , wherein the combination comprises three different molecules each directed to a different one of miR-23b claim 1 , miR-27b and miR-24.3. The method of claim 2 , wherein the three different molecules are nucleic acids claim 2 , each complementary to the microRNA it is targeted to.4. The method of claim 3 , wherein the nucleic acids are antagomirs claim 3 , each fully complementary to the microRNA it is targeted to.5. The method of claim 2 , wherein the three different molecules are nucleic acid analogues claim 2 , each complementary to the microRNA they are targeted to claim 2 , wherein the nucleic acid analogues are analogues by virtue of comprising a methylene bridge connecting a 2′-O atom and a 4′-C atom of at least one ribose thereof.6. The method of claim 5 , wherein the three different nucleic acids analogues are each fully complementary to the microRNA they are targeted to.7. The method of claim 1 , wherein the nucleic acids are ribonucleic acids.8. (canceled)9. The method of claim 1 , wherein the miR-23b has the sequence AUCACAUUGCCAGGGAUUACC (SEQ ID NO:1) claim 1 , wherein the miR-27b has the sequence UUCACAGUGGCUAAGUUCUGC (SEQ ID NO:2) claim 1 , and wherein the miR-24 has the sequence UGGCUCAGUUCAGCAGGAACAG (SEQ ID NO:3).11. The method of claim 1 , wherein one ...

RETINOID REPLACEMENTS AND OPSIN AGONISTS AND METHODS FOR THE USE THEREOF

Compositions of and methods for using synthetic retinoids as retinoid replacements and opsin agonists are provided. 158-. (canceled)59. A method of treating a visual disorder in an aging subject due to a deficiency of 11-cis retinal in an eye of the aging human subject , comprising:administering a therapeutically effective amount of a synthetic retinoid to an eye of the aging human subject in need of such, wherein the human subject has a deficiency of endogenous 11-cis-retinal in the eye and the synthetic retinoid is a cis-retinoid that forms a functional opsin/chromophore complex in the eye.60. The method of claim 59 , wherein the visual disorder associated with a deficiency of endogenous 11-cis-retinal in the eye is selected from decrease of night vision claim 59 , decrease of contrast sensitivity claim 59 , and age-related macular degeneration.61. The method of claim 60 , wherein the age-related macular degeneration (AMD) comprises dry AMD.62. The method of claim 59 , wherein the aging subject is at least 45 years old.63. The method of claim 59 , wherein administering the synthetic retinoid comprises locally administering to the eye of the human subject.64. The method of claim 63 , wherein the locally administering is by eye drops claim 63 , intraocular injection or periocular injection.65. The method of claim 63 , wherein administering the synthetic retinoid comprises systemically administering by an oral dosage form or an injection.67. The method of claim 59 , wherein the synthetic retinoid is 9-cis-retinal.68. A method of treating age-related macular degeneration (AMD) claim 59 , a decrease of night vision claim 59 , or a decrease of contrast sensitivity in an aging human subject claim 59 , comprising:administering a synthetic retinoid to an eye of the aging human subject, wherein the human subject has a deficiency of endogenous 11-cis-retinal in the eye and the synthetic retinoid is a cis-retinoid that forms a functional opsin/chromophore complex in the eye. ...

Anti-Cellulite Composition and Method of Treating Cellulite

A cellulite-reducing topical composition comprising a lecithin organogel, an ethylene oxide-propylene oxide-ethylene oxide triblock copolymer, caffeine, a retinoid, and optionally at least one vitamin, vitamin derivative or vitamin precursor. 1. A cellulite-reducing topical composition comprising:(a) about 5% to about 13% by weight of a lecithin organogel,(b) 1% to 3% by weight of a ethylene oxide-propylene oxide-ethylene oxide triblock copolymer,(c) 1% to 5% caffeine, and(d) a dermatologically acceptable carrier base.2. The cellulite reducing topical composition of further comprising about 0.1% to about 3.0% claim 1 , by weight claim 1 , of a retinoid.3. The cellulite reducing topical composition of wherein the retinoid is retinol.4. The cellulite reducing topical composition of further comprising about 0.1% to about 6.0% claim 1 , by weight claim 1 , of at least one vitamin claim 1 , vitamin derivative or vitamin precursor.5. The cellulite reducing topical composition of wherein the at least one vitamin derivative is tocopherol acetate claim 4 , ascorbyl palmitate claim 4 , or a mixture thereof.6. The cellulite reducing topical composition of wherein the organogel is comprised of soy lecithin and isopropyl palmitate.7Centella asiatica, Coleus forskolii, Ginkgo biloba. The cellulite reducing topical composition of wherein the organogel further comprises at least one anti-cellulite active ingredient selected from the group of: anti-inflammatory agents; extracts of ; ursolic acid; short-chain peptides having from 2 to 12 amino acids; MMP-inhibitors; theophylline and derivatives thereof; carnitine and derivatives thereof.8. The cellulite reducing topical composition of wherein the ethylene oxide-propylene oxide-ethylene oxide triblock copolymer comprises about 70% claim 1 , by weight claim 1 , ethylene oxide.9. A method of reducing cellulite in human skin claim 1 , and the visual manifestations thereof claim 1 , comprising the step of applying to the skin an amount of ...

Composition for Treating Phonatory and Olfactory Apparatus Disorders

A composition is described consisting of coenzyme Q10, vitamin A and suitable excipients for treating phonatory and olfactory apparatus disorders, such as anosmia and dysosmia. 1. Composition consisting of coenzyme Q10 , Vitamin A and pharmaceutically acceptable excipients.2. The composition of claim 1 , wherein coenzyme Q10 is in an amount of 1-25 wt % claim 1 , Vitamin A 0.3-10 wt % claim 1 , on the composition weight.3. The composition of claim 2 , wherein coenzyme Q10 is in an amount of 2-20 wt % claim 2 , Vitamin A 0.5-8 wt % claim 2 , on the composition weight.4. The composition of claim 3 , wherein coenzyme Q10 is in an amount of 3-15 wt % claim 3 , Vitamin A 1-6 wt % claim 3 , on the composition weight.5. The composition of claim 4 , wherein coenzyme Q10 is in an amount of 5-10 wt % claim 4 , Vitamin A 1.5-5 wt % claim 4 , on the composition weight.6. The composition of claim 1 , wherein said pharmaceutically acceptable excipients are colloidal silica claim 1 , dibasic calcium phosphate claim 1 , maltodextrins claim 1 , sugar esters claim 1 , microcrystalline cellulose claim 1 , lactose claim 1 , talc claim 1 , magnesium stearate claim 1 , calcium stearate claim 1 , aluminum silicate or magnesium silicate claim 1 , or mixtures thereof.7. (canceled)8. Method of treating phonatory apparatus disorders and olfactory apparatus disorders claim 1 , such as anosmia and dysosmia claim 1 , comprising the step of administering an effective amount of the composition of in a subject in need thereof.9. The method of claim 8 , wherein the composition is in the form of a unitary dose containing 3.3-83 mg of Coenzyme Q10 and 1-26.6 mg of Vitamin A.10. The method of claim 9 , wherein the composition is in the form of a unitary dose containing 15-35 mg of Coenzyme Q10 and 5-15 mg of Vitamin A.11. The method of claim 8 , wherein the composition is administered by oral claim 8 , inhalative claim 8 , aerosol claim 8 , spray claim 8 , transdermic claim 8 , intravenous claim 8 , ...

Cyclodextrin-Based Microemulsions, and Dermatological Uses Thereof

Described herein are cyclodextrin-stabilized microemulsion systems useful for increasing the solubility, stability, bioavailability, or safety of an active agent for delivery to the skin. The microemulsions may reduce the occurrence of skin irritation or odor upon application. In certain embodiments, the active agent is substantially insoluble in water. The microemulsions may be formulated as semi-solids, for example creams, or as aerosol or non-aerosol foams. Also described are methods of treating skin disorders, comprising the step of applying to an affected area of a subject in need thereof a therapeutically-effective amount of an inventive microemulsion. 1. A formulation comprisinga microemulsion; an active agent; a moisturizer or emollient; a third surfactant; an antioxidant or preservative; a viscosity modifying agent; and a pH adjuster.2. The formulation of claim 1 , wherein the microemulsion consists essentially of:(i)water, in an amount of about 80% by weight of the microemulsion;hydroxypropyl β-cyclodextrin, in an amount of about 5% by weight of the microemulsion; andcaprylocaproyl macrogol-8 glycerides or caprylocaproyl polyoxyl-8 glycerides, in an amount of about 15% by weight of the microemulsion; or(ii)water, in an amount of about 90% by weight of the microemulsion;hydroxypropyl β-cyclodextrin, in an amount of about 3% by weight of the microemulsion; andcaprylocaproyl macrogol-8 glycerides or caprylocaproyl polyoxyl-8 glycerides, in an amount of about 7% by weight of the microemulsion.3. The formulation claim 1 , wherein the active agent is selected from the group consisting of salicylic acid claim 1 , papain claim 1 , sulfur claim 1 , glycolic acid claim 1 , pyruvic acid claim 1 , resorcinol claim 1 , N-acetylcysteine claim 1 , retinoids such as retinoic acid (e.g. claim 1 , tretinoin) and its derivatives (e.g. claim 1 , cis and trans isomers claim 1 , esters) claim 1 , retinol claim 1 , alpha hydroxy acids claim 1 , beta hydroxy acids claim 1 , coal ...

Cyclodextrin-Based Microemulsions, and Dermatological Uses Thereof

Described herein are cyclodextrin-stabilized microemulsion systems useful for increasing the solubility, stability, bioavailability, or safety of an active agent for delivery to the skin. The microemulsions may reduce the occurrence of skin irritation or odor upon application. In certain embodiments, the active agent is substantially insoluble in water. 1. An active agent-containing microemulsion , consisting essentially of: an active agent and a microemulsion , wherein the microemulsion consists essentially of an aqueous phase , a first surfactant , and a second surfactant; and the first surfactant is a cyclodextrin or a derivative of a cyclodextrin.2. The active agent-containing microemulsion of claim 1 , wherein the active agent comprises retinol.3. The active agent-containing microemulsion of claim 1 , wherein the active agent is retinol.4. The active agent-containing microemulsion of claim 1 , wherein the active agent is present in an amount from about 0.01% to about 5% by weight of the active agent-containing microemulsion.5. The active agent-containing microemulsion of claim 1 , wherein the aqueous phase is present in an amount from about 75% to about 95% by weight of the microemulsion.6. The active agent-containing microemulsion of claim 1 , wherein the aqueous phase comprises a moisturizer or emollient.7. The active agent-containing microemulsion of claim 6 , wherein the moisturizer or emollient is selected from the group consisting of panthenol claim 6 , allantoin claim 6 , sodium hyaluraonate claim 6 , pentylene glycol claim 6 , and combinations/mixtures thereof.8. The active agent-containing microemulsion of claim 6 , wherein the moisturizer or emollient is present in an amount from about 0.8% to about 2.3% by weight of the aqueous phase.9. The active agent-containing microemulsion of claim 1 , wherein the aqueous phase comprises an anti-inflammatory agent.10. The active agent-containing microemulsion of claim 9 , wherein the anti-inflammatory agent is ...

Micro-RNA Family That Modulates Fibrosis and Uses Thereof

The present invention relates to the identification of a microRNA family, designated miR-29a-c, that is a key regulator of fibrosis in cardiac tissue. The inventors show that members of the miR-29 family are down-regulated in the heart tissue in response to stress, and are up-regulated in heart tissue of mice that are resistant to both stress and fibrosis. Also provided are methods of modulating expression and activity of the miR-29 family of miRNAs as a treatment for fibrotic disease, including cardiac hypertrophy, skeletal muscle fibrosis other fibrosis related diseases and collagen loss-related disease. 188-. (canceled)89. A method of inducing collagen deposition in a tissue of a subject in need thereof comprising contacting said tissue with an antisense oligonucleotide comprising a sequence that is at least partially complementary to a miR-29a , miR-29b , and/or miR-29c sequence.90. The method of claim 89 , wherein the antisense oligonucleotide comprises a sequence that is at least partially complementary to SEQ ID NO: 18 claim 89 , SEQ ID NO: 19 claim 89 , and/or SEQ ID NO: 20.91. The method of claim 90 , wherein the antisense oligonucleotide comprises a sequence that is at least 85% complementary to SEQ ID NO: 18 claim 90 , SEQ ID NO: 19 claim 90 , and/or SEQ ID NO: 20.92. The method of claim 90 , wherein the antisense oligonucleotide comprises a sequence that is at least 95% complementary to SEQ ID NO: 18 claim 90 , SEQ ID NO: 19 claim 90 , and/or SEQ ID NO: 20.93. The method of claim 90 , wherein the antisense oligonucleotide comprises a sequence that is 100% complementary to SEQ ID NO: 18 claim 90 , SEQ ID NO: 19 claim 90 , and/or SEQ ID NO: 20.94. The method of claim 89 , wherein the antisense oligonucleotide comprises a sequence that is substantially complementary to a pre-miR-29a claim 89 , pre-miR-29b claim 89 , or pre-miR-29c sequence.95. The method of claim 89 , wherein the antisense oligonucleotide is about 15 to about 50 nucleotides in length.96. ...

Method for Treating Hearing Loss

A method of treating hearing loss includes the step administering a composition to the mammal, wherein the composition consists essentially of a biologically effective amount of vitamin A, vitamin E, vitamin C, a vasodilator comprising magnesium, and, optionally, a withanolide, and/or resveratrol. 1. A method of treating hearing loss , said method comprising the step of internally administering a composition to the mammal , wherein the composition consists essentially of a biologically effective amount of vitamin A , vitamin E , vitamin C , a vasodilator comprising magnesium , and , optionally , a withanolide , and/or resveratrol.2. A method as set forth in wherein the step of internally administering the composition is further defined as orally administering the composition to the mammal.3. A method as set forth in wherein the step of internally administering the composition is further defined as intravenously administering the composition to the mammal.4. A method as set forth in further comprising the step of detecting hearing loss in a mammal.5. A method as set forth in wherein the step of internally administering the composition occurs prior to the step of detecting the hearing loss in the mammal.6. A method as set forth in wherein an average difference in threshold shift in mammals from baseline threshold sensitivity at 4 claim 5 , 8 claim 5 , and 16 kHz claim 5 , as compared to an untreated control claim 5 , is at least 25 decibels when the trauma results from exposure to 120 decibel SPL Octave Band Noise centered at 4 kHz for five hours.7. A method as set forth in wherein the composition further comprises resveratrol.8. A method as set forth in wherein the vitamin A is present in the composition in an amount of at least 830 IU.9. A method as set forth in wherein the vitamin C is present in the composition in an amount of at least 4 claim 1 ,000 IU.10. A method as set forth in wherein the vitamin E is further defined as a water-soluble analogue of alpha- ...

ZEAXANTHIN-ENRICHED POULTRY EGG

An object of the present invention is to provide zeaxanthin-enriched poultry eggs containing zeaxanthin at high concentrations. The present invention specifically relates to zeaxanthin-enriched poultry eggs obtained by feeding poultry with a poultry feedstuff containing zeaxanthin-producing bacteria. 1. A poultry egg containing zeaxanthin in yolk at 3.5 mg to 10 mg per 100 g of yolk.2. The poultry egg according to claim 1 , wherein the poultry are chickens.3. A zeaxanthin-enriched poultry egg claim 1 , which is obtained by feeding poultry with a poultry feedstuff containing zeaxanthin-producing bacteria.4Paracoccus.. The zeaxanthin-enriched poultry egg according to claim 3 , wherein the bacteria belong to the genus5. The zeaxanthin-enriched poultry egg according to claim 3 , wherein the amount of zeaxanthin in the feedstuff is 1 mg or more per 100 g of the feedstuff.6. The zeaxanthin-enriched poultry egg according to claim 3 , containing zeaxanthin in yolk at 1.5 mg to 10 mg per 100 g of yolk.7. The zeaxanthin-enriched poultry egg according to claim 3 , wherein the poultry are chickens.8. A method for producing a zeaxanthin-enriched poultry egg comprising a step of feeding poultry with a poultry feedstuff containing zeaxanthin-producing bacteria.9Paracoccus.. The method according to claim 8 , wherein the bacteria belong to the genus10. The method according to claim 8 , wherein the amount of zeaxanthin in the feedstuff is 1 mg or more per 100 g of the feedstuff.11. The method according to claim 8 , wherein the zeaxanthin-enriched poultry egg contains zeaxanthin in yolk at 1.5 mg to 10 mg per 100 g of yolk.12. The method according to claim 8 , wherein the poultry are chickens.13. A poultry feedstuff containing zeaxanthin-producing bacteria.14Paracoccus.. The poultry feedstuff according to claim 13 , wherein the bacteria belong to the genus15. The poultry feedstuff according to claim 13 , wherein the amount of zeaxanthin to be added is 1 mg or more per 100 g of the ...

AQUEOUS OPHTHALMIC COMPOSITION

This invention relates to an aqueous ophthalmic composition comprising (A) polyoxyethylene castor oil in which the number of moles of added ethylene oxide is 2 to 30, and (B) at least one member selected from the group consisting of castor oil and vitamin A. According to the aqueous ophthalmic composition of the present invention, the defoaming time can be reduced even when foam is generated by vibration or impact. 1. An aqueous ophthalmic composition comprising (A) polyoxyethylene castor oil in which the number of moles of added ethylene oxide is 2 to 30 , and (B) at least one member selected from the group consisting of castor oil and vitamin A.2. The aqueous ophthalmic composition according to claim 1 , wherein component (A) is polyoxyethylene castor oil in which the average number of moles of added ethylene oxide is 2 to 12.3. The aqueous ophthalmic composition according to claim 1 , wherein the total content of component (A) is 0.0005 to 5 w/v % based on the total amount of the aqueous ophthalmic composition.4. The aqueous ophthalmic composition according to claim 2 , wherein the total content of component (A) is 0.0005 to 5 w/v % based on the total amount of the aqueous ophthalmic composition.5. The aqueous ophthalmic composition according to claim 1 , which further comprises at least one member selected from the group consisting of boric acids and salts thereof.6. The aqueous ophthalmic composition according to claim 2 , which further comprises at least one member selected from the group consisting of boric acids and salts thereof.7. The aqueous ophthalmic composition according to claim 3 , which further comprises at least one member selected from the group consisting of boric acids and salts thereof.8. The aqueous ophthalmic composition according to claim 4 , which further comprises at least one member selected from the group consisting of boric acids and salts thereof.9. The aqueous ophthalmic composition according to claim 1 , which further comprises at ...

ZEAXANTHIN FOR TUMOR TREATMENT

A composition comprising a pharmaceutically effective amount of zeaxanthin or its derivative for use in treating a malignant tumor and a method of using a pharmaceutically effective amount of zeaxanthin or its derivative either alone or together with one or more pharmaceutical agents for treating a malignant tumor. The tumor may be, but is not limited to breast cancer, cervix cancer, colon cancer, cutaneous melanoma, cutaneous squamous carcinoma, hepatocellular carcinoma, lung cancer, osteosarcoma, prostate cancer, and uveal melanoma. The pharmaceutically effective amount of zeaxanthin is generally above about 0.5 mg/kg/d to about 20 mg/kg/d. 19-. (canceled)10. A method of treating a malignant tumor comprising administering a composition comprising zeaxanthin in combination with one or more anti-malignant tumor agents to a subject in need thereof.11. The method of claim 10 , wherein the composition further comprises one or more pharmaceutically acceptable additives claim 10 , excipient claim 10 , adjuvant or carriers.12. The method of claim 10 , wherein the anti-malignant tumor agent is selected from 5-Fluorouracil claim 10 , Adriamycin claim 10 , Cytoxan claim 10 , Cisplatin claim 10 , and Avastin®.13. The method of claim 10 , wherein the subject is a patient diagnosed with a malignant tumor.14. The method of claim 10 , wherein the zeaxanthin is administered in an amount sufficient to induce apoptosis of the malignant tumor.15. The method of claim 10 , wherein the zeaxanthin is administered in an amount sufficient to delay progression of the malignant tumor.16. The method of claim 10 , wherein apoptosis is induced in the malignant tumor cells when exposed to zeaxanthin and wherein apoptosis is not induced in non-malignant tumor cells.17. The method of claim 10 , wherein the malignant tumor is selected from breast cancer claim 10 , cervix cancer claim 10 , colon cancer claim 10 , cutaneous melanoma claim 10 , cutaneous squamous carcinoma claim 10 , hepatocellular ...

EMULSIONS PROVIDING STABLE VITAMIN COMPOSITIONS AND METHODS OF FORMING COMPOSITIONS THEREOF

Stable vitamin oil-in-water emulsions and methods of making those emulsions are described herein. The emulsions may be used to make beverage products that include fat-soluble vitamins. The emulsions may also be used in beverage products that are colored and which maintain color stability for an extended period of time. 1. An oil-in-water emulsion comprising:an oil phase wherein the primary oil among all oils in said oil phase is limonene;wherein up to about 40% by weight of all oils in said oil phase are selected from the group consisting of corn oil, sunflower oil, soybean oil, and combinations thereof;beta-carotene in an amount between about 1% and about 5% by weight; anda surfactant portion of a quillaja extract in an amount between about 2.5% to about 20% by weight.2. The oil-in-water emulsion of further comprising water in an amount of no more than about 50% by weight.3. The oil-in-water emulsion of further comprising vitamin E in an amount of about 0.1% to about 5% by weight.4. (canceled)5. (canceled)6. The oil-in-water emulsion of wherein said limonene is present in an amount of about 15% to about 50% by weight.7. (canceled)8. The oil-in-water emulsion of wherein up to about 10% of all oils in said oil phase are oils other than limonene.9. The oil-in-water emulsion of wherein said oils other than limonene consist of saturated and monounsaturated fatty acids.10. (canceled)11. (canceled)12. The oil-in-water emulsion of wherein a source of said quillaja extract is Q-Naturale.13. The oil-in-water emulsion of wherein said oil phase comprises particles with an average size of about 0.1 microns to about 0.5 microns.14. (canceled)15. The oil-in-water emulsion of wherein said emulsion is photostable for at least about 4 months.16. An oil-in-water emulsion comprising:an oil phase wherein the primary oil among all oils in said oil phase is limonene;wherein up to about 30% by weight of all oils in said oil phase are carrier oils;vitamin A in an amount between about 1% ...

RETINOID REPLACEMENTS AND OPSIN AGONISTS AND METHODS FOR THE USE THEREOF

Compositions of and methods for using synthetic retinoids as retinoid replacements and opsin agonists are provided. 158-. (canceled)59. A method of treating a visual disorder in an aging subject due to a deficiency of 11-cis retinal in an eye of the aging human subject , comprising:administering a therapeutically effective amount of a synthetic retinoid to an eye of the aging human subject in need of such, wherein the human subject has a deficiency of endogenous 11-cis-retinal in the eye and the synthetic retinoid is a cis-retinoid that forms a functional opsin/chromophore complex in the eye.60. The method of claim 59 , wherein the visual disorder associated with a deficiency of endogenous 11-cis-retinal in the eye is selected from decrease of night vision claim 59 , decrease of contrast sensitivity claim 59 , and age-related macular degeneration.61. The method of claim 60 , wherein the age-related macular degeneration (AMD) comprises dry AMD.62. The method of claim 59 , wherein the aging subject is at least 45 years old.63. The method of claim 59 , wherein administering the synthetic retinoid comprises locally administering to the eye of the human subject.64. The method of claim 63 , wherein the locally administering is by eye drops claim 63 , intraocular injection or periocular injection.65. The method of claim 63 , wherein administering the synthetic retinoid comprises systemically administering by an oral dosage form or an injection.67. The method of claim 59 , wherein the synthetic retinoid is 9-cis-retinal.68. A method of treating age-related macular degeneration (AMD) claim 59 , a decrease of night vision claim 59 , or a decrease of contrast sensitivity in an aging human subject claim 59 , comprising:administering a synthetic retinoid to an eye of the aging human subject, wherein the human subject has a deficiency of endogenous 11-cis-retinal in the eye and the synthetic retinoid is a cis-retinoid that forms a functional opsin/chromophore complex in the eye. ...

COMPOSITION FOR REGENERATING NORMAL TISSUE FROM FIBROTIC TISSUE

The present invention relates to a pharmaceutical composition and a method for regenerating normal tissue from fibrotic tissue, the pharmaceutical composition and the method employing a collagen-reducing substance. In accordance with the present invention, normal tissue can be therapeutically regenerated from fibrotic tissue.

Aqueous Ophthalmic Composition

The present invention relates to an aqueous ophthalmic composition comprising (A) polyoxyethylene castor oil, (B) polyethylene glycol monostearate, and (C) at least one member selected from the group consisting of sesame oil, castor oil, vitamin A, and chlorobutanol. 1. An aqueous ophthalmic composition , comprising (A) polyoxyethylene castor oil , (B) polyethylene glycol monostearate , and (C) at least one member selected from the group consisting of sesame oil , castor oil , vitamin A , and chlorobutanol.2. The aqueous ophthalmic composition according to claim 1 , further comprising (D) a buffer.3. The aqueous ophthalmic composition according to claim 1 , further comprising (E) a surfactant other than components (A) and (B).4. The aqueous ophthalmic composition according to claim 1 , wherein the aqueous ophthalmic composition is eye drops claim 1 , an eye wash claim 1 , a solution for wearing a contact lens claim 1 , or a contact lens care solution.57-. (canceled)8. The aqueous ophthalmic composition according to claim 2 , further comprising (E) a surfactant other than components (A) and (B).9. The aqueous ophthalmic composition according to claim 2 , wherein the aqueous ophthalmic composition is eye drops claim 2 , an eye wash claim 2 , a solution for wearing a contact lens claim 2 , or a contact lens care solution.10. The aqueous ophthalmic composition according to claim 8 , wherein the aqueous ophthalmic composition is eye drops claim 8 , an eye wash claim 8 , a solution for wearing a contact lens claim 8 , or a contact lens care solution.11. The aqueous ophthalmic composition according to claim 1 , wherein total content of component (C) is 0.00002 to 10 claim 1 ,000 parts by weight based on 1 part by weight of total content of component (A).12. The aqueous ophthalmic composition according to claim 1 , wherein total content of component (C) is 0.00002 to 10 claim 1 ,000 parts by weight based on 1 part by weight of total content of component (B).13. The aqueous ...

DRY GLASSY COMPOSITION COMPRISING A BIOACTIVE MATERIAL

The present invention relates to formulations and methods for stabilizing and protecting of biologic materials during harsh storing and use conditions, wherein the formulations relate to embedded bioactive materials and biologics, including live bacteria, in a protective glassy matrix. 1. A composition , comprising a bioactive material , at least one matrix forming agent and at least two glass forming agents.2. The composition of claim 1 , wherein the composition is a dry glassy composition comprising a bioactive material3. The composition of claim 1 , wherein the formulation comprises total solids ranging from about 30 weight percent to about 70 weight percent.4. The composition of claim 1 , wherein the bioactive material comprises a cell claim 1 , a microbe claim 1 , a virus claim 1 , a cell culture claim 1 , a bacteria claim 1 , a probiotic bacteria claim 1 , a plant and soil probiotic bacteria claim 1 , a yeast claim 1 , a protein claim 1 , a recombinant protein claim 1 , an enzyme claim 1 , a peptide claim 1 , a hormone claim 1 , a vaccine claim 1 , a drug claim 1 , an antibiotic claim 1 , a vitamin claim 1 , a carotenoid claim 1 , a mineral claim 1 , a microbiocide claim 1 , a fungicide claim 1 , a herbicide claim 1 , an insecticide or a spermicide.5. The composition according to wherein the matrix forming agent is a polysaccharide selected from the group consisting of: cellulose acetate phthalate (CAP) claim 1 , carboxy-methyl-cellulose claim 1 , pectin claim 1 , sodium alginate claim 1 , salts of alginic acid claim 1 , hydroxylpropyl methyl cellulose (HPMC) claim 1 , methyl cellulose claim 1 , carrageenan claim 1 , guar gum claim 1 , gum acacia claim 1 , xanthan gum claim 1 , locust bean gum claim 1 , chitosan and chitosan derivatives claim 1 , starches and modified starches claim 1 , cyclodextrins claim 1 , inulin claim 1 , maltodextrins claim 1 , dextrans claim 1 , and combinations thereof.6. The composition of claim 1 , wherein the matrix forming agent is ...

METHODS OF TREATING DISEASES ASSOCIATED WITH HIGH-FAT DIET AND VITAMIN A DEFICIENCY USING RETINOIC ACID RECEPTOR AGONISTS

This invention relates to pharmaceutical composition and methods of using vitamin A and/or RARβ agonist for the treatment or prevention of diseases or conditions associated with high fat diet and/or vitamin deficiency. 1. A method of treating or preventing a pancreatic disease in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).2. The method of claim 1 , wherein said pancreatic disease is associated with obesity.3. The method of claim 1 , wherein said pancreatic disease is caused by a high fat diet.4. The method of claim 1 , wherein said pancreatic disease is diabetes.5. The method of claim 1 , wherein said diabetes is type I or type II diabetes claim 1 , or gestational diabetes.6. The method of claim 1 , wherein said pancreatic disease is associated with reduced vitamin A level in the pancreas.7. A method of treating or preventing the degeneration of pancreatic beta cells in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).8. A method of maintaining or improving the function of pancreatic beta cells in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).9. A method of maintaining or improving pancreatic insulin secretion in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).10. A method of maintaining or improving insulin sensitivity in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).11. A method of maintaining or improving the level of glucagon in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).12. A method of treating or preventing fat deposit in a subject comprising administering to said subject vitamin .A or an agonist of retinoic acid receptor-beta (RARβ).13. A method of treating or ...

ENCAPSULATION OF HYDROPHOBIC BIOLOGICALLY ACTIVE COMPOUNDS

A composition comprising hydrophobic droplets coated by a shell and dispersed in a matrix and a consumable product comprising the composition are provided. The hydrophobic droplets comprise a hydrophobic compound, the shell comprises an irreversibly denatured protein, and the matrix comprises a protein, a starch, and a polysaccharide. Also provided are methods for preparing the composition and the consumable product. 1. A composition comprising hydrophobic droplets coated by a shell and dispersed in a matrix , wherein the hydrophobic droplets comprise a hydrophobic compound , wherein the shell comprises an irreversibly denatured protein , wherein the matrix comprises a protein , a starch , and a polysaccharide , and wherein the composition comprises less than 20 wt % water.2. The composition of claim 1 , wherein the hydrophobic compound is a bioactive agent selected from the group consisting of vitamins claim 1 , antibiotics claim 1 , carotenoids claim 1 , plant extracts claim 1 , fruit extracts claim 1 , vegetable extracts claim 1 , antioxidants claim 1 , lipids claim 1 , steroids claim 1 , phytochemicals and drugs.3. The composition of claim 1 , wherein the irreversibly denatured protein is prepared by applying two different external stressors claim 1 , wherein each external stressor is selected from the group consisting of an acid claim 1 , a base claim 1 , an inorganic salt claim 1 , an enzyme claim 1 , an organic solvent claim 1 , heat and sheer force claim 1 , and a combination thereof.4. The composition of claim 1 , wherein the hydrophobic droplets have a particle size within the range of 0.1 μm to 5.0 μm.5. The composition of claim 1 , wherein the ratio between the irreversibly denatured protein and the hydrophobic droplet is within the range of 0.1:1 to 1:1 by weight.6. The composition of claim 1 , wherein the protein is a globular or randomly coiled protein.7. The composition of claim 6 , wherein the globular or randomly coiled protein is selected from the ...

ZEAXANTHIN FOR TUMOR TREATMENT

A composition comprising a pharmaceutically effective amount of zeaxanthin or its derivative for use in treating a malignant tumor and a method of using a pharmaceutically effective amount of zeaxanthin or its derivative either alone or together with one or more pharmaceutical agents for treating a malignant tumor. The tumor may be, but is not limited to breast cancer, cervix cancer, colon cancer, cutaneous melanoma, cutaneous squamous carcinoma, hepatocellular carcinoma, lung cancer, osteosarcoma, prostate cancer, and uveal melanoma. The pharmaceutically effective amount of zeaxanthin is generally above about 0.5 mg/kg/d to about 20 mg/kg/d. 1. A method of treating a malignant tumor in a human patient by administering to said patient a composition comprising a pharmaceutically effective amount of zeaxanthin or a zeaxanthin derivative , wherein the zeaxanthin derivative is a derivative selected from the group consisting of an aldehyde , a dialdehyde , a ketone , a carboxylic acid , an epoxide , a furanoxide , a gamma-lactone , an alpha-hydroxy ketone , a diol , an acetal , a ketal , a halogenated derivative , an acetylated derivative , a derivative containing one or more alkynic bonds , and combinations thereof.2. The method of claim 1 , wherein said malignant tumor is a malignant tumor selected from the group consisting of breast cancer claim 1 , cervix cancer claim 1 , colon cancer claim 1 , cutaneous melanoma claim 1 , cutaneous squamous carcinoma claim 1 , hepatocellular carcinoma claim 1 , lung cancer claim 1 , osteosarcoma claim 1 , prostate cancer claim 1 , and uveal melanoma.3. The method of claim 2 , wherein the pharmaceutically effective amount of zeaxanthin is about 0.5 mg/kg/d to about 20 mg/kg/d.4. The method of claim 2 , wherein the pharmaceutically effective amount of zeaxanthin is about 2.5 mg/kg/d.5. The method of claim 1 , wherein the administration is an oral administration claim 1 , a topical administration claim 1 , a nasal administration claim ...

COMBINATION OF A RETINOID AND A DIOL AND POLYUNSATURATED FATTY ACID ESTER

The present invention concerns a combination of a retinoid and a diol and polyunsaturated fatty acid ester, a dermatological or dermocosmetic composition containing such a combination and use of same in the treatment of acne and the prevention of retentional lesions. The present invention also concerns a retinoid, optionally in combination with a diol and polyunsaturated fatty acid ester, for use in the prevention of retentional lesions. 118-. (canceled)20. The combination according to claim 19 , wherein n is between 1 and 10.21. The combination according to claim 20 , wherein n is 1 claim 20 , 2 claim 20 , 3 claim 20 , 4 or 5.22. The combination according to claim 19 , wherein m is 0 or 1.23. The combination according to claim 19 , wherein the polyunsaturated fatty acid is selected from α-linolenic acid claim 19 , stearidonic acid claim 19 , eicosatrienoic acid claim 19 , eicosatetraenoic acid claim 19 , eicosapentaenoic acid claim 19 , docosapentaenoic acid claim 19 , docosahexaenoic acid claim 19 , tetracosapentaenoic acid claim 19 , tetracosahexaenoic acid claim 19 , linoleic acid claim 19 , gamma-linolenic acid claim 19 , eicosadienoic acid claim 19 , dihomo-gamma-linolenic acid claim 19 , arachidonic acid claim 19 , docosatetraenoic acid claim 19 , docosapentaenoic acid claim 19 , adrenic acid and calendic acid.24. The combination according to claim 23 , wherein the polyunsaturated fatty acid is α-linolenic acid claim 23 , stearidonic acid or linoleic acid.26. The combination according to claim 19 , wherein the retinoid is selected from retinol claim 19 , retinaldehyde claim 19 , and retinoic acid in its various stereoisomeric forms.28. A method for preventing the formation of retentional lesions or for treating acne comprising the administration to a patient in need thereof of an effective amount of a combination according to .29. A dermatological or dermocosmetic composition comprising at least one combination according to in association with at least one ...

CONTROLLED RELEASE MUCOADHESIVE SYSTEMS

Formulations for chemoprevention of oral cancer and precancerous lesions, and for methods for preparing the formulations are described. 157.-. (canceled)58. A formulation , comprising:from about 5 wt % to about 95 wt %, based on the total weight of the formulation, mucoadhesive material, wherein the mucoadhesive material comprises a methacrylate copolymer;an effective amount of fenretinide or a pharmaceutically acceptable salt thereof;a transmucosal permeation enhancer agent comprising a mixture of:from about 1 wt % to about 2.5 wt %, based on the total weight of the formulation, propylene glycol (PG), andfrom 1 wt % to about 5 wt %, based on the total weight of the formulation, menthol; and,at least one solubilizer agent selected from the group consisting of a nonionic surfactant, a bile salt, a phospholipid, a polymeric solubilizer, and combinations thereof.59. The formulation of claim 58 , wherein the at least one solubilizer agent is selected from the group consisting of sodium deoxycholate claim 58 , a polyoxy-ethylene-sorbitan higher fatty acid ester claim 58 , a polyoxyethylene (20) oleyl ether claim 58 , and combinations thereof.60. The formulation of claim 58 , wherein the fenretinide and the permeation enhancer agent are adapted to be in contact with the same mucosal membrane.61. The formulation of claim 60 , wherein the mucosal membrane is the buccal mucosa.62. A mouth product comprising the formulation of claim 58 , wherein the mouth product is selected from the group consisting of a toothpaste claim 58 , a mouthwash or mouth rinse claim 58 , a gel or paste claim 58 , a spray claim 58 , a chewing gum claim 58 , and a lozenge.63. The formulation of claim 58 , wherein the formulation contains a predetermined amount of fenretinide in an amount selected from the group consisting of 10 μg claim 58 , 15 μg claim 58 , 25 μg claim 58 , 50 μg claim 58 , 100 μg claim 58 , 500 μg claim 58 , 1 mg claim 58 , 2 mg claim 58 , 3 mg claim 58 , 4 mg claim 58 , 5 mg claim ...

Anxiolytic Effect of Pterostilbene

We report for the first time that pterostilbene, a natural analog of resveratrol, shows anxiolytic-like action by downregulating phosphorylated levels of ERKs in the hippocampus of mice. Mice administered pterostilbene (1-10 mg/kg BW) by oral gavage were subjected to the Elevated-plus maze (EPM) test. Pterostilbene manifested anxiolytic activity at 1 and 2 mg/kg doses, demonstrated by an increase in percent permanence time and number of entries in open arms, critical determinants correlated with anxiety. This anxiolytic activity of pterostilbene was comparable to that of diazepam at 1 and 2 mg/kg in the EPM. The percent traveled distance and the percent permanence time in the enclosed arms were decreased with the 1 and 2 mg/kg doses. The 5 and 10 mg/kg doses did not show any anxiolytic effect. Locomotor activity was unaffected in all doses. Western blot analysis corroborated the observed behaviors in the EPM, revealing a decrease in both ERK1 and ERK2 phosphorylation in hippocampal homogenates from mice treated with 1 and 2 mg/kg doses; the 5 and 10 mg/kg doses showed no significant effect on the phosphorylation of ERKs. Pterostilbene was detected in serum and brain tissue following a single oral administration, demonstrating that the compound can cross the blood-brain barrier to reach the brain regions, including hippocampus, and thereby exert its anxiolytic effect. Resveratrol, the parent molecule of pterostilbene, did not have any anxiolytic effect. 117-. (canceled)18. A method for treating an anxiety disorder in a subject in need thereof , comprising administering to the subject a pharmaceutical or nutraceutical composition comprising a therapeutically effective amount of pterostilbene wherein a therapeutic anxiolytic effect results after a single administration of said therapeutically effective amount of pterostilbene and said therapeutic anxialytic effect is comparable to the therapeutic anxiolytic effect of Diazepam , a positive anxiolytic control , and is ...

METHOD FOR PRODUCING A FLURANE COMPLEX

The invention relates to a method for producing a flurane complex, comprising the following steps: producing an aqueous solution of sulfobutylether-β-cyclodextrin (SBECD); controlling the temperature of said solution to a temperature of from 2 to 15° C.; adding the flurane to the aqueous solution; allowing the solution to react to produce the complex; and separating the complex. 1. A method for producing a flurane complex , characterized by the following steps:a. preparing an aqueous solution of sulfobutylether-β-cyclodextrin (SBECD),b. controlling the temperature of said solution to a temperature of from 2 to 15° C.,c. adding the flurane to the aqueous solution,d. allowing the reaction to produce the complex,e. separating off the complex.2. The method as claimed in claim 1 , characterized in that the aqueous solution prepared in step a. comprises SBECD at a concentration of from 5 to 20% by weight claim 1 , preferably 10 to 15% by weight.3. The method as claimed in or claim 1 , characterized in that the flurane in step c. is added in a molar ratio to the SBECD of from 4:1 to 1:1 claim 1 , preferably from 3:1 to 2:1.4. The method as claimed in any of to claim 1 , characterized in that the complex is separated off by freeze-drying.5. The method as claimed in any of to claim 1 , characterized in that the flurane is selected from the group consisting of sevoflurane claim 1 , enflurane claim 1 , isoflurane claim 1 , desflurane and methoxyflurane.6. The method as claimed in claim 5 , characterized in that the flurane is sevoflurane.7. A complex of SBECD and a flurane claim 5 , obtainable by a method as claimed in any of to .8. The complex as claimed in claim 7 , characterized in that the flurane content is greater than 8% by weight claim 7 , preferably greater than 8.2% by weight claim 7 , more preferably greater than 8.5% by weight.9. The complex as claimed in or claim 7 , characterized in that the flurane is sevoflurane.10. The complex as claimed in any of to claim 7 , ...

Zeaxanthin Formulations With Additional Ocular-Active Nutrients, For Protecting Eye Health And Treating Eye Disorders

Oral formulations for promoting eye health, and in particular for preventing or treating macular degeneration, are disclosed, containing zeaxanthin, a carotenoid pigment, and at least two or more additional ocular-active nutrients selected from lipoic acid, omega-3 fatty acids, plant-derived compounds such as flavonoids, anthocyanins, or polyphenolics, taurine, carnitine, Coenzyme-Q10, carnosine, and nutrients that stimulate the production of glutathione. Processes are disclosed for identifying ocular-active nutrients that will interact in a synergistic and potentiating manner with zeaxanthin, to provide better and more effective protection, for eye health, than can be provided by zeaxanthin alone. Additional optional agents include zinc, vitamin E, and vitamin C. 14-. (canceled)5. A nutritional supplement for eye health , comprising: (a) at least 0.5 mg of zeaxanthin, the zeaxanthin being present in the 3R-3R′ stereoisomer form and is substantially free of meso-zeaxanthin stereoisomers,', '(b) zinc in an amount that does not exceed 40 mg,', '(c) vitamin E, and', '(d) vitamin C., 'a capsule or tablet for oral ingestion that includes a composition comprising'}6. The nutritional supplement of claim 5 , wherein the composition further includes omega-3 fatty acids.7. The nutritional supplement of claim 6 , wherein the composition further includes a lipoic acid8. The nutritional supplement of claim 7 , wherein the composition further includes lutein.9. The nutritional supplement of claim 5 , wherein the composition further includes lutein.10. The nutritional supplement of claim 9 , wherein the composition further includes omega-3 fatty acids11. The nutritional supplement of claim 9 , wherein the composition further includes mixed tocopherols.12. The nutritional supplement of claim 5 , wherein vitamin C is in the form of ascorbic acid.13. The nutritional supplement of claim 5 , wherein the capsule or table provides a daily dosage of the ingredients to the user that is ...

METHODS OF TREATING DISEASES ASSOCIATED WITH HIGH-FAT DIET AND VITAMIN A DEFICIENCY USING RETINOIC ACID RECEPTOR AGONISTS

This invention relates to pharmaceutical composition and methods of using vitamin A and/or RARβ agonist for the treatment or prevention of diseases or conditions associated with high fat diet and/or vitamin deficiency. 1. A method of treating or preventing a pancreatic disease in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).2. The method of claim 1 , wherein said pancreatic disease is associated with obesity.3. The method of claim 1 , wherein said pancreatic disease is caused by a high fat diet.4. The method of claim 1 , wherein said pancreatic disease is diabetes.5. The method of claim 1 , wherein said diabetes is type I or type II diabetes claim 1 , or gestational diabetes.6. The method of claim 1 , wherein said pancreatic disease is associated with reduced vitamin A level in the pancreas.7. A method of treating or preventing the degeneration of pancreatic beta cells in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).8. A method of maintaining or improving the function of pancreatic beta cells in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).9. A method of maintaining or improving pancreatic insulin secretion in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).10. A method of maintaining or improving insulin sensitivity in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).11. A method of maintaining or improving the level of glucagon in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).12. A method of treating or preventing fat deposit in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).13. A method of treating or ...

GEL COMPOSITION FOR TREATMENT OF COMMON ACNE COMPRISING A COMBINATION OF BENZOYL PEROZIDE AND ADAPALENE AND/OR ADAPALENE SALT

Dermatological/cosmetic compositions suited for preventing or treating cell differentiation and/or proliferation and/or keratinization disorders, including preventing or treating common acne, comprise, in a physiologically acceptable medium, (i) at least one dispersed retinoid, (ii) dispersed benzoyl peroxide, in free or encapsulated form, and (iii) at least one pH-independent gelling agent, selected from the group consisting of (a) polyacrylamide gelling agents, (b) gelling agents which are acrylic polymers coupled to hydrophobic chains, (c) modified starch gelling agents, and mixture thereof, said composition maintaining good chemical stability of (i) and (ii) without their degradation over time at a temperature of between 4° C. and 40° C. 134-. (canceled)35. A physiologically acceptable aqueous gel composition for treatment of common acne comprising:0.05% to 1% adapalene and/or at least one pharmaceutically acceptable salt thereof,2.5% to 5% dispersed benzoyl peroxide; and2 to 5% of at least one pH-independent gelling agent of the polyacrylamide family, said percentages being based on the weight of the total aqueous gel composition for treatment of common acne.36. The physiologically acceptable aqueous gel composition of comprising:0.15% adapalene and/or at least one pharmaceutically acceptable salt thereof, and3% dispersed benzoyl peroxidesaid percentages being based on the weight of the total aqueous gel composition for treatment of common acne.37. The physiologically acceptable aqueous gel composition of comprising:0.3% adapalene and/or at least one pharmaceutically acceptable salt thereof, and2.5% dispersed benzoyl peroxidesaid percentages being based on the weight of the total aqueous gel composition for treatment of common acne.38. The physiologically acceptable aqueous gel composition of further comprising at least one additive used in the cosmetics or pharmaceutical field chosen from corticosteroids claim 35 , antihistamines claim 35 , antifungal agents ...

METHODS FOR THE TREATMENT AND PREVENTION OF AGE-RELATED RETINAL DYSFUNCTION

A method of treating or preventing age-related retinal dysfunction involves administering to a patient a pharmaceutically effective amount of a synthetic retinal derivative repeatedly over a duration of at least about 3 months. Effective synthetic retinal derivatives include 9-cis-retinyl esters, 11-cis-retinyl esters, derivatives and congeners thereof, and combinations thereof. Suitable ester substituents include carboxylates of C-Cmonocarboxylic acids and C-Cpolycarboxylic acids. 1. A method of treating or preventing age-related retinal dysfunction in a subject comprising administering to said subject a pharmaceutically effective amount of a synthetic retinal derivative , wherein said synthetic retinal derivative is administered to said subject for a period of at least three months.2. The method of claim 1 , wherein said synthetic retinal derivative is administered to said subject for a period of from about six to about ten months.3. The method of claim 1 , wherein said synthetic retinal derivative is administered about once every day or once every other day; about four times a week claim 1 , three times a week claim 1 , or two times a week; or about once every two claim 1 , three claim 1 , four claim 1 , five claim 1 , six claim 1 , seven claim 1 , eight claim 1 , or nine weeks.4. The method of claim 1 , wherein said synthetic retinal derivative is a compound of any one of Formulas I-XVI as disclosed in PCT/US2005/021812 (WO 2006/002097) or a compound of any one of Formulas I-XII as disclosed in PCT/US2005/021812 (WO 2004/082622).5. The method of claim 4 , wherein:(a) said synthetic retinal derivative is a 9-cis-retinyl ester and/or an 11-cis-retinyl ester; and{'sub': 1', '10', '3', '10', '2', '22, '(b) the ester substituent of said synthetic retinal derivative comprises a carboxylate radical of a C-Cmonocarboxylic acid, a Cto Cpolycarboxylic acid, or a Cto Cpolycarboxylic acid.'}6. The method of claim 5 , wherein said synthetic retinal derivative is selected ...

METHOD FOR THE TREATMENT OF DISEASES ASSOCIATED WITH SULFATASE DEFICIENCIES

A method for a treatment of individuals suffering from diseases associated with sulfatase deficiencies including lysosomal storage disease includes administering at least once a therapeutically effective amount of at least one retinoid. In particular, the compounds tazaroten and bexaroten have beneficial effects on these individuals. Pharmaceutical compositions comprising both active agents namely, tazaroten and bexaroten compounds, or similar compounds, provides for ready treatment of such individuals, and enhanced treatment is achieved with at least two active agents. 1. Method for the treatment of individuals suffering from diseases associated with sulfatase deficiencies comprising the step of administering at least once a therapeutically effective amount of at least one retinoid to said individual.2. The method according to wherein administration of said therapeutically effective amount of at least one retinoid to said individual is periodically repeated.3. The method for treatment of individuals suffering from diseases associated with sulfatase deficiencies according to wherein the retinoid is a retinoid of the third generation.5. The method according to where X is S claim 4 , R is hydrogen claim 4 , and n is 0 or 1.6. The method according to wherein the compound is ethyl 6-(2-(4 claim 5 ,4-dimethylthiochroman-6-yl)ethynyl)nicotinate or a pharmaceutically acceptable salt thereof.8. The method for treatment of individuals suffering from diseases associated with sulfatase deficiencies according to wherein the at least one retinoid is 4-[1 -(5 claim 7 ,6 claim 7 ,7 claim 7 ,8-tetrahydro-3 claim 7 ,5 claim 7 ,5 claim 7 ,8 claim 7 ,8-pentamethyl-2-naphthalenyl)ethenyl]benzoic acid or a pharmaceutically acceptable salt thereof.9. The method for treatment of individuals suffering from diseases associated with sulfatase deficiencies according to claim 1 , wherein the disease associated with sulfatase deficiencies is a lysosomal storage disease or a single sulfatase ...

USE OF ANTIOXIDANTS FOR THE TREATMENT OF COGNITIVE AND BEHAVIOURAL DISORDERS IN INDIVIDUALS WITH FRAGILE X SYNDROME

The invention relates to the use of antioxidants such as, ascorbic acid (Vitamin C), Tocopherol (Vitamin E), vitamin A and polyphenols, for the treatment of cognitive and behavioural disorders in patients with Fragile X syndrome. Specifically, the invention relates to the use of said antioxidants in a pre-determined concentration in a therapeutic doses, in order to obtain the greatest amount of antioxidants possible in all the tissues of the organism, so as to eliminate the excess free radicals produced in the cells and to treat the aforementioned cognitive and behavioural disorders in patients with Fragile X syndrome. 121-. (canceled)22. A method of treating a mammal suffering from Fragile X Syndrome , the method comprising administering to said mammal a therapeutically effective amount of a pharmaceutical composition or a combined preparation comprising:a. a hydrophilic antioxidant compound; andb. a lipophilic antioxidant compound, such that said Fragile X Syndrome in said mammal is treated.23. The method according to claim 22 , wherein the pharmaceutical composition or the combined preparation further comprises vitamin A and/or polyphenols.24. The method according to claim 22 , wherein the pharmaceutical composition consists of:a. a hydrophilic antioxidant compound;b. a lipophilic antioxidant compound; andc. a pharmaceutically acceptable excipient and/or pharmaceutically acceptable vehicle.25. The method according to claim 24 , wherein the pharmaceutical composition further contains vitamin A and/or polyphenols.26. The method according to claim 22 , comprising sequential administration to said mammal of a therapeutically effective amount of:a. an hydrophilic antioxidant compound; andb. a lipophilic antioxidant compound.27. The method according to claim 26 , further comprising administering to said mammal vitamin A and/or polyphenols.28. The method according to claim 22 , wherein the lipophilic antioxidant compound is tocopherol (vitamin E).29. The method ...

Nutritional Formulations and Method for Treating Diseases

The present invention provides methods for treating retinal disorders using a nutraceutical composition comprising lutein and zeaxanthin. Methods for treating vitreomacular traction disorder and related disorders are disclosed. 1. A method for treating a retinal disorder , the retinal disorder being vitreomacular traction disorder , the method comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising lutein and zeaxanthin.2. (canceled)3. The method of claim 1 , wherein the retinal disorder is a nutritional deficiency disorder.4. The method of claim 1 , wherein the therapeutically effective amount of lutein is about 10 to 20 mg daily.5. The method of claim 1 , wherein the therapeutically effective amount of zeaxanthin is about 0.5-5 mg daily.6. The method of claim 1 , wherein 20 mg lutein and 5 mg zeaxanthin are administered to the subject daily.7. The method of claim 1 , wherein the composition is administered orally.8. The method of claim 1 , wherein the composition is administered daily for two to 24 months.9. The method of claim 1 , wherein the composition further comprises at least one of omega 3 fatty acids and probiotics.10. The method of claim 9 , wherein the fatty acids are at least one of Docosahexaenoic acid (DHA) and Eicosapentaenoic acid (EPA).11Bifidobacterium.. The method of claim 9 , wherein the probiotics are live microorganisms belonging to the order Lactobacilliales or the genus1220-. (canceled)21. The method of claim 1 , wherein the composition further comprises Eicosapentaenoic acid (EPA).22. The method of claim 21 , further comprising probiotics.23Bifidobacterium. The method of claim 22 , wherein the probiotics are live microorganisms belonging to the order Lactobacilliales or the genus24. The method of claim 21 , wherein the composition further comprises Docosahexaenoic acid (DHA).25. The method of claim 22 , wherein the composition further comprises Docosahexaenoic acid (DHA).26. The ...

ENHANCED DELIVERY EPINEPHRINE COMPOSITIONS

Pharmaceutical compositions having enhanced active component permeation properties are described. 1. A pharmaceutical composition , comprising:a polymeric matrix;pharmaceutically active component including epinephrine in the polymeric matrix; andan adrenergic receptor interacter.2. The pharmaceutical composition according to claim 1 , further comprising a permeation enhancer.3. The pharmaceutical composition according to claim 1 , wherein the composition is a film further comprising a polymeric matrix claim 1 , the pharmaceutically active component being contained in the polymeric matrix.4. The pharmaceutical composition according to claim 2 , wherein the permeation enhancer includes a phenylpropanoid.5. The pharmaceutical composition according to claim 2 , wherein the permeation enhancer includes farnesol or Labrasol.6. The pharmaceutical composition according to claim 2 , wherein the permeation enhancer includes linoleic acid.7. The pharmaceutical composition according to claim 1 , wherein the pharmaceutical composition is a film further comprising a polymeric matrix claim 1 , the pharmaceutically active component being contained in the polymeric matrix.8. The pharmaceutical composition according to claim 1 , wherein the pharmaceutical composition is a chewable or gelatin based dosage form claim 1 , spray claim 1 , gum claim 1 , gel claim 1 , cream claim 1 , tablet claim 1 , liquid or film.9. The pharmaceutical composition according to claim 4 , wherein the phenylpropanoid is eugenol or eugenol acetate.10. The pharmaceutical composition according to claim 4 , wherein the phenylpropanoid is a cinnamic acid claim 4 , cinnamic acid ester claim 4 , cinnamic aldehyde or hydrocinnamic acid.11. The pharmaceutical composition according to claim 4 , wherein the phenylpropanoid is chavicol.12. The pharmaceutical composition according to claim 4 , wherein the phenylpropanoid is safrole.13. The pharmaceutical composition according to claim 1 , wherein the adrenergic receptor ...

FORTIFICANT COMPOSITION

The present invention provides a fortificant composition comprising a sugar derived humectant in the range of 30 to 60 wt %; a solubilizer in the range of 1 to 40 wt %; an encapsulated fat soluble fortificant in the range of 0.001 to 10 wt %; a water soluble fortificant in the range of 0.001 to 10 wt %; and water in the range of 1 to 30 wt %. 113-. (canceled)14. A fortificant composition comprising:a. a sugar derived humectant, selected from the group of sugar alcohols, monosaccharides and disaccharides, in the range of 30 to 60 wt %;b. a solubilizer in the range of 5 to 30 wt %; wherein the solubilizer is a solubility excipient selected from the group of polymer, surfactant and lipid based excipient; an encapsulated fat-soluble micronutrient in the range of 0.001 to 10 wt %;c. a water-soluble micronutrient in the range of 0.001 to 10 wt %; and 'wherein the sugar derived humectant is a sugar polyol, the solubilizer is cross povidone, polyethylene glycol, propylene glycol or mixtures thereof as a polymer; the solubilizer is polysorbate as a surfactant; and the water-soluble and encapsulated fat-soluble micronutrients are vitamins.', 'd. water in the range of 1 to 30 wt %;'}15. The composition according to wherein the sugar derived humectant is a food grade humectant.16. The composition according to wherein the encapsulated fat-soluble micronutrient is water dispersible.17. The composition according to wherein the composition is suitable to deliver fat-soluble and water-soluble vitamins in a single composition.18. The composition according to wherein the composition suitable for in-line fortification of drinking water in a water dispensing device.191. A method for making the composition according to claim claim 14 , the method comprising the steps of:a. adding a sugar derived humectant in a range of 30 to 60 wt % and a solubilizer in a range of 5 to 30 wt % to water to obtain an aqueous mixture;b. mixing the encapsulated fat-soluble and the water-soluble micronutrient ...

METHODS AND APPARATUS FOR REDUCING ANXIETY IN A PATIENT

Apparatus and methods for inhibiting the odor of an anesthesia mask, and thereby reducing patient anxiety, generally comprising the use of a towelette treated with a pleasant odorant or flavorant to wipe down a piece of medical equipment, generally a piece of non-metallic or plastic equipment, such as a breathing mask, prior to it being positioned on a patient, and in a location on the patient where the odorant or flavorant can be smelled or tasted. 1. A method of reducing anxiety in a patient comprising:providing a wearable medical device configured for use on a human patient;providing a towelette treated with an odorant;applying said towelette to said wearable medical device such that at least some of said odorant is transferred from said towelette to said wearable medical device;fitting said wearable medical device having said transferred at least some odorant to said human patient;at least some of said transferred at least some odorant vaporizing from said wearable medical device;said human patient inhaling at least some of said vaporized odorant.2. The method of claim 1 , wherein said odorant has a sweet odor.3. The method of claim 2 , wherein said sweet odor is a fruit odor.4. The method of claim 1 , wherein said wearable medical device comprises an anesthesia breathing mask.5. The method of claim 4 , wherein said breathing mask is sized and shaped for use with a child.6. The method of claim 4 , wherein said applying step comprises wiping down the interior said of side breathing mask.7. The method of claim 1 , wherein said towelette is not treated with an alcohol or anti-microbial agent prior to said applying step.8. The method of claim 1 , wherein claim 1 , before said applying step claim 1 , said towelette is treated with a one or more agents selected from the group consisting of: a cleaning agent claim 1 , an anti-bacterial agent claim 1 , an anti-microbial agent claim 1 , a dissipant agent claim 1 , or an evaporant agent.9. The method of claim 1 , wherein ...

Novel Formulations and Methods for Treating Dermatological Disorders or Diseases

The present invention provide compositions and methods for treating a dermatological disorder or disease. 1. A pharmaceutically acceptable composition for treating a dermatological disorder or disease , wherein said composition comprises a pharmaceutically acceptable excipient and at least one component selected from the group consisting of:(a) a metered amount of a volatile anesthetic dissolved in a solution in an amount effective to treat said dermatological disorder or disease, wherein said solution further comprises at least one extractive solvent in an amount effective to reduce volatility of said volatile anesthetic, wherein said solution is a component of an emulsion;(b) a metered amount of a liposome suspension comprising a volatile anesthetic in an amount effective to treat said dermatological disorder or disease;(c) a metered amount of a volatile anesthetic dissolved in a solution in an amount effective to treat said dermatological disorder or disease, wherein said solution further comprises at least one extractive solvent in an amount effective to reduce volatility of said volatile anesthetic, wherein said composition further comprises a solubilizing agent;(d) a metered amount of a micro-droplet suspension, wherein said micro-droplet suspension comprises a sphere of a volatile anesthetic in an amount effective to treat said dermatological disorder or disease, wherein said sphere is surrounded by a stabilizing layer of a phospholipid;and any combinations thereof.2. The composition of claim 1 , wherein said at least one extractive solvent is selected from the group consisting of dimethyl sulfoxide (DMSO) claim 1 , N-methyl-2-pyrrolidone (NMP) claim 1 , dimethylformamide claim 1 , dimethylacetamide claim 1 , dimethylisosorbide claim 1 , ethanol claim 1 , propanol claim 1 , PEG-400 claim 1 , PEG-300 claim 1 , diethylene glycol monoethyl ether claim 1 , isopropanol claim 1 , and any combinations thereof.3. The composition of claim 1 , wherein said composition ...

METHODS OF PROVIDING ANTI-INFLAMMATION SUPPORT

This disclosure provides products, including pharmaceutical compositions and dietary supplements, which are useful for anti-inflammatory support. 2. The method of claim 1 , wherein R represents hydrogen or C-Calkyl.3. The method of claim 1 , wherein R′ represents hydrogen or C-Calkyl.4. The method of claim 1 , wherein X represents halogen or C-Calkyl.5. The method of claim 1 , wherein the compound is anatabine.6. The method of claim 1 , wherein the compound is S-(−)-anatabine.7. The method of claim 1 , wherein the compound is R-(+)-anatabine.8. The method of claim 1 , wherein the vitamin is Vitamin A.9. The method of claim 1 , wherein the vitamin is Vitamin D3.108. The method of claim 1 , wherein the product further comprises Vitamin D3.11. The method of claim 5 , wherein the anatabine is synthetic anatabine.12. The method of claim 5 , wherein the anatabine is provided in the form of an extract from a plant.13. The method of claim 5 , wherein the anatabine is in an amount of about 1 mg.14. The method of claim 1 , wherein the product further comprises one or more additional ingredients selected from the group consisting of mannitol claim 1 , natural mint flavors claim 1 , artificial mint flavors claim 1 , sucralose claim 1 , silicon dioxide claim 1 , stearic acid claim 1 , hydroxypropyl methylcellulose claim 1 , magnesium stearate claim 1 , titanium dioxide claim 1 , natural glaze claim 1 , methyl parabens claim 1 , propylparabens claim 1 , triethyl citrate claim 1 , citric acid claim 1 , BHT claim 1 , mono and diglycerides claim 1 , and polysorbate 80.15. The method of claim 1 , wherein the product is a dietary supplement.16. The method of claim 1 , wherein the product is a pharmaceutical composition. This application is a division of Ser. No. 13/494,237 filed on Jun. 12, 2012, which claims the benefit of and incorporates by reference Ser. No. 61/528,380 filed on Aug. 29, 2011.. Graph showing effects of anatabine on TNFα-induced NFκB activity in vitro.. Graph ...

COMPOSITIONS AND METHODS FOR REGULATING THE ENCOCANNABINOID SYSTEM

Compositions comprising select meroterpenes and a linoleic component and the use thereof in regulating the endocannabinoid system (ECS), especially in controlling and/or reducing the levels of cortisol: thereby having a stress reducing or inhibition effect. 2. The composition of wherein the lir c leis component is linoleic acid or a Cto Clinoleate and the weight ratio of the compound of Structure I to the linoleic component is from 12:1 to 1:12.3. The composition of wherein the linoleic component is one of linoleic acid or a C1 to C8 linoleate and the weight ratio of the compound of Structure I to the linoleic component is from 3 1 to 1:3.4. The composition of wherein the linoleic component is or includes ethyl linoleate.5. The composition of wherein the linoleic component is a long chain fatty acid or fatty ester composition having a linoleic content of at least 45% by weight and weight ratio of the compound of Structure I to the linoleic component 1:20.6. The composition of wherein the linoleic component is a long chain fatty acid composition comprising or derived from one or more natural oil extracts.7. The composition of wherein the natural oil extract is isolated from safflower claim 6 , grape seed claim 6 , rosehip claim 6 , walnut claim 6 , evening primrose claim 6 , silybum marianum claim 6 , hemp claim 6 , sunflower claim 6 , wheat germ claim 6 , pumpkin seed claim 6 , sesame claim 6 , rice bran claim 6 , almond claim 6 , rapeseed claim 6 , peanut claim 6 , olive claim 6 , soybean claim 6 , or coconut.8. The composition of wherein the compound of Structure I is selected from bakuchiol claim 1 , hydroxybakuchiol and that compound wherein R═R═H claim 1 , R═OH claim 1 , and R═R═CH.9. The composition of wherein the compound of Structure I is bakuchiol.10. The composition of further comprising a pharmaceutically acceptable vehicle wherein the combination of the compound of Structure I and the linoleic component is present in an amount of from 0.01 to 99 percent ...

METHODS OF TREATING DISEASES ASSOCIATED WITH HIGH-FAT DIET AND VITAMIN A DEFICIENCY USING RETINOIC ACID RECEPTOR AGONISTS

This invention relates to pharmaceutical composition and methods of using vitamin A and/or RARβ agonist for the treatment or prevention of diseases or conditions associated with high fat diet and/or vitamin deficiency. 1. A method of treating or preventing a pancreatic disease in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).2. The method of claim 1 , wherein said pancreatic disease is associated with obesity.3. The method of claim 1 , wherein said pancreatic disease is caused by a high fat diet.4. The method of claim 1 , wherein said pancreatic disease is diabetes.5. The method of claim 1 , wherein said diabetes is type I or type II diabetes claim 1 , or gestational diabetes.6. The method of claim 1 , wherein said pancreatic disease is associated with reduced vitamin A level in the pancreas.7. A method of treating or preventing the degeneration of pancreatic beta cells in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).8. A method of maintaining or improving the function of pancreatic beta cells in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).9. A method of maintaining or improving pancreatic insulin secretion in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).10. A method of maintaining or improving insulin sensitivity in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).11. A method of maintaining or improving the level of glucagon in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).12. A method of treating or preventing fat deposit in a subject comprising administering to said subject vitamin A or an agonist of retinoic acid receptor-beta (RARβ).13. A method of treating or ...

METHODS FOR THE TREATMENT AND PREVENTION OF AGE-RELATED RETINAL DYSFUNCTION

A method of treating or preventing age-related retinal dysfunction involves administering to a patient a pharmaceutically effective amount of a synthetic retinal derivative repeatedly over a duration of at least about 3 months. Effective synthetic retinal derivatives include 9-cis-retinyl esters, 11-cis-retinyl esters, derivatives and congeners thereof, and combinations thereof. Suitable ester substituents include carboxylates of C-Cmonocarboxylic acids and C-Cpolycarboxylic acids. 1. A method of treating or preventing age-related retinal dysfunction , comprising:administering to a subject in need a pharmaceutically effective amount of a synthetic retinal derivative, wherein said synthetic retinal derivative is administered to said subject for a period of at least three months.2. The method of claim 1 , wherein said synthetic retinal derivative is administered to said subject for a period of from about six to about ten months.3. The method of claim 1 , wherein said synthetic retinal derivative is administered about once every day or once every other day; about four times a week claim 1 , three times a week claim 1 , or two times a week; or about once every two claim 1 , three claim 1 , four claim 1 , five claim 1 , six claim 1 , seven claim 1 , eight claim 1 , or nine weeks.4. The method of claim 1 , wherein said age-related retinal dysfunction is manifested by one or more of the following clinical conditions: an impairment in rod-mediated dark adaptation after light exposure claim 1 , an impairment in night vision claim 1 , an impairment in contrast sensitivity claim 1 , and age-related macular degeneration (AMD).5. The method of claim 1 , wherein said synthetic retinal derivative is administered via a method selected from gavage claim 1 , orally claim 1 , and locally to a subject's eye.6. The method of claim 5 , wherein said synthetic retinal derivative is locally administered via eye drops claim 5 , an intraocular injectable solution or a periocular injectable ...

Compositions and methods for treating Alzheimer's disease and related disorders and promoting a healthy nervous system

The present invention relates generally to methods of inhibiting the onset and progression of Alzheimer's disease (AD), mild cognitive impairment (MCI), and related neurodegenerative disorders involving amyloidosis. The methods involve administering a composition comprising a therapeutically effective amount of D-pinitol to individuals who are at risk of developing the disease or have one or more symptoms of the disease. The invention also relates to methods of treating or preventing Alzheimer's disease or MCI that involve the use of such compositions. The invention further provides methods to promote the general health of the nervous system through administration of active ingredient compositions. The invention further relates to animal and cellular systems for the study of AD, MCI, and related disorders, and the identification of reagents useful in treating amyloidosis. The invention further provides methods to inhibit AD or MCI in an individual based on reducing caloric intake by the individual. The invention further relates to a method of treating or inhibiting an amyloidogenic disorder by caloric restriction. 177-. (canceled)78. A method of treating an individual identified as being at risk of developing Alzheimer's disease comprising providing said identified individual with D-pinitol in an amount and for a sufficient period of time , to reduce the likelihood that said identified individual will develop said Alzheimer's disease.79. The method of claim 78 , wherein said individual has been identified as being at risk of developing Alzheimer's disease due to a genetic factor claim 78 , family history or the presence of mild cognitive impairment.80. The method of claim 78 , wherein said individual has been identified as being at risk of developing Alzheimer's disease due to the presence of at least one ε4 allele or the absence of an ε2 allele at the apolipoprotein E locus.81. The method of claim 79 , wherein said identified individual is provided with D-pinitol ...

TREATMENT OF A SKIN LESION

The invention provides a spray applicator () for topical treatment, the spray applicator () comprising a container () comprising a treatment liquid () under pressure and a propellant (), wherein the container () is in fluid connection with a spray valve system () for application of at least part of the treatment liquid () on a topical area, wherein the treatment liquid () comprises an acid, wherein the container () comprises a container wall () having a top layer () and a top layer coating () on said top layer (), wherein the top layer () optionally comprises a metal and wherein the top layer coating () comprises a polymer and/or a resin. 1. A spray applicator for topical treatment , the spray applicator comprising a container comprising a treatment liquid under pressure and a propellant , wherein the container is in fluid connection with a spray valve system for application of at least part of the treatment liquid on a topical area , wherein the treatment liquid comprises an acid , wherein the spray applicator further comprises a distance holder configured to arrange on a topical area and comprising a opening configured to enclose a topical lesion , wherein the spray applicator is configured to spray the treatment liquid through the opening in the distance holder.2. The spray applicator according to claim 1 , wherein the treatment liquid at least comprises trichloro acetic acid.3. The spray applicator according to claim 1 , whereinthe acid comprises one or more acids selected from the group consisting of trichloro acetic acid, salicylic acid, formic acid, glycolic acid, dichloro acetic acid, monochloro acetic acid, boric acid, nitric acid, sulfuric acid, phosphoric acid, oxalic acid, lactic acid, hydrochloric acid,{'sub': 2', '2, 'the propellant comprises one or more propellants selected from the group consisting of dimethyl ether (DME), diethyl ether (DEE), methyl ethyl ether (methoxy ethane), carbon dioxide (CO), nitrogen (N), nitrous oxide, propane, butane, ...

Compositions and methods for treating alzheimer`s disease and related disorders and promoting a healthy nervous system

The present invention relates generally to methods of inhibiting the onset and progression of Alzheimer's disease (AD), mild cognitive impairment (MCI), and related neurodegenerative disorders involving amyloidosis. The methods involve administering a composition comprising a therapeutically effective amount of D-pinitol to individuals who are at risk of developing the disease or have one or more symptoms of the disease. The invention also relates to methods of treating or preventing Alzheimer's disease or MCI that involve the use of such compositions. The invention further provides methods to promote the general health of the nervous system through administration of active ingredient compositions. The invention further relates to animal and cellular systems for the study of AD, MCI, and related disorders, and the identification of reagents useful in treating amyloidosis. The invention further provides methods to inhibit AD or MCI in an individual based on reducing caloric intake by the individual. The invention further relates to a method of treating or inhibiting an amyloidogenic disorder by caloric restriction.

Zeaxanthin Formulations With Additional Ocular-Active Nutrients,For Protecting Eye Health And Treating Eye Disorders

Oral formulations for promoting eye health, and in particular for preventing or treating macular degeneration, are disclosed, containing zeaxanthin, a carotenoid pigment, and at least two or more additional ocular-active nutrients selected from lipoic acid, omega-3 fatty acids, plant-derived compounds such as flavonoids, anthocyanins, or polyphenolics, taurine, carnitine, Coenzyme-Q10, carnosine, and nutrients that stimulate the production of glutathione. Processes are disclosed for identifying ocular-active nutrients that will interact in a synergistic and potentiating manner with zeaxanthin, to provide better and more effective protection, for eye health, than can be provided by zeaxanthin alone. Additional optional agents include zinc, vitamin E, and vitamin C. 14-. (canceled)5. A nutritional supplement for eye health , comprising: (a) at least 0.5 mg of zeaxanthin, the zeaxanthin being present in the 3R-3R′ stereoisomer form and is substantially free of meso-zeaxanthin stereoisomers,', '(b) zinc in an amount that does not exceed 40 mg,', '(c) vitamin E, and', '(d) vitamin C., 'a capsule or tablet for oral ingestion that includes a composition comprising'}6. The nutritional supplement of claim 5 , wherein the composition further includes omega-3 fatty acids.7. The nutritional supplement of claim 6 , wherein the composition further includes a lipoic acid8. The nutritional supplement of claim 7 , wherein the composition further includes lutein.9. The nutritional supplement of claim 5 , wherein the composition further includes lutein.103. The nutritional supplement of claim 9 , wherein the composition further includes omega- fatty acids11. The nutritional supplement of claim 9 , wherein the composition further includes mixed tocopherols.12. The nutritional supplement of claim 5 , wherein vitamin C is in the form of ascorbic acid.13. The nutritional supplement of claim 5 , wherein the capsule or table provides a daily dosage of the ingredients to the user that is ...

VITAMIN COMPOSITION

A composition comprising: (i) a mixture containing a lipid-soluble vitamin dissolved in a lipid, and (ii) bran; wherein the mixture is absorbed into and/or adsorbed onto the bran and wherein the lipid does not originate from the bran. Also provided are processes for providing a stabilised vitamin composition. 1. A composition comprising: a mixture containing a lipid-soluble vitamin dissolved in a lipid , and bran , wherein the mixture is absorbed into and/or adsorbed onto the bran and wherein the lipid does not originate from the bran.2. A composition according to claim 1 , wherein the lipid-soluble vitamin is selected from the group consisting of vitamin A claim 1 , provitamin A and vitamin A ester claim 1 , and combinations thereof.3. A composition according to claim 1 , wherein the lipid is a fat.4. A composition according to claim 1 , wherein the bran is selected from the group consisting of rice bran claim 1 , wheat bran claim 1 , oat bran claim 1 , and combinations thereof.5. A composition according to claim 1 , wherein the weight ratio of the mixture to bran is from about 1:200 to about 1:1.6. A composition according to claim 1 , wherein the amount of lipid-soluble vitamin in the lipid is from about 0.1 wt. % to about 5 wt. %.7. A composition according to claim 1 , wherein the composition further comprises an antioxidant.8. A composition according to claim 1 , wherein the composition further comprises an emulsifier.9. A composition according to claim 1 , wherein the ratio of the amount of lipid-soluble vitamin present in the composition following a storage period of about 20 days at about 60° C. and about 68% relative humidity to the amount of lipid-soluble vitamin present in the composition at the start of the same storage period is at least 0.5:1.10. A process for preparing a composition comprising a mixture containing a lipid-soluble vitamin dissolved in a lipid claim 1 , and bran comprising the steps of:(a) dissolving a lipid-soluble vitamin in a lipid to ...

NOVEL COATING SYSTEM

The present patent application relates to a novel coating system, coated compositions with such a coating system, as well as to the use of such compositions in the production food, feed, dietary supplements and/or pharmaceutical products, as well as to food, feed, dietary supplements and/or pharmaceutical products comprising such compositions. 2. Coating system according to claim 1 , wherein the mass median diameter of the lipid compound is less than 0.8 μm.3. Coating system according to claims claim 1 , wherein the lipid compound is a saturated fatty acid as well as salts thereof.4. Coating system according to claim 1 , wherein the gum having emulsifying properties is chosen from the groups consisting of gum acacia claim 1 , gum ghatti and tic gums.5. Coating system according to claim 1 , wherein the film forming compound is a hydrocolloid claim 1 , preferably alginates claim 1 , pectins claim 1 , guar gum claim 1 , caroube gum claim 1 , xanthan gum claim 1 , starches claim 1 , modified starches claim 1 , cellulose and cellulose derivates (such as carboxymethylcellulose or hydroxypropylmethylcellulose).6. Coating system according to claim 1 , wherein the emulsifier is chosen from the group consisting of sucrose ester claim 1 , ascorbyl palmitate and polyoxyethylene-sorbitan-fatty acid esters.7. Coating system according to claim 1 , wherein the coating system comprises at least one plasticizer.8. Coating system according to comprising 10 to 50 wt-% of at least one lipid compound claim 1 , preferably claim 1 , 20 to 40 wt-% claim 1 , based on the total weight of the coating system.9. Coating system according to comprising 5 to 30 wt-% of at least one gum having emulsifying properties claim 1 , preferably 10 to 25 wt-% claim 1 , based on the total weight of the coating system.10. Coating system according to comprising 40 to 80 wt-% claim 1 , preferably 45 to 70 wt-% of at least one film forming compound and/or at least one emulsifier claim 1 , based on the total ...

MULTILAYERED EMULSION FILM AND METHOD FOR PREPARING THE SAME

Multilayer thin emulsion films are disclosed. Also disclosed are methods for preparing the multilayer thin emulsion films. According to the methods, an amphiphilic block polymer is used as a surfactant to form a polymer thin film at the oil/water interface, ionic lecithin is used as an auxiliary surfactant to prepare physically stable ionic oil-in-water nanoemulsions, and a layer-by-layer assembly technique is used to alternately laminate polymer thin films and nanoemulsion layers. The multilayer thin emulsion films enable slow release of active substances in specific temperature ranges and are structurally biocompatible while possessing improved capture efficiency and physically stable membrane structures. Spinodal decomposition of the multilayer thin emulsion films is induced by heating, allowing release of oils and active substances loaded into the nanoemulsions. Therefore, the multilayer thin emulsion films are expected to be useful as smart drug release materials in a variety of applications, including cosmetics, pharmaceuticals, and biotherapy. 1. A multilayer thin emulsion film comprising a substrate and 1 to 100 layers of composite thin films laminated on the substrate to release an active substance in a specific temperature range wherein each of the composite thin films consists of a cross-linkable positively charged polymer layer coated on the substrate surface and a nanoemulsion layer comprising a plurality of nanoemulsions arrayed on the polymer layer and wherein each of the nanoemulsions is a spherical particle consisting of (a) a core comprising the active substance and an oil and a shell comprising (b) an amphiphilic polymer consisting of a biodegradable hydrophobic polymer composed of poly(ester) and a hydrophilic polymer composed of poly(ethylene oxide) and (c) lecithin and continuously or discontinuously surrounding the core.2. The multilayer thin emulsion film according to claim 1 , wherein the oil is selected from the group consisting of silicone ...

PHARMACEUTICAL FORMULATIONS COMPRISING 9-CIS-RETINYL ESTERS IN A LIPID VEHICLE

Pharmaceutical formulations comprising 9-cis-retinyl esters in a lipid vehicle are described as retinoid replacement therapies for treating retinal degenerations in humans. 120-. (canceled)21. A liquid oral pharmaceutical formulation suitable for treating a human subject with an endogenous 11-cis-retinal deficiency consisting essentially of 9-cis-retinyl acetate in soybean oil and an anti-oxidant , wherein said formulation is not in the form of a capsule.22. The formulation of claim 21 , wherein the soybean oil is highly refined soybean oil.23. The formulation of claim 21 , wherein the soybean oil is U.S.P. grade soybean oil.24. The formulation of claim 21 , wherein the 9-cis-retinyl acetate is present up to 30% by weight of the formulation.25. The formulation of claim 21 , wherein the 9-cis-retinyl acetate is present up to 25% by weight of the formulation.26. The formulation of claim 21 , wherein the 9-cis-retinyl acetate is present up to 10% by weight of the formulation.27. The formulation of claim 21 , wherein the 9-cis-retinyl acetate is present up to 5% by weight of the formulation.28. The formulation of claim 21 , wherein the 9-cis-retinyl acetate is present from about 1.25 to 20 mg/mL in the formulation.29. The formulation of claim 21 , wherein the 9-cis-retinyl acetate is present at about 20 mg/mL in the formulation.30. The formulation of claim 21 , wherein the anti-oxidant comprises α-tocopherol claim 21 , butylated hydroxyanisole (BHA) claim 21 , butylated hydroxytoluene (BHT) claim 21 , ascorbyl palmitate claim 21 , propyl gallate claim 21 , tert-butyl hydroquinone (TBHQ) claim 21 , or a chelating agent claim 21 , or a combination thereof.31. The formulation of claim 21 , wherein the anti-oxidant comprises butylated hydroxyanisole (BHA).32. The formulation of claim 21 , wherein the formulation comprises about 0.1% by weight to volume of the anti-oxidant.33. The formulation of claim 21 , wherein the 11-cis-retinal deficiency is due to an RPE65 mutation.34. ...

ABSORBENT ARTICLE

An absorbent article comprising at least a topsheet layer and a backsheet layer, each layer having a first and a second surface, at least one of the layers has a composition comprising a skin beneficial agent printed on the first surface and an ink composition printed on the second surface, wherein the compositions on the first and the second surfaces respectively may be interchanged. 1. An absorbent article comprising at least a topsheet layer and a backsheet layer , each layer having a first and a second surface , at least one of the layers has a composition comprising a skin beneficial agent printed on the first surface and an ink composition printed on the second surface , wherein the compositions on the first and the second surfaces respectively may be interchanged.2. Absorbent article according to claim 1 , wherein the skin beneficial agent is enclosed in microcapsules.3. Absorbent article according to claim 1 , wherein the first surface is the skin facing surface and the second surface is the garment facing surface of the article.4. Absorbent article according to claim 1 , wherein the layer comprises a zone of skin beneficial agent.5. Absorbent article according claim 1 , wherein the layer comprises a zone of ink composition.6. Absorbent article according to claim 5 , wherein the zone of skin beneficial agent has a non-linear boundary in at least the transversal direction of the article.7. Absorbent article according claim 4 , wherein the boundary of the zone ends at least 1 mm from the transversal edges of the layer.8. Absorbent article according to claim 4 , wherein the boundary of the zone ends at least 1 mm from the longitudinal edges of the layer.9. Absorbent article according claim 4 , wherein the zone has a boundary enclosing an area of at least 1 mm.10. Absorbent article according to claim 1 , wherein the ink forms an artwork on the surface of the layer.11. Absorbent article according to claim 1 , wherein the skin beneficial agent and the ink are ...

Compositions and method for utilization of thioretinamide in therapy of degenerative diseases of aging

A process for the endogenic catabolism of homocysteine and the control of homocysteine levels for treating disease and the degenerative diseases of aging is provided along with pharmaceutical compositions having thioretinamide, retinol or combinations thereof in combination with an enzyme or a pro-enzyme. The process includes the catabolism of homocysteine thiolactone in cells and tissues by catalyzing the reaction of homocysteine thiolactone with an enzyme-bound retinoic acid to increase the bioavailability of thioretinamide in diseased and aged cells and tissue. 124.-. (canceled)25. A composition of matter for the catabolism of homocysteine in tissues and cells comprising a formulation of thioretinamide and pancreatin and optionally retinol.26. The composition of wherein said formulation is thioretinamide and pancreatin.27. The composition of wherein said formulation is from about 0.05% to 21% wt % of thioretinamide to about 97% to 99.5% wt % of pancreatin.28. The composition of further comprising adenosyl methionine or the salts thereof.29. The composition of further comprising a vitamin or a pro-vitamin.30. The composition of wherein said vitamin or pro-vitamin is vitamin C or an ascorbate.31. The composition of wherein said ascorbate includes a bioflavonoid.32. The composition of wherein said vitamin is a vitamer of the B family.33. The composition of wherein said vitamer is pyridoxal phosphate.34. The composition of wherein said vitamer is cyanocobalamin.35. The composition of wherein said vitamer is amygdalin.36. The composition of wherein said vitamer is a folate or folic acid.37. The composition of wherein said vitamer is nicotinic acid.38. The composition of wherein said vitamer is riboflavin.39. The composition of further comprising an amino acid.40. The composition of wherein said amino acid is tryptophan.41. The composition of further comprising a broad spectrum antibiotic.42. The composition of wherein said broad spectrum antibiotic is doxycycline.43. ...

MICRONEEDLE CONTAINING RETINOL OR RETINOL DERIVATIVE

The present disclosure relates to a system for administering retinol into skin that ensures stability of retinol, reduces skin irritation of retinol, and continues to exert effects, wherein the system is a microneedle including microparticles containing retinol or retinol derivatives. The present disclosure further provides a method for manufacturing a retinol administration system that reduces skin irritation, exerts effects of retinol for a long time, and ensures stability of retinol very unstable to light, wet and temperature. The present disclosure further provides a method for administering retinol into skin using the microneedle. 1. A microneedle comprising microparticles containing retinol or retinol derivatives.2. The microneedle according to claim 1 , wherein a material that forms the microneedle is dissolved in skin claim 1 , and the microparticles comprise a sustained release polymer.3. The microneedle according to claim 2 , wherein the material that forms the microneedle is hyaluronic acid claim 2 , sodium carboxymethyl cellulose (Na-CMC) claim 2 , vinylpyrrolidone-vinylacetate copolymer claim 2 , poly vinyl alcohol claim 2 , poly vinyl pyrrolidone claim 2 , saccharides claim 2 , or mixtures thereof.4. The microneedle according to claim 3 , wherein the microneedle further comprises a plasticizer besides the material that forms the microneedle.5. The microneedle according to claim 2 , wherein the sustained release polymer is poly(lactide) claim 2 , poly(glycolide) claim 2 , poly(lactide-co-glycolide) claim 2 , polyanhydride claim 2 , polyorthoester claim 2 , polyetherester claim 2 , polycaprolactone claim 2 , mono-methoxy polyethyleneglycol-polycaprolactone (MPEG-PCL) claim 2 , polyesteramide claim 2 , poly(butyric acid) claim 2 , poly(valeric acid) claim 2 , polyurethane claim 2 , polyacrylate claim 2 , ethylene-vinylacetate copolymer claim 2 , acryl substituted cellulose acetate claim 2 , non-degradable polyurethane claim 2 , polystyrene claim 2 , ...

ASSOCIATION OF MILIACIN AND POLAR LIPIDS, PARTICULARLY SPHINGOLIPIDS AND/OR PHOSPHOLIPIDS, FOR HAIR AND SCALP CARE

The present disclosure relates to a cosmetic or dietary composition for combating human or animal hair loss and/or promoting hair growth and/or regrowth and/or enhancing the beauty thereof (shine, softness, strength) and/or enhancing scalp comfort, comprising at least miliacin in a proportion greater than 0.1% by mass with respect to the total mass of the composition and polar lipids in a proportion greater than 0.1% by mass with respect to the total mass of the composition, including sphingolipids, particularly ceramides and/or glycosylceramides, and/or phospholipids in a proportion greater than 0.1% by mass with respect to the total mass of the composition. 1. A cosmetic or dietary composition , comprising:from 0.01% to 10% by weight miliacin, based on the total weight of said cosmetic or dietary composition; andfrom 0.01% to 5% by weight of at least one sphingolipid, based on the total weight of said cosmetic or dietary composition; and optionallyfrom 0.01% to 5% of at least one phospholipid, based on the total weight of said cosmetic or dietary composition; and optionallya pharmaceutically acceptable medium.2. The cosmetic or dietary composition according to claim 1 , wherein said at least one sphingolipid comprises at least one ceramide claim 1 , at least one glycosylceramide claim 1 , or a mixture thereof.3. The cosmetic or dietary composition according to claim 1 , comprising from 0.1% to 1.0% by weight of said at least one sphingolipid.4. The cosmetic or dietary composition according to claim 2 , comprising from 0.1% to 1% by weight of said at least one ceramide claim 2 , said at least one glycosylceramide claim 2 , or a mixture thereof.5. The cosmetic or dietary composition according to claim 1 , comprising from 0.3% to 1.5% of said phospholipid.6. The cosmetic or dietary composition according to claim 1 , comprising from 0.5% to 1.5% of said phospholipid.7. The cosmetic or dietary composition according to claim 1 , comprising from 0.3% to 1.5% of said ...

PARTICLES COMPRISING A RELEASABLE DOPANT THEREIN

A process for making particles comprising a hydrophobic dopant for subsequent release therefrom is disclosed. The process comprises providing an emulsion comprising a hydrophilic phase and a hydrophobic phase dispersed in the hydrophilic phase, and reacting the precursor material to form the particles comprising the dopant therein. The hydrophobic phase comprises a precursor material and the dopant. 125.-. (canceled)26. A solid particle comprising a releasable hydrophobic dopant distributed in an organically modified ceramic matrix , wherein (i) the particle is a porous solid particle comprising pores distributed throughout said organically modified ceramic matrix and (ii) the dopant is distributed substantially homogeneously within the particle and is releasable by diffusion from the pores of the particle.27. A particle of claim 26 , wherein said organically modified ceramic matrix is formed from a precursor material selected from the group consisting of hydrolysable organosilica precursors claim 26 , organotitania precursors claim 26 , organoalumina precursors claim 26 , organozirconia precursors claim 26 , and a mixture of any two or more thereof.28. The particle of having a particle size of from about 100 nm to 100 microns.29. The particle of claim 26 , wherein the dopant represents from 1 to 50% of the weight or the volume of the particle.30. A method for treating a condition in a subject comprising administering to the subject a therapeutically effective quantity of particles claim 26 , said particles comprising a releasable hydrophobic dopant distributed in an organically modified ceramic matrix claim 26 , wherein the dopant is indicated for the condition claim 26 , and wherein (i) each of the particles is a porous solid particle and (ii) the dopant is distributed substantially homogeneously within and is releasable by diffusion from each particle.31. The method of claim 30 , wherein the condition is selected from the group consisting of cancer claim 30 , ...

AQUEOUS SOLUTION FOR A SURGERY AND METHOD FOR USING THE SAME

The present invention provides an aqueous solution for a surgery, especially laparoscopic surgery and a method for using such a liquid solution during surgery. The aqueous solution comprises at least an antioxidant agent and a haemostatic agent in order to prevent intestinal obstruction, pain and difficulties in repeated surgeries. The present invention provides also a method for using such an aqueous solution during a surgery. 1. Aqueous solution for controlling oxidative stress and enhanced visual recognition during a surgery , comprising Methylene Blue and a haemostatic agent.2. Aqueous solution according to claim 1 , comprising one of the following as solvent:a. sterile waterb. Normal Saline, or{'sub': '2', 'c. an isotonic solution containing about 6.5 g NaCl, 0.42 g KCl, 0.25 g CaCland 0.2 g of sodium bicarbonate dissolved in one liter of distilled water.'}3. Aqueous solution according to claim 1 , comprising at least 100 mL claim 1 , preferably 100 mL to 3 L claim 1 , more preferably 1 L or 3 L solvent.4. Aqueous solution according to claim 1 , comprising an antioxidant agent in addition to Methylene Blue dye.5. Aqueous solution according to claim 1 , comprising 1 to 3% or about 1% Methylene Blue or per 1000 mL claim 1 , 1 to 250 mg of Methylene Blue or per 100 mL claim 1 , 1 to 5 mg Methylene Blue claim 1 , more preferably 3 mg Methylene Blue.6. Aqueous solution according to claim 1 , comprising an antioxidant agent in addition to Methylene Blue dye in form of one of the Vitamins C claim 1 , E and A or a combination thereof.7. Aqueous solution according to claim 1 , comprising about 500 mg/3000 cc Vitamin C as an antioxidant agent in addition to Methylene Blue dye.8. Aqueous solution according to claim 1 , wherein said haemostatic agent comprises a local vasoconstructive agent or Vasopressin.9. Aqueous solution according to claim 1 , comprising about 0.01% Vasopressin.10. Aqueous solution according to claim 1 , further comprising a local anesthetic.11. ...

Aqueous Ophthalmic Composition

The present invention relates to an aqueous ophthalmic composition comprising (A) polyoxyethylene castor oil, (B) polyethylene glycol monostearate, and (C) at least one member selected from the group consisting of sesame oil, castor oil, vitamin A, and chlorobutanol. 17-. (canceled)8. An aqueous ophthalmic composition , comprising (A) polyoxyethylene castor oil , (B) polyethylene glycol monostearate , and (C) at least one member selected from the group consisting of sesame oil , castor oil , vitamin A , and chlorobutanol.9. The aqueous ophthalmic composition according to claim 8 , further comprising (D) a buffer.10. The aqueous ophthalmic composition according to claim 8 , further comprising (E) a surfactant other than components (A) and (B).11. The aqueous ophthalmic composition according to claim 8 , wherein the aqueous ophthalmic composition is eye drops claim 8 , an eye wash claim 8 , a solution for wearing a contact lens claim 8 , or a contact lens care solution.12. The aqueous ophthalmic composition according to claim 9 , further comprising (E) a surfactant other than components (A) and (B).13. The aqueous ophthalmic composition according to claim 9 , wherein the aqueous ophthalmic composition is eye drops claim 9 , an eye wash claim 9 , a solution for wearing a contact lens claim 9 , or a contact lens care solution.14. The aqueous ophthalmic composition according to claim 12 , wherein the aqueous ophthalmic composition is eye drops claim 12 , an eye wash claim 12 , a solution for wearing a contact lens claim 12 , or a contact lens care solution.15. The aqueous ophthalmic composition according to claim 8 , wherein total content of component (C) Is 0.00002 to 10 claim 8 ,000 parts by weight based on 1 part by weight of total content of component (A).16. The aqueous ophthalmic composition according to claim 8 , wherein total content of component (C) is 0.00002 to 10 claim 8 ,000 parts by weight based on 1 part by weight of total content of component (B).17. The ...

POLYSACCHARIDE THERAPEUTIC CONJUGATES

A composition includes a polysaccharide at least one retinoid linked to at least one monosaccharide subunit of the polysaccharide with a covalent linkage. The linkage being degradable by hydrolysis during digestion of the composition to provide controlled, delayed, and/or sustained delivery of the at least one retinoid upon enteral administration of the composition to a subject. 1. A composition comprising:a polysaccharide; andat least one retinoid linked to at least one monosaccharide subunit of the polysaccharide with a hydrolysable covalent linkage, the linkage being degradable by hydrolysis during digestion of the composition to provide controlled, delayed, and/or sustained delivery of the at least one retinoid upon enteral administration of the composition to a subject.2. (canceled)3. The composition of claim 1 , the hydrolysable covalent linkage selected from ester claim 1 , ether claim 1 , thioether claim 1 , disulfide claim 1 , amide claim 1 , imide secondary amine claim 1 , direct carbon (C—C) claim 1 , carboxylic ester claim 1 , sulfate ester claim 1 , sulfonate ester claim 1 , phosphate ester claim 1 , urethane and carbonate hydrolysable covalent linkages.4. The composition of claim 3 , the hydrolysable covalent linkage comprising a hydrolysable carboxylic ester linkage.5. The composition of claim 3 , the at least one monosaccharide subunit of the polysaccharide having a carboxylate ion or amine residue claim 3 , the carboxylate ion residue or amine residue forming the covalent linkage with the retinoid.6. The composition of claim 3 , wherein the at least one retinoid is directly linked to the at least one monosaccharide subunit of the polysaccharide through the covalent linkage.7. The composition of claim 3 , the covalent linkage comprising a linker that connects the monosaccharide subunit of the polysaccharide to the retinoid claim 3 , the linker having two or more functional groups providing hydrolysable covalent bonds to the at least one monomer ...

PHARMACEUTICAL COMPOSITION FOR IMPROVING WOUND HEALING OR PROPHYLACTICALLY PREVENTING OR INHIBITING SCAR FORMATION

A pharmaceutical composition for improving wound healing is provided. The pharmaceutical composition includes (a) hyaluronic acid or its derivation, (b) an effective amount of an active ingredient; and optionally (c) pharmaceutically acceptable carriers and/or excipients. In one embodiment, the active ingredient includes vitamin. In another embodiment, the active ingredient includes acexamic acid. In still another embodiment, the pharmaceutical composition can further comprise sorbic acid. 1. A pharmaceutical composition for improving wound healing , comprising a hyaluronic acid or a derivative thereof , and a vitamin.2. The pharmaceutical composition according to claim 1 , wherein the vitamin comprises vitamin A claim 1 , vitamin D claim 1 , vitamin E claim 1 , their derivation or combinations thereof.3. The pharmaceutical composition according to claim 1 , wherein the vitamin is consisted of vitamin A and vitamin D.4. The pharmaceutical composition according to claim 1 , wherein the vitamin is consisted of vitamin A claim 1 , vitamin D and vitamin E.5. The pharmaceutical composition according to claim 4 , wherein the vitamin is consisted of 100-40000 IU/g vitamin A claim 4 , 20-10000 IU/g vitamin D and 0.001-20% w/w vitamin E.6. The pharmaceutical composition according to claim 1 , wherein the hyaluronic acid is a low molecular weight hyaluronic acid claim 1 , and the low molecular weight hyaluronic acid has a molecular weight between 200 kDa and 1000 kDa.7. The pharmaceutical composition according to claim 6 , wherein the low molecular weight hyaluronic acid has a molecular weight between 200 kDa and 400 kDa.8. The pharmaceutical composition according to claim 1 , wherein the pharmaceutical composition is formed of solution claim 1 , gel claim 1 , emugel claim 1 , cream claim 1 , ointment claim 1 , lotion claim 1 , transdermal system claim 1 , suspension or patch.9. The pharmaceutical composition according to claim 1 , wherein the pharmaceutical composition is ...

Self-Retaining Oral Device

A mouthpiece includes a buccal retention feature that produces frictional attachment to the lateral buccal portions (inner cheeks) of the individual user. The mouthpiece includes a U-shaped body sized and shaped to conform to the outer face of the dental arch. The retention feature includes bulbous protrusions that project laterally outward from the body to engage the cheek. The mouthpiece, and particularly the buccal retention feature, has a width that is large enough to prevent dislodgment or removal of the device from the mouth, taking advantage of the decrease in the intercommissural distance as the mouth is opened to attempt to remove the device. The device further includes a duct portion extending forward, outside the mouth, from the body, to permit normal respiration through the duct portion. The duct portion can be configured to connect to other devices, including but not limited to, devices for rebreathing, suctioning, feeding or delivering medicaments. 1. A mouthpiece comprising:a U-shaped body configured to seat against the outer face of the dental arch of a person when the mouthpiece is in the mouth of the person;an opening defined in said U-shaped body in communication with the oral cavity of the person when the U-shaped body is seated against the outer face of the dental arch; anda buccal retention portion configured for frictional engagement with the lateral buccal portions (inner cheeks) of the person.2. The mouthpiece of claim 1 , wherein:the U-shaped body includes opposite arms arranged to be positioned between the dental arch and the lateral buccal portions of the person; andthe buccal retention portion includes a bulbous protrusion on each of the opposite arms, protruding laterally outward from the U-shaped body into contact with the lateral buccal portions of the person.3. The mouthpiece of claim 2 , wherein the mouthpiece has a lateral width spanning the bulbous protrusions claim 2 , the lateral width being greater than the intercommissural ...

ORAL PHARMACEUTICAL COMPOSITION OF ISOTRETINOIN

The present invention provides an oral pharmaceutical composition of isotretinoin with reduced food effect. The present invention further relates to a process for preparing the oral pharmaceutical composition of the present invention. 133-. (canceled)34. An oral pharmaceutical composition comprising a micronized isotretinoin having d90 value of not more than 30 microns , wherein said composition is in the form of dispersion in a liquid vehicle and exhibits a reduced food effect.35. The oral pharmaceutical composition according to claim 34 , wherein said composition comprises a low dose isotretinoin in an amount of about 36 mg claim 34 , about 32 mg claim 34 , about 28 mg claim 34 , about 24 mg claim 34 , about 20 mg claim 34 , about 16 mg claim 34 , or about 8 mg.36. The oral pharmaceutical composition according to claim 34 , wherein said composition is further filled into capsules.37. The oral pharmaceutical composition according to claim 34 , wherein the micronized isotretinoin has Dless than 25 μm claim 34 , less than 20 μm claim 34 , less than 15 μm claim 34 , or less than 10 μm.38. The oral pharmaceutical composition according to claim 34 , wherein the micronized isotretinoin further has Dis less than 20 μm claim 34 , less than 15 μm claim 34 , less than 10 μm claim 34 , or less than 5 μm.39. The oral pharmaceutical composition according to claim 34 , wherein the micronized isotretinoin further has Dis less than 10 μm claim 34 , less than 8 μm claim 34 , less than 7 μm claim 34 , less than 5 μm claim 34 , or less than 2 μm.40. The oral pharmaceutical composition according to claim 34 , wherein the composition releases more than 50% of isotretinoin in 15 minutes in a 900 ml of media with a pH of 7.8 rotating at a 100 rpm in USP Type I apparatus.41. An oral pharmaceutical composition according to wherein the composition has a mean fed/fasted ratio of Cof about 1.10.42. An oral pharmaceutical composition according to wherein the has a mean fed/fasted ratio of ...

Zeaxanthin Formulations With Additional Ocular-Active Nutrients, For Protecting Eye Health And Treating Eye Disorders

Oral formulations for promoting eye health, and in particular for preventing or treating macular degeneration, are disclosed, containing zeaxanthin, a carotenoid pigment, and at least two or more additional ocular-active nutrients selected from lipoic acid, omega- fatty acids, plant-derived compounds such as flavonoids, anthocyanins, or polyphenolics, taurine, carnitine, Coenzyme-Q10, carnosine, and nutrients that stimulate the production of glutathione. Processes are disclosed for identifying ocular-active nutrients that will interact in a synergistic and potentiating manner with zeaxanthin, to provide better and more effective protection, for eye health, than can be provided by zeaxanthin alone. Additional optional agents include zinc, vitamin E, and vitamin C. 14-. (canceled)5. A nutritional supplement for eye health in the form of a capsule or tablet for oral ingestion , comprising:(a) a plurality of carotenoids including at least zeaxanthin and lutein, but being free of beta-carotene, the zeaxanthin being present in the 3R-3R′ stereoisomer form and is substantially free of meso-zeaxanthin stereoisomers, the zeaxanthin being present in an amount that is at least 0.5 mg;(b) zinc in an amount that does not exceed 40 mg;(c) vitamin E; and(d) vitamin C.6. The nutritional supplement of claim 5 , further comprising omega-3 fatty acids.7. The nutritional supplement of claim 6 , wherein the omega-3 fatty acids include docosa-hexaenoic acid (DHA) and eicosa-pentaenoic acid (EPA).8. The nutritional supplement of claim 5 , further comprising a lipoic acid.9. The nutritional supplement of claim 5 , further comprising mixed tocopherols.10. The nutritional supplement of claim 5 , further comprising selenium and riboflavin.11. The nutritional supplement of claim 10 , wherein the vitamin E is presented in the form of an alpha-tocopherol.12. The nutritional supplement of claim 11 , wherein vitamin C is presented in the form of ascorbic acid.13. The nutritional supplement of ...

TOPICAL COMPOSITION CONTAINING SILICONE BASE

It is an object to provide a topical composition that is excellent in texture and feeling upon use. The present invention is a topical composition without water, satisfying the following: (A) the composition includes a silicone base in a proportion of 80% by weight or more; (B) the silicone base includes (b1) a silicone elastomer, (b2) a cyclic volatile methylsiloxane having 3 to 6 silicon atoms, and (b3) a linear dimethylpolysiloxane and/or linear methylphenylpolysiloxane; (C) the composition includes therein an active ingredient present in a dispersed or dissolved type; and (D) the composition does not contain any non-silicone thickener. 1. A topical composition without water , which is characterized in that:(A) the composition comprises a silicone base in a proportion of 80% by weight or more, (b1) a silicone elastomer,', '(b2) a cyclic volatile methylsiloxane having 3 to 6 silicon atoms, and', '(b3) a linear dimethylpolysiloxane and/or linear methylphenylpolysiloxane,, '(B) the silicone base comprises(C) the composition comprises therein an active ingredient present in a dispersed or dissolved type, and(D) the composition does not contain any non-silicone thickener.2. The topical composition according to claim 1 , comprising the silicone base in a proportion of 83% by weight or more.3. The topical composition according to claim 1 , wherein the silicone base consists of the components (b1) to (b3).4. The topical composition according claim 1 , comprising the active ingredient in a dispersed type claim 1 , and comprising the silicone base in a proportion of 93% by weight or more.5. The topical composition according to claim 4 , wherein the ratio by weight of the components (b1) to (b3) in the silicone base is as follows: b1:b2: b3 is 5.5 to 11.5:40 to 86:3 to 55 (provided that b1+b2+b3=100).6. The topical composition according to claim 4 , wherein the ratio by weight of the components (b1) to (b3) in the silicone base is as follows: b1:b2: b3 is 8 to 11.5:55 to 86 ...

POLYMER CONJUGATED PROTEIN MICELLES

The invention encompasses micelle assemblies, compositions having micelle assemblies, and methods for preparing micelle assemblies and compositions thereof. The invention also encompasses a prolamine protein conjugated to a polymer, such as a polyethylene glycol (PEG) chain, which conjugates can be used to prepare micelle assemblies. The invention further encompasses methods of encapsulating molecules using the conjugates of the invention. The micelle assemblies can be used for a variety of applications, such as treating cancer, targeting tumors, reducing the toxicity of a drug in vivo, increasing the efficacy of an encapsulated agent in vivo, protecting an encapsulated agent against degradation, and enhancing the water solubility of a drug or other agent. 1. A stable micelle comprising: (i) an amphiphilic copolymer containing zein covalently conjugated to PEG and (ii) one or more cargo molecules , wherein the one or more cargo molecules are selected from the group consisting of a buffer , a hydrophobic agent , a therapeutic agent , an antioxidant , an anti-inflammatory drug , an anticancer drug , a cosmetic , a pharmaceutical , a nutraceutical , a pesticide , an insecticide , an herbicide , an antiseptic , a diagnostic agent , a food additive , a fragrance , a dye , and a textile.2. The stable micelle of claim 1 , wherein said hydrophobic agent is selected from the group consisting of abietic acid claim 1 , aceglatone claim 1 , acenaphthene claim 1 , acenocoumarol claim 1 , acetohexamide claim 1 , acetomeroctol claim 1 , acetoxolone claim 1 , acetyldigitoxins claim 1 , acetylene dibromide claim 1 , acetylene dichloride claim 1 , acetylsalicylic acid claim 1 , alantolactone claim 1 , aldrin claim 1 , alexitol sodium claim 1 , allethrin claim 1 , allylestrenol claim 1 , allyl sulfide claim 1 , alprazolam claim 1 , aluminum bis(acetylsalicylate) claim 1 , ambucetamide claim 1 , aminochlothenoxazin claim 1 , aminoglutethimide claim 1 , amyl chloride claim 1 , ...

THIORETINAMIDE COMPOSITIONS FOR THE APOPTOSIS OF MALIGNANT CELLS WHILE PREVENTING THE APOPTOSIS OF NORMAL CELLS AND RELATED METHODS

The invention pertains to novel compositions and related method for stimulating the immune system to promote the apoptosis of malignant cells while inhibiting the apoptosis of normal cells by employing compositions of thioretinamide with organic allyl sulfides or furanonaphthoquinones and in particular diallyl trisulfide, napabucasin and optionally with pancreatin and/or cobalamin. The novel compositions and method are designed to work with the immune system to treat a wide variety of malignant neoplasms which involve working with an immune system or a reduced functioning of the immune system. 1. A composition of matter to treat cancer by stimulating the immune system and increasing the apoptosis of malignant cells comprising a therapeutically effective amount of thioretinamide , a therapeutically effective amount of ally! sulfide and optionally a therapeutically effective amount of pancreatin.2. The composition of wherein the therapeutically effective amount of allyl sulfide is a therapeutically effective amount of diallyl trisulfide.3. The composition of wherein the composition includes a therapeutically effective amount of pancreatin.4. The composition of further comprising a therapeutically effective amount of cobalamin.5. The composition of further comprising a therapeutically effective amount of pyridoxal.6. The composition of further comprising a therapeutically effective amount of folate.7. The composition of further comprising a therapeutically effective amount of adenosyl methionine.8. A composition of matter to treat cancer by stimulating the immune system and increasing the apoptosis of malignant cells comprising in combination a therapeutically effective amount of thioretinamide claim 1 , a therapeutically effective amount of a furanonaphthoquinone and optionally a therapeutically effective amount of pancreatin to stimulate the immune system and cross the blood brain barrier.9. The composition of wherein the therapeutically effective amount of the ...

Cooling Adjunct For Medications To Treat Disorders In The Nasal Cavity

The present discovery pertains generally to the field of therapeutic compounds. More specifically the present discovery pertains to certain di-alkyl-phosphinoyl-alkanes as described herein, DIPA-1-8 and DIPA-1-9, and 2-6 and 2-7 that are collectively referred to herein as “DAPA compounds”, that are useful in the treatment of disorders (e.g., diseases) including: sensory discomfort (e.g., caused by inflammation, irritation, itch, or pain) in the nasal cavity. The applicant has found that localized delivery of DAPA compounds in combination with an intranasal steroid or an intranasal antihistamine immediately relieves nasal discomfort and enhances patient adherence to the use of the nasal medications. 1. A composition useful for relieving sensory discomfort in a nasal cavity , comprising: {'br': None, 'sub': 1', '2', '3, '(O═)PRRR'}, 'a 1-[Dialkyl-phosphinoyl]-alkane of Formula 1'}{'sub': 1', '2', '3, 'wherein each of R, R, is either isopropyl or sec-butyl and Ris a linear alkyl group of 6 to 9 carbons, said 1-[Dialkyl-phosphinoyl]-alkane being carried as a therapeutically effective amount in a liquid solution; and,'}an intranasal steroid or an intranasal antihistamine.2. The composition as in formulated in a dosage form suitable for intranasal administration.3. The composition as in wherein the dosage form is adapted for use as a nasal spray claim 2 , as nasal drops claim 2 , or as an irrigation solution.4. The composition as in wherein the 1-[Dialkyl-phosphinoyl]-alkane is present in the solution at a concentration of 1 to 10 mg/mL.5. The composition as in wherein the 1-[Dialkyl-phosphinoyl]-alkane is selected from the group consisting of 1-[Diisopropyl-phosphinoyl]-octane claim 1 , 1-[Diisopropyl-phosphinoyl]-nonane claim 1 , 1-[Di-sec-butyl-phosphinoyl]-hexane and 1-[Di-sec-butyl-phosphinoyl]-heptane.6. The composition as in wherein the intranasal steroid is selected from the group consisting of triamcinolone acetonide claim 1 , beclomethasone dipropionate claim 1 ...

TREATMENT OF EPITHELIAL LAYER LESIONS

Methods for the treatment of lesions originating in an epithelial layer, particularly diseases of the epithelium of the skin, bladder, oral mucosa, vagina and cervix are described. Also described are uses and formulations for the treatment of lesions originating in an epithelial layer. 1. A method for the treatment of a lesion originating in an epithelial layer in a subject , said lesion selected from a proliferative , pre-cancerous or cancerous lesion , the method comprising topically administering to the lesion of the subject , a therapeutically effective amount of an interferon α and a retinoid , wherein the interferon α and the retinoid are administered concurrently or sequentially.2. A method according to wherein administration of the interferon α and the retinoid is sequential.3. A method according to wherein the time interval between interferon α administration and retinoid administration is up to 36 hours.4. A method according to wherein the time interval between interferon α administration and retinoid administration is from 24 to 36 hours.5. A method according to wherein administration of the interferon α and the retinoid is concurrent.6. (canceled)7. A method according to wherein the interferon α is administered by injection into the lesion.8. A method according to wherein the interferon α is α-2b.10. A method according to wherein the interferon α is administered in an amount from about 0.2 million to about 5 million international units or from about 1 million to about 3 million international units.11. A method according to wherein the retinoid is administered in an amount from about 0.01 to about 0.15% w/w or from about 0.05 to about 0.1% w/w.12. A method according to wherein said proliferative claim 1 , pre-cancerous or cancerous lesion comprises a proliferative claim 1 , pre-cancerous or cancerous lesion of the skin claim 1 , bladder claim 1 , a vaginal or cervical neoplasia or oral leukoplakia.13. A topical formulation comprising or consisting ...

AEROSOL COMPOSITION FOR THE PREVENTION OF SYMPTOMS OF METAL INDUCED ALLERGY AND A METHOD OF SYNTHESIZING THE SAME

The embodiments herein disclose hypoallergenic, metal surface sealant clear aerosol composition to be used on metals (specifically jewelry) to prevent skin allergies and the process of tarnishing of metal. The method of synthesizing hypoallergenic metal surface sealant clear aerosol composition comprises the following steps. The paraloid-B-48 material (10.59 wt %) is added to ethyl acetate (31.77 wt %) slowly under constant agitation. The mixture comprising paraloid-B-48 material and ethyl acetate is agitated till no lumps are present. The butyl acetate (8.47 wt %), TAXIB Plasticizer (0.70 wt %), propylene glycol monomethyl ether (PM) acetate (19.77 wt %), ethyl acetate (28.24 wt %), Chemia #46210 Lavandin (0.42 wt %) and dimethyl ether to the mixture comprising paraloid-B-48 material and ethyl acetate are added to the mixture comprising paraloid B-48 material and ethyl acetate to obtain a composition. The composition is blended at a predetermined speed to uniformly mix the components. 1. A method of synthesizing clear , hypoallergenic metal surface sealant aerosol composition , comprises:adding a resin material to ethyl acetate to form a mixture under constant agitation, and wherein a concentration of the resin material present in the composition is in a predetermined range, and wherein a concentration of the ethyl acetate present in the composition is in a predetermined range;agitating the mixture comprising the resin material and the ethyl acetate till no lumps are present;adding butyl acetate, TXIB Plasticizer, Propylene Glycol Monomethyl Ether (PM)Acetate, Ethyl acetate, a herbal fragrance and a propellent to the mixture comprising resin material and ethyl acetate obtain a composition, and wherein a concentration of the butyl acetate present in the composition is in a predetermined range, and wherein the TXIB plasticizer is added in the composition in a predetermined amount, a concentration of the propylene glycol monomethyl ether acetate present in the ...

Zeaxanthin for Tumor Treatment

A composition comprising a pharmaceutically effective amount of zeaxanthin or its derivative for use in treating a malignant tumor and a method of using a pharmaceutically effective amount of zeaxanthin or its derivative either alone or together with one or more pharmaceutical agents for treating a malignant tumor. The tumor may be, but is not limited to breast cancer, cervix cancer, colon cancer, cutaneous melanoma, cutaneous squamous carcinoma, hepatocellular carcinoma, lung cancer, osteosarcoma, prostate cancer, and uveal melanoma. The pharmaceutically effective amount of zeaxanthin is generally above about 0.5 mg/kg/d to about 20 mg/kg/d. 1. A method of treating a malignant tumor in a human patient by administering to said patient a composition comprising a pharmaceutically effective amount of zeaxanthin or a zeaxanthin derivative , wherein the zeaxanthin derivative is a derivative selected from the group consisting of an aldehyde , a dialdehyde , a ketone , a carboxylic acid , an epoxide , a furanoxide , a gamma-lactone , an alpha-hydroxy ketone , a diol , an acetal , a ketal , a halogenated derivative , an acetylated derivative , a derivative containing one or more alkynic bonds , and combinations thereof.2. The method of claim 1 , wherein said malignant tumor is a malignant tumor selected from the group consisting of breast cancer claim 1 , cervix cancer claim 1 , colon cancer claim 1 , cutaneous melanoma claim 1 , cutaneous squamous carcinoma claim 1 , hepatocellular carcinoma claim 1 , lung cancer claim 1 , osteosarcoma claim 1 , prostate cancer claim 1 , and uveal melanoma.3. The method of claim 2 , wherein the pharmaceutically effective amount of zeaxanthin is about 0.5 mg/kg/d to about 20 mg/kg/d.4. The method of claim 2 , wherein the pharmaceutically effective amount of zeaxanthin is about 2.5 mg/kg/d.5. The method of claim 1 , wherein the administration is an oral administration claim 1 , a topical administration claim 1 , a nasal administration claim ...

METHOD AND COMPOSITION FOR THE TREATMENT OF MODERATE TO SEVERE KERATOCONJUNCTIVITIS SICCA

The present invention relates to topical ophthalmic compositions for treating or preventing epithelial lesions or ophthalmic disorders, including dry eye or keratoconjunctivitis sicca. 1. A method for treating an epithelial lesion of the eye or ophthalmic disorder comprising: topically administering an ophthalmic composition comprising conditioned media , or concentrate of said media , from cultured conjunctiva cells or cultured corneal cells in combination with a pharmaceutically acceptable carrier to the ocular surface or immediate vicinity of an eye of a subject in need thereof2. The method of claim 1 , wherein the cultured conjunctiva cells comprise an enriched population of conjunctiva epithelial cells or an enriched population of corneal epithelial cells.3. The method of claim 2 , wherein the conjunctiva epithelial cells or corneal epithelial cells are human cells.4. The method of claim 1 , wherein said composition is applied to the ocular surface of the eye.5. The method of claim 1 , wherein said composition is applied to a region of the eye adjacent the ocular surface.6. The method of claim 1 , wherein said composition comprises one or more human growth factors.7. The method of claim 1 , wherein said composition further comprises retinol or bicarbonate.8. The method of claim 6 , wherein said one or more growth factors are selected from EGF or TGF-β or combinations thereof.9. The method of claim 6 , wherein said one or more growth factors are selected from the group consisting of GM-CSF claim 6 , IL-15 claim 6 , IL-1a claim 6 , IL-2 claim 6 , IL-4 claim 6 , IL-5 claim 6 , IL-6 claim 6 , IL-7 claim 6 , IL-8 claim 6 , MCP-1 claim 6 , TNFα claim 6 , FGF-2 claim 6 , Flt-3 claim 6 , PDGF-AA claim 6 , TGF-β1 claim 6 , TGF-β2 claim 6 , and TGF-β3 claim 6 , or combinations thereof.10. The method of claim 1 , wherein said composition comprises about 3.0-5.0 mg/ml mucin claim 1 , about 0.3-0.6 pg/ml GM-CSF claim 1 , about 0.09-0.2 pg/ml IL15 claim 1 , about 0.17-0.3 pg ...

EXCIPIENT BASE FORMULA, CHEWABLE FORMULA CONTAINING THE SAME, AND THE METHOD OF MAKING CHEWABLE TABLET

An excipient base formula for chewable tablet comprises from about 15% to about 55% by weight of xylitol; from about 20% to about 45% by weight of inulin; from about 1% to about 4% by weight of flowing agent; and from about 1% to about 4% by weight of lubricant based on the total weight of the excipient base formula. A chewable formula comprises at least one active ingredient and said excipient base formula, wherein inulin is not considered as the active ingredient. The chewable formula is suitable for a direct compaction to produce chewable tablet. 1. An excipient base formula for chewable tablet , comprising:from about 15% to about 55% by weight of xylitol;from about 20% to about 45% by weight of inulin;from about 1% to about 4% by weight of flowing agent; andfrom about 1% to about 4% by weight of lubricant, based on the total weight of the excipient base formula.2. The excipient base formula of claim 1 , comprising:from about 15% to about 40% by weight of xylitol;from about 20% to about 40% by weight of inulin;from about 1% to about 3% by weight of flowing agent; andfrom about 1% to about 4% by weight lubricant, based on the total weight of the excipient base formula.3. The excipient base formula of claim 1 , further comprising from about 3% to about 10% by weight of flavoring agent based on the total weight of the excipient base formula.4. The excipient base formula of claim 1 , wherein the flowing agent comprises silica.5. The excipient base formula of claim 1 , wherein the lubricant comprises a material selected from the group consisting of magnesium stearate claim 1 , stearic acid claim 1 , ascorbyl palmitate claim 1 , coconut oil powder claim 1 , and rice bran extract.6. A chewable formula comprising at least one active ingredient and the excipient base formula of claim 1 , wherein the inulin is not considered as the active ingredient.7. The chewable formula of claim 6 , wherein the chewable formula is directly compressible into a chewable tablet.8. A ...

SUBLINGUAL OR BUCCAL ADMINISTRATION OF DIM FOR TREATMENT OF SKIN DISEASES

Described herein are methods for treating one or more skin conditions by administering, via the sublingual or buccal route, a composition comprising substituted or unsubstituted diindolylmethane. In particular, methods are provided for improving the bioavailability and pharmacokinetic parameters of substituted or unsubstituted diindolylmethane following a sublingual or buccal administration, relative to an oral administration. 1. A method of treating acne in a subject in need thereof comprising administering to the subject a composition comprising a substituted or unsubstituted diindolylmethane , wherein the composition is administered by a sublingual or buccal route.2. The method of claim 1 , wherein the composition further comprises a substituted or unsubstituted retinoic acid based component.3. The method of claim 2 , wherein the retinoic acid based component is vitamin A.4. The method of claim 1 , wherein the composition further comprises a vitamin A palmitate.5. The method of claim 1 , wherein the administration of the composition by the sublingual or buccal route increases bioavailability of the substituted or unsubstituted diindolylmethane by about 1-fold to about 50-fold compared to bioavailability of a substituted or unsubstituted diindolylmethane of a comparative composition administered by oral route at the same delivery dose.6. The method of claim 1 , wherein following administration of the composition by the sublingual or buccal route Cmax of the substituted or unsubstituted diindolylmethane in plasma increases by about 1-fold to about 50-fold compared to Cmax of a substituted or unsubstituted diindolylmethane of a comparative composition administered by oral route at the same delivery dose.7. The method of claim 1 , wherein following administration of the composition by the sublingual or buccal route the AUC of the substituted or unsubstituted diindolylmethane in plasma increases by about 1-fold to about 50-fold compared to the AUC of a substituted or ...

METHODS FOR DELIVERING VOLATILE ANESTHETICS FOR REGIONAL ANESTHESIA AND/OR PAIN RELIEF

The present invention provides methods for reducing pain in a subject in need of such pain reduction by delivering, e.g., intrathecally or epidurally, a volatile anesthetic such as a halogenated ether compound in an amount effective to reduce pain. Chronic or acute pain may be treated, or the anesthetic may be delivered to the subject to anesthetize the subject prior to a surgery. In certain embodiments, isoflurane, halothane, enflurane, sevoflurane, desflurane, methoxyflurane, xenon, and mixtures thereof may be used. Dosing regimens including a one-time administration, continuous and/or periodic administration are contemplated. 1. A method for reducing pain in a subject in need of such pain reduction comprising topically administering to the subject a volatile anesthetic in an amount effective to reduce pain , wherein the topical administration is not by inhalation.2. The method of claim 1 , wherein the volatile anesthetic is a halogenated ether anesthetic.3. The method of claim 1 , wherein the pain is chronic pain.4. The method of claim 1 , wherein the pain is acute pain.5. (canceled)6. The method of claim 1 , wherein the volatile anesthetic is selected from the group consisting of isoflurane claim 1 , halothane claim 1 , enflurane claim 1 , sevoflurane claim 1 , desflurane claim 1 , methoxyflurane claim 1 , and mixtures thereof.7. The method of claim 6 , wherein the volatile anesthetic is isoflurane.8. (canceled)9. The method of claim 1 , wherein the volatile anesthetic is formulated as a solution comprising from about 5% to about 75% v/v anesthetic.10. The method of claim 9 , wherein the solution comprises from about 10% to about 50% v/v anesthetic in solution.11. The method of claim 10 , wherein the anesthetic is isoflurane.12. (canceled)13. The method of claim 10 , wherein the anesthetic is isoflurane.14. The method of claim 6 , wherein the halogenated compound is sevoflurane.15. (canceled)16. The method of claim 1 , wherein the administration of the volatile ...

Antisense restenosis composition and method

The present invention provides an improved method for reducing the risk or severity of restenosis following cardiac angioplasty. The method includes administering to a target vessel region, a morpholino antisense compound having uncharged phosphorus-containing backbone linkages, and spanning the start codon of a human c-myc mRNA. Also disclosed are novel antisense compounds and compositions, and a method for assaying the effectiveness of antisense delivery and uptake to a target vessel region.

Carbamide peroxide compositions for the treatment of dermatological disorders and methods for their use

Topical compositions which include urea and carbamide peroxide are described. Compositions having a pH in the acidic range, particularly in the range of about 2.5 to about 9 are also described. Methods for treating dermatological disorders using the composition are also described.

SUBLINGUAL OR BUCCAL ADMINISTRATION OF DIM FOR TREATMENT OF SKIN DISEASES

Described herein are methods for treating one or more skin conditions by administering, via the sublingual or buccal route, a composition comprising substituted or unsubstituted diindolylmethane. In particular, methods are provided for improving the bioavailability and pharmacokinetic parameters of substituted or unsubstituted diindolylmethane following a sublingual or buccal administration, relative to an oral administration.

Method of producing aecol nanocapsules

FIELD: medicine. SUBSTANCE: invention relates to nanotechnology, medicine, food industry, namely to process for producing nanocapsules, wherein the nanocapsule shell is carrageenan, and core of nanocapsules is a mixture of vitamin A, vitamin E and vitamin K, characterized in that a mixture of these vitamins is added to a suspension of carrageenan in toluene in the presence of 0.01 g of E472c as a surfactant, followed by stirring at 1,300 rpm, after which 10 ml of chloroform are added, after which the resulting suspension is filtered and dried at room temperature, the core/shell ratio being 1:1, or 1:3, or 3:1 or 1:5. EFFECT: invention allows to simplify and accelerate the process of producing nanocapsules and increase the output by mass. 1 cl, 4 ex РОССИЙСКАЯ ФЕДЕРАЦИЯ (19) RU (11) (13) 2 644 725 C2 (51) МПК A61K 9/51 (2006.01) A61K 31/07 (2006.01) A61K 31/355 (2006.01) A61K 31/122 (2006.01) A61K 47/36 (2006.01) B82B 1/00 (2006.01) ФЕДЕРАЛЬНАЯ СЛУЖБА ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ (12) ОПИСАНИЕ ИЗОБРЕТЕНИЯ К ПАТЕНТУ На основании пункта 1 статьи 1366 части четвертой Гражданского кодекса Российской Федерации патентообладатель обязуется заключить договор об отчуждении патента на условиях, соответствующих установившейся практике, с любым гражданином Российской Федерации или российским юридическим лицом, кто первым изъявил такое желание и уведомил об этом патентообладателя и федеральный орган исполнительной власти по интеллектуальной собственности. (52) СПК (21)(22) Заявка: 2016121723, 01.06.2016 01.06.2016 (72) Автор(ы): Кролевец Александр Александрович (RU) (73) Патентообладатель(и): Кролевец Александр Александрович (RU) Дата регистрации: 13.02.2018 (56) Список документов, цитированных в отчете о поиске: RU 2562561 (C1), 10.09.2015. RU Приоритет(ы): (22) Дата подачи заявки: 01.06.2016 (43) Дата публикации заявки: 06.12.2017 Бюл. № 34 2554738 (C1), 27.06.2015. ЧУЕШОВ В.И. Промышленная технология лекарств в 2-х томах, том 2, 2002, стр. 383. 2 6 4 4 7 2 5 (24) Дата ...

Nanoemulsion composition and manufacturing method thereof

본 발명은 지용성 비타민, 알코올 용매 및 비이온성 계면활성제를 포함하는 나노에멀전 조성물 및 그 제조방법 제공한다. 본 발명에 따르면, 각 지용성 비타민의 종류에 따라 가장 적합한 계면활성제를 선택하여, 다른 비타민-계면활성제의 조합보다 효과적으로 지용성 비타민을 가용화시켜 미세입자화 할 수 있어 적은 양의 계면활성제로도 많은 양의 비타민을 제형 내에 안정화시킬 수 있고, 더 작은 크기의 입자를 만들 수 있다는 장점을 가지므로, 생체 내 사용시 우수한 안정성 및 효과를 제공하는 약학 조성물 및 화장료 조성물에 적용될 수 있다. The present invention provides a nanoemulsion composition comprising a fat-soluble vitamin, an alcohol solvent and a nonionic surfactant, and a method of preparing the same. According to the present invention, the most suitable surfactant is selected according to the type of each fat-soluble vitamin, so that the fat-soluble vitamin can be solubilized and finely granulated more effectively than other vitamin-surfactant combinations, so that even a small amount of the surfactant Since vitamins have the advantage of being able to stabilize in formulations and to produce smaller sized particles, they can be applied to pharmaceutical and cosmetic compositions that provide excellent stability and effectiveness in in vivo use.

A method for the treatment of hepatosis in cattle

РОССИЙСКАЯ ФЕДЕРАЦИЯ (19) RU (11) (13) 2016 139 885 A (51) МПК A61K 33/00 (2006.01) ФЕДЕРАЛЬНАЯ СЛУЖБА ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ (12) ЗАЯВКА НА ИЗОБРЕТЕНИЕ (21)(22) Заявка: 2016139885, 10.10.2016 Приоритет(ы): (22) Дата подачи заявки: 10.10.2016 (43) Дата публикации заявки: 10.04.2018 Бюл. № 10 R U (57) Формула изобретения Способ лечения гепатозов у крупного рогатого скота, включающий использование гепатопротекторного препарата, отличающийся тем, что коровам с интервалом в 5 дней курсом 45 дней по 10 мл парентерально вводят масляный раствор гепатопротектора, содержащего 0,03-0,06% диацетофенонилселинида, 0,09-0,18% бетакаротина, 5,5-6,0% фосфолипидов и одновременно с кормом применяют по 150 г бентонита - в течение 30 дней ежедневно, а затем - по 100 г, в течение 15 дней. Стр.: 1 A 2 0 1 6 1 3 9 8 8 5 A (54) Способ лечения гепатозов у крупного рогатого скота 2 0 1 6 1 3 9 8 8 5 (72) Автор(ы): Кузьминова Елена Васильевна (RU), Семененко Марина Петровна (RU), Онищук Филипп Давидович (RU), Тяпкина Евгения Викторовна (RU), Кощаев Андрей Георгиевич (RU), Соколов Максим Николаевич (RU) R U Адрес для переписки: 350004, г. Краснодар, ул. 1-Линия, 1, Краснодарский НИВИ, для патентоведа Дорониной Т.А. (71) Заявитель(и): Федеральное государственное бюджетное научное учреждение Краснодарский научно-исследовательский ветеринарный институт (ФГБНУ Краснодарский НИВИ) (RU), Кузьминова Елена Васильевна (RU), Семененко Марина Петровна (RU)

Способ получения нанокапсул умифеновира (Арбидола) в альгинате натрия

Способ получения нанокапсул умифеновира (Арбидола) в альгинате натрия, характеризующийся тем, что в качестве оболочки нанокапсул используется альгинат натрия, а в качестве ядра - умифеновир при получении нанокапсул методом осаждения нерастворителем с применением петролейного эфира в качестве осадителя. РОССИЙСКАЯ ФЕДЕРАЦИЯ (19) RU (11) (13) 2014 141 023 A (51) МПК A61K 9/00 (2006.01) B82B 1/00 (2006.01) ФЕДЕРАЛЬНАЯ СЛУЖБА ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ (12) ЗАЯВКА НА ИЗОБРЕТЕНИЕ (21)(22) Заявка: 2014141023, 10.10.2014 (71) Заявитель(и): Кролевец Александр Александрович (RU) Приоритет(ы): (22) Дата подачи заявки: 10.10.2014 (43) Дата публикации заявки: 27.04.2016 Бюл. № 12 R U A 2 0 1 4 1 4 1 0 2 3 A (57) Формула изобретения Способ получения нанокапсул умифеновира (Арбидола) в альгинате натрия, характеризующийся тем, что в качестве оболочки нанокапсул используется альгинат натрия, а в качестве ядра - умифеновир при получении нанокапсул методом осаждения нерастворителем с применением петролейного эфира в качестве осадителя. 2 0 1 4 1 4 1 0 2 3 (54) Способ получения нанокапсул умифеновира (Арбидола) в альгинате натрия R U Адрес для переписки: 305018, г.Курск, а/я 1011, Кролевцу Александру Александровичу (72) Автор(ы): Кролевец Александр Александрович (RU), Богачев Илья Александрович (RU), Никитин Кирилл Сергеевич (RU), Медведева Яна Владимировна (RU) Стр.: 1

Method of producing nanocapsules of umifenovir (arbidol) in sodium alginate

FIELD: nanotechnology. SUBSTANCE: present invention relates to nanotechnology, medicine, pharmacology and pharmaceutics. Particular feature of present method is use of umifenovir and shells of nanocapsules of sodium alginate, and also use of non-petroleum ether while getting nanocapsules via physical-chemical method of non-solvent deposition. EFFECT: technical task of the invention is to simplify and accelerate the process of production of nanocapsules and increase the mass output. 1 cl, 4 ex РОССИЙСКАЯ ФЕДЕРАЦИЯ (19) RU (11) (13) 2 619 331 C2 (51) МПК A61K 31/075 (2006.01) A61K 9/50 (2006.01) B01J 13/02 (2006.01) C08J 9/32 (2006.01) ФЕДЕРАЛЬНАЯ СЛУЖБА ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ (12) ФОРМУЛА (21)(22) Заявка: ИЗОБРЕТЕНИЯ К ПАТЕНТУ РОССИЙСКОЙ ФЕДЕРАЦИИ 2014141023, 10.10.2014 (24) Дата начала отсчета срока действия патента: 10.10.2014 Дата регистрации: (73) Патентообладатель(и): Кролевец Александр Александрович (RU) Приоритет(ы): (22) Дата подачи заявки: 10.10.2014 (43) Дата публикации заявки: 27.04.2016 Бюл. № 12 (56) Список документов, цитированных в отчете о поиске: RU 2134967, 27.08.1999. WO 2011/ Адрес для переписки: 305018, г.Курск, а/я 1011, Кролевцу Александру Александровичу 2 6 1 9 3 3 1 R U (57) Формула изобретения Способ получения нанокапсул умифеновира (Арбидола) в альгинате натрия, характеризующийся тем, что в качестве оболочки используется альгинат натрия, который осаждают из суспензии в бензоле в присутствии сложного эфира глицерина с одно-двумя молекулами пищевых жирных кислот и одной-двумя молекулами лимонной кислоты путем добавления петролейного эфира в качестве осадителя, при этом массовое соотношение ядро:оболочка альгината натрия составляет 1:1, 1:3 или 5:1. Стр.: 1 C 2 C 2 (54) Способ получения нанокапсул умифеновира (Арбидола) в альгинате натрия 2 6 1 9 3 3 1 160733, 29.12.2011. WO 2011/056935, 12.05.2011. WO 2011/127030, 13.10.2011. (45) Опубликовано: 15.05.2017 Бюл. № 14 R U 15.05.2017 (72) Автор(ы): Кролевец Александр Александрович (RU ...

Method for prevention of acute postpartum endometritis in cows

FIELD: veterinary science. SUBSTANCE: invention relates to veterinary science, particularly to veterinary obstetrics. Method for prevention of acute postpartum endometritis in cows consists in the fact that a Dorogov Antisetik-Stimulant - 2 fraction tissue biostimulator is used at ratio of 1:10. Preparation is administered intramuscularly in dose of 10.0 ml/head three times on 20th, 30th and 40th day of the dry period, the last injection being performed 20 days before the delivery date. EFFECT: more effective prevention of acute postpartum endometritis before and after calving. 1 cl, 3 tbl, 3 ex РОССИЙСКАЯ ФЕДЕРАЦИЯ (19) RU (11) (13) 2 768 589 C1 (51) МПК A61K 35/12 (2015.01) A61K 31/07 (2006.01) A61K 31/355 (2006.01) A61K 31/593 (2006.01) A61P 15/00 (2006.01) A61D 19/00 (2006.01) ФЕДЕРАЛЬНАЯ СЛУЖБА ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ (12) ОПИСАНИЕ ИЗОБРЕТЕНИЯ К ПАТЕНТУ (52) СПК A61K 35/12 (2021.08); A61K 31/07 (2021.08); A61K 31/355 (2021.08); A61K 31/593 (2021.08); A61K 2121/00 (2021.08); A61D 19/00 (2021.08) (21)(22) Заявка: 2021114400, 20.05.2021 20.05.2021 Дата регистрации: 24.03.2022 (45) Опубликовано: 24.03.2022 Бюл. № 9 2 7 6 8 5 8 9 R U (56) Список документов, цитированных в отчете о поиске: RU 2202343 C1, 20.04.2003. RU 2572216 C1, 27.12.2015. RU 2218155 C2, 10.12.2003. НИКОЛАЕВ С.В. БИОЛОГИЧЕСКИЕ АСПЕКТЫ ПРИМЕНЕНИЯ ОЗОНИРОВАННОЙ ЭМУЛЬСИИ ПРИ ОСТРОМ ЭНДОМЕТРИТЕ У КОРОВ -ПЕРВОТЕЛОК / Диссертация на соиск. уч. степ. к.в.н., Киров, 2017. ДЖАКУПОВ И.Т. Применение гипохлорита натрия при лечении эндометритов у коров / Актуальные проблемы (см. прод.) (54) Способ профилактики острого послеродового эндометрита у коров (57) Реферат: Изобретение относится к ветеринарии, в внутримышечно в дозе 10,0 мл/на голову частности к ветеринарному акушерству. Способ трехкратно на 20-й, 30-й и 40-й день сухостойного профилактики острого послеродового периода, при этом последнюю инъекцию проводят эндометрита у коров заключается в том, что за 20 дней до даты родов. Изобретение ...

Azithromycin for the treatment of granulomatous pink (red) acne

1. Cпособ устранения признаков и симптомов гранулематозных розовых (красных) угрей, включающий системное введение индивидууму, страдающему от гранулематозных розовых (красных) угрей, азитромицина в дозировке и в течение периода времени, достаточных для уменьшения признаков и симптомов гранулематозных розовых (красных) угрей у индивидуума. ! 2. Способ по п.1, в котором азитромицин вводят ежедневно в течение периода, по меньшей мере, двух недель. ! 3. Способ по п.1, в котором азитромицин вводят ежедневно или через день в течение периода, по меньшей мере, двух недель. ! 4. Способ по п.1, в котором доза азитромицина равна от 100 до 1000 мг в сутки. ! 5. Способ по п.1, в котором азитромицин вводят перорально. ! 6. Способ по п.1, в котором азитромицин вводят в комбинации с введением одного или нескольких местных лекарственных средств, которые, как известно, являются эффективными в лечении вида розовых (красных) угрей, иных, чем гранулематозные розовые (красные) угри. ! 7. Способ по п.6, в котором местное лекарственное средство выбрано из группы, состоящей из гормонов, ретиноидов, азелоиновый кислоты, 10% сульфацетамида натрия с 5% серой и метронидазола. ! 8. Способ по п.1, в котором азитромицин вводят в качестве основной терапии в лечении гранулематозных розовых (красных) угрей. ! 9. Способ по п.1, в котором лечение азитромицином начато после безуспешного лечения гранулематозных розовых (красных) угрей введением одного или нескольких лекарственных средств, иных, чем азитромицин. РОССИЙСКАЯ ФЕДЕРАЦИЯ (19) RU (11) 2008 122 964 (13) A (51) МПК A61K 31/70 (2006.01) ФЕДЕРАЛЬНАЯ СЛУЖБА ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ, ПАТЕНТАМ И ТОВАРНЫМ ЗНАКАМ (12) ЗАЯВКА НА ИЗОБРЕТЕНИЕ (21), (22) Заявка: 2008122964/14, 08.11.2006 (71) Заявитель(и): ДАУ ФАРМАСЬЮТИКАЛ САЙЕНСИЗ (US) (30) Конвенционный приоритет: 09.11.2005 US 60/734,843 (43) Дата публикации заявки: 20.12.2009 Бюл. № 35 (87) Публикация PCT: WO 2007/086978 (02.08.2007) R U (54) АЗИТРОМИЦИН ДЛЯ ЛЕЧЕНИЯ ГРАНУЛЕМАТОЗНЫХ РОЗОВЫХ ( ...

Azithromycin for treatment of granulomatous rosacea

阿奇霉素全身性给药至少两个星期对减轻肉芽肿性酒糟鼻的体征和症状是有效的，肉芽肿性酒糟鼻是酒糟鼻的一种变型，通常对除肉芽肿性酒糟鼻之外的各型酒糟鼻有效的治疗方案没有有利的反应。

anti-oxidant and anti-inflammation composition extracted from Isodon excisus, and its extracting method

본 발명은 항산화 및 항염증 조성물에 관한 것으로서, 더욱 상세하게는 오리방풀에서 분리한 화합물 3-[3,4-dihydroxyphenyl]acrylic acid 1-[3,4-dihydroxyphenyl]-2-methoxycarbonylethyl ester를 함유하는 항산화 및 항염증 조성물에 관한 것이다. 상기 물질은 자유 라디칼 생성을 억제하여 항산화 효과를 가지며, 또한 NO 생성을 억제하여 항염증 효과를 나타냄으로써 약학적 조성물, 피부외용제, 화장료 조성물 또는 건강식품으로 사용 가능하다.

It is a kind of to be used to treat fat pharmaceutical composition and preparation method thereof

本发明属于药物组合物领域，尤其涉及一种主要由考来维仑与脂溶性维生素制成的用于治疗肥胖的药物组合物及其制备方法。所述药物组合物由包括考来维仑、维生素E、维生素A和药用辅料的原料制备而成。进一步的，可由包括如下重量份的原料制备而成：考来维仑1000份，维生素E 10‑30份，维生素A 1‑3份，以及所述药用辅料210‑480份。通过临床前动物试验研究显示，本发明所述的药物组合物对肥胖患者具有良好的治疗效果，同时还具有抗衰老，提高患者生活质量的良好效果，在临床治疗肥胖症以及日常保健方面具有重要的应用价值和推广意义。

The method of producing acyl derivatives of digoxin

Dermal uses of trans-retinoids for the treatment of cancer

The dermal use of non-irritating retinoids such as the esters and amides of 13-cis and 13-trans-retinoic acid for effecting the reduction and reversal of photoaging and skin cancer is disclosed.

Immunosuppressive agents

본 발명은 디테르펜 유도체를 포함하는 면역억제제에 관한 것으로서, 구체적으로는 면역학적인 면에서 염증에 관여하는 전사조절인자인 NFAT의 기능을 억제하는 면역억제제에 관한 것이다. 본 발명에 따른 약제학적 조성물은 NFAT저해활성을 나타내어, 관절염과 같은 염증성 질환의 치료에 유용할 수 있다.

The method of obtaining nanocapsules AEKol

А 2016122845 ко РОССИЙСКАЯ ФЕДЕРАЦИЯ (19) 2х 5 хх У < #2 (13) А К В ах — ВИ ° 232 (51) МПК Аб/К 9/50 (2006.0Т) В82В 1/00 (2006.0Т) ие 7 ФЕДЕРАЛЬНАЯ СЛУЖБА ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ (12) ЗАЯВКА НА ИЗОБРЕТЕНИЕ (21)(22) Заявка: 2016122845, 08.06.2016 Приоритет(ы): (22) Дата подачи заявки: 08.06.2016 (43) Дата публикации заявки: 13.12.2017 Бюл. № 35 Адрес для переписки: 305018, г. Курск, а/я 1011, Кролевцу Александру Александровичу (71) Заявитель(и): Кролевец Александр Александрович (КО) (72) Автор(ы): Кролевец Александр Александрович (КО) (54) Способ получения нанокапсул АЕКола, (57) Формула изобретения Способ получения нанокапсул АЕКола, характеризующийся тем, что в качестве оболочки нанокапсул используется ксантановая камедь, при этом АЕКол прибавляют в суспензию ксантановой камеди в бензоле в присутствии 0,01 г Е472с в качестве поверхностно-активного вещества, затем перемешивают при 1300 об/мин, после приливают 10 мл четыреххлористого углерода, после чего полученную суспензию отфильтровывают и сушат при комнатной температуре, при этом соотношение ядро/ оболочка составляет 1:1, или 1:3, или 3:1, или 1:5. Стр.: 1 па 7862191 0Сс У

The method of obtaining nanocapsules AEKol

РОССИЙСКАЯ ФЕДЕРАЦИЯ (19) RU (11) (13) 2016 134 390 A (51) МПК A61K 9/50 (2006.01) ФЕДЕРАЛЬНАЯ СЛУЖБА ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ (12) ЗАЯВКА НА ИЗОБРЕТЕНИЕ (21)(22) Заявка: 2016134390, 22.08.2016 (71) Заявитель(и): Кролевец Александр Александрович (RU) Приоритет(ы): (22) Дата подачи заявки: 22.08.2016 (43) Дата публикации заявки: 05.03.2018 Бюл. № 07 (72) Автор(ы): Кролевец Александр Александрович (RU) A R U A 2 0 1 6 1 3 4 3 9 0 (57) Формула изобретения Способ получения нанокапсул АЕКола, характеризующийся тем, что в качестве оболочки нанокапсул используется конжаковая камедь, при этом АЕКол прибавляют в суспензию конжаковой камеди в гексане в присутствии 0,01 г Е472с в качестве поверхностно-активного вещества, затем перемешивают при 1300 об/мин, после приливают 10 мл 1,2-дихлорэтана, после чего полученную суспензию отфильтровывают и сушат при комнатной температуре, при этом соотношение ядро/оболочка составляет 1:1 или 1:3 или 3:1 или 1:5. 2 0 1 6 1 3 4 3 9 0 (54) Способ получения нанокапсул АЕКола R U Адрес для переписки: 305018, г. Курск, а/я 1011, Кролевцу Александру Александровичу Стр.: 1

Method of treating periodontitis

FIELD: medicine.SUBSTANCE: invention refers to medicine, namely to dentistry, and can be used for local treatment of mild and moderate periodontitis. That is ensured by removing dental deposits and curettage of periodontal pockets. Irrigating solution for ultrasonic irrigation of periodontal pockets in scaling and closed curettage is represented by solution of Antiran preparation containing Antiran and distilled water in ratio 1:3. After ultrasonic irrigation, a protective gingival dressing is applied for a day. That is followed by transmembrane dialysis daily for 20 minutes. With mild severity of periodontitis, transmembral dialysis is performed for 3 days. Average periodontitis is 5 days.EFFECT: method provides the effective treatment of periodontitis ensured by the revealed possibility of correction of the structure and haemodynamics of the periodontium caused by the combination of irrigation with Antiran in a certain volume ratio in a solution with ultrasonic scaling and transmembrane dialysis.1 cl, 2 ex РОССИЙСКАЯ ФЕДЕРАЦИЯ (19) RU (11) (13) 2 690 433 C1 (51) МПК A61C 17/00 (2006.01) A61K 9/08 (2006.01) A61K 31/075 (2006.01) A61K 47/02 (2006.01) A61P 31/00 (2006.01) ФЕДЕРАЛЬНАЯ СЛУЖБА ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ (12) ОПИСАНИЕ ИЗОБРЕТЕНИЯ К ПАТЕНТУ (52) СПК A61C 17/00 (2018.08); A61K 9/08 (2018.08); A61K 31/075 (2018.08); A61K 47/02 (2018.08) (21)(22) Заявка: 2018112540, 06.04.2018 (24) Дата начала отсчета срока действия патента: Дата регистрации: 03.06.2019 (45) Опубликовано: 03.06.2019 Бюл. № 16 Адрес для переписки: 664081, г. Иркутск, ул. Станиславского, 1/3, кв. 23, Дударь Марине Вячеславовне 2 6 9 0 4 3 3 C 1 применения терпенсодержащего препарата в лечении хронического генерализованного пародонтита. Иркутский ГМУ Минздрава РФ, Вестник УГМУ, см. реферат, материалы и методы: абз. 5-7, результаты и обсуждение: абз. 1-3, февраль 2017. RU 2428950 C1, 20.09.2011. US 20080255498 A1, 16.10.2008. Дударь М.В. и др. Лечение (см. прод.) (54) СПОСОБ ЛЕЧЕНИЯ ...

retinol encapsulating liposome

Method for treating pigs in case of dysentery and other bacterial diseases

FIELD: veterinary.SUBSTANCE: invention relates to veterinary medicine and is intended for treatment of pig dysentery. Combination of antibacterial preparations in the form of emulsion on oil solution of eleovite is used with the following ratio of components, mass %: trichopol (metronidazole) – 2; tylan – 14; tiamulin – 5; eleovit – 32; distilled sterile water – 47. Drug is injected into muscles at a dose of 1 ml per 10 kg of body weight of the animal, but no more than 5 ml per injection, 3 times at intervals of 48 hours.EFFECT: method provides higher treatment effectiveness.1 cl, 4 tbl РОССИЙСКАЯ ФЕДЕРАЦИЯ (19) RU (11) (13) 2 678 082 C1 (51) МПК A61K 31/5517 (2006.01) A61K 31/336 (2006.01) A61K 31/07 (2006.01) A61K 38/38 (2006.01) A61P 31/04 (2006.01) ФЕДЕРАЛЬНАЯ СЛУЖБА ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ (12) ОПИСАНИЕ ИЗОБРЕТЕНИЯ К ПАТЕНТУ (52) СПК A61K 31/5517 (2006.01); A61K 31/336 (2006.01); A61K 31/07 (2006.01); A61K 38/38 (2006.01); A61K 2121/00 (2006.01) (21)(22) Заявка: 2017102073, 23.01.2017 23.01.2017 Дата регистрации: 23.01.2019 (45) Опубликовано: 23.01.2019 Бюл. № 3 105267765 A, 27.01.2016. ТИХОНОВ В.Л. и др. Применение метронидазола при дизентерии свиней. - Новости ветер. фарм. мед. - 1992. - Т.8, N 2. - с.48-50. SCHULZE F. et al. Effect of metronidazole on the gastrointestinal flora of swine Nahrung. 1987; N 31(5-6), c. 481-4. PMID:3657923. (54) Способ лечения свиней при дизентерии и других бактериальных заболеваниях (57) Реферат: Изобретение относится к ветеринарной Элеовит - 32; Вода дистиллированная стерильная медицине и предназначено для лечения дизентерии - 47. Препарат вводят в мышцы в дозе 1 мл на 10 свиней. Используют комбинацию кг массы тела животного, но не более 5 мл на 1 антибактериальных препаратов в форме эмульсии инъекцию, 3 раза с интервалами по 48 часов. на масляном растворе элеовита при следующем Способ позволяет повысить эффективность соотношении компонентов, масс. %: Трихопол лечения. 4 табл. (метронидазол) - 2; Тилан - 14; Тиамулин ...

Methods and compositions for treating hcap associated diseases

The disclosure provides, among other things, methods and compositions for treating HCAP associated diseases, such as malignant and benign cell hyperproliferative diseases. Preferred diseases include EGFR associated diseases, including cancers, e.g., breast cancer.

Sublingual or buccal introduction of dim for treating skin diseases

Группа изобретения относится к лечению кожных заболеваний. Способ лечения акне у субъекта, нуждающегося в этом, включает введение субъекту композиции, содержащей замещенный или незамещенный дииндолилметан, где композицию вводят посредством сублингвального или буккального пути. Также раскрыт способ лечения розацеа у субъекта, нуждающегося в этом. Группа изобретений обеспечивает улучшение биодоступности и фармакокинетических параметров замещенного или незамещенного дииндолилметана после сублингвального или буккального введения в сравнении с пероральным введением. 2 н. и 28 з.п. ф-лы, 2 табл., 7 пр., 2 ил. РОССИЙСКАЯ ФЕДЕРАЦИЯ (19) RU (11) (13) 2 741 577 C2 (51) МПК A61K 31/07 (2006.01) A61K 31/404 (2006.01) A61P 17/00 (2006.01) A61P 17/10 (2006.01) ФЕДЕРАЛЬНАЯ СЛУЖБА ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ (12) ОПИСАНИЕ ИЗОБРЕТЕНИЯ К ПАТЕНТУ (52) СПК A61K 31/07 (2020.08); A61K 31/404 (2020.08); A61P 17/00 (2020.08); A61P 17/10 (2020.08) (21)(22) Заявка: 2019110755, 15.09.2017 (24) Дата начала отсчета срока действия патента: (73) Патентообладатель(и): СКИНТЕК ЛАЙФ САЙЕНС ЛИМИТЕД (GB) Дата регистрации: 27.01.2021 15.09.2016 US 62/395,234 (43) Дата публикации заявки: 15.10.2020 Бюл. № 29 (45) Опубликовано: 27.01.2021 Бюл. № 3 (85) Дата начала рассмотрения заявки PCT на национальной фазе: 15.04.2019 2 7 4 1 5 7 7 (56) Список документов, цитированных в отчете о поиске: WO 2012130698 A1, 04.10.2012. WO 2016012523 A1, 28.01.2016. RU 2409363 C9, 10.12.2013. DE 102013104441 A1, 16.10.2014. Приоритет(ы): (30) Конвенционный приоритет: R U 15.09.2017 (72) Автор(ы): СКЕЙФ, Майкл, К. (US) IB 2017/001290 (15.09.2017) C 2 C 2 (86) Заявка PCT: (87) Публикация заявки PCT: R U 2 7 4 1 5 7 7 WO 2018/051183 (22.03.2018) Адрес для переписки: 119019, Москва, Гоголевский бульвар,11, Строкова Ольга Владимировна (54) СУБЛИНГВАЛЬНОЕ ИЛИ БУККАЛЬНОЕ ВВЕДЕНИЕ DIM ДЛЯ ЛЕЧЕНИЯ ЗАБОЛЕВАНИЙ КОЖИ (57) Реферат: Группа изобретения относится к лечению нуждающегося в этом. Группа изобретений кожных заболеваний. ...

Compositions comprising meroterpenes and linoleic acid derivatives and their use for regulating the endocannabinoid system

Compositions comprising select meroterpenes and a linoleic component and the use thereof in regulating the endocannabinoid system (ECS).

Treatment of cellulite with retinoids

Procédé servant à inhiber et à inverser le processus de formation de la cellulite et comprenant l'application localisée d'un rétinoïde sur l'épiderme en quantité et pendant une durée suffisantes pour inhiber ou inverser le processus de formation de la cellulite, mais en quantité insuffisante pour provoquer une irritation excessive. Le procédé utilise de préférence, de l'acide rétinoïque contenu dans un excipient émollient. A method for inhibiting and reversing the cellulite formation process and comprising the localized application of a retinoid to the epidermis in an amount and for a duration sufficient to inhibit or reverse the cellulite formation process, but in quantity insufficient to cause excessive irritation. The process preferably uses retinoic acid contained in an emollient excipient.

13-Cis-retinoic acid for the use in compositions against the aging of the skin

13-cis-Retinoic acid can be used in topical products for the treatment of light-damaged skin (ageing skin).

Patent EP0573601A4