DUAL TARGETING ANTISENSE OLIGONUCLEOTIDES AS APOPTOTIC INHIBTOR THERAPEUTIC COMPOSTIONS AND METHODS FOR THEIR USE IN THE TREATMENT OF CANCER
This application claims the benefit of U.S. Provisional Patent Application Ser. No. 62/193,568 filed on 16 Jul. 2015, entitled “DUAL TARGETING ANTISENSE OLIGONUCLEOTIDES AS APOPTOTIC INHIBITOR THERAPEUTIC COMPOSTIONS AND METHODS FOR THEIR USE IN THE TREATMENT OF CANCER”, which application is incorporated by reference herein in its entirety. The present invention provides compounds, compositions and methods for modulating the expression of human Inhibitors of Apoptosis (IAPs). In particular, this invention relates to dual-targeting antisense oligonucleotides (dASOs) capable of modulating human BIRC6 and cIAP1 or survivin mRNA expression, and their uses and methods for the treatment of various indications, including various cancers. In particular the invention relates to therapies and methods of treatment for cancers such as prostate cancer, including castration-resistant prostate cancer (CRPC). Prostate cancer is the most common non-cutaneous cancer and the second leading cause of cancer-related deaths for males in the Western world (Siegel R, et al., 2012, 62(1):10-29). Prostate cancers are initially androgen-dependent, and while androgen deprivation therapy (ADT) can induce marked tumor regression, resistance to ADT inevitably emerges, leading to castration-resistant prostate cancer (CRPC). The current standard care for treating CRPC is systemic, docetaxel-based chemotherapy, increasing the overall survival of patients by about 2 months compared to mitoxantrone-based therapy (Petrylak D P, et al., N Engl J Med. 2004; 351(15):1513-1520; Tannock I F, et al., N Engl J Med. 2004; 351(15):1502-1512). Recently, sipuleucel-T, cabazitaxel, abiraterone, MDV3100 and Radium-223 have shown more prolonged overall survival benefit and are approved by the FDA for treatment of the disease (Bishr M and Saad F., Nat Rev Urol. 2013; 10(9):522-528). However, none of these drugs are curative; they incrementally improve overall survival. The establishment of more effective therapeutic targets and drugs, specifically those targeting the molecular drivers of metastatic CRPC, is of critical importance for improved disease management and patient survival (Lin D, et al., Curr Opin Urol. 2013; 23(3):214-219). Apoptosis, a cell death-inducing process important in the regulation of cell numbers in normal tissues, can be triggered by a variety of death signals from both extracellular and intracellular origins, and involves activation of caspases (intracellular cysteine proteases) that mediate the execution of apoptosis (Hensley P, et al., Biol Chem. 2013; 394(7):831-843). Human cancers are characterized by resistance to apoptosis, intrinsic or acquired, considered to be a key factor underlying resistance to therapeutic intervention, and promising new strategies have been developed based on drug-induced apoptosis (Gleave M, et al., Cancer Chemother Pharmacol. 2005; 56 Suppl 1:47-57). The treatment resistance of CRPC is thought to be based on an increased resistance to apoptosis by the prostate cancer cells and may be addressed by targeting anti-apoptotic genes and their products (Zielinski R R, et al., Cancer J. 2013; 19(1):79-89). The Inhibitors of Apoptosis (IAP) form a family of functionally and structurally related proteins that have a major role in cell death regulation. They act as endogenous apoptosis inhibitors by binding to caspases, thereby suppressing apoptosis initiation. The human IAP family consists of 8 members that are characterized by the presence of 1 to 3 baculovirus inhibitor of apoptosis repeat (BIR) motifs that are involved in the binding of IAPs to caspases. There is increasing evidence that IAPs also affect other cellular processes, such as ubiquitin-dependent signalling events that activate nuclear factor κB (NFκB) transcription factors, which in turn drive the expression of genes important in cellular processes such as cell survival (Gyrd-Hansen M and Meier P. Nat Rev Cancer. 2010; 10(8):561-574). Due to their ability to control cell death and elevated expression in a variety of cancer cell types, IAP proteins are attractive targets for the development of novel anti-cancer treatments (de Almagro M C and Vucic D. Exp Oncol. 2012; 34(3):200-211). Four IAP members, i.e. XIAP, survivin, cIAP1 and cIAP2, have been reported to be up-regulated in prostate cancer (Krajewska M, et al., Clin Cancer Res. 2003; 9(13):4914-4925). Survivin in particular is promising as a potential therapeutic target for the disease (Rodriguez L, et al., Biochem Pharmacol. 2013; 86(11):1541-1554 Carrasco R A, et al., Mol Cancer Ther. 2011; 10(2):221-232). The BIRC6 gene (BRUCE/APOLLON) encodes a 528 kDa protein in mammals, consisting of a single N-terminal BIR domain and a C-terminal ubiquitin-conjugating (UBC) domain; the latter has chimeric E2/E3 ubiquitin ligase activity as well as anti-apoptotic activity (Bartke T, et al., Mol Cell. 2004; 14(0:801-811). Through its BIR domain, BIRC6 protein can bind to active caspases, including caspases-3, 6, 7 and 9 and such interactions have been shown to underlie its ability to inhibit the caspase cascade and ultimately apoptosis (Bartke T, et al., Mol Cell. 2004; 14(6):801-811). Through its UBC domain, BIRC6 facilitates proteasomal degradation of pro-apoptotic proteins, including caspase-9 (Hao Y, et al., Nat Cell Biol. 2004; 6(9):849-860), SMAC/DIABLO (Hao Y, et al., Nat Cell Biol. 2004; 6(9):849-860; Qiu X B and Goldberg A L. J Biol Chem. 2005; 280(1):174-182), and HTRA2/OMI (Bartke T, et al., Mol Cell. 2004; 14(6):801-811; Sekine K, et al., Biochem Biophys Res Commun. 2005; 330(1):279-285). Elevated expression of BIRC6 has been found in a variety of cancers, i.e. childhood de novo acute myeloid leukemia (Sung K W, et al., Clin Cancer Res. 2007; 13(17):5109-5114), colorectal cancer (Bianchini M, et al., Int J Oncol. 2006; 29(1):83-94), neuroblastoma (Bartke T, et al., Mol Cell. 2004; 14(6):801-811; Lamers F, et al., BMC Cancer. 2012; 12:285), melanoma (Tassi E, et al., Clin Cancer Res. 2012; 18(12):3316-3327) and non-small cell lung cancer (Dong X, et al., J Thorac Oncol. 2013; 8(2):161-170). Furthermore, BIRC6 has been implicated in maintaining resistance against cell death stimuli [Chen Z, et al., Biochem Biophys Res Commun. 1999; 264(3):847-854; Chu L, et al., Gene Ther. 2008; 15(7):484-494). In contrast to other IAPs, BIRC6 has been shown to have a cytoprotective role, essential for survival of mammalian cells (Hao Y, et al., Nat Cell Biol. 2004; 6(9):849-860; Qiu X B, et al., EMBO J. 2004; 23(4):800-810). BIRC6 is also known for its essential role in regulating cytokinesis, a final event of cell division (Pohl C and Jentsch S. Cell. 2008; 132(5):832-845). The dual roles of BIRC6 in cell death and division processes resemble those of survivin, and render it a promising target for therapy of a variety of cancers (Martin S J. Nat Cell Biol. 2004; 6(9):804-806). Therapeutic options for castration resistant prostate cancer (CRPC) treatment have changed considerably with the recent FDA approvals of newer agents that improve patient survival. In particular, Enzalutamide (ENZ), a second generation androgen receptor antagonist approved for treating metastatic CRPC in post-docetaxel and more recently, pre-docetaxel setting. However, within 2 years of clinical practice, development of ENZ resistance was evident in majority of patients (Claessens et al. 2014) and no known therapies were shown to be effective to ENZ-resistant CRPC to-date. Thus, a novel therapeutic agent that can effectively suppress ENZ-resistant CRPC would be useful. The present invention is based in part on the discovery that the inhibition of BIRC6 expression and the inhibition of cIAP1 expression with dual-targeting antisense oligonucleotide (dASO) 6w2 (5′-CTGCAGCATCATGTGGACT-′3—SEQ ID NO:1) may be useful in the treatment of cancer. Similarly, the invention is also based in part of the discovery that the inhibition of BIRC6 expression and the inhibition of suvivin expression with dASO 6w5 (5′-CAGGTGAAACACTGGGACA-′3—SEQ ID NO:2) may be useful in the treatment of cancer. The combined inhibition of BIRC6 expression with the inhibition of cIAP1 expression or combined inhibition of BIRC6 expression with the inhibition of survivin expression leads to reduced proliferation of cancer cells. Furthermore, that reduction in proliferation extends to castration-resistant prostate cancer (CRPC). In a first aspect, a composition is provided a method for the treatment of a cancer cell, the method including administering an oligonucleotide of SEQ ID NO:1 or SEQ ID NO:2 to the cell. In a further aspect, there is provided a method including administering a dual-targeting antisense oligonucleotides (dASO) of SEQ ID NO:1 or SEQ ID NO:2. In a further aspect, there is provided a dual-targeting antisense oligonucleotide (dASO), wherein the oligonucleotide has a sequence selected from the following: (a) CTGCAGCATC ATGTGGACT (SEQ ID NO: 1); and (b) CAGGTGAAAC ACTGGGACA (SEQ ID NO: 2). In a further aspect, there is provided a dual-targeting antisense oligonucleotide (dASO) of SEQ ID NO:1 or SEQ ID NO:2 for use in the treatment of cancer. In a further aspect, there is provided a dual-targeting antisense oligonucleotide (dASO) of SEQ ID NO:1 or SEQ ID NO:2 for inhibiting expression of one of more of BIRC6 and cIAP1 or survivin. In a further aspect, there is provided a pharmaceutical composition, the composition including (a) dual-targeting antisense oligonucleotide (dASO) of SEQ ID NO:1 or SEQ ID NO:2; and (b) a pharmaceutically acceptable carrier. In a further aspect, there is provided a use of a dASO of SEQ ID NO:1 or SEQ ID NO:2 in the preparation of a medicament for the treatment of cancer. In a further aspect, there is provided a use of a dASO of SEQ ID NO:1 or SEQ ID NO:2 in the preparation of a medicament for inhibiting expression of one of more of BIRC6 and cIAP1 or survivin. In a further aspect, there is provided a use of a dASO) of SEQ ID NO:1 or SEQ ID NO:2 for the treatment of cancer. In a further aspect, there is provided a use of a dASO of SEQ ID NO:1 or SEQ ID NO:2 for inhibiting expression of one of more of BIRC6 and cIAP1 or survivin. In accordance with a further aspect, there is provided a commercial package including (a) an antisense oligonucleotide sequence described herein and a pharmaceutically acceptable carrier; and (b) instructions for the use thereof for modulating IAP activity. In a further aspect, there is provided a commercial package, including: (a) dASO of SEQ ID NO:1 or SEQ ID NO:2; and (b) instructions for the treatment of cancer. In accordance with a further aspect, there is provided a method for modulating IAP activity, the method comprising administering a dual-targeting antisense oligonucleotides (dASO) of SEQ ID NO:1 or SEQ ID NO:2 and a pharmaceutically acceptable carrier; and (b) instructions for the use thereof. In accordance with a further aspect, there is provided a method for modulating IAP activity in a cell, the method comprising administering a dual-targeting antisense oligonucleotides (dASO) of SEQ ID NO:1 or SEQ ID NO:2 to the cell. In accordance with a further aspect, there is provided a use of a dual-targeting antisense oligonucleotides (dASO) of SEQ ID NO:1 or SEQ ID NO:2 for modulating IAP activity. In accordance with a further aspect, there is provided a use of a dual-targeting antisense oligonucleotides (dASO) of SEQ ID NO:1 or SEQ ID NO:2 in the manufacture of a medicament for modulating IAP activity. The dASO may further include a modified internucleoside linkage. The modified internucleoside linkage may be a peptide-nucleic acid linkage, a morpholino linkage, a N3′ to P5′ phosphoramidate linkage, a methylphosphonate linkage or a phosphorothioate linkage. The dASO may further include a modified sugar moiety. The modified sugar moiety may be a 2′-O-alkyl oligoribonucleotide. The dASO may further have a 2′MOE gapmer modification. The dASO may further include a modified nucleobase. The modified nucleobase may be a 5-methyl pyrimidine or a 5-propynyl pyrimidine. The cell may be a human cell. The the cancer may be characterized by elevated expression of one of more of BIRC6 and cIAP1 or survivin. The cancer may be selected from one or more of the following: prostate cancer; childhood de novo acute myeloid leukemia; colorectal cancer; neuroblastoma; melanoma; and non-small cell lung cancer. The prostate cancer may be castration-resistant prostate cancer (CRPC). The prostate cancer may be enzalutamide (ENZ) resistant CRPC. The dASO may be substantially complementary to the mRNA of BIRC6 and cIAP1. The dASO may be administered intravenously. The dASO may be topically administered to a tissue. The dASO may be mixed with lipid particles prior to administration. The dASO may be encapsulated in liposomes prior to administration. Any terms not directly defined herein shall be understood to have the meanings commonly associated with them as understood within the present field of art. Certain terms are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner in describing the compositions, devices, methods and the like of embodiments, and how to make or use them. It will be appreciated that the same thing may be said in more than one way. Consequently, alternative language and synonyms may be used for any one or more of the terms discussed herein. No significance is to be placed upon whether or not a term is elaborated or discussed herein. Some synonyms or substitutable methods, materials and the like are provided. Recital of one or a few synonyms or equivalents does not exclude use of other synonyms or equivalents, unless it is explicitly stated. Use of examples in the specification, including examples of terms, is for illustrative purposes only and does not limit the scope and meaning of the embodiments described herein. A method is provided for “treating” a cancer cell, wherein treating is meant to encompass preventing proliferation of the cell, ameliorating symptoms associated with the cancer, and eradicating the cancer cell. The term “treating” as used herein is also meant to include the administration at any stage of the cancer, including early administration of a compound or late administration. A person of skill in the art would appreciate that the term “ameliorating” is meant to include the prospect of making a cancer more tolerable for a subject afflicted therewith (for example, by reducing tumour load). A person of skill in the art would also appreciate that the term “eradication” with regards to cancer would include elimination of the cancer cells in whole or in part from a subject. Accordingly, as used herein “treatment” may refer to the prevention of cancer cell proliferation in a subject, the amelioration of symptoms associated with the cancer, the eradication of the cancer from a subject, or combinations thereof. Antisense oligonucleotide compounds are typically single stranded RNA compounds which bind to complementary RNA compounds, such as target mRNA molecules, and block translation from the complementary RNA compounds by sterically interfering with the normal translational machinery. This process is usually passive, in that it does not require or involve additional enzymes to mediate the RNA interference process. Specific targeting of antisense RNA compounds to inhibit the expression of a desired gene may generally involve designing the antisense RNA compound to have a homologous, complementary sequence to the desired gene. Perfect homology is not necessary for the RNA interference effect. In one embodiment of the invention, the antisense RNA compounds include any RNA compound with sufficient complementary homology to bind to the BIRC6 mRNA transcript and the cIAP1 transcript causing a reduction in translation of the BIRC6 and cIAP1 proteins. In another embodiment of the invention, the antisense RNA compounds include any RNA compound with sufficient complementary homology to bind to the BIRC6 mRNA transcript and the survivin transcript causing a reduction in translation of the BIRC6 and survivin proteins. The antisense compounds be modified to enhance the stability of the oligonucleotides, particularly for in vivo use. Numerous examples of methods for designing and optimizing antisense RNA compounds are found in the journal literature—i.e. (Pan and Clawson 2006; Patzel 2007; Peek and Behlke 2007). Perfect sequence complementarity is not necessary for the antisense compound to modulate expression of the target gene. The present inventors provide non-limiting examples of antisense compounds which modulate the expression of BIRC6, cIAP1 and survivin. Antisense oligonucleotide sequences as described herein or for use as described herein may be administered by means of a medical device or appliance such as an implant, graft, prosthesis, stent, etc. Also, implants may be devised which are intended to contain and release such compounds or compositions. An example would be an implant made of a polymeric material adapted to release the compound over a period of time. Dual-targeting antisense oligonucleotides (dASOs) that simultaneously target BIRC6 and another co-upregulated IAP member are provided herein. Encompassed herein, is the use of dASOs 6w2 and 6w5 for administration to a cell. The 6w2 and 6w5 dASOs as used in the examples had a modified internucleoside linkages. In particular, the dASOs had phosphorothioate linkages between all nucleosides. 6w2 may have combined inhibition of BIRC6 expression and cIAP1 expression. 6w2 and 6w5 are both 19-mer oligonucleotides with modified phosphorothioate linkages. However, variations of 6w2 and 6w5 may also have unmodified phosphodiester linkages or partially modified linkages (i.e. any integer between 1 and 18 phosphorothioate linkage(s) or other modified linkages). Alternative modifications are also known in the art. A phosphorothioate oligonucleotide bond modification alters the phosphate linkage by replacing one of the non-bridging oxygens with sulfur. The introduction of phosphorothioate linkages alters the chemical properties of the oligonucleotide. In particular, the addition of phosphorothioate linkages reduces nuclease degradation of the oligonucleotide and thereby increasing the half-life in situ. Accordingly, this modification is particularly useful for antisense oligonucleotides, which when introduced into cells or biological matrices can interact with target nucleic acids to silence the expression of a particular transcript. Oligonucleotides containing phosphorothioate linkages accomplish this feat either through direct blockage of translation or enable enzymatic degradation of the target transcript (for example, via RNase H). Although phosphorothioate linkages provide improved half-life, the introduction of these linkages into an oligonucleotide may also introduce limitations to their function as antisense oligonucleotides. Each phosphorothioate linkage creates a chiral center at each bond, which may result in multiple isomers of the oligonucleotide generated during synthesis and the isomers may have differential characteristics and functional properties. However much of the isomer effects may be mitigated through careful positioning of the modifications or by using additional modifications in conjunction with the phosphorothioate bonds. One or more of the phosphorothiodiester linkages of the oligonucleotide moiety may be modified by replacing one or both of the two bridging oxygen atoms of the linkage with analogues such as —NH, —CH2, or —S. Other oxygen analogues known in the art may also be used. A “modified oligonucleotide” as used herein is meant to include oligonucleotides that are substituted or modified. In addition to the naturally occurring primary bases adenine, guanine, cytosine, and thymine, or other natural bases such as inosine, deoxyinosine, and hypoxanthine, there are numerous other modifications. For example, isosteric purine 2′deoxy-furanoside analogues, 2′-deoxynebularine or 2′deoxyxanthosine, or other purine and pyrimidine analogues such as 5-methyl pyrimidine or a 5-propynyl pyrimidine may also be utilized to improve stability and target hybridization. A “modified sugar” as used herein when discussing an oligonucleotide moiety, a sugar modified or replaced so as to be ribose, glucose, sucrose, or galactose, or any other sugar. Alternatively, the oligonucleotide may have one or more of its sugars substituted or modified in its 2′ position, i.e. 2′alkyl or 2′-0-alkyl. An example of a 2′-O-allyl sugar is a 2′-O-methylribonucleotide. Furthermore, the oligonucleotide may have one or more of its sugars substituted or modified to form an α-anomeric sugar. “Second-generation” oligonucleotides as used herein mat be defined as oligonucleotides that are resistant to degradation by cellular nucleases and capable of hybridizing specifically to their target mRNA with equal or higher affinity than first generation ASOs. An example of a 2ndgeneration ASO is a 2′-O-(2-Methoxyethyl)-RNA (2′MOE gapmer modification). With a 2′-MOE gapmer the 5′ and 3′ ends may have 2′-MOE modified nucleotides to protect against degradation, but the gap between the 5′ and 3′ ends may be unmodified phosphodiester linkages. Numerous other chemical modifications have been developed to improve ASOs. For example, morpholino, N3′ to P5′ phosphoramidate, and methylphosphonate chemical modifications are known in the art (N. Dias, and C. A. Stein 2002). Furthermore, peptide nucleic acids (PNAs) may also be used. The percent matching to primary and secondary targets are shown below in TABLE A. The compounds, as described herein, may be in isolation, or may be linked to or in combination with tracer compounds, liposomes, carbohydrate carriers, polymeric carriers or other agents or excipients as will be apparent to one of skill in the art. In alternate embodiments, such compounds may further comprise an additional medicament, wherein such compounds may be present in a pharmacologically effective amount. The term “medicament” as used herein refers to a composition that may be administered to a patient or test subject and is capable of producing an effect in the patient or test subject. The effect may be chemical, biological or physical, and the patient or test subject may be human, or a non-human animal, such as a rodent (for example, a transgenic mouse, a mouse or a rat), dog, cat, cow, sheep, horse, hamster, guinea pig, rabbit or pig. The medicament may be comprised of the effective chemical entity alone or in combination with a pharmaceutically acceptable excipient. The term “pharmaceutically acceptable excipient” may include any and all solvents, dispersion media, coatings, antibacterial, antimicrobial or antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. An excipient may be suitable for intravenous, intraperitoneal, intramuscular, subcutaneous, intrathecal, topical or oral administration. An excipient may include sterile aqueous solutions or dispersions for extemporaneous preparation of sterile injectable solutions or dispersion. Use of such media for preparation of medicaments is known in the art. Compositions or compounds according to some embodiments described herein may be administered in any of a variety of known routes. Examples of methods that may be suitable for the administration of a compound include orally, intravenous, inhalation, intramuscular, subcutaneous, topical, intraperitoneal, intra-rectal or intra-vaginal suppository, sublingual, and the like. The compounds described herein may be administered as a sterile aqueous solution, or may be administered in a fat-soluble excipient, or in another solution, suspension, patch, tablet or paste format as is appropriate. A composition comprising the compounds described herein may be formulated for administration by inhalation. For instance, a compound may be combined with an excipient to allow dispersion in an aerosol. Examples of inhalation formulations will be known to those skilled in the art. Other agents may be included in combination with the compounds described herein to aid uptake or metabolism, or delay dispersion within the host, such as in a controlled-release formulation. Examples of controlled release formulations will be known to those of skill in the art, and may include microencapsulation, embolism within a carbohydrate or polymer matrix, and the like. Other methods known in the art for making formulations are found in, for example, “Remington's Pharmaceutical Sciences”, (19th edition), ed. A. Gennaro, 1995, Mack Publishing Company, Easton, Pa. The dosage of the compositions or compounds of some embodiments described herein may vary depending on the route of administration (oral, intravenous, inhalation, or the like) and the form in which the composition or compound is administered (solution, controlled release or the like). Determination of appropriate dosages is within the ability of one of skill in the art. As used herein, an “effective amount”, a “therapeutically effective amount”, or a “pharmacologically effective amount” of a compound refers to an amount of the dASO 6w2 present in such a concentration to result in a therapeutic level of the compound delivered over the term that the compound is used. This may be dependent on the mode of delivery, time period of the dosage, age, weight, general health, sex and diet of the subject receiving the compound. Methods of determining effective amounts are known in the art. It is understood that it could be potentially beneficial to restrict delivery of the compounds described herein to the target tissue or cell in which inhibition of BIRC6 expression and/or the inhibition of cIAP1 expression is desired. It is also understood that it may be desirable to target the compounds described herein to a desired tissue or cell type. The compounds described herein may thus be coupled to a targeting moiety. The compounds may be coupled to a cell uptake moiety. The targeting moiety may also function as the cell uptake moiety. In general, antisense oligonucleotides as described herein may be used without causing substantial toxicity. Toxicity of the compounds as described herein can be determined using standard techniques, for example, by testing in cell cultures or experimental animals and determining the therapeutic index, i.e., the ratio between the LD50 (the dose lethal to 50% of the population) and the LD100 (the dose lethal to 100% of the population). In some circumstances however, such as in severe disease conditions, it may be appropriate to administer substantial excesses of the compositions. Some antisense oligonucleotides as described herein may be toxic at some concentrations. Titration studies may be used to determine toxic and non toxic concentrations. Toxicity may be evaluated by examining a particular antisense oligonucleotide's specificity across cell lines. Animal studies may be used to provide an indication if the compound has any effects on other tissues. In some embodiments, antisense oligonucleotides as described herein may be used, for example, and without limitation, in combination with other treatment methods for at least one indication selected from malignancies in which elevated expression of BIRC6, cIAP1 or survivin is observed. These include, but are not limited to, prostate cancer, childhood de novo acute myeloid leukemia, colorectal cancer, neuroblastoma, melanoma, and non-small cell lung cancer in mammals, including humans. For example, antisense oligonucleotides and may be used as neoadjuvant (prior), adjunctive (during), and/or adjuvant (after) therapy with surgery, radiation (brachytherapy or external beam), or other therapies (eg. HIFU). The following methods and materials were employed with respect to the EXAMPLES described herein. Cell Lines PC-3 human prostate cancer cell lines were obtained from the American Type Culture Collection (1991, ATCC). C4-2 cells were kindly provided by Dr. L. W. K. Chung (1992, MD Anderson Cancer Center, Houston, Tx). They were maintained as monolayer cultures in RPMI-1640 (Gibco BRL™, Gaithersburg, Md.) supplemented with 10% fetal bovine serum (FBS). Prior to usage, cells were determined to be Tissue Microarray (TMA) Construction and Immunohistochemistry (IHC) Prostate specimens (60 benign prostate samples, 137 primary tumors with no lymph node metastasis, 30 primary tumors with lymph node metastasis, 65 neo-adjuvant treated primary tumors, 67 CRPCs) were obtained from the Vancouver Prostate Centre Tissue Bank following written informed patients' consent and institutional study approval. All samples had been obtained through radical prostatectomy except the CRPC samples that were obtained through transurethral resection of prostate (TURP). TMAs were constructed as previously described (Thomas C, et al., Molecular cancer therapeutics. 2011; 10(2):347-359). Immunohistochemical staining using rabbit polyclonal antibody against BIRC6, rabbit monoclonal antibody against Survivin, monoclonal antibody against cIAP1 and rabbit polyclonal antibody against XIAP was conducted using a Ventana autostainer (model Discover XT™; Ventana Medical Systems™, Tucson, Ariz.) with an enzyme-labelled biotin-streptavidin system and a solvent-resistant DAB Map kit (Ventana™). Descriptively, 0 represents no staining by any tumor cells, 1 represents a faint or focal, questionably present stain, 2 represents a stain of convincing intensity in a minority of cells and 3 a stain of convincing intensity in a majority of cells. Dual IAP-Targeting ASO Design and Validation Dual IAP-targeting ASOs (dASOs) were designed as 20-mers with perfect complementary matches to BIRC6 mRNA sections and containing no more than 3 base mismatches to the second target mRNA (i.e. cIAP1 or survivin). Sequence alignment to each pair of targeted genes was performed using Clustalw (http://www.genome.jp/tools/clustalw/) and BLAST 2 Sequence in NCBI (http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi) to identify sequences with highest complementarities. ASOs with full phosphorothioate-modified backbone were designed. The dASO knock-down efficacy of six designed dASOs was tested by determining target protein expression 48 hours after transfection using Western blot analysis. Two dASO candidates (6w2 and 6w5) were selected for further studies: dASO 6w2 (SEQ ID NO:1 5′CTGCAGCATCATGTGGACT) and dASO 6w5 (SEQ ID NO:2 5′CAGGTGAAACACTGGGACA). Non-targeting control ASOs: Scramble (Scrb) B control (SEQ ID NO:3 5′CCTTCCCTGAAGGTTCCTCC), and mismatched (MM) control (SEQ ID NO:4 5′CAGCAGCAGAGTATTTATCAT). Further information on dASO targeting regions and presence of mismatches to target mRNA are shown in TABLE A. A person of skill in the art based on the general knowledge in the art and the information provided herein would be able to synthesize the dual-targeting ASOs described herein or modify the dASOs described herein. siRNA and ASO Transfections Small interfering RNAs (siRNAs) targeting cIAP1 (si-cIAP1, siGENOME SMARTpool™ human BIRC2), survivin (si-Surv, siGENOME SMARTpool™ human BIRC5), BIRC6 [si-BIRC6, 5′-GUU-UCA-AAG-CAG-GAU-GAU-G-dTdT-3′] (Ren J, et al., Proc Natl Acad Sci USA. 2005; 102(3):565-570) and negative control (siCtrl) siRNAs were purchased from Dharmacon™ (Cat #M-004390-02-0005, M-003459-03-0005 and D001810-10-05, Chicago, Ill.). Cells were transfected with siRNA (2 nM for si-survivin and si-cIAP1, 10 nM for si-BIRC6) or ASO (100-200 nM) for 72 hours using oligofectamin reagent (Invitrogen™) following the manufacturer's instructions. Western Blotting Cell lysates were prepared using cell lysis buffer (1% NP-40, 0.5% sodium deoxycholic acid) supplemented with a protease inhibitor cocktail (Roche™, Nutley, N.J.). For detection of BIRC6 (528 kDa), 10 μg whole cell lysate was resolved in 5% SDS-polyacrylamide gel and electrotransferred to a PVDF membrane in tris (25 mM), glycine (191.5 mM), methanol (10%), SDS (0.05%) buffer at 40V overnight at 4° C. Membranes were probed with anti-BIRC6 antibody at room temperature for 2.5 hours. For detection of cIAP1 and survivin, lysate was resolved in 10% and 15% SDS-polyacrylamide gel, respectively, and electro-transferred to a PVDF membrane in tris (25 mM), glycine (191.5 mM), methanol (10%) buffer at 100V for 1 hour. Membranes were probed with anti-cIAP1 and anti-survivin antibodies at room temperature for 2.5 hours. Actin or vinculin were used as loading controls and detected on membranes using rabbit anti-actin polyclonal antibody or mouse anti-vinculin antibody. Annexin V Assay Apoptosis was detected by fluorescence-activated cell sorter (FACS) analysis with annexin-V conjugated with fluorescein isothiocyanate (Annexin-V-FITC) (Invitrogen™) and propidium iodide (PI) staining following the manufacturer's protocol as previously described (Low C G et al., PLoS One. 2013; 8(2):e55837). Early apoptotic cells were identified as Annexin-V positive, PI negative. Data are presented as means±SD of triplicate experiments. MTS Cell Viability Assay C4-2 cells (1×105) or PC-3 cells (2.5×104) were seeded onto 12-well or 24-well culture plates and transfected the next day. MTS (Promega™, Madison, Mich.) was added to wells at 0, 48, 72 and 96 hours after transfection and incubated for 2 hours at 37° C. Aliquots (100 μl) of the culture medium were transferred to a 96-well plate for measuring absorbance at OD490. Triplicate wells were tested per assay and each experiment was repeated twice. Cell Proliferation Assay PC-3 cells (5×104) were seeded onto 12-well plates and transfected with ASOs the next day. Cell numbers were counted at 0, 48, 72, 96 hours after transfection using a TC10™ Automated Cell Counter (Bio-rad Laboratories™, Inc, Berkeley, Calif.). Triplicate wells were tested per assay and the experiment was repeated twice. Results are presented as percentage of untreated control values, mean±S.D. Cell Cycle Analysis Cell cycle distribution was determined by flow cytometry of PI-stained cells as previously described (Low C G et al., PLoS One. 2013; 8(2):e55837). Cells were fixed at 72 hours after transfection. The proportion of cells in G1, S, and G2-M phases of the cell cycle was determined using a FlowJo Program™ (TreeStar Inc™, Ashland, Oreg.). 4,6-Diamidino-2-phenylindole (DAPI) staining PC-3 cells were seeded on cover slips in 12 well-plates and transfected with ASO the next day. After 72 hours of transfection, cells were washed twice with PBS and slides were mounted using VECTASHIELD™ Mounting Medium with DAPI™ (Vector Laboratories™, CA). Cell morphology was examined under a fluorescent microscope (Carl Zeiss™, Germany). Cells exhibiting fragmented nuclear bodies were considered to be undergoing apoptosis. A total of 500 cells were counted in five randomly selected fields per sample using a magnification of 400×. Dual Luciferase Reporter Assay PC-3 cells (7×103) were seeded onto 96-well plates and co-transfected the next day with 0.05 μg pGL4.32 [luc2P/NF-kB-RE/Hygro] (#E849A, Promega Corp.™, Madison, Wis.), 1 ng pRL-CMV ( Animal Studies PC-3 cells (1×106) were mixed with matrigel and inoculated subcutaneously in both flanks of 6- to 8-weeks-old NOD-SCID mice under isoflurane anesthesia. When tumors reached a volume of 50-70 mm3, mice were randomized into 3 groups (n=12 tumors per group), control ASO, dASO 6w2 and dASO 6w5. The ASOs were administrated to the mice by intraperitoneal injection once daily for 15 consecutive days at a dose of 10 mg/kg. Tumor volume was measured on day 0 and on day 15, the last day of treatment, using the formula: volume=(width)2×length/2. Mice were euthanized on day 15 and tumors fixed for immunohistochemical staining. Percentage of tumor growth represents the change in tumor volume measured on days 1 and 15. Viable tumor volume refers to total tumor volume×(100%−% of necrotic area), where % of necrotic area was determined by microscopic examination of H&E stained sections. Scoring of BIRC6 was determined on a four-point scale as mentioned above. Ki-67 positive cells were counted in 6-8 randomly selected fields (40× magnification) and results are presented as percentage of cells with Ki-67 positive nuclei compared to the total number of cells. Statistical analyses Comparisons of two groups were made using the Student t test. Analyses of correlation between IAP members were performed using a Spearman non-parametric test. Analyses of correlation between BIRC6 expression trend and various prognostic factors were carried out using the Chi square test for trend. Statistical analyses were performed using GraphPad Prism™ 4.0 (GraphPad™). Results with a p<0.05 were considered significant. Patient Derived Xenograft (PDX) Studies The responses of a panel of 8 PDX models to ENZ were examined. One of the models, LTL313BR, was a castration relapsed subline of patient derived prostate cancer cells which was found to be highly resistant to ENZ. Development of PDX LTL313B and LTL313BR tumor lines. LTL313BR was accomplished using castration relapse (3-4 months post castration) of parental LTL313B (www.livingtumorlab.com). Its parental hormone naïve tumor line LTL313B was sensitive to ENZ. The dASO 6w2 was tested for its ability to impede ENZ-resistant CRPC growth. The expression of BIRC6 in relation to ENZ resistance (LTL313B vs LTL313BR) was examined, followed by efficacy study using a larger cohort (N=30) of ENZ-resistant LTL313BR. Finally, the effect of dASO treatment on LTL313BR apoptosis and survival signaling were also investigated. Immunohistochemical staining of BIRC6 in prostate cancer tissue arrays revealed that BIRC6 expression was elevated in tumors at more advanced clinical stages, i.e. expression of BIRC6 was significantly higher in T3-4 stage tumors than in T1-2 stage tumors or benign prostate (mean intensity±S.E.: 1.91±0.06, 1.60±0.10 and 1.53±0.13, respectively; Benign to T3-4, p=0.0032; T1-2 to T3-4, p=0.0059; Student's t test) ( To establish whether there was a correlation between increases in the expression of BIRC6 in prostate cancer and those of other IAP members, the IHC expression profiles of BIRC6, XIAP, survivin and cIAP1 in individual clinical prostate samples (including benign tissue, primary cancer and CRPC) were analyzed for correlations by the Spearman's rank correlation test using GraphPad 4 software. The Spearman r coefficients for the BIRC6-survivin and BIRC6-XIAP combinations were 0.3987 and 0.6025, respectively (p<0.0001), indicating positive correlations between BIRC6 and survivin, and between BIRC6 and XIAP. A weak, but significant, positive correlation was observed for the BIRC6-cIAP1 combination, with a Spearman r coefficient of 0.194 (p=0.0072). The positive correlations between the expressions of BIRC6 and the other IAPs were visualized by representative IHC stained images of matched patients' samples ( As BIRC2 (cIAP1), BIRC4 (XIAP) and BIRC5 (survivin) tended to be co-upregulated in prostate cancer in addition to BIRC6, simultaneous targeting of BIRC6 plus one of these IAP members was more likely to give superior anti-cancer effects. Accordingly, dual-targeting antisense oligonucleotides (dASOs), specifically targeting combinations of BIRC6 with each of the other three IAPs, i.e. 6w2, 6w4, 6w5, were tested for anticancer activity. As shown in Supplementary At a comparable degree of silencing of BIRC6, cIAP1 and survivin, knockdown of each IAP alone by siRNA did not result in marked reduction in viable PC-3 cell numbers compared to the mock control (27.8%, −20.8% and −17.7%, respectively). However, simultaneous silencing of BIRC6+cIAP1 and BIRC6+survivin by 6w2 and 6w5, respectively, led to marked reductions in the number of viable cells (490.1% and 590.8% of suppression, respectively, p<0.001. Since different silencing methodologies were used, i.e. siRNA and ASO, that presumably work via different mechanisms (Bilanges B and Stokoe D. Biochem J. 2005, 388(Pt 2):573-583), the viabilities of cells treated with either method were normalized using the cell viabilities obtained with the corresponding, non-targeting controls ( The activities of 6w2 and 6w5 were more closely examined in time course studies using cell proliferation/viability assays. Dual silencing of BIRC6+cIAP1 in PC-3 cell cultures by 6w2 effectively suppressed cell proliferation at 48, 72 and 115 hours by 77.0%, 82.4% and 76.7%, respectively, compared to Scrambled (Scrb) control (p<0.05). Similarly, silencing of BIRC6+survivin by 6w5 resulted in 74.7%, 840.1% and 78.5% growth inhibition compared to Scrb at the same time points (p<0.05) ( To understand the cause of growth-inhibition given by dASOs, apoptosis induction was first investigated. PC-3 cells were incubated with dASOs 6w2 and 6w5 for 72 hours and then subjected to Annexin V and PI staining and FACS analysis to determine the amount of early apoptotic cells generated. FACS analysis showed that the treatments led to apoptosis of 11.3% and 16.6% obtained with 6w2 and 6w5, respectively, compared to 2.8% obtained with Scrb ASO (p=6.68×10-5 and 0.047 respectively) ( In view of a close link between IAPs and the NFkB pathway (Krieg A, et al., Proc Natl Acad Sci USA. 2009; 106(34):14524-14529; Varfolomeev E, et al., J Biol Chem. 2008, 283(36):24295-24299), the effects of dASO 6w2 and 6w5 on NFkB transactivation in PC-3 cells were examined using a dual luciferase reporter assay under TNFα-induced and non-induced conditions. The TNFα-induced NFkB activation was markedly suppressed in dASO 6w2-treated cells compared to cells treated with Mock (97.0%, % suppression to mock, p=0.003), whereas NFkB activation was 20.2% suppressed by Scrb ASO compared to Mock. A marked suppression of NFkB activation was also observed in dASO 6w5-treated cells (79.0%, % of suppression to mock, p=0.011) ( Taken together, the results demonstrate that the growth suppression of dASO 6w2- and 6w5-treated PC-3 cells was associated with apoptosis induction, G2-M phase arrest and repression of NFkB promoter activation, highlighting the multifaceted action of both dASOs. dASOs suppress PC-3 xenograft growth. NOD-SCID mice carrying subcutaneous PC-3 xenografts were treated daily for 15 days with dASOs 6w2, 6w5 or mismatched (MM) ASO (10 mg/kg). Tumor volumes were determined at the end of the treatment; there was no significant difference in total volume between tumors in control and treatment groups ( The dASO-reduced tumor growth was associated with a significant decrease in intratumoral BIRC6 protein expression in both treatment groups compared to the MM control (p=0.026 for MM to 6w2, p=0.006 for MM to 6w5) ( In order to search for PDX models for ENZ-CRPC, a panel of 8 PDX tumor lines were treated with ENZ (10 mg/kg ENZ or vehicle for 4 weeks, N=10 per group) and their responses to ENZ in terms of tumor growth were examined at the end of treatment. Among the panel, LTL313BR CRPC line did not respond to ENZ treatment whereas its parental line LTL313B readily responded to ENZ treatment ( BIRC6 is reported for its role in promoting treatment resistance; however, its association with ENZ resistance is unknown. Here, we compared BIRC6 mRNA and protein expression between LTL313B and LTL313BR by RNA-seq and immunohistochemistry. BIRC6 was elevated in LTL313BR for both mRNA and protein levels. In addition, an upregulation trend of BIRC6 protein was also observed in ENZ treated LTL313BR tumors compared with vehicle control ( BIRC6 target inhibition was first validated in pilot set LTL313BR (n=8 for scrambled control and n=9 for 6w2) by IHC staining ( To understand the underlying cause of inhibitory effect induced by 6w2, we first examined the presence of apoptosis induction by IHC cleaved caspase-3 staining. 6w2 treated tumors demonstrated 2-fold increase of percentage of apoptotic cells (16%) compared to that of scrb (7.5%) ( The above ENZ-resistant CRPC PDX model results, suggest that dASO 6w2 harbours significant therapeutic effect towards ENZ-resistant CRPC. As such, dASO 6w2 may represent an effective therapeutic option for the emerging ENZ-resistant CRPC incidence in clinic. Although embodiments described herein have been described in some detail by way of illustration and example for the purposes of clarity of understanding, it will be readily apparent to those of skill in the art in light of the teachings described herein that changes and modifications may be made thereto without departing from the spirit or scope of the appended claims. Such modifications include the substitution of known equivalents for any aspect of the invention in order to achieve the same result in substantially the same way. Numeric ranges are inclusive of the numbers defining the range. The word “comprising” is used herein as an open ended term, substantially equivalent to the phrase “including, but not limited to”, and the word “comprises” has a corresponding meaning. As used herein, the singular forms “a”, “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a thing” includes more than one such thing. Citation of references herein is not an admission that such references are prior art to an embodiment of the present invention. The invention includes all embodiments and variations substantially as herein described and with reference to the figures. Provided herein are compositions, method and uses for modulating IAP activity or for the treatment of cancer. The compositions comprise dual-targeting antisense oligonucleotides (dASO) for administration to a cancer cell, wherein the cancer cell may be characterized by elevated expression of one of more of BIRC6, cIAP1 or survivin. The cancer may be selected from one or more of: prostate cancer; childhood de novo acute myeloid leukemia; colorectal cancer; neuroblastoma; melanoma; and non-small cell lung cancer. The prostate cancer may be castration-resistant prostate cancer (CRPC). 1. A method of treating cancer, the method comprising administering a dual-targeting antisense oligonucleotides (dASO) of SEQ ID NO:1 or SEQ ID NO:2. 2. The method of 3. The method of 4. The method of 5. The method of 6. The method of 7. The method of 8. The method of 9. The method of 10. The method of 11. The method of 12. The method of 13. The method of 14. The method of 15. The method of 16. The method of 17. The method of 18. The method of 19. A dual-targeting antisense oligonucleotide (dASO), wherein the oligonucleotide has a sequence selected from the following: 20. The dASO of 21. The dASO of 22. The dASO of 23. The dASO of 24. The dASO of 25. The dASO of 26. The dASO of 27. A pharmaceutical composition, the composition comprising (a) dual-targeting antisense oligonucleotide (dASO) of SEQ ID NO:1 or SEQ ID NO:2; and (b) a pharmaceutically acceptable carrier. 28. The pharmaceutical composition of 29. The pharmaceutical composition of 30. The pharmaceutical composition of 31. The pharmaceutical composition of 32. The pharmaceutical composition of 33. The pharmaceutical composition of 34. The pharmaceutical composition of 35. The pharmaceutical composition of 36. A commercial package, comprising:
a. a dASO of SEQ ID NO:1 or SEQ ID NO:2; and b. instructions for the treatment of cancer. 37. The commercial package of 38. The commercial package of CROSS REFERENCE TO RELATED APPLICATION
TECHNICAL FIELD
BACKGROUND
SUMMARY
BRIEF DESCRIPTION OF THE DRAWINGS
DETAILED DESCRIPTION
Primary and secondary targeted regions and percentage of matching nucleotide sequences for the two dASOs. dASO Primary Target % match Secondary target % match 6w2 BIRC6 mRNA, nt 19/19 BIRC2 transcript 18/19 9299-9281 (100%), variant 2 mRNA, (95%) nt 955-937 BIRC2 transcript 18/19 variant 1 mRNA., (95%) nt 678-660 6w5 BIRC6 mRNA nt 19/19 BIRC5 transcript 16/19 12035-12017 (100%), variant 1-3 mRNA, (84%) Nt 282-300 Methods and Materials
ExampleS
Example 1
Elevated BIRC6 Protein Expression is Associated with Poor Prognostic Factors in Prostate Cancer
Example 2
Positive Correlation Between Expressions of BIRC6 and Other IAP Members in Human Prostate Cancer
Example 3
Dual IAP-Targeting Antisense Oligonucleotides Suppress Prostate Cancer Cell Proliferation
Example 4
The Anti-Cancer Effects Obtained by Single and Dual Targeting of IAPs were Compared
Example 5
dASOs 6w2 and 6w5 Induce Apoptosis, Cell Cycle Arrest and Suppress NFkB Activation
Example 6
The Therapeutic Potential of dASOs was Examined In Vivo
Example 7
Patient Derived Xenograft Model LTL313BR as a Clinically Relevant Model for Enzalutamide (ENZ) Resistant CRPC
Example 8
Enzalutamide Resistant Phenotype was Associated with Elevated BIRC6 Expression
Example 9
6w2 Effectively Suppressed Enz-Resistant LTL313BR Growth
Example 10
6w2 Treatment Simultaneously Increased Apoptosis and Suppressed Pro-Survival Factors in LTL313BR Tumors
REFERENCES
Description: dASO 6w2 SEQ ID NO: 1 5′ CTGCAGCATC ATGTGGACT ′3 Description: dASO 6w5 SEQ ID NO: 2 5′ CAGGTGAAACACTGGGACA 3′ Description: Scramble (Scrb) B control (Non-targeting control ASO) SEQ ID NO: 3 5′ CCTTCCCTGAAGGTTCCTCC 3′ Description: mismatched (MM) control (Non-targeting control ASO) SEQ ID NO: 4 5′ CAGCAGCAGAGTATTTATCAT 3′ Description: dASO 6w4 SEQ ID NO: 5 5′ ATCTGCCTCCAGAGTAGAC 3′ (a) (SEQ ID NO: 1) CTGCAGCATC ATGTGGACT; and (b) (SEQ ID NO: 2) CAGGTGAAAC ACTGGGACA.


























