METHOD FOR EXTENDING HALF-LIFE OF PROTEIN
The present invention refers to protein or (poly) peptide of substituting residues of the peptide by one or more (poly) protein or a method which increases half-life are disclosed. In addition this method it became work number (poly) peptides by increased half life protein or are disclosed. Intracellular protein decomposition lysosomal (lysosome) effected by two paths and proteasome (proteasome). 10 - 20% Of a protein degrading lysosomal path temporal ethylene free substrate specificity and sophisticated. I.e. cells into the cell surface protein (endocytosis) containing embedded into movement under most extracellular or the membrane protein as the process of disassembling a lysosomal are disclosed. However, proteins in eukaryotic cells in order to selectively decomposed by an enzyme target protein ubiquitin (ubiquitin) coupled after polyubiquitin chains formed [khwi this natural binding, this process is recognized by proteasome and decomposed, i.e. ubiquitin - proteasome via path (ubiquitin-a proteasome pathway: UPP) should. A recombinant eukaryotic cells along with an 80 - 90% or more of the through this process, ubiquitin - proteasome path present in eukaryotic cells by adjusting most of Proteolysis, load and homeostasis protein responsible for substrate. Natural [...] highly conserved 76 amino acids present in the protein as substantially all of eukaryotic cells, among the second amino acid residue lysine (Lysine, Lys, K) and 6, 11, 27, 29, 33, 48, 63, 63 and 48 once the polyubiquitin chain defining the major could be bonded each other. (E1, E2, E3) (ubiquitination) [khwi this natural set of enzyme-based up-and-labeled protein which participates, labeled protein is ATP - dependent protein decomposition enzyme complex is decomposed by proteasome 26S are disclosed. - Ubiquitin proteasome path to separate two consecutive makes including, first one of the substrate and several ubiquitin molecules covalently mark process, by a second ubiquitin 26S proteasome complex labeled protein from being degraded by proteolytic process are disclosed. The combination of substrate molecules at the end of the lysine residue natural [...] C - [khwi with natural substrate peptide (isopeptide bond) occurs through glycine between isoforms, ubiquitin activating enzyme E1 -, coupled enzyme E2 - ubiquitin, ubiquitin by natural number E3 enzyme [khwi with the mote the s reel [lu which comes between the chemical modification by forming a combustion chamber. One of the ATP - dependent reaction [...] natural active to about E1 (ubiquitin non-activating enzyme). E2 - E1 ubiquitin moiety within a domain cysteine (cysteine) (ubiquitin-a conjugating enzyme) is [khen gay [syen anger receives the same number from activated natural [...] E3 (ligase) positioned directly delivers the enzyme or protein modification. E3 enzyme also catalyzes the natural matrix protein lysine [...] glycine residues between preexisting isocyanate groups stable covalent bond or a peptide. C - [...] natural substrate bound to the protein lysine residues [khwi this another natural end can be connected, by repeating these procedures several matrix protein ubiquitin molecules to cover the connected polyubiquitin chain branching are formed and then are degradable protein recognized by the 26S proteasome are selected. On the other hand, a wide variety of protein and (poly) peptide in vivo therapeutic effect is known. The protein or (poly) peptide in vivo therapeutic effect, e.g., growth hormone releasing hormone (growth hormone releasing hormone, GHRH), growth hormone releasing peptide (growth hormone releasing peptide), interferon (interferons, interferon - α or interferon - β), interferon receptor (interferon receptors), colony stimulating factor (colony stimulating factors, CSFs), glucagon - like peptide (glucagon - like peptides), interleukin (interleukins), interleukin receptor (interleukin receptors), to pretension (enzymes), interleukin binding protein (interleukin binding proteins), cytokine binding protein (cytokine binding proteins), G - protein - coupled receptor (G - protein - coupled receptor), human growth hormone (human growth hormone, hGH), macrophage activating factor (macrophage activating factor), granulocyte-macrophage colony stimulating peptide (macrophage peptide), B cell factor (B cell factor), T cell factor (T cell factor), protein A (protein A), it knows hindrance number (allergy inhibitor), the writing nose only necrosis (cell necrosis glycoproteins), G - protein - coupled receptor (G - protein - coupled receptor), immunotoxin (immunotoxin), lymphotoxin (lymphotoxin), tumor necrosis factor (tumor necrosis factor), tumor billion user number (tumor suppressors), transition growth factor (metastasis growth factor), alpha -1 antitrypsin (alpha - 1 antitrypsin), albumin (albumin), alpha - (alpha - lactalbumin) [...] albumin, lipoprotein apolipoprotein a - E (apolipoprotein - E), erythropoietin (erythropoietin), highly glycosylated with erythropoietin (highly glycosylated erythropoietin), angiopoietin (angiopoietins), hemoglobin (hemoglobin), thrombin (thrombin), thrombin receptor activating peptide (thrombin receptor activating peptide), [...] (thrombomodulin), number VII factor (factor VII), number VIIa factor (factor VIIa), number VIII factor (factor VIII), number IX factor (factor IX), number XIII factor (factor XIII), plasminogen activating factors (plasminogen activating factor), passage height it recovers, number (urokinase), Streptomyces height it recovers, number (streptokinase), hirudin (hirudin), C protein (protein C), C - reactive protein (C - reactive protein), number (renin inhibitor) renin inhibitor, inhibiting low speed number (collagenase inhibitor), super oxide discharge nothing other oh number (superoxide dismutase), leptin (leptin), platelet derived growth factor (platelet - derived growth factor), epidermal growth factor (epithelial growth factor), endothelial cell growth factor (epidermal growth factor), angiostatin (angiostatin), angiotensin (angiotensin), the growth factor which boils (bone growth factor), wall pole protein (bone stimulating protein), calcitonin (calcitonin), insulin (insulin), art five [pheyp (atriopeptin), cartilage inducing factor (cartilage inducing factor), fibrin binding peptide (fibrin - binding peptide), l car toe [nin (elcatonin), connective tissue activating factor (connective tissue activating factor), tissue coagulation factor orgin billion number number (tissue factor pathway inhibitor), follicle stimulating hormone (follicle stimulating hormone), n-desmethyl (luteinizing hormone), hormone releasing hormone (luteinizing hormone releasing hormone), neurological growth factor (nerve growth factors), parathyroid hormone (parathyroid hormone), relaxin (relaxin), chronic obstructive pulmonary disease (secretin), high titer production (somatomedin), insulin-like growth factor (insulin - like growth factor), adrenal cortex hormone (adrenocortical hormone), glucagon (glucagon), call [ley hour talkie [nin (cholecystokinin), pancreatic pulley [pheyp tie [tu (pancreatic polypeptide), gastrin secretion peptide (gastrin releasing peptide), corticotrophin releasing factor (corticotropin releasing factor), thyroid-stimulating hormone (thyroid stimulating hormone), auto [thayk new (autotaxin), lactoferrin (lactoferrin), myostatin (myostatin), receptor (receptors), receptor antagonists (receptor antagonists) number, cell surface antigen (cell surface antigens), of viral origin vaccine antigens (virus derived vaccine antigens), mono claw board antibodies (monoclonal antibodies), poly claw board antibodies (polyclonal antibodies), and antibody fragment comprises. One of the plurality of pin the pancreatic insulin secretion of β - (β-a trophin) β - cells rapidly growing substrate. One of the plurality of pin number 2 β - 1 year or month for patients with diabetes mellitus by administration, blood sugar value constantly conditioned can be pancreatic β - substantially maintaining the activity of cells. In addition, insulin administered but, β - is effected by administering human body substantially free amine adverse side of one of the plurality of pin. One of the plurality of pins between a wrong temporal expression of mouse pancreatic β - - proliferation of beta cells promoted corrosion disclosed (Cell 153, 747 - 758, 2013) reported that. Growth hormone (Growth hormone: GH) peptide hormone the same is made to synthesis and secretion in pituitary former lobe, in vivo bone, cartilage growth such as to promote the decomposition of lipid and protein synthesis as well as metabolic to barge into substrate. Liver fibrosis therapy can be used in a penis growth hormone may, dwarfs the congenital cardiac fibrosis, chronic pulmonary disorders, chronic kidney disease, due to the chronic wasting disease treating dwarfs, growth hormone deficiency degradation thyroid or liver fibrosis, diabetes hormone secretion or more dwarfs due to use, can be native or disease comprising ternary syndrome chromosome. STAT (signal transducers and activators of transcription) protein gene for regulating transcription level of growth hormone may (Oncogene, 19, 2585 - 2597, 2000) that it has been reported. Insulin (Insulin) vivo glucose control as follows. Of the pancreas is a paper machine through the blood glucose concentration of the insulin is destroyed insulin shortage increases sodium channel modulators can be administered to a patient number 1. In addition, the concentration of blood glucose in spite of secreted insulin generation somatic insulin receptor resistant sodium channel modulators can be administered for amplifying a patient that is not regulated number 2. The resulting temperature difference between STAT3 phosphorylation of the insulin is stimulating hepatic artery (glucose) it has been reported that regulating homeostasis (Cell Metabolism 3, 267 - 275, 2006). The immune system cells of the leukocyte interferon (Interferons), antibody of axl (natural killer cell), fibroblast, epithelial cells are obtained and made and secreted, the protein family naturally occurring electromagnetic wave is disclosed. The interferon type I, type II, and type III receptor proteins having 3 to each classification of determined depending on the type of delivery. It will therefore completely fails or the mechanisms of action of interferon, virus, bacteria, and the other arm for modulating immune system of external materials if known. On the other hand, directly kill the virus or cancer are interferon on which facilitates the reaction of the immune system and, adjusting agent or a gene by numerous protein secretion a tumor number billion growth of cancer cells in the base. Interferon type I IFN provided α is included and used in the treatment of hepatitis B hepatitis C are capable of having a known, can be used to treat multiple sclerosis is IFN-a β. Interferon - α is STAT provided 1, on increasing -2 -3 (J Immunol, 187, 2578 - 2585, 2011) value that is reported, melagatran roh e (melanoma) for stimulating the growth by activating cells in which the interferon - α that STAT3 protein has been reported (Euro J Cancer, 45, 1315 - 1323, 2009). Processing a cell interferon - β side including a it has been reported that an active signal transduction induced AKT (Pharmaceuticals (Basel), 3, 994 - 1015, 2010). Granulocyte colony magnetic pole factor (G-a CSF: Granulocyte-a colony stimulating factor) is granulocyte and made marrow cells to discharge for preparing stem cells and blood flow agents or glycoprotein are disclosed. It acts as a type of colony magnetic pole factor (colony stimulating factor) and promotion of functionally cytokines are disclosed. G-a CSF is amorphous hematopoietic scheme in addition to acting as the apoptosis of Neurotrophic factor can be. Its receptors expressed in brain and spinal cord neurons in the central nervous system number chamber and both being in the operation of the neuronal G-a CSF, neural plasticity in plan company cells increase the slide groove. Due to these properties is for treatment of neurological disorders such as brain infarction G-a CSF study power during disclosed. G-a CSF is granulocyte generation of electromagnetic wave is returning stimulating leukocytes. In addition, recombinant forms of neutrophil in oncology hematology G-a CSF chemotherapeutic cancer patients are used to primarily for facilitating recovery from 19. In the H chain (glioma) is granulocyte colony magnetic pole factor (G-a CSF) activate the H chain involved in proliferation and this is effected by insuring that STAT3 has been reported (Cancer Biol Ther. , 13 (6), 389 - 400, 2012), Expressed in ovarian epithelial cancer (ovarian epithelial cancer cells) and female uterine cancer pathologies that JAK2/STAT3 path along adjusting a take-all decline relationship has been reported (Br J Cancer, 110, 133 - 145, 2014). The glycoprotein hormone erythropoietin (Erythropoietin, EPO), interleukin 3 (IL-a 3), interleukin 6 (IL-a 6), various such growth factor viii. glucocorticoid stem cell factor. As erythropoietin cytokine involved in erythropoiesis while bone marrow precursor of red form present in 2000. In addition, erythropoietin dependent hypertension associated with vascular contraction which, in-vivo iron control hormone (iron-a regulatory hormone) generated between number regulated by to increase the absorption of iron ions to absorption of hormone [...] billion in 2000. In addition, the neuronal injury such as stroke or myocardial infarction erythropoietin for used for the reaction of protecting brain nerve plays an important role. As well as memory enhancing, wound recovery, effectively treating depression passes is known. The erythropoietin or erythropoietin lung cancer are blood cancer increased phosphorylation of cell cycle progression by administering Erk1/2 when adjusting to increase a dragging effect such that it has been reported in hypoxic (J Hematol Oncol. , 6, 65, 2013). Recombinant fibroblast growth factor -1 acidic FGF (Fibroblast growth factor-a 1: FGF-a 1) and embryonic development as one of the fibroblast growth factor, cell growth, tissue regeneration, cancer growth transition or the like could be bonded each other. In addition clinical study (angiogenesis) it has been reported that induce cardiac angiogenesis in FGF-a 1 (BioDrugs. , 11 (5), 301308, 1999). To promote growth of fibroblasts to FGF citrus peel is in operation due to healthy skin-elasticity enhancing skin dermis cells keep the perpendicular distance which makes skin moistened skin cells to the activation of the entire of lifting [...] bright that the skin causes can be maintained. In addition, the wound or skin or damaged to quickly recover from defense function-treatment to enhance skin barrier aids also other. HEK293 cells sheet also increases it has been reported that the Erk 1/2 phosphorylation (Nature, 513 (7518), 436 - 439, 2014). (Vascular endothelial growth factor A: VEGFA) (vasculogenesis) and angiogenesis is vascular endothelial generating factor A angiogenesis stimulating signal transduction protein (angiogenesis) in its own inside of the tissues of hypoxic environment as could be bonded each other (Mol Cell Endocrinol. , 397, 5157, 2014). Bronchial asthma in the case of diabetes, (Diabetes, 48 (11), 22292239, 2013) which increased concentration plasma of VEGF, VEGF function to the normal embryonic development, generation of new vascular injury, after movement of the muscles used for the new function such as blind passage. The VEGF is [...] diseases simultaneously with each other. In the case of solid tumors are not injected continuously blood cannot be longer than when the growing transition occurs increases VEGF is expressed to be coated. Growth and proliferation of endothelial cells associated with the angiogenesis action where it is as important factor to cancer cells, it has been reported that when the PI3K/Akt/HIF-a 1 alpha signal transduction involving (Carcinogenesis, 34, 426 - 435, 2013). It has been reported that AKT phosphorylation in addition VEGF is inducing (Kidney Int. , 68, 1648 - 1659, 2005). In adipose tissue (Ghrelin) promoting hormone secreted protein (Leptin) and appetite billion number appetite during immune response number protein (Leptin) appetite billion, reproductive and hematopoietic action plays an important role and a water-circulating hormone 16 provided kDa (Cell Res. , 10, 81 - 92, 2000), Promoting appetite hormone (Ghrelin) growth hormone release receptor (the growth hormone secretagogue receptor; GHS-a R) adipose tissue through the chloride ion secretion in appetite and stored thereon until the next 28 amino acids peptide (stomach-a peptide) (J Endocrinol. , 192, 313323, 2007; Nature, 442, 656 - 660, 1999), formed through processing procedures from preproghrelin (Pediatr Res. , 65, 3944, 2009; J Biol Chem. , 281 (50), 3886738870, 2006). The adipose tissue (Leptin) protein secretion in appetite satiety billion number enabling no longer food until the next to hormone, hormone secretion door number eat the data reporting desire is generated. As the leptin secretion of insulin secretion is an oligosaccharide solution to enhance the secretion of appetite increase lowers the C35 fatty acid reported corrosion disclosed (J Biol Chem. , 277 (7), 5667 - 5674, 2002; I. J. S. N. , 7 (1), 06 - 15, 2016). In addition number protein phosphorylation of AKT in breast cancer are increasing appetite billion (Leptin) that has been reported (Cancer Biol Ther. , 16 (8), 1220 - 1230, 2015), PI3K/AKT signal transduction by agents that uterine cancer growth in cancer cells has been reported (Int J Oncol. , 49 (2), 847, 2016). Appetite while promoting hormone (Ghrelin) growth hormone release receptor (the growth hormone secretagogue receptor; GHS-a R) through the effect of cell growth, it has been reported that STAT3 through increasing calcium regulation body (Mol Cell Endocrinol. , 285, 19 - 25, 2008). (GLP-a 1) is secreted in the writing base car the similar peptide which it boils and team L opening to deliver the enhance insulin secretion as retinoic (incretin) hormone. In particular, glucose concentration which does not easily generate that blood glucose is characterized by insulin according to enhance secretion, thanks to this feature 2 can be used in the treatment of diabetes type report described (Pharmaceuticals (Basel), 3 (8), 2554 - 2567, 2010; Diabetologia, 36 (8), 741 - 744, 1993). In addition GLP-a 1 lowering movement of upper fire extinguisher tube, such as appetite billion respectively number whose action present methods for the expansion of the pancreas is a β disapproval (Endocr Rev. , 16 (3), 390 - 410, 1995; Endocrinology, 141 (12), 4600 - 4605, 2000; Dig Dis Sci. , 38 (4), 665 - 673, 1993; Am J Physiol. , 273 (5 Pt 1), E981988, 1997). However GLP-a 1 to about 2 minutes after cutting to developed with a number of acute coronary syndrome very short etc. too large a drawback. In addition glucose homeostasis adjusts a current diabetes treatment number in which insulin resistance plays an important role since it has been reported that induce STAT3 (Biochem Biophys Res Commun. , 425 (2), 304 - 308, 2012). The formation protein which it boils (BMP2) as one of the TGF-a β superfamily (superfamily), cartilage and important role protein and bone formation, cell growth, cell death and differentiation in used for the central nervous system role (Genes Dev. , 10, 1580 - 1594, 1996; Development, 122, 3725 - 3734, 1996; J Biol Chem. , 274, 26503 - 26510, 1999; J Exp Med. , 189, 1139 - 1147, 1999). Myeloma bone disorder patient shown in anticancer effect treating multiple myeloma cells inducing apoptosis can be seen to be used as multiple number report described (Blood, 96 (6), 2005 - 2011, 2000; Leuk Lymphoma. , 43 (3), 635 - 639, 2002). Immunoglobulin G (IgG) antibodies is found in blood and decorations is provided major external misfortune cells resistant tissue antibodies hepatitis c viral infection control each other. IgG monomer and small size, this IgG easily can flow through the diffuse to the organization(Basic Histology, McGraw-a Hill, ISBN 0 - 8385 - 0590 - 2, 2003). IgG is immunodeficiency, autoimmune diseases, and are used to treat infections (Proc Natl Acad Sci U S A. , 107 (46), 19985 - 19990, 2010). Additional information that uniquely identifies you. Related therapeutic protein involved in the regulation of body homeostasis is increasing the number of risk murill etc. and has fewer side effects. For example, the treatment of thyroid cancer inhibiting insulin secretion hormone degrading enzymes (DPP-a 4) number sequence number to number is enabled without cloning, insulin writing position risk breast cancer to increase known. In addition, disease is growth hormone or growth hormone secretion in patients with diabetes continuously administer excess crude, fine vascular disorders, etc. the number of passes is associated with early death reported. As such, the development of new therapeutic number number existing protein and related therapeutic administration of width is need, the present invention victims of the protein amino acid sequence one or more lysine ubiquitin proteasome system by protein of substituting residues - prevent from being degraded by proteolytic method which increases half-life of proteins by the arrears of work. The present invention refers to a protein or (poly) peptides which increases half-life number [...] intended for the method. In addition the present invention refers to one or more lysine residues substituted protein as amino acid sequence, the protein having a number [...] intended for the increased half-life. In addition, the present invention refers to pharmaceutical compositions including proteins have an increased half having the number [...] intended. In order to achieve said purposes, the present invention refers to protein amino acid sequence including the one or more lysine substituting residues, protein a method which increases half-life number [...] substrate. In the present invention, a conservative amino acid protein lysine residue can be substituted. In the present invention, "conservative amino acid substitution" similar amino acid residues, e.g., charge or hydrophobicity substituted by an amino acid residue side chains which have different chemical properties which means that the other. Generally conservative amino acid substitutions to the functional characterization of protein by substantially does not change. An example of side chain amino acid group having similar chemical properties 1) aliphatic side chains: glycine, alanine, valine, leucine and acid leucine; 2) aliphatic - hydroxyl side chains: serine and threonine; 3) amide - side chain: asparagine and glutamine; 4) aromatic side chains: phenylalanine, tyrosine and tryptophan; 5) basic side chains: lysine, arginine and histidine; 6) acidic side chains: oh [su group [lu glutamate 7 and C16) sulfur - side chain: comprising cysteine and methionine. In the present invention protein lysine side chains including arginine or histidine can be substituted basic residue, preferably arginine residues is substituted. According to the present invention one or more lysine residues protein amino acid sequence protein is substituted with arginine which can be can be increased half life remaining in long time. Figure 1 β - indicating the structure of one of the plurality of pin expression vectors are disclosed. Figure 2 β - gene PCR for indicating one of the plurality of pin layer are disclosed. Figure 3 HEK-a 293T plasmid gene in β - revealing the expression of one of the plurality of pins are disclosed. Figure 4 when one of the plurality of pin number etched by analyzing β - [khwi anger natural decomposition path. Figure 5 shows a β - arginine lysine residues which are substituted with one of the plurality of pin also compared to wild-type BIP substituent exhibits positive [khwi anger. Figure 6 protein synthesis inhibitor (cycloheximide, CHX) number which has been treated with one of the plurality of pin exhibits after half-β - cycloalkyl [...] change. Figure 7 shows a JAK-a STAT signaling such as oil also exhibits the results for the effect. Structure of Figure 8 exhibits growth hormone expression vector. Figure 9 layer exhibits growth hormone for PCR. Figure 10 HEK-a 293T cells indicating the expression of growth hormone plasmid gene are disclosed. Figure 11 [khwi anger natural growth hormone releasing number etched when decomposition of path analysis. Figure 12 shows a lysine residues are substituted with arginine also compared to wild-type growth hormone substituent exhibits positive [khwi anger BIP. Figure 13 which has been treated with growth hormone protein synthesis inhibitor (cycloheximide, CHX) half-life number cyclo [...] exhibits after change. Figure 14 shows a JAK-a STAT signaling such as oil also exhibits the results for the effect. Figure 15 structure of insulin expression vector exhibits. Figure 16 exhibits insulin for PCR result. Figure 17 HEK-a 293T cells expression of insulin plasmid gene by a goniophotometer. [Khwi anger natural insulin analysis decomposition of path number etched in Figure 18. Figure 19 shows a lysine residues are substituted with arginine also compared to wild-type insulin substituent exhibits positive [khwi anger BIP. Figure 20 has been treated with a protein synthesis inhibitor (cycloheximide, CHX) number cyclo [...] exhibits change after insulin half-life. Figure 21 shows a JAK-a STAT signaling such as oil also exhibits the results for the effect. Figure 22 interferon - α expression vector indicating the structure of substrate. Figure 23 interferon - α gene exhibits for PCR result. Figure 24 HEK-a 293T cells expression of interferon - α gene plasmid by a goniophotometer. Figure 25 natural interferon - α [khwi anger number etched during decomposition of path analysis. Figure 26 shows a interferon - α substituent substituted with arginine lysine residues also compared to wild-type BIP exhibits positive [khwi anger. Figure 27 protein synthesis inhibitor (cycloheximide, CHX) has been treated with a half-life change number cyclo [...] exhibits after interferon - α. Figure 28 shows a JAK-a STAT signaling such as oil also exhibits the results for the effect. Figure 29 G non-CSF expression vectors indicating the structure of substrate. Figure 30 G non-CSF gene exhibits for PCR result. Figure 31 HEK-a 293T cells expression of plasmid gene exhibits G-a CSF. [Khwi anger natural decomposition of path number etched by analyzing G-a CSF in Figure 32. Figure 33 shows a lysine residues are substituted with arginine also compared to wild-type BIP G-a CSF substituent exhibits positive [khwi anger. Figure 34 has been treated with a protein synthesis inhibitor (cycloheximide, CHX) number cyclo [...] exhibits G non-CSF after half-life change. Figure 35 shows a JAK-a STAT signaling such as oil also exhibits the results for the effect. Figure 36 - β interferon expression vector indicating the structure of substrate. Figure 37 interferon - β gene exhibits for PCR result. Expression of interferon - β plasmid gene exhibits Figure 38 HEK provided 293T cells. Figure 39 natural interferon - β [khwi anger number etched when decomposition of path analysis. Figure 40 shows a arginine lysine residues also compared to wild-type interferon - β substituent substituted BIP exhibits positive [khwi anger. Figure 41 protein synthesis inhibitor (cycloheximide, CHX) - β interferon after half-life has been treated with a number cyclo [...] exhibits change. Figure 42 shows a result for the effects such as PI3K/AKT signaling also JAK-a STAT and oil exhibits. Figure 43 structure of erythropoietin expression vector exhibits. Figure 44 exhibits for erythropoietin gene PCR result. Figure 45 HEK-a 293T cells expression of erythropoietin plasmid gene by a goniophotometer. Figure 46 natural decomposition of path number etched when erythropoietin by analyzing [khwi anger. Figure 47 shows a lysine residues are substituted with arginine also compared to wild-type erythropoietin substituent exhibits positive [khwi anger BIP. Figure 48 protein synthesis inhibitor (cycloheximide, CHX) which has been treated with erythropoietin after half-life change number cyclo [...] exhibits. Figure 49 shows a MAPK/ERK signaling such as oil also exhibits the results for the effect. Figure 50 BMP2 expression vector indicating the structure of substrate. Figure 51 BMP2 gene exhibits for PCR result. Figure 52 HEK-a 293T cells expression of plasmid gene exhibits BMP2. Figure 53 natural decomposition of path number BMP2 when etched by analyzing [khwi anger. Figure 54 shows a lysine residues are substituted with arginine also compared to wild-type BIP BMP2 substituent exhibits positive [khwi anger. Figure 55 protein synthesis inhibitor (cycloheximide, CHX) has been treated with a half-life change number cyclo [...] after BMP2 exhibits. Figure 56 shows a JAK-a STAT signaling such as oil also exhibits the results for the effect. Figure 57 fibroblast growth factor -1 (FGF-a 1) expression vector indicating the structure of substrate. Figure 58 (FGF-a 1) gene for fibroblast growth factor -1 exhibits PCR result. Figure 59 HEK-a 293T cells (FGF-a 1) expression of fibroblast growth factor -1 plasmid gene exhibits. Figure 60 by analyzing fibroblast growth factor -1 (FGF-a 1) [khwi anger natural decomposition of path 25 in number. Figure 61 shows a lysine residues are substituted with arginine also compared to wild-type fibroblast growth factor -1 exhibits positive [khwi anger BIP (FGF-a 1) substituent. Figure 62 which has been treated with protein synthesis inhibitor (cycloheximide, CHX) number cyclo [...] after fibroblast growth factor -1 (FGF-a 1) exhibits change half-life. Figure 63 shows a MAPK/ERK signaling such as oil also exhibits the results for the effect. Figure 64 exhibits structure of leptin (Leptin) expression vector. Figure 65 exhibits for leptin (Leptin) gene PCR result. Figure 66 HEK-a 293T cells expression of plasmid gene exhibits leptin (Leptin). Figure 67 [khwi anger natural decomposition of path number etched in leptin (Leptin) analysis. Figure 68 shows a leptin (Leptin) substituted with arginine lysine residues also compared to wild-type BIP substituent exhibits positive [khwi anger. Figure 69 which has been treated with protein synthesis inhibitor (cycloheximide, CHX) number cyclo [...] leptin (Leptin) exhibits change after half-life. Figure 70 shows a PI3K/AKT signaling also exhibits the results for the effect such as oil. Figure 71 exhibits structure of vascular endothelial growth factor (VEGFA) expression vector. Figure 72 exhibits PCR result for vascular endothelial growth factor (VEGFA) gene. Figure 73 HEK-a 293T cells expression of vascular endothelial growth factor (VEGFA) plasmid gene by a goniophotometer. Figure 74 [khwi anger natural decomposition of path number etched in vascular endothelial growth factor (VEGFA) analysis. Figure 75 shows a wild-type arginine lysine residues substituted also compared to vascular endothelial growth factor (VEGFA) substituent exhibits positive [khwi anger BIP. Figure 76 protein synthesis inhibitor (cycloheximide, CHX) number cyclo [...] has been treated with a half-life after vascular endothelial growth factor (VEGFA) indicating a change in the other. Figure 77 shows a result for the effects such as PI3K/AKT signaling also JAK-a STAT and oil exhibits. Figure 78 ghrelin/five hemp cloth star [thin enzymatic peptide (Ghrelin/obestatin prepropeptide) expression vector (Prepro provided GHRL) indicating the structure of substrate. Figure 79 ghrelin/PCR result for five hemp cloth star [thin enzymatic peptide gene exhibits. Figure 80 HEK-a 293T cells expression of plasmid Prepro provided GHRL gene exhibits. Figure 81 [khwi anger natural decomposition of path by analyzing Prepro provided GHRL etched in number. Figure 82 shows a lysine residues are substituted with arginine also compared to wild-type BIP Prepro provided GHRL substituent exhibits positive [khwi anger. Figure 83 after protein synthesis inhibitor (cycloheximide, CHX) has been treated with a half-life change number cyclo [...] Prepro provided GHRL exhibits. Figure 84 shows a JAK-a STAT signaling such as oil also exhibits the results for the effect. Figure 85 GHRL expression vector indicating the structure of substrate. Figure 86 GHRL gene exhibits for PCR result. Figure 87 HEK-a 293T cells expression of plasmid GHRL gene by a goniophotometer. [Khwi anger natural decomposition of path number etched by analyzing GHRL in Figure 88. Figure 89 shows a lysine residues are substituted with arginine also compared to wild-type BIP GHRL substituent exhibits positive [khwi anger. Figure 90 protein synthesis inhibitor (cycloheximide, CHX) number cyclo [...] GHRL has been treated with a half-life exhibits after change. Figure 91 shows a JAK-a STAT signaling such as oil also exhibits the results for the effect. The writing base car similar boils [pheyp tie [tu Figure 92 -1 (GLP-a 1) expression vector indicating the structure of substrate. (GLP-a 1) gene PCR result for the writing base car similar boils [pheyp tie [tu Figure 93 -1 exhibits. The writing base car similar boils [pheyp tie [tu (GLP-a 1) expression of plasmid gene exhibits -1 Figure 94 HEK-a 293T cells. Figure 95 by analyzing the writing base car similar boils [pheyp tie [tu [khwi anger natural decomposition of path number -1 (GLP-a 1) when etched. Figure 96 shows a lysine residues are substituted with the writing base car similar boils [pheyp tie [tu also compared to wild-type arginine -1 BIP (GLP-a 1) substituent exhibits positive [khwi anger. Figure 97 protein synthesis inhibitor (cycloheximide, CHX) after the writing base car similar boils [pheyp tie [tu has been treated with a number cyclo [...] -1 (GLP-a 1) exhibits a change in half-life. Figure 98 shows a JAK-a STAT signaling such as oil also exhibits the results for the effect. Figure 99 IgG expressed vector indicating the structure of substrate. Figure 100 IgG heavy gene exhibits for PCR result. Expression of gene exhibits IgG heavy plasmid Figure 101 HEK-a 293T cells. Figure 102 [khwi anger natural number by analyzing IgG immunoglobulin heavy chain decomposition path when etched. Figure 103 shows a lysine residues are substituted with arginine also compared to wild-type BIP IgG heavy substituent exhibits positive [khwi anger. Figure 104 has been treated with a protein synthesis inhibitor (cycloheximide, CHX) number cyclo [...] IgG immunoglobulin heavy chain exhibits change after half-life. Figure 105 IgG light chain expression vector indicating the structure of substrate. Figure 106 IgG light chain gene exhibits for PCR result. Figure 107 HEK-a 293T cells expression of gene exhibits IgG light chain plasmid. Figure 108 [khwi anger natural number by analyzing IgG [...] decomposition path when etched. Figure 109 shows a lysine residues are substituted with arginine also compared to wild-type BIP IgG light chain substituent exhibits positive [khwi anger. Figure 110 has been treated with a protein synthesis inhibitor (cycloheximide, CHX) number cyclo [...] IgG immunoglobulin heavy chain exhibits change after half-life. One embodiment of the present invention, protein is one of the plurality of pin β - among others. One of the plurality of pin 62, 124, 153 and 158 in an amino acid sequence represented by sequence number 1 β - N - end and one or more arginine residues is substituted with an uncovered from lysine residue. As a result, the β - said one of the plurality of pin and increased half life including inhibiting adipogenesis and/or treating diabetes pharmaceutical composition co number encoded (Cell, 153 (4), 747758, 2013; Cell Metab. , 18 (1), 5 - 6, 2013; Front Endocrinol (Lausanne), 4, 146, 2013). Other in one embodiment of the present invention, protein is growth hormone are disclosed. Sequence number 10 from second end 64, 67, 96, 141, 166, 171, 184, 194 and 198 in an amino acid sequence represented by growth promotion of one or more arginine residues is substituted with an N - lysine residue. The, said increased half life growth hormone and including other growth hormone deficient disorder and treating dwarfs (Kabuki syndrome (KSS) and Kearns-a Sayre syndrome) pharmaceutical composition for preventing or treating co number encoded (J Endocrinol Invest. , 39 (6), 667 - 677, 2016; J Pediatr Endocrinol Metab. , 2016, [Epub ahead of print]; Horm Res Paediatr. 2016, [Epub ahead of print]). Other in one embodiment of the present invention, insulin protein are disclosed. N - end 53 and 88 in an amino acid sequence represented by sequence number 17 of insulin from arginine residues is substituted with one or more second lysine residue. The, said insulin increased half life and/or treating composition for preventing and treating diabetes including encoded ball number. Other in one embodiment of the present invention, protein is interferon - α are disclosed. In an amino acid sequence represented by sequence number 22 of interferon - α from N - end 17, 54, 72, 93, 106, 135, 144, 154, 156, 157 and second lysine residue is substituted with one or more arginine residues 187. Thus, interferon - α increased half life and including a solid cancer and haematological including immune disease and/or autoimmune a cancer and/or infection for prevention and/or treating composition including ball number encoded (Ann Rheum Dis. , 42 (6), 672 - 676, 1983; Memo. , 9, 63 - 65, 2016). Other in one embodiment of the present invention, protein is granulocyte colony magnetic pole factor among others. Granulocyte colony stimulating factor in an amino acid sequence represented by sequence number 31 N - 11, 46, 53, 64 from the distal end and one or more second lysine residue is substituted with an arginine residues 73. , the granulocyte colony magnetic pole factor preventing and/or treating neutropenia nine decrements symptoms including increased half life and steel ball number encoded (EMBO Mol Med. 2016, [Epub ahead of print]). Other in one embodiment of the present invention, - β interferon protein are disclosed. Granulocyte colony stimulating factor N - from the distal end 36 in an amino acid sequence represented by sequence number 4, 40, 54, 66, 73, 120, 126, 129, 136, 144, 155 and 157 one or more arginine residues is substituted with a second lysine residue. The, - β interferon increased half life and including multiple sclerosis, autoimmune diseases, viral infections, HIV associated diseases, hepatitis C, for preventing and/or treating composition co number encoded rheumatoid arthritis. In addition, including immune disease and/or a cancer and/including a solid cancer and haematological autoimmune or infection for prevention and/or treating composition co number encoded (Ann Rheum Dis. , 42 (6), 672 - 676, 1983; Memo. , 9, 63 - 65, 2016). Other in one embodiment of the present invention, protein is erythropoietin (EPO) are disclosed. Sequence number 43 47, 72, 79, 124, 143, 167, 179 and 181 erythropoietin in an amino acid sequence represented by second lysine residue is substituted with one or more arginine residues N - from the distal end. The, increased half-life by including erythropoietin and chronic renal anemia, anemia according to surgery, such as cancer or cancer treatment according to anemia, anemia prevention and/or therapeutic pharmaceutical composition co number encoded. Other in one embodiment of the present invention, protein is the formation protein which it boils (BMP2) are disclosed. Sequence number 52 in an amino acid sequence represented by the formation protein which it boils N - from the distal end 32, 64, 127, 178, 185, 236, 241, 272, 278, 281, 285, 287, 290, 293, 297, 355, 358, 379 and 383 arginine residues is substituted with one or more second lysine residue. , the prevention and/or treatment of anemia and nitric acid increased half life including the formation protein which it boils and pharmaceutical composition co number encoded (Cell J. , 17 (2), 193 - 200, 2015; Clin Orthop Relat Res. , 318, 222 - 230, 1995). Other in one embodiment of the present invention, protein is fibroblast growth factor -1 (FGF-a 1) are disclosed. Sequence number 61 in an amino acid sequence represented by fibroblast growth factor -1 N - from the distal end 15, 24, 25, 27, 72, 115, 116, 120, 127, 128, 133 and 143 one or more arginine residues is substituted with a second lysine residue. The, increased half life fibroblast growth factor -1 and including nerve disease prevention and/or therapeutic pharmaceutical composition co number encoded. Other in one embodiment of the present invention, protein hormone (Leptin) appetite billion number are disclosed. In an amino acid sequence represented by seq ID number hormone (Leptin) N - from the distal end 26, 32, 36, 54, 56, 74 and 66 billion appetite 115 one or more arginine residues is substituted with a second lysine residue. The, number hormone (Leptin) and silica and/or increased half life appetite billion including heart disease prevention and/or therapeutic pharmaceutical composition number encoded ball/or obesity. (Ann N Y Acad Sci. , 1243, 1529, 2011; J Neurochem. , 128 (1), 162 - 172, 2014; Clin Exp Pharmacol Physiol. , 38 (12), 905 - 913, 2011) Other in one embodiment of the present invention, protein is vascular endothelial growth factor A (VEGFA) are disclosed. In an amino acid sequence represented by sequence number 75 VEGFA N - from the distal end 22, 42, 74, 110, 127, 133, 134, 141, 142, 147, 149, 152, 154, 156, 157, 169, 180, 184, 191 206 and one or more second lysine residue is substituted with an arginine residues. Thus, the increased half life VEGFA and including anti - aging, hair growth, prevention and/or treatment of diseases associated with angiogenesis and wound healing pharmaceutical composition co number encoded. Other in one embodiment of the present invention, appetite promoting hormone precursor protein are disclosed. Sequence number 39, 42, 43, 47, 85, 100, 111 and 117 in an amino acid sequence represented by promoting hormone precursor appetite 80 second lysine residue is substituted with one or more arginine residues N - from the distal end. The, increased half life appetite promoting hormone precursor and including obesity, nutrition and/or treating incontinence including use of appetite control function and prevention of hearing loss measurement ball number encoded pharmaceutical composition. Other in one embodiment of the present invention, protein is promoting hormone (Ghrelin) appetite are disclosed. Sequence number 83 in an amino acid sequence represented by promoting hormone (Ghrelin) appetite N - from the distal end 39, 42, 43, and 47 one or more arginine residues is substituted with a second lysine residue. The, increased half life appetite promoting hormone (Ghrelin) and including obesity, appetite control function diseases including use of pharmaceutical composition number encoded measurement nutritional incontinence and ball. Other in one embodiment of the present invention, the writing base car the similar peptide which it boils (GLP-a 1) protein are disclosed. Sequence number 92 117 from the distal end in an amino acid sequence represented by the writing base car the similar peptide which it boils (GLP-a 1) one or more arginine residues is substituted with an N - 125 and second lysine residue. Thus, the use of increased half life (GLP-a 1) and including the writing base car the similar peptide which it boils and/or treating composition co number encoded. One embodiment of the present invention, heavy chain (HC) immunoglobulin (IgG) protein are disclosed. The immunoglobulin heavy chain (HC) in an amino acid sequence represented by sequence number 97 (IgG) N - from the distal end 49, 62, 84, 95, 143, 155, 169, 227, 232, 235, 236, 240, 244, 268, 270, 296, 310, 312, 339, 342, 344, 348, 356, 360, 362, 382, 392, 414, 431, 436 and second lysine residue is substituted with one or more arginine residues 461. The, immunoglobulin (IgG) including increased half life and various carcinoma of pharmaceutical composition for the treatment of treatment-based antibody IgG number encoded ball number. One embodiment of the present invention, immunoglobulin (IgG) heavy chain (LC) protein are disclosed. The immunoglobulin light chain (LC) in an amino acid sequence represented by sequence number 104 (IgG) N - 61, 64, 67, 125, 129, 148, 167, 171, 191 from the distal end of, one or more arginine residues is substituted with a second lysine residue 205, 210, 212 and 229. The, immunoglobulin (IgG) including increased half life and various carcinoma of pharmaceutical composition for the treatment of treatment-based antibody IgG number encoded ball number. In the present invention, protein amino acid sequence (arginine, R) for the substitution of a lysine residue arginine residues of site specific mutations using the air induction (site-a directed mutagenesis). The method DNA sequences work grudge number after the certain mutations may derive a primer, in particular amino acid residues substituted plasmid DNA PCR performed by certain conditions a small number etched. In the present invention, the target protein by cell lines when the surface area of natural wind into and transfect immune in sinkage analysis method [khwi anger, MG132 (number proteasome inhibitors) reagent processing result, natural degree [khwi anger increases through ubiquitin proteasome degradation of target proteins via path - that has been confirmed. (Oral) oral pharmaceutical composition in the present invention, transdermal (transcutaneous), subcutaneous (subcutaneous), intravenous (intravenous) or intramuscular administration can be delivery in-vivo by a variety of routes including, scanning number number can be administered. In addition, pharmaceutical compositions of the present invention administered in accordance with the method after the fast release, prolonged release or to be released slowly can be elder brother anger method known to one skilled in the number. Said number type sealer is coated in the number (tablet), tablet (pill), powder (powder), it buys the [syey (sachet), l rack hour [lu number (elixir), suspension (suspension), emulsion (emulsion), solution (solution), syrup (syrup), aerosol (aerosol), soft or hard gelatin capsule (soft and hard gelatin capsule), a sterile injection solution (sterile injectable solution), sterile packaged powder etc.. Suitable carrier, number and dilution number include excipients, lactose (lactose), with [thu five [su dextran (dextrose), sucrose (sucrose), mannitol (mannitol), xylitol (xylitol), sweeteners (erythritol), maltitol (maltitol), carbohydrate (starches), gum acacia (gum acacia), alginate (alginates), gelatin (gelatin), calcium phosphate (calcium phosphate), calcium silicate (calcium silicate), cellulose (cellulose), methyl cellulose (methyl cellulose), creasing dephosphorisation cellulose (microcrystalline cellulose) micro, polyvinyl pyrrolidone (polyvinyl pyrrolidone), water, methyl hydroxy benzoate (methylhydroxybenzoates), propyl hydroxy benzoate (propylhydroxybenzoates), talc (talc), magnesium (magnesium stearate) and mineral oils comprise a metal salt of stearic acid. In addition, number type comprises filling number, number clause agglutination (anti non-agglutinating agents), lubricating number (lubricating agents), wet number (wetting agents), flavoring (flavoring agents), emulsion (emulsifiers) number, such as number further comprises preserving (preservative) can be. In the present invention, clearly described with a single forms will not comprising a plurality form. In addition, in the present invention configured, such as having a similar to the term "including" have meanings interpreted substrate. In the present invention, "(poly) peptide or protein physiologically active" is useful when administering to a mammal including a human biological activity (poly) peptide or protein representing big. Hereinafter, in the embodiment according to the present invention more detailed as follows. In the embodiment to exemplify the present invention is to provided for, in the embodiment for the present invention is the number by one and not the. Example embodiment 1: β - [khwi anger analysis and half-life increased intracellular signaling identifying one of the plurality of pin protein BIP checking HepG2 cells (ATCC, HB-a 8065) β - trough for cloning pin using a positive number in the RNA extracted from the Trizol and chloroform. Then (Invitrogen, Grand Island, NY) single-stranded cDNA using SuperScriptTM First non-Strand cDNA Synthesis System and copiers. The synthesized cDNA templates (template) through one of the plurality of pin was β - polymerase chain reaction amplification. One of the plurality of pin DNA amplification products pcDNA3 non-myc β - (5. 6 Kb) EcoRI fragment into BamHI cloning and joining and produced a number hanhyo factor (also 1, one of the plurality of pin β - amino acid sequence: SEQ No. 1) After hanhyo small number, agar with [cu gel electrophoresis confirmed through objects (2 also). In addition of Figure 1 bio-sequence listing underline on cloned site and coarse part confirms part may be used in polymerase chain reaction primer set message on a metal thin film and, in addition agar with [cu gel has been confirmed through electrophoresis result objects (2 also). Polymerase chain reaction conditions were as follows; in initial degeneration by reacting 3 minutes 94 °C, modified (denature) in 30 seconds for an 94 °C, annealing (annealing) in 30 seconds for an 58 °C, (extention) 1 in 25 cycle repeatedly for an extending component 72 °C have, in 10 minutes after reaction with respect to the 72 °C. The number it became work number to determine if the DNA is protein expression as indicated map of Figure 1 for present anti - myc pcDNA3 non-myc vector myc (9E 10, Santa Cruz Biotechnology, sc provided 40) electroblotting (Western blot) expression has been confirmed through the [wey the [su it shook off for using such antibodies. Through one of the plurality of pins coupled to the myc protein expression confirmed (actin) β - well when the expression vector is a loaded (loading) dose through the camera into blot (blot) has been confirmed (3 also). Lysine residues using site specific mutation induction (site-a directed mutagenesis) replaced by arginine (Arginine, R) a transparent conductive layer, certain mutations may derive a DNA primer sequences (β - trough pin K62R FP 5 '- AGGGACGGCTGACAAGGGCCAGGAA3' (SEQ No. 2), 'RP 5 provided CCAGGCTGTTCCTGGCCCTTGTCAGC-a 3' (SEQ No. 3); One of the plurality of pin β - K124R FP 5 '- GGCACAGAGGGTGCTACGGGACAGC-a 3' (SEQ No. 4), RP 5 'a-C GTAGCACCCTCTGTGCCTGGGCCA-a 3' (SEQ No. 5); One of the plurality of pin β - K153R FP 5 '- GAATTTG AGGTCTTAAGGGCTCACGC-a 3' (SEQ No. 6), 'RP 5 provided CTTGTCAGCGTGAGCCCTTAAGAC CTC-a 3' (SEQ No. 7); One of the plurality of pin β - K158R FP 5 '- GCTCACGCTGACAGGCAGAGCCACAT-a 3' (SEQ No. 8), 'RP 5 provided CCATAGGATGTGGCTCTGCCTGTCAGC-a 3' (SEQ No. 9) After a number work grudge, specific amino acid residues substituted plasmid DNA PCR-gate performing a small number. One of the plurality of pin and use pcDNA3-a myc-a β - template, a small number of plasmid DNA (K→R) arginine lysine residues (table 1) substituent is 4-gate. One of the plurality of pin and pcDNA3-a myc-a β - WT pMT123 provided HA - ubiquitin (J Biol Chem. , 279 (4), 2368 - 2376, 2004; Cell Research, 22, 873885, 2012; Oncogene, 22, 12731280, 2003; Cell, 78, 787 - 798, 1994) HEK 293T cells (ATCC, CRL-a 3216) using a plasmid encoding with respect to the infection. In order to identify one of the plurality of pin and WT 2 [khwi anger natural degree micro g DNA 1 micro g pcDNA3-a myc-a β - (co a-transfection) cavity cells transfected pMT123 provided HA - ubiquitin and 24 after a time MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 hours after processing, immune precipitated analysis was embodiment (4 also). Each one of the plurality of pin WT pcDNA3-a myc-a β - in addition, one of the plurality of pin substituent pcDNA3-a myc-a β - (K62R), one of the plurality of pin substituent pcDNA3-a myc-a β - (K124R), one of the plurality of pin substituent (K153R) pcDNA3-a myc-a β - encoding plasmid (K158R) pcDNA3-a myc-a β - and one of the plurality of pin substituent using HEK 293T been transfect cells. In order to identify one of the plurality of pin WT pcDNA3-a myc-a β - [khwi anger natural degree, one of the plurality of pin substituent pcDNA3-a myc-a β - (K62R), one of the plurality of pin substituent pcDNA3-a myc-a β - (K124R), and one of the plurality of pin substituent (K153R) pcDNA3-a myc-a β - (K158R) 2 g each one of the plurality of pin substituent pcDNA3-a myc-a β - a micro g cells transfected DNA 1 micro pMT123 provided HA - ubiquitin (co-a transfection) 24 and sedimentation analysis has been completed and cavity fiberizable immunospecifically his embodiment (5 also). For returned obtained protein sample dissolves immune buffer (1% Triton X, 150 mm NaCl, 50 mm Tris a-HCl, pH 8 and 1 mm PMSF (phenylmethanesulfonyl fluoride) cyanuric acid, anti - myc (9E 10) antibody (Santa Cruz Biotechnology, sc provided 40) and 4 °C 1 difference in mixed with him as during night. 4 °C sinkage body protein A/G beads (Santa Cruz Biotechnology) 2 in time using immune reaction was separated. Next, the-wash 2 buffer was dissolved. Protein samples after 7 minutes in 100 °C heated 2X SDS mixed with buffer, SDS-a PAGE to separate a her embodiment. (Polyvinylidene difluoride, PVDF) membrane (Millipore) after moved from poly vinyl this flow which is burnt the id separated protein, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - HA (Santa Cruz Biotechnology, sc provided 7392) and anti - β a-actin a 1:1 (Santa Cruz Biotechnology, sc provided 47778), 000 blocking solution weight ratio including anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, anti - myc (9E 10, sc provided 40) embodiment is returned when tnfrsf, one of the plurality of pins is formed in combination polyubiquitin angry [khwi this natural WT pcDNA3-a myc-a β - by having a shape (smear) address (also 4, lanes 3 and 4) [khwi this natural appeared strongly featured band is detected. In addition, when the processor during a time 6 MG132 (proteasome billion number number, 5 micro g/Ml), poly type expense [khwi anger [khwi this increased natural formation is detected more strongly featured appeared (also 4, lane 4) band. These results indicate that one of the plurality of pin natural β - [khwi with ubiquitin binding when the number etched poly type expense [khwi anger - proteasome through the system. One of the plurality of pin substituent in addition pcDNA3-a myc-a β - (K62R), one of the plurality of pin substituent pcDNA3-a myc-a β - (K153R), and in the case of one of the plurality of pin substituent pcDNA3-a myc-a β - (K158R), WT band than releasing it appeared. They are not natural substituents [khwi this natural binding (5 also, lane 3, 5 and 6) presents a small [khwi this detection. One of the plurality of pin WT pcDNA3-a myc-a β -, one of the plurality of pin substituent pcDNA3-a myc-a β - (K62R), one of the plurality of pin substituent pcDNA3-a myc-a β - (K124R), one of the plurality of pin substituent pcDNA3-a myc-a β - (K153R), and one of the plurality of pin substituent by each micro g (K158R) pcDNA3-a myc-a β - 2 transfected HEK 293T cells with respect to the (transfection). Transfected 48 hours, protein generation number (CHX) cycloalkyl [...] (cycloheximide) (Sigma non-Aldrich) (100 micro g/Ml) high-K dielectric material 20 minutes, 60 minutes and at least over half 40 were measured. As a result, the number has been confirmed that the one of the plurality of pin fixed to the human β - billion (6 also). Human β - 1 hours while the one of the plurality of human β - (variant) of the plurality of pin half-pin substituted β - 1 half-life time of at least one of the plurality of pin substituent (K62R) and body (K158R) longer than WT plastic this result may have shown graph (6 also). One of the plurality of pins between a wrong temporal expression of mouse pancreatic β - - it has been reported that promote the proliferation of beta cells (Cell, 153, 747 - 758, 2013). The is in the embodiment, the throttle valve in a cell of the plurality of pin substituent transmissions by signal transduction has been confirmed that the β - β - pin. Cells (ATCC, CRL-a 1469) 7 to turn a first PANC provided 1 PBS then major portions, one of the plurality of pin WT pcDNA3-a myc-a β -, one of the plurality of pin substituent pcDNA3-a myc-a β - (K62R), one of the plurality of pin substituent pcDNA3-a myc-a β - (K124R), one of the plurality of pin substituent (K153R) pcDNA3-a myc-a β - (K158R) by each one of the plurality of pin substituent g and pcDNA3-a myc-a β - 3 using micro, PANC-a 1 been transfect cells. 2 Infection after a lapse, quantifying each and in proteins, intracellular signal transduction identifying the [wey the [su it shook off [...] be conducting. To this end, each one of the plurality of pin WT pcDNA3-a myc-a β -, one of the plurality of pin substituent pcDNA3-a myc-a β - (K62R), one of the plurality of pin substituent pcDNA3-a myc-a β - (K124R), one of the plurality of pin substituent (K153R) pcDNA3-a myc-a β - pcDNA3-a myc-a β - (K158R) and one of the plurality of pin substituent isolated from infected cells (polyvinylidene difluoride, PVDF) membrane protein poly vinyl this flow which is burnt the id PANC-a 1 after moved from, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - STAT3 (Santa Cruz Biotechnology, sc provided 21876), anti - phospho-a STAT3 (Y705, cell signaling 9131S) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio [ley comb including blocking solution 1:1000 anti - (goat anti-a rabbit IgG a-HRP, Santa Cruz Biotechnology, sc-a 2004) and anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, one of the plurality of pin substituent pcDNA3-a myc-a β - (K62R), one of the plurality of pin substituent (K124R) pcDNA3-a myc-a β - and one of the plurality of pin substituent in a cell (K153R) pcDNA3-a myc-a β - PANC-a 1 is equal to or one of the plurality of pin WT increased phospho-a STAT3 signal transduction pcDNA3-a myc-a β - and viscoelasticity (also 7). Example embodiment 2: analysis and half-life increased growth hormone protein BIP [khwi anger identifying confirming the intracellular signaling Growth hormone (GH) polymerase chain reaction amplified through pCS4-a flag and (4. 3 Kb, Oncotarget. , 7 (12), 14441 - 14457, 2016) EcoRI fragment into a number hanhyo factor produced by bonding cloning it does, (8 also, GH amino acid sequence: SEQ No. 10), The result is a number hanhyo small after cutting, agar with [cu gel electrophoresis confirmed through objects (also 9). In addition of Figure 8 bio-sequence listing underline on cloned site and coarse part confirms portion is once again able to function key on a metal thin film is used in polymerase chain reaction primer set, it is confirmed through electrophoresis result objects in addition agar with [cu gel (9 also). Polymerase chain reaction conditions as follows; in initial degeneration by reacting 3 minutes 94 °C, modified for an in 30 seconds 94 °C, annealing reaction in 30 seconds for 60 °C, in repeated cycles have performed for processing a 25 30 extending for an 72 °C, after 10 minutes in reaction with respect to the 72 °C. The number it became work number to determine if the DNA is protein expression as indicated pCS4 non-flag vector map of Figure 8 for present anti - flag flag (Sigma provided aldrich, F3165) conducting the [wey the [su it shook off [...] for using such antibodies. As a result flag that have been coupled to the growth hormone protein was well expressed, camera into expression vector [...] quantitative loaded of intetrest (also 10). Arginine lysine residues using site specific mutation induction (site-a directed mutagenesis) replaced by a transparent conductive layer, certain mutations may derive a DNA primer sequences (GH K67R FP 5 '- CCAAAGGAACAGAGGTATTCATTC-a 3' (SEQ No. 11), 'RP 5 provided CAGGAATGAATACCTCTGTTCCTT-a 3' (SEQ No. 12); GH K141R FP 5 'a-GA CCTCCTAAGGGACCTAGAG-a 3' (SEQ No. 13), 'RP 5 provided CTCTAGGTCCCTTAGGAGGTC-a 3' (SEQ No. 14); 'GH K166R FP 5 provided CAGATCTTCAGGCAGACCTAC-a 3' (SEQ No. 15), RP 5 '- GTAGGTCTGCCTGAAGATCTG-a 3' (SEQ No. 16) Number after a work grudge, the substitution of specific amino acid residues in certain conditions by performing PCR plasmid DNA-gate a small number. Segmenting use pcDNA3 non-myc - growth hormone and, arginine lysine residues (table 2) plasmid DNA-gate a small number (K→R) substituent. Plasmid DNA encoding growth hormone WT pMT123 provided HA - pCS4 non-flag - and using HEK 293T cell infected with respect to ubiquitin. Natural wind [khwi anger for micro g and g is intended to growth hormone WT 2 pCS4 non-flag - transfected pMT123 provided HA - ubiquitin DNA 1 micro cavity with respect to the (co a-transfection). Transfected 24 hours, MG132 (number proteasome inhibitors, 5 micro g/Ml) the next time a 6, conducting immune sedimentation analysis (11 also). In addition pCS4 non-flag - WT growth hormone, growth hormone substituent pCS4 non-flag - (K67R), growth hormone substituent pCS4 non-flag - (K141R), pCS4 non-flag - growth hormone substituent using a plasmid DNA encoding ubiquitin (K166R) and pMT123 provided HA - each with respect to the HEK 293T cell infected. To make sure that the extent to which conduction pCS4 non-flag - WT [khwi anger natural growth hormone, growth hormone substituent pCS4 non-flag - (K67R), pCS4 non-flag - growth hormone substituent on each 2 g (K141R) and pCS4 non-flag - growth hormone substituent (K166R) micro cavity 24 and transfect cell DNA 1 micro g pMT123 provided HA - ubiquitin immunospecifically sedimentation analysis has been completed his embodiment (12 also). For immune is returned obtained sample dissolution buffer (1% Triton X, 150 mm NaCl, 50 mm Tris a-HCl, pH 8 and 1 mm PMSF (phenylmethanesulfonyl fluoride) cyanuric acid, anti - flag (Sigma provided aldrich, F3165) is mixed with him as during night in 4 °C 1 difference antibodies. 4 °C sinkage body protein A/G beads (Santa Cruz Biotechnology) 2 in time using immune reaction was separated. Then, the-wash 2 buffer was dissolved. 2X SDS sample buffer after 7 minutes in 100 °C immune [...] protein mixed with heated, to separate a SDS-a PAGE his embodiment. (Polyvinylidene difluoride, PVDF) membrane then moved from poly vinyl this flow which is burnt the id separated protein, anti - flag (Sigma provided aldrich, F3165), anti - HA (Santa Cruz Biotechnology, sc provided 7392) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio including blocking solution 1:1000 anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, anti - flag (Sigma provided aldrich, F3165) tnfrsf embodiment is returned when, in combination polyubiquitin angry [khwi this is natural growth hormone WT pCS4 non-flag - by BIP [khwi this detected band shape formed address (also 11, lanes 2 and 3) appeared strongly featured. In addition, MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 when a processing time is detected more strongly featured type expense [khwi anger etched formation [khwi this increased natural sweet taste (11 also, lane 3) band. In addition pCS4 non-flag - growth hormone substituent (K67R), growth hormone substituent pCS4 non-flag - (K141R), in the case of growth hormone substituent pCS4 non-flag - (K166R), a pulse band than soft WT, pCS4 non-flag - growth hormone substituent (K67R), growth hormone substituent pCS4 non-flag - (K141R), and returned to the natural growth hormone substituent pCS4 non-flag - (K166R) is detected (12 also, lanes 3 - 5) [khwi this natural binding [khwi with less. These results indicate that ubiquitin proteasome - [khwi with natural growth hormone binding to poly type expense [khwi anger decomposition at or over the system. WT pCS4 non-flag - growth hormone, growth hormone substituent pCS4 non-flag - (K67R), growth hormone substituent pCS4 non-flag - (K141R), HEK 293T cells transfected by a growth hormone substituent pCS4 non-flag - 2 with respect to the micro g (K166R) (transfection). Transfected 48 hours, number cycloheximide (CHX) generation of protein (Sigma non-Aldrich) (100 micro g/Ml) for processing time 1, time 2, time 4, 8 were measured half-life and very long periods of time. As a result, the decomposition of human growth hormone has been confirmed that the number billion (13 also). 2 Hours while the half-life of human growth hormone human growth hormone substituent of half-life longer than 8 hr or longer WT pCS4 non-flag - (K141R) plastic this result may have shown graph (13 also). STAT (signal transducers and activators of transcription) protein gene for regulating transcription level of growth hormone may (Oncogene, 19, 2585 - 2597, 2000) that it has been reported. In it in the embodiment, in a cell growth hormone growth hormone substituent transmissions by signal transduction has been confirmed. WT pCS4 non-flag - growth hormone, growth hormone substituent pCS4 non-flag - (K67R), growth hormone substituent pCS4 non-flag - (K141R) and 3 g (K166R) growth hormone substituent by using HEK293 pCS4 non-flag - each with respect to the micro cell infected. 1 After infection, cells using sony kater (sonicator) after dissolving, obtained protein PBS 7 to turn and caused by processing cells washed PANC provided 1, 2 each proteins in quantifying PANC-a 1 after him. Identifying the [wey the [su it shook off his [...] embodiment be intracellular signal transduction. During this process each pCS4 non-flag - WT growth hormone, growth hormone substituent pCS4 non-flag - (K67R), growth hormone substituent pCS4 non-flag - (K141R) and pCS4 non-flag - growth hormone substituent (K166R) isolated from infected cells (polyvinylidene difluoride, PVDF) membrane protein poly vinyl this flow which is burnt the id PANC-a 1 next, anti - STAT3 (Santa Cruz Biotechnology, sc provided 21876), anti - phospho-a STAT3 (Y705, Cell Signaling Technology, 9131S) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio [ley comb including blocking solution 1:1000 anti - (goat anti-a rabbit IgG a-HRP, Santa Cruz Biotechnology, sc-a 2004) and anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, growth hormone substituent (K141R) pCS4-a flag - in a cell is equal to or increased growth hormone WT PANC-a 1 pCS4 non-flag - phospho-a STAT3 signal transduction was visible, pCS4 non-flag - growth hormone substituent (K67R) is increased than the contrast in the phospho-a STAT3 signal transfer and viscoelasticity (14 also). Example embodiment 3: insulin protein BIP [khwi anger analysis and half-life increased intracellular signaling identifying identifying By polymerase chain reaction DNA amplification products pcDNA3 non-myc insulin (5. 6 Kb) EcoRI and a BamHI fragment number hanhyo factor is produced by bonding brasiliensis (also 15, insulin amino acid sequence: SEQ No. 17). The result after hanhyo small number, agar with [cu gel electrophoresis confirmed through objects (16 also). In addition of Figure 15 bio-sequence listing underline on cloned site and coarse part confirms portion is once again able to function key polymerase chain reaction primer set is used when a metal thin film, the result agar with [cu gel electrophoresis confirmed through objects (16 also). Polymerase chain reaction conditions as follows; in initial degeneration by reacting 3 minutes 94 °C, modified for an in 30 seconds 94 °C, 60 °C for 30 seconds in annealing reaction, catalysts for processing a 25 30 extending into the space between the repeating period in 72 °C have, in 10 minutes after 72 °C his response. The number it became work number to determine if the DNA is protein expression as indicated pcDNA3 non-myc vector map of Figure 15 for myc present anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40) [...] expression has been confirmed through the [wey the [su it shook off for using such antibodies. Insulin protein coupled to formate less well expressed myc, [...] camera into expression vector dose through the loaded of intetrest (17 also). Arginine lysine residues using site specific mutation induction (site-a directed mutagenesis) replaced by a transparent conductive layer, certain mutations may derive a DNA primer sequences (insulin K53R FP 5 '- GGCTTCTTCTACACACCCAGGACCC-a 3' (SEQ No. 18), 'RP 5 provided CTCCCGGCGGGTCCTGGGTGTGTA-a 3' (SEQ No. 19); Insulin K88R FP 5 'a-TCCCTGCAGAGGCGTGGCATTGT-a 3' (SEQ No. 20), 'RP 5 provided TTGTTCCACAATGCCA CGCCTCTGCAG-a 3' (SEQ No. 21) After a number work grudge, specific amino acid residues substituted plasmid DNA in PCR performed by certain conditions a small number-gate. PcDNA3 non-myc - insulin template and use, a small number of lysine residues (K→R) 2 plasmid DNA (table 3) arginine substituted-gate. Plasmid DNA encoding insulin WT pMT123 provided HA - pcDNA3 non-myc - and using a cell infected HEK 293T with respect to ubiquitin. Natural wind [khwi anger for micro g and g is intended to ubiquitin DNA 1 insulin WT 2 pcDNA3 non-myc - pMT123 provided HA - transfected with respect to the micro cavity (co a-transfection). Transfected 24 hours, 6 hours after processing a MG132 (number proteasome inhibitors, 5 micro g/Ml), conducting immune sedimentation analysis (18 also). In addition each pcDNA3 non-myc - insulin WT, pcDNA3 non-myc - insulin substituent (K53R), pcDNA3 non-myc - encoding plasmid DNA (K88R) and insulin substituent using HEK 293T cell infected pMT123 provided HA - with respect to ubiquitin. Natural degree [khwi anger in order to identify, pcDNA3 non-myc - WT insulin, pcDNA3 non-myc - insulin substituent on each 2 g (K53R) and pcDNA3 non-myc - insulin substituent (K88R) plasmid DNA 1 micro g pMT123 provided HA - ubiquitin micro cells from the cavity 24 (also 19) was embodiment immunospecifically sedimentation analysis has been completed. For immune is returned obtained sample dissolution buffer (1% Triton X, 150 mm NaCl, 50 mm Tris a-HCl, pH 8 and 1 mm PMSF (phenylmethanesulfonyl fluoride) cyanuric acid, anti - myc (9E 10) 1 is mixed with him as during night in 4 °C difference antibodies. 4 °C sinkage body protein A/G beads (Santa Cruz Biotechnology) 2 in time using immune reaction was separated. Then, the-wash 2 buffer was dissolved. 2X SDS sample buffer after 7 minutes in 100 °C immune [...] protein mixed with heated, to separate a SDS-a PAGE his embodiment. Then moved from poly vinyl this flow which is burnt the id membrane separated protein, anti - myc (9E 10, sc provided 40), anti - HA (sc provided 7392) and anti - β a-actin (sc provided 47778) a the weight ratio including blocking solution 1:1000 anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) (Western blot detection kit, ABfrontier, Seoul, Korea) was developed using ECL system. As a result, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40) tnfrsf embodiment is returned when, in combination polyubiquitin reduced by [khwi this is natural insulin WT pcDNA3 non-myc - address [khwi this detected band is formed having a shape natural sweet taste (18 also, lane 3 and 4) strongly featured. In addition, MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 when a processing time is detected more strongly featured type expense [khwi anger etched formation [khwi this increased natural sweet taste (18 also, lane 4) band. In addition pcDNA3 non-myc - in the case of insulin substituent (K53R), a pulse band than soft WT, pcDNA3 non-myc - insulin substituent is not natural (K53R) [khwi with natural binding (19 also, lane 3) [khwi this is detected as possible. Or more [khwi with the result of the insulin natural binding ubiquitin proteasome system - through decomposition is at or poly type expense [khwi anger. Insulin WT pcDNA3 non-myc -, pcDNA3 non-myc - insulin substituent (K53R) and 2 g (K88R) HEK293T cells transfected by insulin substituent pcDNA3 non-myc - each with respect to the micro. Transfected 48 hours, protein generation number (CHX) cycloalkyl [...] (Sigma non-Aldrich) (100 micro g/Ml) for processing time 2, 4 time, very long periods of time by measuring the half-life result and 8, the number has been confirmed that the decomposition of human insulin billion (also 20). As a result, 30 minutes while the half-human insulin, human insulin substituent of half-life longer than 1 hr or longer (K53R) pcDNA3 non-myc - WT plastic have shown the results graph (also 20). STAT3 phosphorylation of the insulin is between glucose homeostasis that stimulate as a result between the control has been reported (Cell Metab. , 3, 267275, 2006). In the in the embodiment, in a cell insulin and insulin substituent transmissions by signal transduction has been confirmed. First, pcDNA3 non-myc - insulin WT, pcDNA3 non-myc - insulin substituent (K53R), and each micro g 3 by using PBS (K88R) pcDNA3 non-myc - insulin substituent to the flushing away of a HepG2 PANC-a 1 (ATCC, AB-a 8065) observed every 7 and with respect to the infection. After 2, then each proteins in quantifying, identifying the [wey the [su it shook off his [...] embodiment be intracellular signal transduction. During this process each pcDNA3 non-myc - insulin WT, pcDNA3 non-myc - insulin substituent (K88R) infecting a pcDNA3 non-myc - insulin substituent (K53R) and HepG2 cells (ATCC, AB-a 8065) isolated protein PANC-a 1 and then moved from PVDF membrane, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - STAT3 (Santa Cruz Biotechnology, sc provided 21876), anti - phospho-a STAT3 (Y705, Cell Signaling 9131S) and anti - β - expression vector (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio [ley comb including blocking solution 1:1000 anti - (goat anti-a rabbit IgG a-HRP, Santa Cruz Biotechnology, sc-a 2004) and anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, pcDNA3 non-myc - insulin substituent (K53R) (ATCC, AB-a 8065) HepG2 PANC-a 1 and the insulin signal transduction in a cell is about the same or increased phospho-a STAT3 pcDNA3 non-myc - WT and viscoelasticity (21 also). In the embodiment 4: interferon - α protein BIP [khwi anger analysis and half-life increased intracellular signaling identifying identifying Interferon - α DNA amplification by polymerase chain reaction products pcDNA3 non-myc (5. 6 Kb) EcoRI fragment into a number hanhyo factor produced by bonding cloning it does, (22 also, interferon - α amino acid sequence: SEQ No. 22), The result is a number hanhyo small after cutting, agar with [cu gel electrophoresis confirmed through objects (also 23). In addition of Figure 22 bio-sequence listing on coarse and underline Image generation cloning site is once again able to function key part confirms polymerase chain reaction primer set is used when a metal thin film, the result agar with [cu gel electrophoresis confirmed through objects (also 23). Polymerase chain reaction conditions as follows; in initial degeneration by reacting 3 minutes 94 °C, modified for an in 30 seconds 94 °C, 58 °C for 30 seconds annealing reaction in, extending into the space between the component 72 °C 1 in 25 cycles for an repeatedly have, been in 10 minutes after 72 °C reacting. The number it became work number to determine if the DNA is protein expression as indicated pcDNA3 non-myc vector map of Figure 22 for myc present anti - myc (9E 10, sc provided 40) when the expression is verified through the [wey the [su it shook off [...] for using such antibodies, making sure that the myc protein expression well through coupled to interferon - α have confirmed his camera into expression vector dose through the loading [...] pulse (also 24). Arginine lysine residues using site specific mutation induction (site-a directed mutagenesis) replaced by a transparent conductive layer, certain mutations may derive a DNA primer sequences (IFN-a α K93R FP 5 '- CTTCAGCACAAGGGACTCATC-a 3' (SEQ No. 23), 'RP 5 provided CAGATGAGTCCCTTGTGCTGA-a 3' (SEQ No. 24); IFN-a α K106R 'FP 5 provided CTCCTAGAC AGATTCTACACT-a 3' (SEQ No. 25), 'RP 5 provided AGTGTAGAATCTGTCTAGGAG-a 3' (SEQ No. 26); IFN-a α K144R 'FP 5 provided GCTGTGAGGAGATACTTCCAA-a 3' (SEQ No. 27), 'RP 5 provided TT GGAAGTATCTCCTCACAGC-a 3' (SEQ No. 28); IFN-a α K154R 'FP 5 provided CTCTATCTGAGAGAG AAGAAA-a 3' (SEQ No. 29), 'RP 5 provided TTTCTTCTCTCTCAGATAGAG-a 3' (SEQ No. 30) After a number work grudge, specific amino acid residues substituted plasmid DNA in PCR performed by certain conditions a small number-gate. Templates and use pcDNA3 non-myc - interferon - α, a smaller number of plasmid DNA (K→R) arginine lysine residues (table 4) 4 substitutes for the-gate. Plasmid DNA encoding ubiquitin pcDNA3 non-myc - interferon - α WT and pMT123 provided HA - using HEK 293T cell infected with respect to. Natural wind [khwi anger for micro g and g is intended to ubiquitin DNA 1 - α WT 2 pcDNA3 non-myc - interferon pMT123 provided HA - with respect to the micro cavity transfected. MG132 (number proteasome inhibitors, 5 micro g/Ml) time after time transfected 24 a 6 next, immune precipitated analysis was embodiment (also 25). In addition each pcDNA3 non-myc - interferon - α WT, pcDNA3 non-myc - interferon - α substituent (K93R), pcDNA3 non-myc - interferon - α substituent (K106R), pcDNA3 non-myc - interferon - α substituent (K144R), pcDNA3 non-myc - interferon - α substituent (K154R), and using a plasmid DNA encoding ubiquitin pMT123 provided HA - with respect to the HEK 293T cell infected. Natural degree [khwi anger in order to identify pcDNA3 non-myc - interferon - α WT, pcDNA3 non-myc - interferon - α substituent (K93R), pcDNA3 non-myc - interferon - α substituent (K106R), pcDNA3 non-myc - interferon - α substituent on each micro g 2 - α substituent (K144R) and pcDNA3 provided myc - interferon (K154R) cell an cavity 24 and transfect DNA 1 micro g pMT123 provided HA - ubiquitin immunospecifically sedimentation analysis has been completed his embodiment (also 26). For immune is returned obtained sample dissolution buffer (1% Triton X, 150 mm NaCl, 50 mm Tris a-HCl, pH 8 and 1 mm PMSF (phenylmethanesulfonyl fluoride) cyanuric acid, anti - myc (9E 10) 1 is mixed with him as during night in 4 °C difference antibodies. 4 °C sinkage body protein A/G beads (Santa Cruz Biotechnology) 2 in time using immune reaction was separated. Then, the-wash 2 buffer was dissolved. 2X SDS sample buffer after 7 minutes in immune [...] protein mixed with 100 °C after boiling, to separate a SDS-a PAGE his embodiment. After moved from PVDF membrane separated protein, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - HA (Santa Cruz Biotechnology, sc provided 7392) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio including blocking solution 1:1000 anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, anti - myc (9E 10, sc provided 40) when returned tnfrsf embodiment, pcDNA3 non-myc - [khwi this is natural interferon - α WT combination polyubiquitin angry by address to which band is formed having a shape natural sweet taste (25 also, lanes 3 and 4) [khwi this strongly featured. In addition, MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 when a processing time is detected more strongly featured type expense [khwi anger etched formation [khwi this increased natural sweet taste (25 also, lane 4) band. In addition pcDNA3 non-myc - interferon - α substituent (K93R), pcDNA3 non-myc - interferon - α substituent (K106R), pcDNA3 non-myc - interferon - α substituent (K144R) - α substituent (K154R) pcDNA3 non-myc - and in the case of interferon, a pulse band than soft WT, pcDNA3 non-myc - interferon - α substituent (K93R), pcDNA3 non-myc - interferon - α substituent (K106R), pcDNA3 non-myc - interferon - α substituent (K144R) and returned to natural [khwi this is natural interferon - α substituent (K154R) pcDNA3 non-myc - [khwi with less binding is detected (26 also, lane 3 and 6). The result of the or more [khwi with the natural interferon - α - which bind at or degrading the ubiquitin proteasome system through poly type expense [khwi anger. PcDNA3 non-myc - interferon - α WT, pcDNA3 non-myc - interferon - α substituent (K93R), pcDNA3 non-myc - interferon - α substituent (K106R), pcDNA3 non-myc - interferon - α substituent (K144R) - α substituent HEK 293T cells by each 2 g and pcDNA3 non-myc - interferon (K154R) with respect to the micro transfected. Transfected 48 hours, protein generation number (CHX) cycloalkyl [...] (Sigma non-Aldrich) (100 micro g/Ml) high-K dielectric material 1, 2 over half the measuring result, human interferon - α is the decomposition of billion number has been confirmed (27 also). While the half-life within the human interferon - α 1, human pcDNA3 non-myc - interferon - α substituent (K93R), pcDNA3 non-myc - interferon - α substituent (K144R) - α substituent of half-life longer than 2 or more (K154R) and pcDNA3 non-myc - interferon-type plastic WT, this result may have shown graph (27 also). Interferon - α is STAT provided 1, on increasing -2 -3 is reported that was (J Immunol. , 187, 2578 - 2585, 2011), Melanoma cells in which the interferon - α STAT3 protein for stimulating the growth by activating it has been reported that (Eur J Cancer, 45, 1315 - 1323, 2009). In the embodiment the interferon - α - α substituent transmissions by signal transduction in a cell on the interferon has been confirmed. Cells (ATCC, TIB-a 202) to turn a major portions 7 PBS THP-a 1 then, pcDNA3 non-myc - interferon - α WT, pcDNA3 non-myc - interferon - α substituent (K93R), pcDNA3 non-myc - interferon - α substituent (K106R), pcDNA3 non-myc - interferon - α substituent (K144R), and each micro g 3 - α substituent (K154R) using pcDNA3 non-myc - interferon by THP-a 1 1 2 and then sequentially after a cell infected after each quantitative in proteins, intracellular signal transduction Western blot was identifying a second embodiment. During this process pcDNA3 non-myc - interferon - α WT, pcDNA3 non-myc - interferon - α substituent (K93R), pcDNA3 non-myc - interferon - α substituent (K106R), pcDNA3 non-myc - interferon - α substituent (K144R), pcDNA3 non-myc - interferon - α substituent (K154R) isolated from cells infected THP-a 1 protein after moved from PVDF membrane, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - STAT3 (Santa Cruz Biotechnology, sc provided 21876), anti - phospho-a STAT3 (Y705, cell signaling 9131S) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio [ley comb including blocking solution 1:1000 anti - (goat anti-a rabbit IgG a-HRP, Santa Cruz Biotechnology, sc-a 2004) and anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, pcDNA3 non-myc - interferon - α substituent (K93R), pcDNA3 non-myc - interferon - α substituent (K106R), pcDNA3 non-myc - interferon - α substituent (K144R), pcDNA3 non-myc - interferon - α substituent in the THP-a 1 cells (ATCC, TIB-a 202) (K154R) equal or increased interferon - α WT pcDNA3 non-myc - phospho-a STAT3 signal transfer and viscoelasticity (28 also). Example embodiment 5: Granulocyte colonyStimulating factor (G -CSF) Protein Natural [khwi anger Analysis and half-life increased intracellular signaling identifying identifying Granulocyte colony stimulating factor (G-a CSF) by polymerase chain reaction DNA amplification products pcDNA3 non-myc (5. 6 Kb) EcoRI fragment into a number hanhyo factor produced by bonding cloning it does, (29 also, G a-CSF amino acid sequence: SEQ No. 31), The result is a number hanhyo small after cutting, agar with [cu gel electrophoretic through (30 also) has been confirmed. In addition of Figure 29 bio-sequence listing underline on cloned site and coarse part confirms portion is once again able to function key on a metal thin film and used in polymerase chain reaction primer cent, the result agar with [cu gel electrophoresis confirmed through objects (30 also). Polymerase chain reaction conditions as follows; in initial degeneration by reacting 3 minutes 94 °C, modified for an in 30 seconds 94 °C, 58 °C for 30 seconds annealing reaction in, 1 in 25 extending into the space between the repeating period for an component 72 °C have, in 10 minutes after reaction with respect to the 72 °C. The number it became work number to determine if the DNA is protein expression as indicated pcDNA3 non-myc vector map of Figure 29 to present an anti myc - myc (9E 10, Santa Cruz Biotechnology, sc provided 40) [...] expression has been confirmed through the [wey the [su it shook off for using such antibodies. Granulocyte colony stimulating factor (G-a CSF) coupled to the myc protein expressed well making sure that the camera into expression vector are loaded when the dose through the [...] up (also 31). Arginine lysine residues using site specific mutation induction (site-a directed mutagenesis) replaced by a transparent conductive layer, certain mutations may derive a DNA primer sequences (G-a CSF K46R FP 5 '- AGCTTCCTGCTCAGGTGCTTAGAG-a 3' (SEQ No. 32), 'RP 5 provided TTGCTCTAAGCACCTGAGCAGGAA-a 3' (SEQ No. 33), G-a CSF K73R FP 5 '- TGTGCCACCTACAGGCTGTGCCAC-a 3' (SEQ No. 34), 'RP 5 provided GGGGTGGCACAGCCTGTA GGTGGC-a 3' (SEQ No. 35) Number after a work grudge, specific amino acid residues substituted plasmid DNA in PCR performed by certain conditions a small number-gate. Granulocyte colony stimulating factor (G-a CSF) pcDNA3 non-myc - templates is used, a smaller number of plasmid DNA-gate 2 is Lysine (K→R) arginine residues (table 5) substituent. Granulocyte colony stimulating factor (G-a CSF) pcDNA3 non-myc - WT using a plasmid DNA encoding ubiquitin pMT123 provided HA - and with respect to the HEK 293T cell infected. Natural granulocyte colony stimulating factor (G-a CSF) in order to identify the degree [khwi anger pcDNA3 non-myc - WT 2 g and g cells transfected DNA 1 micro cavity with respect to the micro pMT123 provided HA - ubiquitin. 24 Infection points MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 after processing a time, immune sedimentation analysis was embodiment (also 32). In addition granulocyte colony stimulating factor (G-a CSF) each pcDNA3 non-myc - WT, granulocyte colony stimulating factor (G-a CSF) substituent (K46R) pcDNA3 non-myc -, granulocyte colony stimulating factor (G-a CSF) pcDNA3 non-myc - ubiquitin encoding using a plasmid DNA (K73R) and pMT123 provided HA - with respect to the HEK 293T cell infected. Natural granulocyte colony stimulating factor (G-a CSF) in order to identify the degree [khwi anger pcDNA3 non-myc - WT, granulocyte colony stimulating factor (G-a CSF) substituent pcDNA3 non-myc - (K46R), granulocyte colony stimulating factor (G-a CSF) pcDNA3 non-myc - each 2 micro g (K73R), and cavity 24 and transfect cell DNA 1 micro g pMT123 provided HA - ubiquitin (also 33) conducting immunospecifically sedimentation analysis has been completed. For immune is returned obtained sample dissolution buffer (1% Triton X, 150 mm NaCl, 50 mm Tris a-HCl, pH 8 and 1 mm PMSF (phenylmethanesulfonyl fluoride) cyanuric acid, anti - myc (9E 10) 1 is mixed with him as during night in 4 °C difference antibodies. 4 °C sinkage body protein A/G beads (Santa Cruz Biotechnology) 2 in time using immune reaction was separated. Then, the-wash 2 buffer was dissolved. 2X SDS sample buffer after 7 minutes in 100 °C immune [...] protein mixed with heated, to separate a SDS-a PAGE his embodiment. Next separated protein PVDF membrane, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - HA (Santa Cruz Biotechnology, sc provided 7392) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio including blocking solution 1:1000 anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40) embodiment is returned when tnfrsf, granulocyte colony stimulating factor (G-a CSF) pcDNA3 non-myc - WT [khwi this is natural shapes formed by combination polyubiquitin angry address detected band (32 also, lanes 3 and 4) [khwi this natural appeared strongly featured. In addition, MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 when a processing time is detected more strongly featured type expense [khwi anger etched formation [khwi this increased natural sweet taste (32 also, lane 4) band. In the case of granulocyte colony stimulating factor (G-a CSF) in addition pcDNA3 non-myc - (K73R), a pulse band than soft WT, granulocyte colony stimulating factor (G-a CSF) pcDNA3 non-myc - [khwi with natural binding is not natural (K73R) (33 also, lane 4) [khwi this is detected as possible. Granulocyte colony stimulating factor (G-a CSF) is the result of the or more [khwi with natural binding to poly type expense [khwi anger - ubiquitin proteasome degrading at or over the system. Granulocyte colony stimulating factor (G-a CSF) pcDNA3 non-myc - WT, granulocyte colony stimulating factor (G-a CSF) substituent (K46R) pcDNA3 non-myc -, a granulocyte colony stimulating factor (G-a CSF) 2 (K73R) pcDNA3 provided myc - HEK 293T transfected cells (transfection) by micro g with respect to the. Transfected 48 hours, number cycloheximide (CHX) generation of protein (Sigma non-Aldrich) (100 micro g/Ml) for processing a 4 time, half-time and 16 8 very long periods of time were measured. As a result, human granulocyte colony stimulating factor (G-a CSF) the number has been confirmed that the decomposition of billion (34 also). Human granulocyte colony stimulating factor (G-a CSF) of human granulocyte colony stimulating factor (G-a CSF) pcDNA3 non-myc - 4 half-life time (K73R) which while of half-life longer than 16 hr or longer WT plastic this result may have shown graph (also 34). Granulocyte colony stimulating factor (G-a CSF) is the H chain (glioma) and this is effected by insuring that activate STAT3 in the H chain involved in proliferation is reported to have a (Cancer Biol Ther. , 13 (6), 389 - 400, 2012), Expressed in ovarian epithelial cancer JAK2/STAT3 along that path and controlling the female uterine cancer pathologies take-all decline relationship has been reported (Br J Cancer, 110, 133 - 145, 2014). In the in the embodiment, granulocyte colony stimulating factor granulocyte colony stimulating factor (G-a CSF) in a cell on (G-a CSF) substituent transmissions by signal transduction has been confirmed. First major portions 7 to turn a PBS cells (ATCC, TIB-a 202) THP-a 1 then, granulocyte colony stimulating factor (G-a CSF) WT pcDNA3 non-myc -, granulocyte colony stimulating factor (G-a CSF) pcDNA3 non-myc - granulocyte colony stimulating factor (G-a CSF) substituent substituent (K46R) and pcDNA3 non-myc - 3 micro g respectively (K73R) (ATCC, TIB-a 202) with respect to the infected cells by using THP-a 1. 1 Infection after a lapse, quantifying each and in proteins, intracellular signal transduction identifying the [wey the [su it shook off his intended [...] embodiment. Granulocyte colony stimulating factor (G-a CSF) pcDNA3 non-myc - 3 mm during WT, granulocyte colony stimulating factor (G-a CSF) substituent pcDNA3 non-myc - (K46R), granulocyte colony stimulating factor (G-a CSF) substituent (K73R) pcDNA3 non-myc - infected cells (ATCC, TIB-a 202) THP-a 1 (polyvinylidene difluoride, PVDF) membrane protein isolated from poly vinyl this flow which is burnt the id next, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - STAT3 (Santa Cruz Biotechnology, sc provided 21876), anti - phospho-a STAT3 (Y705, cell signaling 9131S) and anti - β a-actin a 1:1 (Santa Cruz Biotechnology, sc provided 47778), 000 anti - [ley comb including blocking solution weight ratio (IgG a-HRP goat anti-a rabbit, Santa Cruz Biotechnology, sc-a 2004) and anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, granulocyte colony stimulating factor (G-a CSF) substituent (K46R) pcDNA3 non-myc -, granulocyte colony stimulating factor (G-a CSF) substituent pcDNA3 non-myc - (K73R) is granulocyte colony stimulating factor (ATCC, TIB-a 202) pcDNA3 non-myc - THP-a 1 cells in WT (G-a CSF) equal or increased phospho-a STAT3 signal transfer and viscoelasticity (also 35). Example embodiment 6: interferon - β protein BIP [khwi anger analysis and half-life increased intracellular signaling identifying identifying Interferon - β DNA amplification by polymerase chain reaction products pcDNA3 non-myc (5. 6 Kb) EcoRI fragment into a number hanhyo factor produced by bonding cloning it does, (36 also, interferon - β amino acid sequence: SEQ No. 36), The result is a number hanhyo small after cutting, agar with [cu gel electrophoresis confirmed through objects (37 also). In addition of Figure 36 bio-sequence listing underline on cloned site and coarse part confirms portion is once again able to function key polymerase chain reaction primer set is used when a metal thin film, the result agar with [cu gel electrophoresis confirmed through objects (37 also). Polymerase chain reaction conditions as follows; in initial degeneration by reacting 3 minutes 94 °C, modified for an in 30 seconds 94 °C, 58 °C for 30 seconds in annealing reaction, catalysts for 72 °C have performed for processing a repeated cycle 50 extending in 25, 10 minutes after 72 °C degree with respect to the reaction. The number it became work number to determine if the DNA is protein expression as indicated map of Figure 36 to present an anti - myc pcDNA3 non-myc vector myc (9E 10, sc provided 40) when the expression is verified through the [wey the [su it shook off [...] for using such antibodies, interferon - β protein expressed myc through well coupled to making sure that the camera into expression vector are loaded with a dose through the aeration chamber [...] up (38 also). In the case of writing this nose room [ley [syen - β interferon in addition (glycosylation) in a cell by blocking this process two types of expression band is PNGase F 24.4 (New England Biolabs Inc. , P0704S) 500 unit 37 °C after processing in a time, kinds of expression has been confirmed that the visible only band (38 also). Lysine residues using site specific mutation induction (site-a directed mutagenesis) replaced by arginine (Arginine, R) a transparent conductive layer, certain mutations may derive a DNA primer sequences (IFN-a β K40R FP 5 '- CAGTGTCAGAGGCTCCTGTGG-a 3' (SEQ No. 37), RP 5 '- CCACAGGAGCCTCTGACACTG-a 3' (SEQ No. 38); IFN-a β K126R FP 5 'a-CT GGAAGAAAGACTGGAGAAA-a 3' (SEQ No. 39), 'RP 5 provided TTTCTCCAGTCTTTCTTCCAG-a 3' (SEQ No. 40); IFN-a β K155R 'FP 5 provided CATTACCTGAGGGCCAAGGAG-a 3' (SEQ No. 41), 'RP 5 provided CTCCTTGGCCCTCAGGTAATG-a 3' (SEQ No. 42) After a number work grudge, specific amino acid residues substituted plasmid DNA in PCR performed by certain conditions a small number-gate. Templates and use pcDNA3 non-myc - interferon - β, lysine residues (K→R) plasmid DNA (table 6) arginine replaced a small number-gate. Plasmid DNA encoding ubiquitin pcDNA3 non-myc - interferon - β WT and pMT123 provided HA - using HEK 293T cell infected with respect to. Natural wind [khwi anger for micro g and g is intended to ubiquitin DNA 1 - β WT 2 pcDNA3 non-myc - interferon pMT123 provided HA - transfected with respect to the micro cavity. After 6 hours the MG132 (number proteasome inhibitors, 5 micro g/Ml) transfected 24 time after processing, immune precipitated analysis was embodiment (39 also). In addition pcDNA3 non-myc - interferon - β WT, pcDNA3 non-myc - interferon - β substituent (K40R), pcDNA3 non-myc - interferon - β substituent (K126R), pcDNA3 non-myc - each plasmid DNA encoding interferon - β substituent (K155R) and pMT123 provided HA - using HEK 293T cell infected with respect to ubiquitin. Natural degree [khwi anger in order to identify pcDNA3 non-myc - interferon - β WT, pcDNA3 non-myc - interferon - β substituent (K40R), pcDNA3 non-myc - interferon - β substituent (K126R), each micro g 2 - β substituent (K155R) pcDNA3 non-myc - interferon, and cavity 24 and transfect cell DNA 1 micro g pMT123 provided HA - ubiquitin immunospecifically sedimentation analysis has been completed his embodiment (also 40). For immune is returned obtained sample dissolution buffer (1% Triton X, 150 mm NaCl, 50 mm Tris a-HCl, pH 8 and 1 mm PMSF (phenylmethanesulfonyl fluoride) cyanuric acid, anti - myc (9E 10) 1 is mixed with him as during night in 4 °C difference antibodies. 4 °C sinkage body protein A/G beads (Santa Cruz Biotechnology) 2 in time using immune reaction was separated. Then, the-wash 2 buffer was dissolved. Immune [...] protein samples are mixed with buffer after 2X SDS, 100 °C after 7 minutes in boiling, to separate a SDS-a PAGE his embodiment. Next separated protein PVDF membrane, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - HA (Santa Cruz Biotechnology, sc provided 7392) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio including blocking solution 1:1000 anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, anti - myc (9E 10, sc provided 40) when returned tnfrsf embodiment, pcDNA3 non-myc - [khwi this is natural interferon - β WT combination polyubiquitin angry by address to which band is formed having a shape natural sweet taste (39 also, lanes 3 and 4) [khwi this strongly featured. In addition, MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 when a processing time is detected more strongly featured type expense [khwi anger etched formation [khwi this increased natural sweet taste (39 also, lane 4) band. In addition pcDNA3 non-myc - interferon - β substituent (K40R), pcDNA3 non-myc - interferon - β substituent (K126R), pcDNA3 non-myc - in the case of interferon - β substituent (K155R), a pulse band than soft WT, pcDNA3 non-myc - interferon - β substituent (K40R), pcDNA3 non-myc - interferon - β substituent (K126R), pcDNA3 non-myc - - β substituent is not natural binding (K155R) [khwi this [khwi with natural interferon is detected (40 also, lane 3 and 5) small. The result of the or more binding to ubiquitin proteasome is natural interferon - β - [khwi with decomposition at or poly type expense [khwi anger over the system. PcDNA3 non-myc - interferon - β WT, pcDNA3 non-myc - interferon - β substituent (K40R), pcDNA3 non-myc - interferon - β substituent (K126R), HEK 293T cells by each 2 g (K155R) pcDNA3 non-myc - interferon - β substituent micro been transfected. Transfected 48 hours, protein generation number (CHX) cycloalkyl [...] (Sigma non-Aldrich) (100 micro g/Ml) time for processing a 4, 8 were measured half-life very long periods of time. As a result, the decomposition of billion number has been confirmed that the human interferon - β (41 also). 4 Half-life time of human interferon - β while the human interferon - β substituent (K126R) pcDNA3 non-myc - (K155R) 8 - β substituent of half-life longer than time WT and pcDNA3 non-myc - interferon-type plastic, this result may have shown graph (Figure 41). When a cell interferon 20 including a it has been reported that an active signal transduction induced AKT (Pharmaceuticals (Basel), 3, 994 - 1015, 2010). In the in the embodiment, interferon - β - β substituent transmissions by signal transduction in a cell on interferon has been confirmed. PcDNA3 non-myc - interferon - β WT, pcDNA3 non-myc - interferon - β substituent (K40R), pcDNA3 non-myc - interferon - β substituent (K126R), pcDNA3 non-myc - 3 micro g using a cell infected by interferon - β substituent (K155R) with respect to the HEK293 respectively. 1 Infection period has lapsed, after dissolving in using sony kater, PBS HepG2 cells obtained protein 7 (ATCC, AB-a 8065) turn to a processing caused by flushing away and, after each 2 HepG2 cells proteins was quantitative. Identifying a second embodiment Western blot was intracellular signal transduction. During this process each pcDNA3 non-myc - interferon - β WT, pcDNA3 non-myc - interferon - β substituent (K40R), interferon - β substituent (K126R) pcDNA3 non-myc - infected HepG2 cells (K155R) - β substituent and pcDNA3 non-myc - interferon protein isolated from PVDF membrane next, anti - STAT3 (Santa Cruz Biotechnology, sc provided 21876), anti - phospho-a STAT3 (Y705, cell signaling 9131S), anti - AKT (H-a 136, Santa Cruz Biotechnology, sc provided 8312), anti - phospho-a AKT (S473, cell signaling 9271S) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio [ley comb including blocking solution 1:1000 anti - (goat anti-a rabbit IgG a-HRP, Santa Cruz Biotechnology, sc-a 2004) and anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) (Western blot detection kit, ABfrontier, Seoul, Korea) antibody cis ECL 2 difference was the development. As a result, pcDNA3 non-myc - interferon - β substituent (K40R), pcDNA3 non-myc - interferon - β substituent (K126R), pcDNA3 non-myc - interferon - β (K155R) is equal to or pcDNA3 non-myc - interferon - β WT HepG2 substituent increased phospho-a AKT signal transduction in a cell and viscoelasticity (also 42). Embodiment example 7: erythropoietin protein Natural [khwi anger Analysis and half-life increased intracellular signaling identifying identifying By erythropoietin DNA polymerase chain reaction amplification products pcDNA3 non-myc expression vector (5. 6 Kb) EcoRI fragment into a cloning hanhyo factor number produced when the joining (43 also, erythropoietin amino acid sequence: SEQ No. 43), The result is a number hanhyo small after cutting, agar with [cu gel electrophoresis confirmed through objects (also 44). In addition of Figure 43 bio-sequence listing underline on cloned site and coarse part confirms portion is once again able to function key polymerase chain reaction primer set is used when a metal thin film, the result agar with [cu gel electrophoresis confirmed through objects (also 44). Polymerase chain reaction conditions as follows; in initial degeneration by reacting 3 minutes 94 °C, modified for an in 30 seconds 94 °C, 58 °C for 30 seconds annealing reaction in, extending into the space between the component 25 is in the repeating cycle 1 for an 72 °C have, in 10 minutes after reaction with respect to the 72 °C. The number it became work number to determine if the DNA is protein expression as indicated pcDNA3-a myc vector map of Figure 43 for present anti myc - myc (9E 10, sc provided 40) conducting the [wey the [su it shook off [...] for using such antibodies. As a result myc erythropoietin protein expressed well coupled to making sure that the camera into expression vector are loaded when the dose through the [...] up (also 45). Arginine lysine residues using site specific mutation induction (site-a directed mutagenesis) replaced by a transparent conductive layer, certain mutations may derive a DNA primer sequences (EPO K124R FP 5 '- GCATGTGGATAGAGCCGTCAGTGC-a 3' (SEQ No. 44), 'RP 5 provided GCACTGACGGCTCTATCCACATGC-a 3' (SEQ No. 45); EPO K167R FP 5 'a-T GACACTTTCCGCAGACTCTTCCGAGTCTAC-a 3' (SEQ No. 46), 'RP 5 provided GTAGACTCGGAAG AGTCTGCGGAAAGTGTCA-a 3' (SEQ No. 47); EPO K179R FP 5 'a-CTCCGGGGAAGGCTG AAGCTG-a 3' (SEQ No. 48), 'RP 5 provided CAGCTTCAGCCTTCCCCGGAG-a 3' (SEQ No. 49); EPO K181R FP 5 'a-GGAAAGCTGAGGCTGTACACAGG-a 3' (SEQ No. 50), 'RP 5 provided CCTGTGTACAG CCTCAGCTTTCC-a 3' (SEQ No. 51) After a number work grudge, specific amino acid residues substituted plasmid DNA in PCR performed by certain conditions a small number-gate. Segmenting use erythropoietin pcDNA3 non-myc - and, arginine lysine residues (table 7) plasmid DNA-gate a small number (K→R) substituent. Plasmid DNA encoding erythropoietin WT and pMT123 provided HA - pcDNA3 non-myc - using HEK 293T cell infected with respect to ubiquitin. To make sure that the extent to which conduction [khwi anger natural erythropoietin WT 2 pcDNA3 non-myc - micro g and g cells transfected DNA 1 pMT123 non-HA - ubiquitin micro cavity and after time MG132 (co a-transfection) 24 (number proteasome inhibitors, 5 micro g/Ml) 6 hours after processing a, immune sedimentation analysis was embodiment (also 46). In addition each pcDNA3 non-myc - erythropoietin WT, pcDNA3 non-myc - erythropoietin substituent (K124R), pcDNA3 non-myc - erythropoietin substituent (K167R), pcDNA3 non-myc - erythropoietin substituent (K179R), pcDNA3 non-myc - erythropoietin substituent using a plasmid DNA encoding ubiquitin (K181R) and pMT123 provided HA - with respect to the HEK 293T cell infected. Natural wind [khwi anger for erythropoietin WT pcDNA3 non-myc -, pcDNA3 non-myc - erythropoietin substituent (K124R), pcDNA3 non-myc - erythropoietin substituent (K167R), pcDNA3 non-myc - erythropoietin substituent (K179R), pcDNA3 non-myc - erythropoietin substituent (K181R) 2 micro g each, and cavity 24 and transfect cell DNA 1 micro g pMT123 provided HA - ubiquitin immunospecifically embodiment (also 47) was precipitated analysis has been completed. For immune is returned obtained sample dissolution buffer (1% Triton X, 150 mm NaCl, 50 mm Tris a-HCl, pH 8 and 1 mm PMSF (phenylmethanesulfonyl fluoride) cyanuric acid, anti - myc (9E 10) 1 is mixed with him as during night in 4 °C difference antibodies. 4 °C sinkage body protein A/G beads (Santa Cruz Biotechnology) 2 in time using immune reaction was separated. Then, the-wash 2 buffer was dissolved. 2X SDS sample buffer after 7 minutes in immune [...] protein mixed with 100 °C after boiling, to separate a SDS-a PAGE his embodiment. Next separated protein PVDF membrane, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - HA (Santa Cruz Biotechnology, sc provided 7392) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio including blocking solution 1:1000 anti - mouse 2 antibody ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) difference was the development. As a result, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40) when returned tnfrsf embodiment, pcDNA3 non-myc - [khwi this is natural erythropoietin WT combination polyubiquitin reduced by [khwi this address to which band is formed having a shape natural sweet taste (46 also, lane 3 and 4) strongly featured. In addition, MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 when a processing time is detected more strongly featured type expense [khwi anger etched formation [khwi this increased natural sweet taste (46 also, lane 4) band. In addition pcDNA3 non-myc - [khwi with the natural erythropoietin substituent (K181R) less (47 also, lane 6) [khwi this binding is detected as not natural. The result of the or more [khwi with the natural erythropoietin binding to ubiquitin proteasome - poly type expense [khwi anger decomposition at or over the system. PcDNA3 non-myc - erythropoietin WT, pcDNA3 non-myc - erythropoietin substituent (K124R), pcDNA3 non-myc - erythropoietin substituent (K167R), pcDNA3 non-myc - erythropoietin substituent (K179R), each micro g HEK 293T cells by erythropoietin substituent (K181R) pcDNA3 non-myc - been transfect 2. 48 Hours, protein generation number (CHX) cycloalkyl [...] (Sigma non-Aldrich) (100 micro g/Ml) for processing time 2, 4 time, very long periods of time measured half 8, and the decomposition of billion number has been confirmed that the human erythropoietin (48 also). As a result human erythropoietin 4 hours while the half-life of human erythropoietin substituent of half-life longer than 8 time (K124R) pcDNA3 non-myc - WT plastic this result may have shown graph (also 48). The erythropoietin or erythropoietin lung cancer are blood cancer increased phosphorylation of cell cycle progression by administering Erk1/2 when adjusting to increase a dragging effect such that it has been reported in hypoxic (J Hematol Oncol. , 6, 65, 2013). In the in the embodiment, in a cell erythropoietin and erythropoietin substituent transmissions by signal transduction has been confirmed. First, famishing, HepG2 cells (ATCC, AB-a 8065) after 8 hours, pcDNA3 non-myc - erythropoietin WT, pcDNA3 non-myc - erythropoietin substituent (K124R), pcDNA3 non-myc - erythropoietin substituent (K167R), pcDNA3 non-myc - erythropoietin substituent (K179R), pcDNA3 non-myc - 3 using erythropoietin substituent (K181R) with respect to a cell infected by HepG2 micro g respectively. After quantifying each and 2 infection in proteins, intracellular signal transduction identifying the [wey the [su it shook off his intended [...] embodiment. During this process each pcDNA3 non-myc - erythropoietin WT, pcDNA3 non-myc - erythropoietin substituent (K124R), pcDNA3 non-myc - erythropoietin substituent (K167R), pcDNA3 non-myc - erythropoietin substituent (K179R), and pcDNA3 non-myc - HepG2 cells infected erythropoietin substituent (K181R) isolated from PVDF membrane protein next, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - Erk1/2 (9B 3, Abfrontier LF provided MA0134), anti - phospho-a Erk1/2 a (Santa Cruz Biotechnology, sc provided 47778) (Thr202/Tyr204, Abfrontier LF provided PA0090) and anti - β a-actin the weight ratio [ley comb including blocking solution 1:1000 anti - (goat anti-a rabbit IgG a-HRP, Santa Cruz Biotechnology, sc-a 2004) and anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, pcDNA3 non-myc - erythropoietin substituent (K124R), pcDNA3 non-myc - erythropoietin substituent (K167R), pcDNA3 non-myc - erythropoietin substituent (K179R), pcDNA3 non-myc - erythropoietin substituent (K181R) in a cell is equal to or increased erythropoietin WT HepG2 pcDNA3 non-myc - phospho-a Erk1/2 signal transduction and viscoelasticity (49 also). Embodiment example 8: The formation protein which it boils (BMP2) Of Natural [khwi anger Analysis and half-life increased intracellular signaling identifying identifying The formation protein which it boils by polymerase chain reaction DNA amplification products (BMP2) pcDNA3 non-myc (5. 6 Kb) EcoRI and XhoI fragment into a number hanhyo factor produced by bonding cloning it does, (50 also, BMP2 amino acid sequence: SEQ No. 52), The result is a number hanhyo small after cutting, agar with [cu gel electrophoresis confirmed through objects (51 also). In addition, coarse and of Figure 50 bio-sequence listing underline on cloned portion part confirms whether numbers is once again able to site polymerase chain reaction primer set is used when a metal thin film, the result agar with [cu gel electrophoresis confirmed through objects (51 also). Polymerase chain reaction conditions as follows; in initial degeneration by reacting 3 minutes 94 °C, modified for an in 30 seconds 94 °C, 58 °C for 30 seconds annealing reaction in, 1 in 30 minutes for processing a repeating cycle 25 extending into the space between the catalysts for 72 °C have, in 10 minutes after reaction with respect to the 72 °C. The number it became work number to determine if the DNA is protein expression as indicated pcDNA3 non-myc vector map of Figure 50 for myc present anti - myc (9E 10, sc provided 40) [...] expression has been confirmed through the [wey the [su it shook off for using such antibodies. Making sure that the well coupled to the osteogenic proteins expressed myc through a transparent conductive layer as in the picomolar (also 52) with [thing it became [...] dose through the camera into expression vector. Arginine lysine residues using site specific mutation induction (site-a directed mutagenesis) replaced by a transparent conductive layer, certain mutations may derive a DNA primer sequences (BMP2 K293R FP 5 '- GAAACGCCTTAGGTCCAGCTGTAAGAGAC-a 3' (SEQ No. 53), 'RP 5 provided GTCTCTTACAGCTGGACCTAAGGCGTTTC-a 3' (SEQ No. 54); 'BMP2 K297R FP 5 provided TTAAGTCCAGCTGTAGGAGACACCCTTTGT-a 3' (SEQ No. 55), 'RP 5 provided ACAAAGGGTGTCTCCTACAGCTGGACTTAA-a 3' (SEQ No. 56); 'BMP2 K355R FP 5 provided GTTAACTCTAGGATTCCTAAGGC-a 3' (SEQ No. 57), RP 5 'a-GC CTTAGGAATCCTAGAGTTAAC-a 3' (SEQ No. 58); BMP2 K383R FP 5 '- GGTTGTATTAAGGAACTATCAGGAC-a 3' (SEQ No. 59), 'RP 5 provided GTCCTGATAGTTCCTTAAT ACAACC-a 3' (SEQ No. 60) After a number work grudge, specific amino acid residues substituted plasmid DNA in PCR performed by certain conditions a small number-gate. The formation protein which it boils and segmenting use pcDNA3 non-myc - (BMP2), lysine (K→R) plasmid DNA (table 8) a small number-gate replaced arginine residues. The formation protein which it boils and a plasmid DNA encoding ubiquitin pMT123 provided HA - pcDNA3 non-myc - WT using HEK 293T cell infected with respect to. Natural degree [khwi anger in order to identify the formation protein which it boils WT 2 g and g is intended to ubiquitin pMT123 provided HA - pcDNA3 non-myc - transfected DNA 1 with respect to the micro micro cavity. After 6 hours the MG132 (number proteasome inhibitors, 5 micro g/Ml) transfected 24 time after processing, immune precipitated analysis was embodiment (53 also). In addition each pcDNA3 non-myc - WT the formation protein which it boils, pcDNA3 non-myc - the formation protein which it boils substituent (K293R), pcDNA3 non-myc - the formation protein which it boils substituent (K297R), pcDNA3 non-myc - the formation protein which it boils substituent (K355R), pcDNA3 non-myc - encoding plasmid DNA (K383R) and pMT123 provided HA - the formation protein which it boils substituent using HEK 293T cell infected with respect to ubiquitin. Natural degree [khwi anger in order to identify the formation protein which it boils pcDNA3 non-myc - WT, pcDNA3 non-myc - the formation protein which it boils substituent (K293R), pcDNA3 non-myc - the formation protein which it boils substituent (K297R), pcDNA3 non-myc - the formation protein which it boils substituent (K355R), pcDNA3 non-myc - the formation protein which it boils substituent (K383R) 2 micro g each, and cavity 24 and transfect cell DNA 1 micro g pMT123 provided HA - ubiquitin immunospecifically embodiment (also 54) was precipitated analysis has been completed. For immune is returned obtained sample dissolution buffer (1% Triton X, 150 mm NaCl, 50 mm Tris a-HCl, pH 8 and 1 mm PMSF (phenylmethanesulfonyl fluoride) cyanuric acid, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40) is mixed with him as during night in 4 °C 1 difference antibodies. 4 °C sinkage body protein A/G beads (Santa Cruz Biotechnology) 2 in time using immune reaction was separated. Then, the-wash 2 buffer was dissolved. 2X SDS sample buffer after 7 minutes in 100 °C immune [...] protein mixed with heated, to separate a SDS-a PAGE his embodiment. Next separated protein PVDF membrane, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - HA (Santa Cruz Biotechnology, sc provided 7392) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio including blocking solution 1:1000 anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40) when returned tnfrsf embodiment, is natural combination formed by the formation protein which it boils WT pcDNA3 non-myc - [khwi this [khwi this address to which band is shaped natural polyubiquitin angry strongly featured appeared (53 also, lanes 3 and 4). In addition, MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 when a processing time is detected more strongly featured type expense [khwi anger etched formation [khwi this increased natural sweet taste (53 also, lane 4) band. In addition pcDNA3 non-myc - the formation protein which it boils substituent (K293R), pcDNA3 non-myc - the formation protein which it boils substituent (K297R), pcDNA3 non-myc - in the case of the formation protein which it boils substituent (K355R), a pulse band than soft WT, pcDNA3 non-myc - the formation protein which it boils substituent (K293R), pcDNA3 non-myc - the formation protein which it boils substituent (K297R), the formation protein which it boils substituent is not natural [khwi this [khwi with natural binding (K355R) pcDNA3 non-myc - less (54 also, lane 3 and 5) is detected. The result of the or more ubiquitin proteasome [khwi with the formation protein which it boils natural binding to poly type expense [khwi anger - decomposition at or over the system. The formation protein which it boils pcDNA3 non-myc - WT, pcDNA3 non-myc - the formation protein which it boils substituent (K293R), pcDNA3 non-myc - the formation protein which it boils substituent (K297R), pcDNA3 non-myc - the formation protein which it boils substituent (K355R), respectively HEK 293T cells transfected by the formation protein which it boils substituent (K383R) pcDNA3-a myc - 2 with respect to the micro g (transfection). Transfected 48 hours, protein generation number (CHX) cycloalkyl [...] (Sigma non-Aldrich) (100 micro g/Ml) 2 for processing time, half-time and 8 4 very long periods of time were measured. As a result, the decomposition billion number has been confirmed that the human is the formation protein which it boils (also 55). The formation protein which it boils substituent (K297R) 2 hours while the formation protein which it boils half-human human pcDNA3 non-myc -, the formation protein which it boils substituent of half-life longer than 4 hr or longer (K355R) pcDNA3 non-myc - WT plastic this result may have shown graph (also 55). The formation protein which it boils various myeloma cells results in apoptosis has been reported that results in inactive STAT3 (Blood, 96, 2005 - 2011, 2000). In the in the embodiment, in a cell with the formation protein which it boils the formation protein which it boils substituent transmissions by signal transduction has been confirmed. First, famishing, HepG2 cells (ATCC, AB-a 8065) after 8 hours, the formation protein which it boils pcDNA3 non-myc - WT, pcDNA3 non-myc - the formation protein which it boils substituent (K293R), pcDNA3 non-myc - the formation protein which it boils substituent (K297R), pcDNA3 non-myc - the formation protein which it boils substituent (K355R), pcDNA3 non-myc - 3 using a cell infected by the formation protein which it boils substituent (K383R) HepG2 micro g with respect to the respectively. 2 Infection after a lapse, quantifying each and in proteins, intracellular signal transduction identifying the [wey the [su it shook off [...] be conducting. Each pcDNA3 non-myc - 3 mm during the formation protein which it boils substituent (K293R), pcDNA3 non-myc - the formation protein which it boils substituent (K297R), pcDNA3 non-myc - the formation protein which it boils substituent (K355R) and isolated from infected HepG2 cells (K383R) pcDNA3 non-myc - the formation protein which it boils substituent then moved from PVDF membrane protein, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - STAT3 (Santa Cruz Biotechnology, sc provided 21876), anti - phospho-a STAT3 (Y705, cell signaling 9131S) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) weight ratio including a 1:1000 - 2 antibody mouse anti - blocking solution [ley with comb anti (Western blot detection kit, ABfrontier, Seoul, Korea) difference ECL system was the development. As a result, the formation protein which it boils substituent (K293R) pcDNA3 non-myc -, pcDNA3 non-myc - the formation protein which it boils substituent (K297R), pcDNA3 non-myc - the formation protein which it boils substituent (K355R), pcDNA3 non-myc - equal to the formation protein which it boils the formation protein which it boils substituent in a cell HepG2 (K383R) is reduced relative to a phospho-a STAT3 WT pcDNA3 non-myc - a regulated signal transduction and viscoelasticity (56 also). Example embodiment 9: fibroblast growth factor -1 (FGF-1) Protein Natural [khwi anger Analysis and half-life increased intracellular signaling identifying identifying By fibroblast growth factor - 1 DNA polymerase chain reaction amplification products pCMV3 provided C a-myc (6. 1 Kb) KpnI and XbaI fragment into a number hanhyo factor produced when the joining cloning (57 also, fibroblast growth factor -1 amino acid sequence: SEQ No. 61), The result is a number hanhyo small after cutting, agar with [cu gel electrophoresis confirmed through objects (58 also). In addition of Figure 57 bio-sequence listing underline on cloned site and coarse part confirms portion is once again able to function key polymerase chain reaction primer set is used when a metal thin film, the result agar with [cu gel electrophoresis confirmed through objects (58 also). Polymerase chain reaction conditions as follows; in initial degeneration by reacting 3 minutes 94 °C, modified for an in 30 seconds 94 °C, 58 °C for 30 seconds annealing reaction in, extending into the space between the repeating period for an in processing a 25 30 72 °C have, in 10 minutes after reaction with respect to the 72 °C. The number it became work number to determine if the DNA is protein expression as indicated map for present anti myc pCMV3 provided C a-myc vector of Figure 57 - myc (9E 10, sc provided 40) [...] expression has been confirmed through the [wey the [su it shook off for using such antibodies. Myc protein expressed well coupled to the fibroblast growth factor -1 making sure that are loaded when the camera into expression vector dose through the [...] up (59 also). When the arginine replaced by lysine residues using site specific mutation induction, certain mutations may derive a DNA primer sequences (FGF-a 1 K27R FP 5 '- AAGAAGCCCAGACTCCTCTAC-a 3' (SEQ No. 62), 'RP 5 provided GTAGAGGAGTCTGGGCTTCT T-a 3' (SEQ No. 63); FGF-a 1 K120R FP 5 'a-CAT GCAGAGAGGAATTGGTTT-a 3' (SEQ No. 64), 'RP 5 provided AAACCAATTCCTCTCTGCATG-a 3' (SEQ No. 65) Number after a work grudge, specific amino acid residues substituted plasmid DNA in PCR performed by certain conditions a small number-gate. Templates and use pCMV3 provided C-a myc-a FGF-a 1 DNA, plasmid DNA (table 9) a small number-gate (K→R) Lysine replaced arginine residues. DNA encoding ubiquitin pCMV3 provided C a-myc - fibroblast growth factor -1 wt and pMT123 provided HA - with respect to the plasmid using HEK 293T cell infected. Natural wind [khwi anger for micro g and pMT123 provided HA - ubiquitin DNA 1 pCMV3 provided C-a myc - fibroblast growth factor -1 wt 2 g with respect to the transfected cells micro cavity. 24 MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 hours after the infection time after processing, immune precipitated analysis was embodiment (also 60). In addition each pCMV3 provided C a-myc - fibroblast growth factor -1 wt, pCMV3 provided C-a myc - fibroblast growth factor -1 substituent (K27R), pCMV3 provided C-a myc - fibroblast growth factor -1 substituent (K120R), using a plasmid DNA encoding ubiquitin pMT123 provided HA - with respect to the HEK 293T cell infected. Natural degree [khwi anger in order to identify pCMV3 provided C a-myc - fibroblast growth factor -1 wt, pCMV3 provided C-a myc - fibroblast growth factor -1 substituent (K27R), each micro g 2 (K120R) -1 pCMV3 provided C-a myc - fibroblast growth factor, and cavity 24 and transfect cell DNA 1 micro g pMT123 provided HA - ubiquitin immunospecifically sedimentation analysis was embodiment (also 61) has been completed. For immune is returned obtained sample dissolution buffer (1% Triton X, 150 mm NaCl, 50 mm Tris a-HCl, pH 8 and 1 mm PMSF (phenylmethanesulfonyl fluoride) cyanuric acid, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40) is mixed with him as during night in 4 °C 1 difference antibodies. 4 °C sinkage body protein A/G beads (Santa Cruz Biotechnology) 2 in time using immune reaction was separated. Then, the-wash 2 buffer was dissolved. 2X SDS sample buffer after 7 minutes in immune [...] protein mixed with 100 °C after boiling, to separate a SDS-a PAGE his embodiment. Next separated protein PVDF membrane, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - HA (Santa Cruz Biotechnology, sc provided 7392) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio including blocking solution 1:1000 anti - mouse 2 antibody ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) difference was the development. As a result, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40) embodiment is returned when tnfrsf, [khwi this is natural combination polyubiquitin angry pCMV3 provided C a-myc - fibroblast growth factor -1 wt by address to which band is formed having a shape natural sweet taste (60 also, lanes 3 and 4) [khwi this strongly featured. In addition, MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 when a processing time is detected more strongly featured type expense [khwi anger etched formation [khwi this increased natural sweet taste (60 also, lane 4) band. In addition pCMV3 provided C a-myc - fibroblast growth factor -1 substituent (K27R), fibroblast growth factor -1 substituent of pCMV3 provided C a-myc - (K120R), a pulse band than soft WT, pCMV3 provided C a-myc - fibroblast growth factor -1 substituent (K27R), -1 substituent (K120R) [khwi with the natural pCMV3 provided C a-myc - fibroblast growth factor binding is detected (61 also, lanes 3, 4) [khwi this less not natural. Or more is the result of the fibroblast growth factor -1 [khwi with natural binding ubiquitin proteasome - poly type expense [khwi anger decomposition is at or over the system. -1 Wt pCMV3 provided C a-myc - fibroblast growth factor, fibroblast growth factor -1 substituent pCMV3 provided C a-myc - (K27R), fibroblast growth factor -1 substituent (K120R) 2 micro g pCMV3 provided C a-myc - HEK 293T cells transfected by 48 hours respectively and, protein generation number (CHX) cycloalkyl [...] (Sigma non-Aldrich) (100 micro g/Ml) very long periods of time measured half-life time and 36 24 high-K dielectric material, the number has been confirmed that the decomposition of human fibroblast growth factor -1 billion (62 also). 1 Half-life of human fibroblast growth factor -1 while -1 substituent (K27R) within human pCMV3 provided C a-myc - fibroblast growth factor, fibroblast growth factor -1 substituent of half-life (K120R) pCMV3 provided C a-myc - WT 1 or more longer than plastic this result may have shown graph (62 also). HEK293 cells a recombinant fibroblast growth factor -1 Erk 1/2 phosphorylation is increased that the sheet also has been reported (Nature, 513 (7518), 436 - 439, 2014). In the in the embodiment, in a cell fibroblast growth factor -1 -1 substituent transmissions by signal transduction has been confirmed and fibroblast growth factor. First, HepG2 cells (ATCC, AB-a 8065) 8 time?For E and after that, pCMV3 provided C a-myc - fibroblast growth factor -1 wt, pCMV3 provided C-a myc - fibroblast growth factor -1 substituent (K27R), fibroblast growth factor -1 substituent (K120R) micro g each pCMV3 provided C a-myc - 3 using a cell infected by the quantifying HepG2 after each and 2 in proteins, intracellular signal transduction a function key web [capstan [...] conducting. During this process pCMV3 provided C a-myc - fibroblast growth factor -1 wt, pCMV3 provided C-a myc - fibroblast growth factor -1 substituent (K27R), fibroblast growth factor -1 substituent pCMV3 provided C a-myc - infected HepG2 cells isolated from PVDF membrane protein (K120R) next, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - Erk1/2 (9B 3, Abfrontier LF provided MA0134), anti - phospho-a Erk1/2 a (Santa Cruz Biotechnology, sc provided 47778) (Thr202/Tyr204, Abfrontier LF provided PA0090) and anti - β a-actin the weight ratio [ley comb including blocking solution 1:1000 anti - (goat anti-a rabbit IgG a-HRP, Santa Cruz Biotechnology, sc-a 2004) and anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, pCMV3 provided C a-myc - fibroblast growth factor -1 substituent (K27R), in a cell (K120R) fibroblast growth factor -1 substituent pCMV3 provided C a-myc - HepG2 is equal to or increased fibroblast growth factor -1 wt pCMV3 provided C a-myc - phospho-a ERK1/2 signal transduction and viscoelasticity (63 also). Example embodiment 10: billion appetite number hormone (Leptin) Protein Natural [khwi anger Analysis and half-life increased intracellular signaling identifying identifying Number hormone (Leptin) appetite billion by polymerase chain reactionDNA amplification products pCMV3 provided C a-myc (6. 1 Kb) KpnI and XbaI fragment into a number hanhyo factor produced when the joining cloning (also 64, leptin amino acid sequence: SEQ No. 66), The result is a number hanhyo small after cutting, agar with [cu gel electrophoresis confirmed through objects (also 65). In addition of Figure 64 bio-sequence listing underline on cloned site and coarse part confirms portion is once again able to function key polymerase chain reaction primer set is used when a metal thin film, the result agar with [cu gel electrophoresis confirmed through objects (also 65). Polymerase chain reaction conditions as follows; in initial degeneration by reacting 3 minutes 94 °C, modified for an in 30 seconds 94 °C, 58 °C for 30 seconds annealing reaction in, for processing a repeating cycle 25 extending into the space between the 45 in catalysts for 72 °C have, in 10 minutes after reaction with respect to the 72 °C. The number it became work number to determine if the DNA is protein expression as indicated map of Figure 64 to present an anti - myc pCMV3 provided C a-myc vector myc (9E 10, sc provided 40) [...] expression has been confirmed through the [wey the [su it shook off for using such antibodies. Myc appetite billion number hormone (Leptin) coupled toMaking sure that the camera into expression vector when the expression well protein dose through the loaded [...] up (66 also). When the arginine replaced by lysine residues using site specific mutation induction, certain mutations may derive a DNA primer sequences (Leptin K26R FP 5 '- CCCATCCAAAAGGTCCAAGAT-a 3' (SEQ No. 67), RP 5 '- ATCTTGGACCTTTTGGATGGG-a 3' (SEQ No. 68); 'Leptin K32R FP 5 provided GA TGACACCAAGACCCTCATC-a 3' (SEQ No. 69), 'RP 5 provided GATGAGGGTCTTGGTGTCATC-a 3' (SEQ No. 70); 'Leptin K36R FP 5 provided ACCCTCATCAGGACAATTGTC-a 3' (SEQ No. 71), 'RP 5 provided GACAATTGTCCTGATGAGGGT-a 3' (SEQ No. 72); 'Leptin K74R FP 5 provided ACCTTATCCAG GATGGACCAG-a 3' (SEQ No. 73), 'RP 5 provided CTGGTCCATCCTGGATAAGGT-a 3' (SEQ No. 74) Number after a work grudge, specific amino acid residues substituted plasmid DNA in PCR performed by certain conditions a small number-gate. Appetite pCMV3 provided C-a myc - billion number hormone (Leptin)DNA templates and use, lysine residues (K→R) plasmid DNA (table 10) a smaller number replaced arginine-gate. DNA encoding ubiquitin protein WT appetite pCMV3 provided C non-myc - billion number using a cell infected HEK 293T pMT123 provided HA - and with respect to the plasmid. To make sure that the extent to which conduction [khwi anger natural appetite WT 6 g protein and DNA 1 billion number pCMV3 provided C a-myc - micro cavity 24 and is intended to transfect micro g pMT123 provided HA - ubiquitin MG132 (number proteasome inhibitors, 5 micro g/Ml) time after time to the next article 6, immune sedimentation analysis was embodiment (also 67). In addition each number protein WT appetite pCMV3 provided C a-myc - billion, billion number appetite pCMV3 provided C a-myc - protein substituent (K26R), appetite (K32R) number protein substituent pCMV3 provided C a-myc - billion, billion number appetite pCMV3 provided C a-myc - protein substituent (K36R), appetite billion number protein substituent (K74R) and pCMV3 provided C a-myc - encoding plasmid DNA using HEK 293T cell infected pMT123 provided HA - with respect to ubiquitin. [Khwi anger natural appetite WT protein number to make sure that the extent to which conduction pCMV3 provided C a-myc - billion, billion number appetite pCMV3 provided C a-myc - protein substituent (K26R), appetite (K32R) number protein substituent pCMV3 provided C a-myc - billion, billion number appetite pCMV3 provided C a-myc - protein substituent (K36R), appetite (K74R) number each micro g protein substituent pCMV3 provided C a-myc - 6 billion, ubiquitin is intended to transfect DNA 1 micro g has been completed and cavity 24 and pMT123 provided HA - immunospecifically sedimentation analysis was embodiment (also 68). For immune is returned obtained sample dissolution buffer (1% Triton X, 150 mm NaCl, 50 mm Tris a-HCl, pH 8 and 1 mm PMSF (phenylmethanesulfonyl fluoride) cyanuric acid, anti - myc (9E 10) 1 is mixed with him as during night in 4 °C difference antibodies. 4 °C sinkage body protein A/G beads (Santa Cruz Biotechnology) 2 in time using immune reaction was separated. Then, the-wash 2 buffer was dissolved. 2X SDS sample buffer after 7 minutes in immune [...] protein mixed with 100 °C after boiling, to separate a SDS-a PAGE his embodiment. Next separated protein PVDF membrane, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - HA (Santa Cruz Biotechnology, sc provided 7392) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio including blocking solution 1:1000 anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, anti - myc (9E 10, sc provided 40) embodiment is returned when tnfrsf, in combination [khwi this is natural number protein WT pCMV3 provided C a-myc - billion appetite by address to which band is formed having a shape natural polyubiquitin angry [khwi this strongly featured appeared (67 also, lane 3 and 4). In addition, MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 when a processing time is detected more strongly featured type expense [khwi anger etched formation [khwi this increased natural sweet taste (67 also, lane 4) band. In addition pCMV3 provided C a-myc - billion appetite number protein substituent (K26R), appetite (K36R) number protein substituent pCMV3 provided C a-myc - billion, billion (K74R) number of appetite pCMV3 provided C a-myc - protein substituent, a pulse band than soft WT, appetite pCMV3 provided C a-myc - billion number protein substituent (K26R), appetite pCMV3 provided C a-myc - billion number protein substituent (K36R), appetite (K74R) [khwi with natural binding protein substituent pCMV3 provided C a-myc - billion number [khwi this is not natural (68 also, lane 3, 5 and 6) is detected as possible. The result of the or more ubiquitin binding protein natural appetite billion number [khwi with decomposition is at or poly type expense [khwi anger - proteasome through the system. Number protein WT appetite pCMV3 provided C a-myc - billion, billion number appetite pCMV3 provided C a-myc - protein substituent (K26R), appetite (K32R) number protein substituent pCMV3 provided C a-myc - billion, billion (K36R) appetite pCMV3 provided C a-myc - number protein substituent, each 6 g protein substituent (K74R) number pCMV3 provided C a-myc - billion HEK 293T cells transfected appetite by 48 hours and micro, protein generation number (CHX) cycloalkyl [...] (Sigma non-Aldrich) (100 micro g/Ml) then processing, 2 time, measured half-life time and 8 4 very long periods of time, the number has been confirmed that the decomposition of protein number human appetite billion billion (69 also). As a result human protein half-life time 4 billion number appetite while appetite (K26R) number protein substituent which human pCMV3 provided C a-myc - billion, billion number protein substituent of half-life (K36R) appetite pCMV3 provided C a-myc - longer than 8 hr or longer WT plastic this result may have shown graph (69 also). Protein phosphorylation of AKT in breast cancer are increasing appetite billion number that has been reported (Cancer Biol Ther. , 16 (8), 1220 - 1230, 2015), PI3K/AKT signal transduction by agents that uterine cancer growth in cancer cells has been reported (Int J Oncol. , 49 (2), 847, 2016). In the in the embodiment, appetite number proteins in a cell number protein substituent transmissions by signal transduction has been confirmed that the appetite billion billion. First, famishing, HepG2 cells (ATCC, AB-a 8065) after 8 hours, number protein WT appetite pCMV3 provided C a-myc - billion, billion number appetite pCMV3 provided C a-myc - protein substituent (K26R), appetite (K32R) number protein substituent pCMV3 provided C a-myc - billion, billion number appetite pCMV3 provided C a-myc - protein substituent (K36R), each 6 billion (K74R) number protein substituent appetite pCMV3 provided C a-myc - HepG2 using a cell infected by micro g with respect to the. 2 Infection after a lapse, quantifying each and in proteins, intracellular signal transduction Western blot was identifying a second embodiment. During this process each pCMV3 provided C a-myc - WT protein number appetite billion, billion number appetite pCMV3 provided C a-myc - protein substituent (K26R), appetite (K32R) number protein substituent pCMV3 provided C a-myc - billion, billion number protein substituent (K36R) and appetite pCMV3 provided C a-myc - number protein substituent HepG2 cells infected appetite pCMV3 provided C a-myc - billion (K74R) isolated from protein next PVDF membrane, anti - myc (9E 10, sc provided 40), anti - AKT (H-a 136, Santa Cruz Biotechnology, sc provided 8312), anti - phospho-a AKT (S473, Cell Signaling 9271S) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio [ley with comb anti - anti - 1:1000 solution including blocking antibody (Western blot detection kit, ABfrontier, Seoul, Korea) mouse 2 difference ECL system was the development. As a result, appetite pCMV3 provided C a-myc - billion number protein substituent (K26R), appetite (K32R) number protein substituent pCMV3 provided C a-myc - billion, billion number appetite pCMV3 provided C a-myc - protein substituent (K36R), the appetite in a cell number (K74R) protein substituent HepG2 pCMV3 provided C a-myc - billion billion appetite compared to controls equal to number pCMV3 provided C a-myc - WT protein significantly increased phospho-a AKT signal transduction and viscoelasticity (also 70). Example embodiment 11: Vascular endothelial generating factor A (VEGFA) Protein Natural [khwi anger Analysis and half-life increased intracellular signaling identifying identifying Vascular endothelial generating factor A DNA polymerase chain reaction amplification products pCMV3 provided C a-myc (6. 1 Kb) KpnI and XbaI fragment into a number hanhyo factor produced when the joining cloning (71 also, vascular endothelial generating factor A amino acid sequence: SEQ No. 75), The result is a number hanhyo small after cutting, agar with [cu gel electrophoresis confirmed through objects (72 also). In addition of Figure 71 bio-sequence listing underline on cloned site and coarse part confirms portion is once again able to function key polymerase chain reaction primer set is used when a metal thin film, the result agar with [cu gel electrophoresis confirmed through objects (72 also). Polymerase chain reaction conditions as follows; in initial degeneration by reacting 3 minutes 94 °C, modified for an in 30 seconds 94 °C, 58 °C for 30 seconds annealing reaction in, extending into the space between the component 72 °C 1 in 25 cycles for an repeatedly have, been in 10 minutes after 72 °C reacting. The number it became work number to determine if the DNA is protein expression as indicated map of Figure 71 for present anti - myc pCMV3 provided C a-myc vector myc (9E 10, Santa Cruz Biotechnology, sc provided 40) [...] expression has been confirmed through the [wey the [su it shook off for using such antibodies. Through VEGFA myc protein expressed well coupled to making sure that the camera into expression vector dose through the loaded when the [...] up (73 also). When the arginine replaced by lysine residues using site specific mutation induction, certain mutations may derive a DNA primer sequences (VEGFA K127R FP 5 '- TACAGCACAACAGATGTGAATGCAGACC-a 3' (SEQ No. 76), 'RP 5 provided GGTCTGCATTCA CATCTGTTGTGCTGTA-a 3' (SEQ No. 77); 'VEGFA K180R FP 5 provided ATCCGCAGACGTGTAG ATGTTCCTGCA-a 3' (SEQ No. 78), RP 5 'a-TG CAGGAACATCTACACGTCTGCGGAT-a 3' (SEQ No. 79) Number after a work grudge, specific amino acid residues substituted plasmid DNA in PCR performed by certain conditions a small number-gate. Templates and use pCMV3 provided C-a myc-a VEGFA DNA, plasmid DNA-gate (table 11) a smaller number (K→R) Lysine replaced arginine residues. Plasmid DNA encoding ubiquitin pCMV3 provided C-a myc-a VEGFA WT and pMT123 provided HA - using HEK 293T cell infected with respect to. Natural wind [khwi anger for micro g ubiquitin DNA 1 micro g pCMV3 provided C-a myc-a VEGFA WT 6 transfected cells with respect to the cavity and pMT123 provided HA -. After 6 hours the MG132 (number proteasome inhibitors, 5 micro g/Ml) transfected 24 time after processing, immune precipitated analysis was embodiment (74 also). In addition each pCMV3 provided C-a myc-a VEGFA WT, pCMV3 provided C-a myc-a VEGFA substituent (K127R), pCMV3 provided C-a myc-a VEGFA substituent (K180R) using a plasmid DNA encoding ubiquitin pMT123 provided HA - and with respect to the HEK 293T cell infected. Natural degree [khwi anger in order to identify pCMV3 provided C-a myc-a VEGFA WT, pCMV3 provided C-a myc-a VEGFA substituent (K180R) 6 each micro g (K127R) and pCMV3 provided C-a myc-a VEGFA substituent, and cavity 24 and transfect cell DNA 1 micro g pMT123 provided HA - ubiquitin immunospecifically sedimentation analysis has been completed his embodiment (also 75). For immune is returned obtained sample dissolution buffer (1% Triton X, 150 mm NaCl, 50 mm Tris a-HCl, pH 8 and 1 mm PMSF (phenylmethanesulfonyl fluoride) cyanuric acid, anti - myc (9E 10, sc provided 40) is mixed with him as during night in 4 °C 1 difference antibodies. 4 °C sinkage body protein A/G beads (Santa Cruz Biotechnology) 2 in time using immune reaction was separated. Then, the-wash 2 buffer was dissolved. 2X SDS sample buffer after 7 minutes in 100 °C immune [...] protein mixed with heated, to separate a SDS-a PAGE his embodiment. Next separated protein PVDF membrane, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - HA (Santa Cruz Biotechnology, sc provided 7392) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio including blocking solution 1:1000 anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, anti - myc (9E 10, sc provided 40) tnfrsf embodiment is returned when, in combination polyubiquitin angry [khwi this is natural pCMV3 provided C-a myc-a VEGFA WT by address [khwi this detected band is formed having a shape natural sweet taste (74 also, lanes 3 and 4) strongly featured. In addition, MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 when a processing time is detected more strongly featured type expense [khwi anger etched formation [khwi this increased natural sweet taste (74 also, lane 4) band. In addition pCMV3 provided C-a myc-a VEGFA substituent (K127R), in the case of pCMV3 provided C-a myc-a VEGFA substituent (K180R), a pulse band than soft WT, pCMV3 provided C-a myc-a VEGFA substituent (K127R), (K180R) returned to the natural pCMV3 provided C-a myc-a VEGFA substituent (also 75, lanes 3, 4) [khwi with [khwi this natural binding is detected as possible. The result of the or more VEGFA [khwi with the natural binding to poly type expense [khwi anger - ubiquitin proteasome degrading at or over the system. PCMV3 provided C-a myc-a VEGFA WT, pCMV3 provided C-a myc-a VEGFA substituent (K127R), each 6 g (K180R) pCMV3 provided C-a myc-a VEGFA substituent by HEK 293T transfected cells (transfection) with respect to the micro. Transfected 48 hours, protein generation number (CHX) cycloalkyl [...] (Sigma non-Aldrich) (100 micro g/Ml) for processing time 2, 4 time, very long periods of time and 8 measured half-life, the human VEGFA number has been confirmed that the decomposition of billion (76 also). 2 Hours while the half-life of human VEGFA, human pCMV3 provided C-a myc-a VEGFA substituent (K127R), (K180R) 4 hr or longer WT pCMV3 provided C-a myc-a VEGFA substituent of half-life longer than plastic this result may have shown graph (also 76). VEGFA is endothelial cell growth, angiogenesis associated with the cancer cells proliferation as important factor acting on which a PI3K/Akt/HIF-a 1 alpha signal transduction involving so when it has been reported that (Carcinogenesis, 34, 426 - 435, 2013). It has been reported that AKT phosphorylation in addition VEGF is inducing (Kidney Int. , 68, 1648 - 1659, 2005). In the in the embodiment, in a cell VEGFA VEGFA substituent on transmissions by signal transduction has been confirmed. First, famishing, HepG2 cells (ATCC, AB-a 8065) after 8 hours, pCMV3 provided C-a myc-a VEGFA WT, pCMV3 provided C-a myc-a VEGFA substituent (K127R) and each 6 micro g (K180R) pCMV3 provided C-a myc-a VEGFA substituent by using a cell infected with respect to HepG2. 2 Infection after a lapse, quantifying each and in proteins, intracellular signal transduction identifying the [wey the [su it shook off [...] be conducting. During this process each pCMV3 provided C-a myc-a VEGFA WT, pCMV3 provided C-a myc-a VEGFA substituent (K127R), and HepG2 cells infected pCMV3 provided C-a myc-a VEGFA substituent (K180R) isolated from PVDF membrane protein next, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - STAT3 (Santa Cruz Biotechnology, sc provided 21876), anti - phospho-a STAT3 (Y705, cell signaling 9131S), anti - AKT (H-a 136, Santa Cruz Biotechnology, sc provided 8312), anti - phospho-a AKT (S473, cell signaling 9271S) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio [ley comb including blocking solution 1:1000 anti - (goat anti-a rabbit IgG a-HRP, Santa Cruz Biotechnology, sc-a 2004) and anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, pCMV3 provided C-a myc-a VEGFA substituent (K127R) and (K180R) in a cell HepG2 pCMV3 provided C-a myc-a VEGFA substituent is equal to or increased phospho-a STAT3 pCMV3 provided C-a myc-a VEGFA WT on phospho-a AKT signal transduction and viscoelasticity (77 also). Example embodiment 12: promoting appetite hormone precursor (Ghrelin/ObestatinPreprohormone; Prepro-GHRL) In Natural [khwi anger Analysis and half-life increased intracellular signaling identifying identifying Appetite by promoting hormone precursor (Ghrelin/Obestatin Preprohormone; prepro-a GHRL) polymerase chain reactionDNA amplification products pCMV3 provided C a-myc (6. 1 Kb) KpnI and XbaI fragment into a number hanhyo factor produced when the joining cloning (78 also, prepro-a GHRL amino acid sequence: SEQ No. 80), The result is a number hanhyo small after cutting, agar with [cu gel electrophoresis confirmed through objects (79 also). In addition of Figure 78 bio-sequence listing underline on cloned site and coarse part confirms portion is once again able to function key on a metal thin film used in polymerase chain reaction primer set the result agar with [cu gel electrophoresis confirmed through objects (79 also). Polymerase chain reaction conditions as follows; in initial degeneration by reacting 3 minutes 94 °C, modified for an in 30 seconds 94 °C, 58 °C for 30 seconds in annealing reaction, catalysts for 72 °C have performed for processing a 25 30 extending in repeated cycles, with respect to the 10 minutes after 72 °C in reaction. The number it became work number to determine if the DNA is protein expression as indicated map of Figure 78 to present an anti - myc pCMV3 provided C a-myc vector myc (9E 10, Santa Cruz Biotechnology, sc provided 40) through expression has been confirmed that the Western blot for using such antibodies. Through appetite myc protein coupled to promoting hormone precursor (Ghrelin/Obestatin Preprohormone; prepro-a GHRL) making sure that the camera into expression vector when the expression well [...] dose through the loaded up (80 also). When the arginine replaced by lysine residues using site specific mutation induction, certain mutations may derive a DNA primer sequences (prepro-a GHRL K100R FP 5 '- GCCCTGGGGAGGTTTCTTCAG-a 3' (SEQ No. 81), 'RP 5 provided CTGAAGAAACCTCCCCAGGGC-a 3' (SEQ No. 82) After a number work grudge, specific amino acid residues substituted plasmid DNA in PCR performed by certain conditions a small number-gate. (Ghrelin/Obestatin Preprohormone; prepro-a GHRL) promoting hormone precursor appetite pCMV3 provided C a-myc - DNA templates is used, a smaller number plasmid DNA (table 12) arginine residues replaced (K→R) Lysine-gate. DNA encoding ubiquitin pCMV3 provided C-a myc-a prepro-a GHRL WT pMT123 provided HA - and with respect to the plasmid using HEK 293T cell infected. Natural degree [khwi anger in order to identify ubiquitin DNA 1 micro g g pCMV3 provided C-a myc-a prepro-a GHRL WT 6 micro cavity with respect to the cells transfected with pMT123 provided HA -. After 6 hours the MG132 (number proteasome inhibitors, 5 micro g/Ml) transfected 24 time after processing, immune sedimentation analysis was embodiment (81 also). Each pCMV3 provided C-a myc-a prepro-a GHRL WT, pCMV3 provided C-a myc-a prepro-a GHRL substituent using a plasmid DNA encoding ubiquitin (K100R) and pMT123 provided HA - with respect to the HEK 293T cell infected. Natural degree [khwi anger in order to identify pCMV3 provided C-a myc-a prepro-a GHRL WT, and 6 each micro g (K100R) pCMV3 provided C-a myc-a prepro-a GHRL substituent, and cavity 24 and transfect cell DNA 1 micro g pMT123 provided HA - ubiquitin immunospecifically sedimentation analysis has been completed his embodiment (82 also). For immune is returned obtained sample dissolution buffer (1% Triton X, 150 mm NaCl, 50 mm Tris a-HCl, pH 8 and 1 mm PMSF (phenylmethanesulfonyl fluoride) cyanuric acid, anti - myc (9E 10, sc provided 40) is mixed with him as during night in 4 °C 1 difference antibodies. 4 °C sinkage body protein A/G beads (Santa Cruz Biotechnology) 2 in time using immune reaction was separated. Then, the-wash 2 buffer was dissolved. 2X SDS sample buffer after 7 minutes in immune [...] protein mixed with 100 °C after boiling, to separate a SDS-a PAGE his embodiment. Next separated protein PVDF membrane, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - HA (Santa Cruz Biotechnology, sc provided 7392) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio including blocking solution 1:1000 anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40) embodiment is returned when tnfrsf, is natural combination polyubiquitin angry pCMV3 provided C-a myc-a prepro-a GHRL WT (smear) formed by shaped address [khwi this [khwi this natural sweet taste (81 also, lane 3 and 4) strongly featured band is detected. In addition, MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 when a processing time is detected more strongly featured type expense [khwi anger etched formation [khwi this increased natural sweet taste (81 also, lane 4) band. In addition pCMV3 provided C-a myc-a prepro-a GHRL substituent of (K100R), a pulse band than soft WT, pCMV3 provided C-a myc-a prepro-a GHRLSubstituent is not natural (K100R) [khwi with natural binding (82 also, lane 3) [khwi this is detected as possible. The result of the or more promoting ubiquitin binding protein [khwi with natural appetite - proteasome degrading poly type expense [khwi anger to at or over the system. PCMV3 provided C-a myc-a prepro-a GHRL WT, each 6 micro g (K100R) pCMV3 provided C-a myc-a prepro-a GHRL substituent HEK 293T cells transfected by with respect to the. Transfected 48 hours, protein generation number (CHX) cycloalkyl [...] (Sigma non-Aldrich) (100 micro g/Ml) 2 for processing time, very long periods of time by measuring the half-life time and 8 4 results, the number has been confirmed that the decomposition of promoting protein human appetite billion (83 also). As a result human appetite while promoting hormone precursor (Ghrelin/Obestatin Preprohormone; prepro-a GHRL) half-life of 2 hours wherein 2 half-life of human pCMV3 provided C-a myc-a prepro-a GHRL substituent (K100R) WT hr or longer longer than plastic this result may have shown graph (83 also). Growth hormone secretion promoting appetite hormone receptor (the growth hormone secretagogue receptor; GHS-a R) through the effect of cell growth, it has been reported that STAT3 through increasing calcium regulation body (Mol Cell Endocrinol. , 285, 19 - 25, 2008). The appetite in promoting hormone precursor in a cell in the embodiment (Ghrelin/Obestatin Preprohormone; prepro-a GHRL) and promoting hormone precursor appetite (Ghrelin/Obestatin Preprohormone; prepro-a GHRL) substituent transmissions by signal transduction has been confirmed. First, famishing, HepG2 cells (ATCC, AB-a 8065) after 8 hours, pCMV3 provided C-a myc-a prepro-a GHRL WT, each 6 micro g (K100R) pCMV3 provided C-a myc-a prepro-a GHRL substituent by using a cell infected with respect to HepG2. 2 Infection after a lapse, then each proteins in quantifying, identifying the [wey the [su it shook off his [...] embodiment be intracellular signal transduction. During this process pCMV3 provided C-a myc-a prepro-a GHRL WT, pCMV3 provided C-a myc-a prepro-a GHRL substituent (K100R) infected HepG2 cells (ATCC, AB-a 8065) (polyvinylidene difluoride, PVDF) membrane protein isolated from poly vinyl this flow which is burnt the id next, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - STAT3 (Santa Cruz Biotechnology, sc provided 21876), anti - phospho-a STAT3 (Y705, cell signaling 9131S), and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio [ley comb including blocking solution 1:1000 anti - (goat anti-a rabbit IgG a-HRP, Santa Cruz Biotechnology, sc-a 2004) and anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, in a cell (K100R) HepG2 pCMV3 provided C-a myc-a prepro-a GHRL substituent is equal to or increased phospho-a STAT3 pCMV3 provided C-a myc-a prepro-a GHRL WT signal transfer and viscoelasticity (84 also). Example embodiment 13: promoting appetite hormone (Ghrelin) In Natural [khwi anger Analysis and half-life increased intracellular signaling identifying identifying Appetite stimulating hormone (Ghrelin) by polymerase chain reactionDNA amplification products pcDNA3 non-myc (5. 6 Kb) BamHI and XhoI fragment into a number hanhyo factor produced when the joining cloning (85 also, Ghrelin amino acid sequence: SEQ No. 83), The result is a number hanhyo small after cutting, agar with [cu gel electrophoresis confirmed through objects (86 also). In addition of Figure 85 bio-sequence listing underline on cloned site and coarse part confirms portion is once again able to function key polymerase chain reaction primer set is used when a metal thin film, the result agar with [cu gel electrophoresis confirmed through objects (86 also). Polymerase chain reaction conditions as follows; in initial degeneration by reacting 3 minutes 94 °C, modified for an in 30 seconds 94 °C, 58 °C for 30 seconds annealing reaction in, for processing a repeating cycle 25 extending into the space between the 20 in catalysts for 72 °C have, in 10 minutes after reaction with respect to the 72 °C. The number it became work number to determine if the DNA is protein expression as indicated map of Figure 85 for present anti - myc pcDNA3 non-myc vector myc (9E 10, sc provided 40) [...] expression has been confirmed through the [wey the [su it shook off for using such antibodies. Through promoting hormone (Ghrelin) coupled to myc appetiteMaking sure that the camera into expression vector when the expression well protein dose through the loaded [...] up (87 also). When the arginine replaced by lysine residues using site specific mutation induction, certain mutations may derive a DNA primer sequences (Ghrelin K39R FP 5 '- AGTCCAGCAGAGAAGGGAGTCGAAGAAGCCA-a 3' (SEQ No. 84), 'RP 5 provided TGGCTTCTTCGACTCCCTTCTCTGCTGGACT-a 3' (SEQ No. 85); 'Ghrelin K42R FP 5 provided AGAAAGGAGTCGAGGAAGCCACCAGCCAAGC-a 3' (SEQ No. 86), 'RP 5 provided GCTTGGCTGGTGGCTTCCTCGACTCCTTTCT-a 3' (SEQ No. 87); 'Ghrelin K43R FP 5 provided AGAAAGGAGTCGAAGAGGCCACCAGCCAAGC-a 3' (SEQ No. 88), RP 5 'a-GC TTGGCTGGTGGCCTCTTCGACTCCTTTCT-a 3' (SEQ No. 89); 'Ghrelin K47R FP 5 provided AAGA AGCCACCAGCCAGGCTGCAGCCCCGA-a 3' (SEQ No. 90), 'RP 5 provided TCGGGGCTGCAGCCT GGCTGGTGGCTTCTT-a 3' (SEQ No. 91) After a number work grudge, specific amino acid residues substituted plasmid DNA in PCR performed by certain conditions a small number-gate. Appetite pcDNA3 non-myc - promoting hormone (Ghrelin)DNA templates and use, lysine residues (K→R) plasmid DNA (table 13) a smaller number replaced arginine-gate. Plasmid DNA encoding ubiquitin pcDNA3 non-myc - promoting hormone WT and appetite using HEK 293T cell infected pMT123 provided HA - with respect to the. [Khwi anger natural wind and for promoting hormone WT 2 micro g DNA 1 micro g appetite pcDNA3 provided myc - transfected cells with respect to the cavity pMT123 provided HA - ubiquitin. MG132 (number proteasome inhibitors, 5 micro g/Ml) time after time transfected 24 a 6 next, immune precipitated analysis was embodiment (88 also). In addition each pcDNA3 non-myc - promoting hormone WT appetite, promoting appetite pcDNA3 non-myc - hormone substituent (K39R), pcDNA3 non-myc - promoting hormone substituent (K42R) appetite, promoting appetite pcDNA3 non-myc - hormone (K43R), pcDNA3 non-myc - encoding plasmid DNA (K47R) and promoting hormone substituent appetite pMT123 provided HA - using HEK 293T cell infected with respect to ubiquitin. In order to identify pcDNA3 non-myc - promoting hormone WT degree [khwi anger natural appetite, promoting appetite pcDNA3 non-myc - hormone substituent (K39R), pcDNA3 non-myc - promoting hormone substituent (K42R) appetite, pcDNA3 non-myc - promoting hormone substituent (K43R) appetite, promoting hormone substituent (K47R) pcDNA3 non-myc - 2 micro g each appetite, and cavity 24 and transfect cell DNA 1 micro g pMT123 provided HA - ubiquitin immunospecifically embodiment (also 89) was precipitated analysis has been completed. For immune is returned obtained sample dissolution buffer (1% Triton X, 150 mm NaCl, 50 mm Tris a-HCl, pH 8 and 1 mm PMSF (phenylmethanesulfonyl fluoride) cyanuric acid, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40) is mixed with him as during night in 4 °C 1 difference antibodies. 4 °C sinkage body protein A/G beads (Santa Cruz Biotechnology) 2 in time using immune reaction was separated. Then, the-wash 2 buffer was dissolved. 2X SDS sample buffer after 7 minutes in immune [...] protein mixed with 100 °C after boiling, to separate a SDS-a PAGE his embodiment. (Polyvinylidene difluoride, PVDF) membrane separated protein poly vinyl this flow which is burnt the id next, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - HA (Santa Cruz Biotechnology, sc provided 7392) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio including blocking solution 1:1000 anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, anti - myc (9E 10, sc provided 40) embodiment is returned when tnfrsf, pcDNA3 non-myc - WT [khwi this is natural appetite-promoting protein in combination polyubiquitin angry shapes (smear) formed by address (88 also, lanes 3 and 4) [khwi this natural appeared strongly featured band is detected. In addition, MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 when a processing time is detected more strongly featured type expense [khwi anger etched formation [khwi this increased natural sweet taste (88 also, lane 4) band. In addition pcDNA3 non-myc - promoting hormone substituent (K39R) appetite, promoting appetite pcDNA3 non-myc - hormone substituent (K42R), pcDNA3 non-myc - promoting hormone substituent (K43R) appetite, pcDNA3 non-myc - in the case of promoting hormone substituent appetite (K47R), a pulse band than soft WT, pcDNA3 non-myc - promoting hormone substituent (K39R) appetite, promoting appetite pcDNA3 non-myc - hormone substituent (K42R), pcDNA3 non-myc - promoting hormone substituent (K43R) appetite, pcDNA3 non-myc - promoting hormone substituent is returned to natural [khwi this [khwi with natural appetite (K47R) coupled (89 also, lanes 3 and 6) is detected as possible. The result of the or more promoting hormone binding to ubiquitin proteasome - [khwi with natural appetite by decomposition at or poly type expense [khwi anger over the system. Appetite pcDNA3 non-myc - promoting hormone WT, pcDNA3 non-myc - promoting hormone substituent (K39R) appetite, promoting appetite pcDNA3 non-myc - hormone substituent (K42R), pcDNA3 non-myc - promoting hormone substituent (K43R) appetite, promoting hormone substituent HEK 293T cells by each micro g (K47R) appetite pcDNA3 non-myc - 2 plasmid 48 hours, protein generation number (CHX) cycloalkyl [...] (Sigma non-Aldrich) (100 ug/Ml) time for processing a 12, 24 time, very long periods of time measured half 36, the number has been confirmed that the decomposition of hormone promoting human appetite billion (90 degree). As a result human appetite while promoting hormone (Ghrelin) half-life 15 hours because the human pcDNA3 non-myc - promoting hormone substituent (K39R) appetite, promoting hormone (K47R) 36 hr or longer half-life longer than the appetite pcDNA3 non-myc - WT plastic this result may have shown graph (also 90). Growth hormone secretion promoting appetite hormone receptor (the growth hormone secretagogue receptor; GHS-a R) through the effect of cell growth, it has been reported that STAT3 through increasing calcium regulation body (Mol Cell Endocrinol. , 285, 19 - 25, 2008). The appetite in a cell in the embodiment and in promoting hormone (Ghrelin) promoting hormone (Ghrelin) substituent transmissions by signal transduction has been confirmed that the appetite. HepG2 cells (ATCC, AB-a 8065) 8 hours after first famishing,, pcDNA3 non-myc - promoting hormone WT appetite, pcDNA3 non-myc - promoting hormone substituent (K39R) appetite, promoting appetite pcDNA3 non-myc - hormone substituent (K42R), pcDNA3 non-myc - promoting hormone substituent (K43R) appetite, promoting hormone substituent (K47R) using micro g each appetite pcDNA3 non-myc - 3 with respect to a cell infected by HepG2. 2 Infection after a lapse, quantifying each and in proteins, intracellular signal transduction identifying the [wey the [su it shook off his intended [...] embodiment. During this process each pcDNA3 non-myc - promoting hormone WT appetite, promoting appetite pcDNA3 non-myc - hormone substituent (K39R), pcDNA3 non-myc - promoting hormone substituent (K42R) appetite, promoting hormone substituent (K43R) appetite pcDNA3 non-myc -, and promoting hormone substituent HepG2 cells infected appetite pcDNA3 non-myc - (K47R) (polyvinylidene difluoride, PVDF) membrane protein isolated from poly vinyl this flow which is burnt the id next, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - STAT3 (Santa Cruz Biotechnology, sc provided 21876), anti - phospho-a STAT3 (Y705, cell signaling 9131S), and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio [ley comb including blocking solution 1:1000 anti - (goat anti-a rabbit IgG a-HRP, Santa Cruz Biotechnology, sc-a 2004) and anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, pcDNA3 non-myc - promoting hormone substituent (K39R) appetite in a cell is increased phospho-a STAT3 promoting hormone WT pcDNA3 non-myc - HepG2 appetite than signal transfer and viscoelasticity (91 also). Example embodiment 14: The writing base car the similar peptide which it boils (GLP-a 1) protein Natural [khwi anger Analysis and half-life increased intracellular signaling identifying identifying The writing base car the similar peptide which it boils by polymerase chain reaction DNA amplification products (GLP-a 1) pcDNA3 non-myc (5. 6 Kb) BamHI and XhoI fragment into a number hanhyo factor produced when the joining cloning (92 also, GLP-a 1 amino acid sequence: SEQ No. 92), The result is a number hanhyo small after cutting, agar with [cu gel electrophoresis confirmed through objects (93 also). In addition of Figure 92 bio-sequence listing underline on coarse part confirms part may be cloned site and message polymerase chain reaction primer set is used when a metal thin film, the result agar with [cu gel electrophoresis confirmed through objects (93 also). Polymerase chain reaction conditions as follows; in initial degeneration by reacting 3 minutes 94 °C, modified for an in 30 seconds 94 °C, 58 °C for 30 seconds annealing reaction in, in repeated cycles have performed for processing a 25 20 extending for an 72 °C, 10 minutes after 72 °C degree with respect to the reaction. The number it became work number to determine if the displayed map of Figure 92 for protein expression in DNA is present in an anti - myc pcDNA3 non-myc vector myc (9E 10, sc provided 40) [...] expression has been confirmed through the [wey the [su it shook off for using such antibodies. Through the writing base car the similar peptide which it boils (GLP-a 1) making sure that the well coupled to the myc protein expression when the camera into expression vector dose through the loaded [...] up (94 also). When the arginine replaced by lysine residues using site specific mutation induction, certain mutations may derive a DNA primer sequences (GLP-a 1 K117R FP 5 '- AAGCTGCCAGGGAATTCA-a 3' (SEQ No. 93), 'RP 5 provided TGAATTCCCTGGCAGCTT-a 3' (SEQ No. 94); GLP-a 1 K125R 'FP 5 provided TTGGC TGGTGAGAGGCC-a 3' (SEQ No. 95), 'RP 5 provided GGCCTCTCACCAGCCAA-a 3' (SEQ No. 96) Number after a work grudge, specific amino acid residues substituted plasmid DNA in PCR performed by certain conditions a small number-gate. The writing base car the similar peptide which it boils and use DNA templates (GLP-a 1) pcDNA3 non-myc -, lysine residues (K→R) plasmid DNA (table 14) a smaller number replaced arginine-gate. The writing base car the similar peptide which it boils pcDNA3 non-myc - encoding plasmid DNA (GLP-a 1) and WT pMT123 provided HA - using a cell infected HEK 293T with respect to ubiquitin. In order to identify the writing base car the similar peptide which it boils (GLP-a 1) WT 2 pcDNA3 non-myc - [khwi anger natural degree micro g and g cells transfected DNA 1 pMT123 provided HA - ubiquitin micro cavity with respect to the (co a-transfection). MG132 (number proteasome inhibitors, 5 micro g/Ml) time after time transfected 24 a 6 next, embodiment immune precipitated analysis was (95 also). In addition each pcDNA3 non-myc - WT (GLP-a 1) the writing base car the similar peptide which it boils, pcDNA3 non-myc - the writing base car the similar peptide which it boils (GLP-a 1) substituent (K117R), pcDNA3 non-myc - the writing base car the similar peptide which it boils (GLP-a 1) substituent (K125R), using a plasmid DNA encoding ubiquitin pMT123 provided HA - with respect to the HEK 293T cell infected. In order to identify the writing base car the similar peptide which it boils (GLP-a 1) [khwi anger natural degree pcDNA3 non-myc - WT, pcDNA3 non-myc - the writing base car the similar peptide which it boils (GLP-a 1) substituent (K117R), the writing base car the similar peptide which it boils (GLP-a 1) substituent on each micro g (K125R) pcDNA3 non-myc - 2 cell an cavity 24 and transfect DNA 1 micro g pMT123 provided HA - ubiquitin immunospecifically sedimentation analysis has been completed his embodiment (also 96). For immune is returned obtained sample dissolution buffer (1% Triton X, 150 mm NaCl, 50 mm Tris a-HCl, pH 8 and 1 mm PMSF (phenylmethanesulfonyl fluoride) cyanuric acid, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40) is mixed with him as during night in 4 °C 1 difference antibodies. 4 °C sinkage body protein A/G beads (Santa Cruz Biotechnology) 2 in time using immune reaction was separated. Then, the-wash 2 buffer was dissolved. 2X SDS sample buffer after 7 minutes in immune [...] protein mixed with 100 °C after boiling, to separate a SDS-a PAGE his embodiment. (Polyvinylidene difluoride, PVDF) membrane separated protein poly vinyl this flow which is burnt the id next, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - HA (Santa Cruz Biotechnology, sc provided 7392) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio including blocking solution 1:1000 anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40) embodiment is returned when tnfrsf, pcDNA3 non-myc - the writing base car the similar peptide which it boils (GLP-a 1) [khwi this is natural shape formed by combination polyubiquitin angry WT address detected strongly featured BIP [khwi this band (95 also, lanes 3 and 4) appeared. In addition, MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 when a processing time is detected more strongly featured type expense [khwi anger etched formation [khwi this increased natural sweet taste (95 also, lane 4) band. In addition pcDNA3 non-myc - the writing base car the similar peptide which it boils (GLP-a 1) substituent (K117R), pcDNA3 non-myc - in the case of the writing base car the similar peptide which it boils (GLP-a 1) substituent (K125R), a pulse band than soft WT, pcDNA3 non-myc - the writing base car the similar peptide which it boils (GLP-a 1) substituent (K117R), the writing base car the similar peptide which it boils (GLP-a 1) substituent (K125R) pcDNA3 non-myc - [khwi with the natural binding is detected as not natural (96 also, lanes 3, 4) [khwi this less. The result of the or more (GLP-a 1) - the writing base car the similar peptide which it boils the natural binding to ubiquitin proteasome [khwi with decomposition at or poly type expense [khwi anger over the system. The writing base car the similar peptide which it boils (GLP-a 1) pcDNA3 non-myc - WT, pcDNA3 non-myc - the writing base car the similar peptide which it boils (GLP-a 1) substituent (K117R), the writing base car the similar peptide which it boils (GLP-a 1) substituent by each micro g (K125R) pcDNA3 non-myc - HEK 293T transfected cells (transfection) with respect to the 2. Transfected 48 hours, protein generation number (CHX) cycloalkyl [...] (Sigma non-Aldrich) (100 micro g/Ml) 2 for processing time, very long periods of time measured half-life time and 8 4, the number has been confirmed that the human the writing base car the similar peptide which it boils and the decomposition of billion (GLP-a 1) (97 also). As a result of half-time while the writing base car the similar peptide which it boils the writing base car the similar peptide which it boils (GLP-a 1) human 2 (GLP-a 1) substituent which human pcDNA3 non-myc - (K117R), pcDNA3 non-myc - the writing base car the similar peptide which it boils of half-life longer than 4 hr or longer WT (GLP-a 1) substituent (K125R) was the result graph (also 97) was compared. The writing base car the similar peptide which it boils and forms a glucose homeostasis (GLP-a 1) is insulin resistance plays an important role since it has been reported that induce current diabetes treatment number in which STAT3 (Biochem Biophys Res Commun. , 425 (2), 304 - 308, 2012). In the embodiment in a cell in the writing base car the similar peptide which it boils and the writing base car the similar peptide which it boils (GLP-a 1) a (GLP-a 1) substituent transmissions by signal transduction has been confirmed. HepG2 cells (ATCC, AB-a 8065) 8 hours after first famishing,, pcDNA3 non-myc - WT (GLP-a 1) the writing base car the similar peptide which it boils, pcDNA3 non-myc - the writing base car the similar peptide which it boils (GLP-a 1) substituent (K117R), pcDNA3 non-myc - 6 by using the writing base car the similar peptide which it boils (GLP-a 1) substituent (K125R) with respect to a cell infected HepG2 micro g respectively. After quantifying each and 2 infection in proteins, intracellular signal transduction identifying the [wey the [su it shook off his intended [...] embodiment. Each pcDNA3 non-myc - 3 mm during the writing base car the similar peptide which it boils (GLP-a 1) WT, pcDNA3 non-myc - the writing base car the similar peptide which it boils (GLP-a 1) substituent (K117R) (GLP-a 1) substituent (K125R) the writing base car the similar peptide which it boils and pcDNA3 non-myc - infected HepG2 cells (polyvinylidene difluoride, PVDF) membrane protein isolated from poly vinyl this flow which is burnt the id next, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - STAT3 (Santa Cruz Biotechnology, sc provided 21876), anti - phospho-a STAT3 (Y705, cell signaling 9131S), and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio [ley comb including blocking solution 1:1000 anti - (goat anti-a rabbit IgG a-HRP, Santa Cruz Biotechnology, sc-a 2004) and anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, pcDNA3 non-myc - the writing base car the similar peptide which it boils (GLP-a 1) substituent is HepG2 (K117R) (ATCC, AB-a 8065) (GLP-a 1) equal to the writing base car the similar peptide which it boils in a cell pcDNA3 non-myc - WT regulated phospho-a STAT3 signal transduction are 10:1 and viscoelasticity (98 also). Example embodiment 15: heavy chain (HC) immunoglobulin (IgG) BIP [khwi anger analysis and half-life increased confirmation The heavy chain (HC) immunoglobulin (IgG) had previously been held at the Roche patent expires Herceptin treatment for breast cancer that the number of rights patent specification (patent number EP1308455 B 9, patent name: A composition comprising anti-a HER2 antibodies, p. 24) Disease codon optimization (codon optimization) reference protein expression in mammalian cells used in the study have a unique DNA sequence after performing the synthesis using EcoRI and XhoI fragments hanhyo factor number made pcDNA3 non-myc (5. 6 Kb) EcoRI and XhoI fragment of joining using cloning it does, (99 also, immunoglobulin (IgG) heavy chain amino acid sequence: SEQ No. 97), Through this process products are number hanhyo small after cutting, agar with [cu gel electrophoretic through signed in objects (also 100). The number is displayed on the display as it became work number to determine if the DNA protein expression of Figure 99 map for present anti - myc pcDNA3 non-myc vector myc (9E 10, Santa Cruz Biotechnology, sc provided 40) [...] expression has been confirmed through the [wey the [su it shook off for using such antibodies. Heavy chain (HC) immunoglobulin (IgG) through coupled to myc protein expressed formate less well, [...] camera into expression vector dose through the loaded up (101 also). When the arginine replaced by lysine residues using site specific mutation induction, certain mutations may derive a DNA primer sequences (IgG HC K235R FP 5 '- ACAAAGGTGGACAGGAAGGTGGAGCCCAAG-a 3' (SEQ No. 98), 'RP 5 provided CTTGGGCTCC ACCTTCCTGTCCACCTTTGT-a 3' (SEQ No. 99); 'IgG HC K344R FP 5 provided GAGTATAAGTGC AGGGTGTCCAATAAGGCCCTGC-a 3' (SEQ No. 100), 'RP 5 provided GCAGGGCCTTATTGGACAC CCTGCACTTATACTC-a 3' (SEQ No. 101); 'IgG HC K431R FP 5 provided CTTTCTGTATAGCAGG CTGACCGTGGATAAGTCC-a 3' (SEQ No. 102), 'RP 5 provided GGACTTATCCACGGTCAGCCTGC TATACAGAAAG-a 3' (SEQ No. 103) After a number work grudge, specific amino acid residues substituted plasmid DNA in PCR performed by certain conditions a small number-gate. PcDNA3-a myc-a IgG HC DNA templates and use, lysine residues (K→R) plasmid DNA (table 15) a smaller number replaced arginine-gate. PcDNA3 non-myc - immunoglobulin (IgG) using a plasmid DNA encoding ubiquitin - HC WT pMT123 provided HA - and with respect to the HEK 293T cell infected. [Khwi anger natural immunoglobulin (IgG) in order to identify the degree of DNA 1 g - HC WT 2 pcDNA3 non-myc - and cavity 24 and is intended to transfect pMT123 provided HA - ubiquitin micro micro g MG132 (number proteasome inhibitors, 5 micro g/Ml) time after a 6 hours after treatment, was immune sedimentation analysis embodiment (102 also). In addition each pcDNA3 non-myc - immunoglobulin (IgG)- HC WT, pcDNA3 non-myc - immunoglobulin (IgG)- HC substituent (K235R), pcDNA3 non-myc - immunoglobulin (IgG)- HC substituent (K344R), pcDNA3 non-myc - immunoglobulin (IgG)- HC substituent using a plasmid DNA encoding ubiquitin (K431R) and pMT123 provided HA - with respect to the HEK 293T cell infected. For immunoglobulin (IgG)- HC WT pcDNA3 non-myc - [khwi anger natural wind, pcDNA3 non-myc - immunoglobulin (IgG)- HC substituent (K235R), pcDNA3 non-myc - immunoglobulin (IgG)- HC substituent (K344R), g 2 - HC (K431R) immunoglobulin (IgG) pcDNA3 non-myc - substituent on each micro cavity 24 and is intended to transfect DNA 1 micro g pMT123 provided HA - ubiquitin immunospecifically embodiment (also 103) was precipitated analysis has been completed. For immune is returned obtained sample dissolution buffer (1% Triton X, 150 mm NaCl, 50 mm Tris a-HCl, pH 8 and 1 mm PMSF (phenylmethanesulfonyl fluoride) cyanuric acid, anti - myc (9E 10, sc provided 40) is mixed with him as during night in 4 °C 1 difference antibodies. 4 °C sinkage body protein A/G beads (Santa Cruz Biotechnology) 2 in time using immune reaction was separated. Then, the-wash 2 buffer was dissolved. 2X SDS sample buffer after 7 minutes in 100 °C immune [...] protein mixed with heated, to separate a SDS-a PAGE his embodiment. (Polyvinylidene difluoride, PVDF) membrane separated protein poly vinyl this flow which is burnt the id next, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - HA (Santa Cruz Biotechnology, sc provided 7392) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio including blocking solution 1:1000 anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, anti - myc (9E 10, sc provided 40) embodiment is returned when tnfrsf, pcDNA3 non-myc - immunoglobulin (IgG)- HC WT [khwi this is natural shapes formed by combination polyubiquitin angry (smear) address [khwi this natural sweet taste (102 also, lanes 3, 4) strongly featured band is detected. In addition, MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 when a processing time is detected more strongly featured type expense [khwi anger etched formation [khwi this increased natural sweet taste (102 also, lane 4) band. In addition pcDNA3 non-myc - immunoglobulin (IgG)- HC substituent of (K431R), a pulse band than soft WT, pcDNA3 non-myc - immunoglobulin (IgG)- HC substituent (K431R) [khwi this is not natural binding is detected as less [khwi with natural (103 also, lane 5). The result of the or more immunoglobulin (IgG)- - HC to the ubiquitin proteasome system through decomposition at or poly type expense [khwi anger. - HC WT pcDNA3 non-myc - immunoglobulin (IgG), immunoglobulin (IgG) pcDNA3 non-myc - - HC substituent (K235R), pcDNA3 non-myc - immunoglobulin (IgG)- HC substituent (K344R), and immunoglobulin (IgG)- HC substituent by each 2 g (K431R) pcDNA3 non-myc - HEK 293T cells transfected 48 hours and micro, protein generation number (CHX) cycloalkyl [...] (Sigma non-Aldrich) (100 micro g/Ml) then processing, time 2, measured half-life time and 8 4 very long periods of time, the number has been confirmed that the decomposition of billion human immunoglobulin (IgG)- HC (104 also). As a result human immunoglobulin (IgG) human immunoglobulin (IgG) while the half-life of 2 hours - HC pcDNA3 non-myc - 4 - HC substituent was the result of half-life longer than the temporal extent (K431R) WT mistletoe graph (104 also). Example embodiment 16: immunoglobulin (IgG) light chain (LC) BIP [khwi anger analysis and half-life increased confirmation The Roche patent (LC) immunoglobulin (IgG) heavy chain was held at the Herceptin treatment for breast cancer that the number of rights expires patent specification (patent number EP1308455 B 9, patent name: A composition comprising anti-a HER2 antibodies, p. 23) Disease refers to protein expression in mammalian cells by the unique DNA sequences used in the study codon performs optimizations have made using EcoRI and XhoI fragments after synthesizing hanhyo factor number pcDNA3 non-myc (5. 6 Kb) EcoRI and XhoI fragment of joining using cloning it does, (105 also, immunoglobulin (IgG) heavy chain amino acid sequence (LC): SEQ No. 104), Through this process products are number hanhyo small after cutting, agar with [cu gel electrophoretic through signed in objects (also 106). The number it became work number to determine if the DNA is protein expression as indicated map of Figure 105 pcDNA3 non-myc vector myc present for anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40) [...] expression has been confirmed through the [wey the [su it shook off for using such antibodies. Through immunoglobulin (IgG) heavy chain (LC) coupled to myc protein expressed well making sure that the camera into expression vector dose through the loaded when the [...] up (107 also). When the arginine replaced by lysine residues using site specific mutation induction, certain mutations may derive a DNA primer sequences (IgG LC K67R FP 5 '- CCTGGCAAGGCCCCAAGGCTGCTGATCTAC-a 3' (SEQ No. 105), 'RP 5 provided GTAGATCAG CAGCCTTGGGGCCTTGCCAGG-a 3' (SEQ No. 106); 'IgG LC K129R FP 5 provided ACAAAGGT GGAGATCAGGAGGACCGTGGCC-a 3' (SEQ No. 107), 'RP 5 provided GGCCACGGTCCTCCTGAT CTCCACCTTTGT-a 3' (SEQ No. 108); 'IgG LC K171R FP 5 provided GCCAAGGTGCAGTGGAGG GTGGATAACGCC-a 3' (SEQ No. 109), 'RP 5 provided GGCGTTATCCACCCTCCACTGCACCTTGG C-a 3' (SEQ No. 110) After a number work grudge, specific amino acid residues substituted plasmid DNA in PCR performed by certain conditions a small number-gate. PcDNA3-a myc-a IgG LC DNA templates and use, arginine lysine residues (K→R) a small number (table 16) plasmid DNA-gate to the annex. PcDNA3 non-myc - immunoglobulin (IgG)- LC WT and using a plasmid DNA encoding ubiquitin pMT123 provided HA - with respect to the HEK 293T cell infected. In order to identify immunoglobulin (IgG)- LC WT 2 pcDNA3 non-myc - [khwi anger natural degree of micro g g cells transfected DNA 1 with respect to the micro cavity and pMT123 provided HA - ubiquitin. After 6 hours the MG132 (number proteasome inhibitors, 5 micro g/Ml) transfected 24 time after processing, immune precipitated analysis was embodiment (also 108). In addition each pcDNA3 non-myc - immunoglobulin (IgG)- LC WT, pcDNA3 non-myc - immunoglobulin (IgG)- LC substituent (K67R), pcDNA3 non-myc - immunoglobulin (IgG)- LC substituent (K129R), pcDNA3 non-myc - immunoglobulin (IgG)- LC substituent using a plasmid DNA encoding ubiquitin (K171R) and pMT123 provided HA - with respect to the HEK 293T cell infected. To make sure that the extent to which conduction [khwi anger natural immunoglobulin (IgG)- LC WT pcDNA3 non-myc -, pcDNA3 non-myc - immunoglobulin (IgG)- LC substituent (K67R), pcDNA3 non-myc - immunoglobulin (IgG)- LC substituent (K129R), immunoglobulin (IgG)- LC substituent on each micro g (K171R) pcDNA3 non-myc - 2 cavity 24 has been completed and is intended to transfect DNA 1 micro g pMT123 provided HA - ubiquitin to an immune precipitated analysis was embodiment (109 also). For immune is returned obtained sample dissolution buffer (1% Triton X, 150 mm NaCl, 50 mm Tris a-HCl, pH 8 and 1 mm PMSF (phenylmethanesulfonyl fluoride) cyanuric acid, anti - myc (9E 10, sc provided 40) is mixed with him as during night in 4 °C 1 difference antibodies. 4 °C sinkage body protein A/G beads (Santa Cruz Biotechnology) 2 in time using immune reaction was separated. Then, the-wash 2 buffer was dissolved. 2X SDS sample buffer after 7 minutes in immune [...] protein mixed with 100 °C after boiling, to separate a SDS-a PAGE his embodiment. (Polyvinylidene difluoride, PVDF) membrane separated protein poly vinyl this flow which is burnt the id next, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40), anti - HA (Santa Cruz Biotechnology, sc provided 7392) and anti - β a-actin (Santa Cruz Biotechnology, sc provided 47778) a the weight ratio including blocking solution 1:1000 anti - mouse (Peroxidase-a labeled antibody to mouse IgG (H + L), KPL, 074 - 1806) ECL system (Western blot detection kit, ABfrontier, Seoul, Korea) antibody 2 difference was the development. As a result, anti - myc (9E 10, Santa Cruz Biotechnology, sc provided 40) embodiment is returned when tnfrsf, pcDNA3 non-myc - immunoglobulin (IgG)- LC WT [khwi this is natural combination polyubiquitin angry by BIP [khwi this address to which band is formed shape appeared strongly featured (108 also, lanes 3, 4). In addition, MG132 (number proteasome inhibitors, 5 micro g/Ml) 6 when a processing time is detected more strongly featured type expense [khwi anger etched formation [khwi this increased natural sweet taste (108 also, lane 4) band. In addition pcDNA3 non-myc - immunoglobulin (IgG)- LC substituent of (K171R), a pulse band than soft WT, pcDNA3 non-myc - immunoglobulin (IgG)- LC substituent (K171R) [khwi this is not natural binding is detected as less [khwi with natural (109 also, lane 5). The result of the or more immunoglobulin (IgG)- LC - ubiquitin proteasome system is at or through decomposition to poly type expense [khwi anger. PcDNA3 non-myc - immunoglobulin (IgG)- LC WT, pcDNA3 non-myc - immunoglobulin (IgG)- LC substituent (K67R), pcDNA3 non-myc - immunoglobulin (IgG)- LC substituent (K129R), immunoglobulin (IgG)- LC substituent by each 2 g (K171R) pcDNA3 non-myc - HEK 293T cells transfected 48 hours and micro, protein generation number (CHX) cycloalkyl [...] (Sigma non-Aldrich) (100 micro g/Ml) 2 for processing time, measured half-life time and 8 4 very long periods of time, the number has been confirmed that the decomposition of billion human immunoglobulin (IgG)- LC (110 also). As a result human immunoglobulin (IgG)- LC 1 hours while the half-life of human immunoglobulin (IgG) pcDNA3 non-myc - longer than 2 hr or longer WT (K171R) - LC substituent of half-life value, the result graph mistletoe (110 also). According to the present invention, (poly) peptides encoded protein or increased half life ball number. The present invention refers to a protein or (poly) peptide may be utilized as a treatment the number relates to search, number about industry may be useful are disclosed. The present invention relates to a method for extending the half-life of protein by including a step of substituting at least one lysine residue existing in an amino acid sequence of protein, or to protein with extended half-life. The lysine residue-substituted protein of the present invention remains in the human body for a long time and has an excellent therapeutic effect. COPYRIGHT KIPO 2018 C - [...] natural appetite in promoting hormone (GHRL) end engaging either of the lysine residue glycine compound is substituted arginine, promoting appetite hormone. According to Claim 1, said sequence number appetite promoting hormone: 83 and its appetite promoting hormone having N - from the distal end 16, 19, and 24 than either of the second position of the lysine residue substituted with arginine, appetite having have an increased half-promoting hormone. Number 1 or number including a cosmetically acceptable excipient according to Claim 2 promoting hormone and about number anti appetite, obesity, nutritional deficiencies, including neurological or [...] preventing use of anorexia nervosa, pharmaceutical compositions for the treatment or prevention therapy. (A) promoter; (b) encoding the appetite [...] bio-sequence listing number 1 anti or according to Claim 2; and an optional linker as a vector including expression, is operatively linked to said promoter and bio-sequence listing compound is, expression vectors. According to Claim 4 expression vector including host cells. Lysine (K) residue site Arginine (R) Lysine (K) is substituted β-a trophin small number water 62 (K62R) pcDNA3-a myc-a β-a trophin 124 (K124R) pcDNA3-a myc-a β-a trophin 153 (K153R) pcDNA3-a myc-a β-a trophin 158 (K158R) pcDNA3-a myc-a β-a trophin Lysine residue (K) Arginine (R) Lysine (K) is substituted with small number GH water 67 PCS4-a flag-a GH (K67R) 141 PCS4-a flag-a GH (K141R) 166 PCS4-a flag-a GH (K166R) Lysine residue (K) Arginine (R) Lysine (K) is substituted with insulin small number water 53 PcDNA3-a myc-a insulin (K53R) 88 PcDNA3-a myc-a insulin (K88R) Lysine residue (K) Arginine (R) Lysine (K) is substituted with small water IFN-a α number 93 PcDNA3-a myc-a IFN-a α (K93R) 106 PcDNA3-a myc-a IFN-a α (K106R) 144 PcDNA3-a myc-a IFN-a α (K144R) 154 PcDNA3-a myc-a IFN-a α (K154R) Lysine residue (K) Arginine (R) Lysine (K) is substituted with small number G-a CSF water 46 PcDNA3-a myc-a G-a CSF (K46R) 73 PcDNA3-a myc-a G-a CSF (K73R) Lysine residue (K) Arginine (R) Lysine (K) is substituted with small water IFN-a β number 40 PcDNA3-a myc-a IFN-a β (K40R) 126 PcDNA3-a myc-a IFN-a β (K126R) 155 PcDNA3-a myc-a IFN-a β (K155R) Lysine residue (K) Arginine (R) Lysine (K) is substituted with small number EPO water 124 (K124R) pcDNA3-a myc-a EPO 167 (K167R) pcDNA3-a myc-a EPO 179 (K179R) pcDNA3-a myc-a EPO 181 (K181R) pcDNA3-a myc-a EPO Lysine residue (K) Arginine (R) Lysine (K) is substituted with small number BMP2 water 293 (K293R) pcDNA3-a myc-a BMP2 297 (K297R) pcDNA3-a myc-a BMP2 355 (K355R) pcDNA3-a myc-a BMP2 383 (K383R) pcDNA3-a myc-a BMP2 Lysine residue (K) Arginine (R) Lysine (K) is substituted with small number FGF-a 1 water 27 PCMV3 provided C-a myc-a FGF-a 1 (K27R) 120 PCMV3 provided C-a myc-a FGF-a 1 (K120R) Lysine residue (K) Arginine (R) Lysine (K) is substituted with small number Leptin water 26 PCMV3 provided C-a myc-a Leptin (K26R) 32 PCMV3 provided C-a myc-a Leptin (K32R) 36 PCMV3 provided C-a myc-a Leptin (K36R) 74 PCMV3 provided C-a myc-a Leptin (K74R) Lysine residue (K) Arginine (R) Lysine (K) is substituted with small number VEGFA water 127 PCMV3 provided C-a myc-a VEGFA (K127R) 180 PCMV3 provided C-a myc-a VEGFA (K180R) Lysine residue (K) Ghrelin Arginine (R) Lysine (K) is substituted with small number water 100 PCMV3 provided C-a myc-a prepro-a GHRL (K100R) Lysine residue (K) Ghrelin Arginine (R) Lysine (K) is substituted with small number water 39 PcDNA3-a myc-a Ghrelin (K39R) 42 PcDNA3-a myc-a Ghrelin (K42R) 43 PcDNA3-a myc-a Ghrelin (K43R) 47 PcDNA3-a myc-a Ghrelin (K47R) Lysine residue (K) Arginine (R) Lysine (K) is substituted with small number GLP-a 1 water 117 (K117R) pcDNA3-a myc-a GLP-a 1 125 (K125R) pcDNA3-a myc-a GLP-a 1 Lysine residue (K) Arginine (R) Lysine (K) is substituted with small number IgG HC water 235 (K235R) pcDNA3-a myc-a IgG HC 344 (K344R) pcDNA3-a myc-a IgG HC 431 (K431R) pcDNA3-a myc-a IgG HC Lysine residue (K) Arginine (R) Lysine (K) is substituted with small number IgG LC water 67 (K67R) pcDNA3-a myc-a IgG LC 129 (K129R) pcDNA3-a myc-a IgG LC 171 (K171R) pcDNA3-a myc-a IgG LC
