Treatment of Cancer by Inhibition of IGFBPs and Clusterin

Agents that reduce the amount of IGFBP-2 and/or IGFBP-5 and that are known to be useful in the treatment of cancer result in increased expression of the protein clusterin. Since clusterin can provide protection against apoptosis, this secondary effect detracts from the efficacy of the therapeutic agent. In overcoming this, the present invention provides a combination of therapeutic agents that is useful in the treatment of cancer. The combination includes an agent that reduces the amount of IGFBP-2 and/or IGFBP-5 and that stimulates expression of clusterin as a secondary effect, and an oligonucleotide that is effective to reduce the amount of clusterin in cancer cells. In some embodiments of the invention, the agent that reduces IGFBP-2 and/or IGFBP-5 is a bispecific antisense species. The oligonucleotide may be an antisense oligonucleotide or an RNAi oligonucleotide. 122-. (canceled)23. A therapeutic combination for treatment of cancer comprising(a) means for reducing IGFBP-2 and/or IGFBP-5 in cancer cells; and(b) means for reducing the effective amount of clusterin in cancer cells. This application is continuation-in-part of U.S. patent application Ser. No. 10/346,493, filed Jan. 17, 2003, which claims the benefit of U.S. Provisional Application No. 60/350,046 filed Jan. 17, 2002. This application also claims the benefit of U.S. Provisional Applications 60/522,948 filed Nov. 23, 2004 and 60/522,960 filed Nov. 24, 2004. All of these applications are incorporated herein by reference.The present application relates to a method for treating cancer in a mammalian subject using a combination of therapeutic agents, one of which is an oligonucleotide effective to reduce the amount of clusterin, also known as testosterone-repressed prostate message-2 (TRPM-2) in the cancer cells, and the other of which reduces expression of insulin-like growth factor binding protein 2 (IGFBP-2) and/or insulin-like growth factor binding protein 5 (IGFBP-5), and also stimulates the ...

Semaphorin 3C (Sema3C) Inhibitor Therapeutics, Methods, and Uses

Provided are methods, uses and pharmaceutical compositions for treatment of prostate cancer with a SEMA3C inhibitor in a biologically effective amount sufficient to cause cell death of a prostate cancer cell or to inhibit proliferation of the prostate cancer cells. The prostate cancer may be an androgen receptor (AR) positive prostate cancer and the SEMA3C inhibitor may be selected from one or more of the following: an antibody, a SEMA3C peptide, an antisense RNA, a siRNA, a shRNA or a small molecule. 1. A method for treating prostate cancer comprising administering a biologically effective amount of a SEMA3C inhibitor to prostate cancer cells.2. The method of claim 1 , wherein said biologically effective amount is an amount sufficient to cause cell death of a prostate cancer cell or to inhibit proliferation of the prostate cancer cells.3. The method of claim 1 , wherein the prostate cancer is an androgen receptor (AR) positive prostate cancer.4. The method of claim 1 , wherein the SEMA3C inhibitor is selected from one or more of the following: an antibody claim 1 , a SEMA3C peptide claim 1 , an antisense RNA claim 1 , a RNAi or a small molecule.5. The method of claim 4 , wherein the antibody is selected from one or more of the following: a polyclonal antibody; a monoclonal antibody; or a fragment thereof; a single chain Fc region (scFc); or an intrabody.6. The method of claim 4 , wherein the antisense RNA comprises about 15 to 50 nucleotides that are at least 80% identical to any 15 to 50 contiguous nucleotides selected from SEQ ID NO:4.7. The method of claim 4 , wherein the antisense RNA comprises about 17 to 30 nucleotides that are at least 80% identical to any 17 to 30 contiguous nucleotides selected from SEQ ID NO:4.8. The method of claim 4 , wherein the antisense RNA comprises about 19 to 25 nucleotides that are at least 80% identical to any 19 to 25 contiguous nucleotides selected from SEQ ID NO:4.9. The method of claim 4 , wherein the antisense RNA comprises ...

Derivatized Hyperbranched Polyglycerols

Herein are provided derivatized hyperbranched polyglycerols (“dHPGs”). The dHPG comprises a core comprising a hyperbranched polyglycerol derivatized with CCalkyl chains and a shell comprising at least one hydrophilic substituent bound to hydroxyl groups of the core, wherein the hyperbranched polyglycerol comprises from about 1 to about 200 moles of the at least one hydrophilic substituent. The dHPGs are for use as agents for the delivery of a drug or other biologically active moiety to the urinary tract, the digestive tract, the airways, the vaginal cavity and cervix and the peritoneal cavity to treat indications such as cancer, which may be useful in the treatment of or the manufacture of a medicament, in the preparation, of a pharmaceutical composition for the treatment of cancer, as a pre-treatment or co-treatment to improve drug uptake in a tissue. Furthermore, there are provided methods of making dHPGs. 1. A hyperbranched polyglycerol , comprising:{'sub': 1', '20, 'a core comprising hyperbranched polyglycerol derivatized with C-Calkyl chains; and'}{'sub': 2', '2', '3', '3', '1', '6', '1', '6', '3', '12', '3, 'sup': +', '+', '+, "a shell comprising at least one hydrophilic substituent bound to hydroxyl groups of the core, wherein the at least one hydrophilic substituent comprises at least one functional group selected from one or more of the following: —NH, ═NH, —NH, and —NR, wherein each R is independently a C-Calkyl group or one R is independently a C-Calkyl group and two R's together form a C-Ccyclic alkyl group so that Rforms a quaternary amine with the nitrogen, and"}wherein the hyperbranched polyglycerol comprises from about 1 to about 200 moles of the at least one functional group per mole of the hyperbranched polyglycerol.2. The hyperbranched polyglycerol of claim 1 , wherein the at least one functional group is —NH.3. The hyperbranched polyglycerol of claim 1 , wherein the at least one hydrophilic substituent is methoxy polyethylene glycol (MePEG) claim ...

P27KIP1 AS A MOLECULAR MARKER FOR SUITABILITY AND EFFICACY OF TREATMENT WITH HSP27 INHIBITORS

Cells expressingHsp27 exhibit reduced levels of p27kip1. Accordingly, a method for treatment of cancer using hsp27 inhibition that includes a preliminary test to ascertain the status of the p27kip1 in the target cells. In this test, a sample of cancerous tissue from the patient from the patient (including a human patient) and evaluated to determine an expression of level of functional p27kip1. In the case where the expression level of p27kip1 is below a threshold level, a therapeutic composition comprising as an active agent a composition effective to inhibit the expression or activity of hsp27 in administered to the patient. 1. A method for treating cancer in a patient diagnosed as suffering from cancer comprising the steps of:(a) obtaining a sample of cancerous tissue from the patient;(b) evaluating the sample of cancerous tissue to determine an expression of level of functional p27kip1; and(c) in the case where the expression level of p27kip1 is below a threshold level, administering to the patient a therapeutic composition comprising as an active agent a composition effective to inhibit the expression or activity of hsp27.2. The method of claim 1 , wherein the active agent is an oligonucleotide that interacts with cellular nucleic acids encoding hsp27 in a sequence specific manner.3. The method of claim 2 , wherein the oligonucleotide is an antisense oligonucleotide.4. The method of claim 3 , wherein the antisense oligonucleotide comprises SEQ ID NO. 5.5. The method of claim 2 , wherein the oligonucleotide is an siRNA oligonucleotide.6. The method of claim 5 , wherein the siRNA oligonucleotide comprises SEQ ID NO. 6.7. The method of claim 1 , wherein the active agent comprises a berberine derivative.8. The method of claim 1 , wherein the active agent comprises a material selected from the group consisting of magnolol-containing synthetic suppressors of protein belonging to hsp27 family claim 1 , shikonin-containing synthetic suppressors of protein belonging to ...

Treatment of Cancer by Inhibition of IGFBPs and Clusterin

Agents that reduce the amount of IGFBP-2 and/or IGFBP-5 and that are known to be useful in the treatment of cancer result in increased expression of the protein clusterin. Since clusterin can provide protection against apoptosis, this secondary effect detracts from the efficacy of the therapeutic agent. In overcoming this, the present invention provides a combination of therapeutic agents that is useful in the treatment of cancer. The combination includes an agent that reduces the amount of IGFBP-2 and/or IGFBP-5 and that stimulates expression of clusterin as a secondary effect, and an oligonucleotide that is effective to reduce the amount of clusterin in cancer cells. In some embodiments of the invention, the agent that reduces IGFBP-2 and/or IGFBP-5 is a bispecific antisense species. The oligonucleotide may be an antisense oligonucleotide or an RNAi oligonucleotide. 1. A method for treating a cancer in a human subject , comprising administering to the subject a therapeutic combination comprising:(a) an agent that reduces IGFBP-2 and/or IGFBP-5 and(b) an oligonucleotide effective to reduce the effective amount of clusterin in the cancer cells,wherein the cancer is one for which reduction in the amount of IGFBP-2 and/or IGFBP-5 is of therapeutic benefit.2. The method of claim 1 , wherein said cancer is selected from the group consisting of breast cancer claim 1 , prostate cancer claim 1 , ovarian cancer and colon cancer.3. The method of claim 2 , wherein the agent that reduces IGFBP-2 and/or IGFBP-5 comprises an antisense oligonucleotide targeting IGFBP-2 and/or IGFBP-5 expression.4. The method of claim 3 , wherein the agent is a bispecific antisense oligonucleotide that reduces IGFBP-2 and IGFBP-5.5. The method of claim 1 , wherein the oligonucleotide effective to reduce the amount of clusterin is an anti-clusterin antisense oligonucleotide.6. The method of wherein said anti-clusterin antisense oligonucleotide is modified to enhance in vivo stability relative to an ...

COMBINATION OF ANTI-CLUSTERIN OLIGONUCLEOTIDE WITH HSP90 INHIBITOR FOR THE TREATMENT OF PROSTATE CANCER

The present invention provides a method for treating a mammalian subject affected by prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) a Heat Shock Protein 90 (Hsp90) inhibitor each in an amount that when in combination with the other is effective to treat the mammalian subject. The present invention also provides pharmaceutical compositions comprising an amount of an oligonucleotide which reduces clusterin expression, and a Hsp90 inhibitor for use in treating a mammalian subject affected by prostate cancer. Also provided are oligonucleotides which reduce clusterin expression for use in combination with a Hsp90 inhibitor in treating a mammalian subject affected by prostate cancer, and a composition for treating a mammalian subject affected by prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) a Hsp90 inhibitor each in an amount that when in combination with the other is effective to treat the mammalian subject. 2. A method for treating a mammalian subject affected by prostate cancer comprising administering to the mammalian subject i) an oligonucleotide which reduces clusterin expression and ii) a Hsp90 inhibitor , which inhibitor is other than Hsp90i-1 , each in an amount that when in combination with the other is effective to treat the mammalian subject.3. A method for treating a mammalian subject affected by prostate cancer comprising administering to the mammalian subject i) an oligonucleotide which reduces clusterin expression and ii) a Hsp90 inhibitor which binds to Hsp90α and Hsp90β with a Kof less than 50 nmol/L , or a prodrug thereof , each in an amount that when in combination with the other is effective to treat the mammalian subject.4. The method of claim 1 , wherein the cancer is androgen-independent prostate cancer.5. The method of claim 1 , wherein the amount of the oligonucleotide and the amount of the Hsp90 inhibitor when taken together is more effective to treat the ...

COMBINATION OF ANTI-CLUSTERIN OLIGONUCLEOTIDE WITH ANDROGEN RECEPTOR ANTAGONIST FOR THE TREATMENT OF PROSTATE CANCER

A method for treating a mammalian subject afflicted with prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) an androgen receptor antagonist having the structure 2. The method of claim 1 , wherein the cancer is androgen-independent prostate cancer.3. The method of claim 1 , wherein the amount of the oligonucleotide and the amount of the androgen receptor antagonist or a pharmaceutically acceptable salt thereof when taken together is more effective to treat the subject than either agent administered alone.4. The method of claim 1 , wherein the amount of the oligonucleotide in is less than an amount which is clinically effective when the oligonucleotide is administered alone.5. The method of claim 1 , wherein the amount of the androgen receptor antagonist or a pharmaceutically acceptable salt thereof is less than an amount which is clinically effective when antagonist or salt thereof is administered alone.6. The method of claim 1 , wherein the amount of the oligonucleotide and the amount of the androgen receptor antagonist or a pharmaceutically acceptable salt thereof when taken together is effective to reduce a clinical symptom of prostate cancer in the subject.7. (canceled)87. The method of any one of - claims 1 , wherein the oligonucleotide is an antisense oligonucleotide.9. The method of claim 8 , wherein the antisense oligonucleotide spans either the translation initiation site or the translation termination site of clusterin-encoding mRNA.10. The method of claim 9 , wherein the antisense oligonucleotide comprises nucleotides claim 9 , the sequence of which is set forth in one of SEQ ID NOS: 1 to 11.11. The method of claim 9 , wherein the antisense oligonucleotide comprises nucleotides claim 9 , the sequence of which is set forth in SEQ ID NO: 3.12. The method of claim 10 , wherein the antisense oligonucleotide is modified to enhance in vivo stability relative to an unmodified oligonucleotide of the same sequence.13. The ...

Bispecific Antisense Oligonucleotides that Inhibit IGFBP-2 and IGFBP-5 and Methods of Using Same

Bispecific antisense oligonucleotides which consist essentially of a sequence of bases that is complementary to portions of both the gene encoding human IGFBP-2 and the gene encoding human IGFBP-5 are useful in as antisense therapeutics in the treatment of endocrine-regulated cancers.

Semaphorin 3C (Sema3C) Inhibitor Therapeutics, Methods, and Uses

Provided are methods, uses and pharmaceutical compositions for treatment of prostate cancer with a SEMA3C inhibitor in a biologically effective amount sufficient to cause cell death of a prostate cancer cell or to inhibit proliferation of the prostate cancer cells. The prostate cancer may be an androgen receptor (AR) positive prostate cancer and the SEMA3C inhibitor may be selected from one or more of the following: an antibody, a SEMA3C peptide, an antisense RNA, a siRNA, a shRNA or a small molecule. 164-. (canceled)65. A pharmaceutical composition comprising a therapeutically effective amount of an anti-SEMA3C antibody having SEMA3C inhibitory activity in combination with a physiologically acceptable carrier.66. The pharmaceutical composition of claim 65 , wherein the anti-SEMA3C antibody is selected from one or more of the following: a polyclonal antibody; a monoclonal antibody; an antigen binding fragment of an antibody; or a single chain antibody.67. The pharmaceutical composition of claim 65 , wherein the anti-SEMA3C antibody is a monoclonal antibody.68. The pharmaceutical composition of claim 65 , wherein the anti-SEMA3C antibody is a polyclonal antibody.69. The pharmaceutical composition of claim 65 , wherein the anti-SEMA3C antibody is an antigen binding fragment of an antibody.70. The pharmaceutical composition of claim 65 , wherein the anti-SEMA3C antibody is a single chain antibody.71. The pharmaceutical composition of claim 65 , formulated for administration with an androgen deprivation therapy.72. The pharmaceutical composition of claim 71 , wherein androgen deprivation therapy is selected from one or more of the following: a luteinizing hormone-releasing hormone (LHRH) analog; an anti-androgen compound; and an adrenal androgen inhibitor.73. The pharmaceutical composition of claim 72 , wherein the androgen deprivation therapy is a luteinizing hormone-releasing hormone (LHRH) analog.74. The pharmaceutical composition of claim 72 , wherein the androgen ...

Dual targeting antisense oligonucleotides as apoptotic inhibtor therapeutic compostions and methods for their use in the treatment of cancer

Provided herein are compositions, method and uses for modulating IAP activity or for the treatment of cancer. The compositions comprise dual-targeting antisense oligonucleotides (dASO) for administration to a cancer cell, wherein the cancer cell may be characterized by elevated expression of one of more of BIRC6, cIAP1 or survivin. The cancer may be selected from one or more of: prostate cancer; childhood de novo acute myeloid leukemia; colorectal cancer; neuroblastoma; melanoma; and non-small cell lung cancer. The prostate cancer may be castration-resistant prostate cancer (CRPC).

B1SP Fusion Protein Therapeutics, Methods, and Uses

Provided are methods, uses and pharmaceutical compositions for treatment of cancer with a B1SP fusion protein in a biologically effective amount sufficient to cause cell death of a prostate cancer cell or to inhibit proliferation of the prostate cancer cells. The cancer may be prostate cancer, breast cancer, ovarian cancer, bladder cancer, kidney cancer, glioblastoma or endometrial cancer. The prostate cancer may be an androgen receptor (AR) positive prostate cancer and the B1SP fusion protein may include a sema domain, a structural stabilization domain; and a half life extending moiety. 154-. (canceled)56. The polynucleotide vector of claim 55 , further comprising one or more of: viral coats; cationic lipids; liposomes; polyamines; gold particles; and targeting moieties.57. The polynucleotide vector of claim 55 , further comprising one or more of: cationic lipid; liposomes; and targeting moieties.58. The polynucleotide vector of claim 56 , wherein the targeting moiety is selected from one or more of: ligands; receptors; and antibodies that target cellular molecules.59. The polynucleotide vector of claim 57 , wherein the targeting moiety is selected from one or more of: ligands; receptors; and antibodies that target cellular molecules.60. The polynucleotide vector of claim 55 , further comprising a viral vector.61. The polynucleotide vector of claim 60 , wherein the viral vector is selected from: retroviral vectors; alphaviral vectors; vaccinial vectors; adenoviral vectors; adeno-associated viral vectors; herpes viral vectors; and fowl pox viral vectors.63. The polynucleotide vector of claim 55 , wherein the B1SP fusion protein is encoded by SEQ ID NO:3.65. The pharmaceutical composition of claim 64 , wherein the polynucleotide vector further comprises one or more polynucleotides encoding a linker and a hinge between the PSI domain and the half life extending moiety.67. The pharmaceutical composition of claim 64 , comprising an amount of the polynucleotide vector ...

Combination Therapy for Cancer Using HSP27 Inhibitor and EGFR Tyrosine Kinase Inhibitors or Anti-Folates

Combination therapy for cancer makes use of HSP27 inhibitors and EGFR tyrosine kinase inhibitors or antifolates. 1. A method for treating cancer in an individual , comprising the steps ofadministering to the individual a therapeutically effective amount of a first active agent which is an inhibitor of Hsp27 activity, andadministering to the individual therapeutically effective amount of a second active agent which is an inhibitor of EGFR tyrosine kinase activity.2. The method of claim 14 , wherein the second agent is a quinazoline.3. The method of claim 2 , wherein the second agent is erlotinib.4. The method of claim 2 , wherein the second agent is gefitinib.5. The method of claim 14 , wherein the second agent is a monoclonal antibody.6. The method of claim 14 , wherein the first agent is administered before the second agent.7. The method of claim 14 , wherein the first agent is an oligonucleotide therapeutic.8. The method of claim 7 , wherein the first agent is an antisense oligonucleotide.9. The method of claim 8 , wherein the first agent is OGX-427 (SEQ ID NO. 1).10. The method of claim 7 , wherein the first agent is an siRNA.11. The method of claim 10 , wherein the first agent comprises SEQ ID NO: 2 and a complementary strand.12. The method of claim 14 , wherein the cancer is prostate claim 14 , bladder claim 14 , lung claim 14 , breast claim 14 , osteosarcoma claim 14 , pancreatic claim 14 , colon claim 14 , testicular claim 14 , colorectal claim 14 , urothelial claim 14 , renal cell claim 14 , hepatocellular claim 14 , leukemia claim 14 , lymphoma claim 14 , ovarian claim 14 , melanoma claim 14 , central nervous system malignancies claim 14 , or squamous cell carcinoma.13. The method of claim 12 , wherein the cancer is lung cancer.14. The method of claim 1 , wherein the individual is human.1527-. (canceled)28. The method of claim 7 , wherein the second agent is a monoclonal antibody.29. The method of claim 7 , wherein the second agent is a quinazoline.30. The ...

Derivatized Hyperbranched Polyglycerols

Herein are provided derivatized hyperbranched polyglycerols (“dHPGs”). The dHPG comprises a core comprising a hyperbranched polyglycerol derivatized with CCalkyl chains and a shell comprising at least one hydrophilic substituent bound to hydroxyl groups of the core, wherein the hyperbranched polyglycerol comprises from about 1 to about 200 moles of the at least one hydrophilic substituent. The dHPGs are for use as agents for the delivery of a drug or other biologically active moiety to the urinary tract, the digestive tract, the airways, the vaginal cavity and cervix and the peritoneal cavity to treat indications such as cancer, which may be useful in the treatment of or the manufacture of a medicament, in the preparation, of a pharmaceutical composition for the treatment of cancer, as a pre-treatment or co-treatment to improve drug uptake in a tissue. Furthermore, there are provided methods of making dHPGs. 1114.-. (canceled)115. A hyperbranched polyglycerol comprising:{'sub': 8', '10, 'a core comprising hyperbranched polyglycerol derivatized with Calkyl chains, Calkyl chains, or a combination thereof; and'}{'sub': '2', 'a shell comprising at least one hydrophilic substituent and at least one functional group, wherein the at least one hydrophilic substituent comprises methoxypolyethylene glycol (MePEG) and the at least one functional group comprises —NH.'}116. The hyperbranched polyglycerol according to claim 115 , wherein the hyperbranched polyglycerol comprises from about 1 to about 200 moles of the at least one functional group per mole of the hyperbranched polyglycerol.117. The hyperbranched polyglycerol according to claim 116 , wherein the hyperbranched polyglycerol comprises from about 30 to about 100 moles of the at least one functional group per mole of the hyperbranched polyglycerol.118. The hyperbranched polyglycerol according to claim 116 , wherein the hyperbranched polyglycerol comprises about 37 moles of the at least one functional group per mole of ...

Combination of Anti-Clusterin Oligonucleotide with HSP90 Inhibitor for the Treatment of Prostate Cancer

The present invention provides a method for treating a mammalian subject affected by prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) a Heat Shock Protein 90 (Hsp90) inhibitor each in an amount that when in combination with the other is effective to treat the mammalian subject. The present invention also provides pharmaceutical compositions comprising an amount of an oligonucleotide which reduces clusterin expression, and a Hsp90 inhibitor for use in treating a mammalian subject affected by prostate cancer. Also provided are oligonucleotides which reduce clusterin expression for use in combination with a Hsp90 inhibitor in treating a mammalian subject affected by prostate cancer, and a composition for treating a mammalian subject affected by prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) a Hsp90 inhibitor each in an amount that when in combination with the other is effective to treat the mammalian subject. 133-. (canceled)34. A pharmaceutical composition comprising an amount of an oligonucleotide which reduces clusterin expression , and a Hsp90 inhibitor , wherein the oligonucleotide is an antisense or RNAi oligonucleotide the reduces clusterin expression , and the Hsp90 inhibitor is 4-(6 ,6-Dimethyl-4-oxo-3-trifluoromethyl-4 ,5 ,6 ,7-tetrahydro-indazol-1-yl)-2-(4-hydroxy-cyclohexylamino)-benzamide , or a pharmaceutically acceptable salt thereof , or a prodrug that is metabolized to release 4-(6 ,6-Dimethyl-4-oxo-3-trifluoromethyl-4 ,5 ,6 ,7-tetrahydro-indazol-1-yl)-2-(4-hydroxy-cyclohexylamino)-benzamide.35. The pharmaceutical composition of claim 34 , wherein the oligonucleotide is an antisense oligonucleotide.36. The pharmaceutical composition of claim 35 , wherein the antisense oligonucleotide comprises one of SEQ ID NOs 3 claim 35 , 4 and 11.37. The pharmaceutical composition of claim 36 , wherein the antisense oligonucleotide comprises SEQ ID NO: 3.38. The pharmaceutical ...

Method for Treatment of Castration-Resistant Prostate Cancer

Castrate resistant prostate cancer cell lines exhibiting resistance to the androgen-receptor antagonist enzaluatamide overexpress one or both of IGFBP-2 or IGFBP-5 when compared to non-resistant cell lines. Oligonucleotides that target IGFBP-2 and IGFBP-5 can be used to overcome this resistance or as part of a treatment program when administered concurrently with the administration of androgen-receptor antagonist treatments. 1. A method for treatment of a patient having a cancer exhibiting resistance to an androgen-receptor antagonist comprising administering to the patient an amount of an agent that reduces expression of IGFBP-2 and IGFBP-5.2. The method of wherein the androgen-receptor antagonist impairs nuclear translocation of androgen-receptor.3. The method of claim 1 , wherein the androgen-receptor antagonist is a diarylthiohydantoin.4. The method of claim 3 , wherein the androgen-receptor antagonist is enzalutamide.5. The method of claim 4 , wherein the agent that reduces expression of IGFBP-2 and IGFBP-5 is a bispecific antisense oligonucleotide.6. The method of claim 5 , wherein the second therapeutic agents has the sequence of SEQ ID NO. 1.7. The method of claim 5 , wherein the second therapeutic agent is OGX-225. (SEQ ID NO. 2).8. The method of claim 4 , wherein the agent that reduces expression of IGFBP-2 and IGFBP-5 is an siRNA.9. The method of claim 8 , wherein the siRNA is an RNA duplex of two complementary RNA strands in which one of the strands has the sequence of SEQ ID NO. 10.10. The method of claim 1 , wherein the agent that reduces expression of IGFBP-2 and IGFBP-5 is a bispecific antisense oligonucleotide.11. The method of claim 10 , wherein the second therapeutic agents has the sequence of SEQ ID NO. 1.12. The method of claim 10 , wherein the second therapeutic agent is OGX-225. (SEQ ID NO. 2)13. The method of claim 1 , wherein the agent that reduces expression of IGFBP-2 and IGFBP-5 is an siRNA.14. The method of claim 13 , wherein the siRNA ...

POLYMERIC PASTE COMPOSITIONS FOR DRUG DELIVERY

This invention provides compositions for controlled localized release of one or more drugs within a subject. More particularly, described herein are compositions comprising a hydrophobic water-insoluble polymer, a low molecular weight biocompatible glycol, and one or more drugs. The compositions described herein may also optionally include a di-block copolymer and/or a swelling agent. 1. A composition , the composition comprising:(a) a hydrophobic water-insoluble polymer having an inherent viscosity (IV) of about 0.15 to about 0.5 dL/g;(b) a low molecular weight biocompatible glycol; with a molecular weight at or below 1,450 Daltons; and(c) one or more drug compounds or pharmaceutically acceptable salt, solvate or solvate of the salt thereof.2. The composition of claim 1 , further comprising a di-block copolymer.3. The composition of or claim 1 , wherein the hydrophobic water-insoluble polymer having an inherent viscosity (IV) of about 0.15 to about 0.5 dL/g is polylactic-co-glycolic acid (PLGA).4. The composition of claim 1 , or claim 1 , wherein the PLGA has a ratio of lactic acid (LA):glycolic acid (GA) at or below 75:25.5. The composition of any one of - claim 1 , wherein the hydrophobic water-insoluble polymer has an inherent viscosity (IV) of about 0.15 to about 0.3 dL/g.6. The composition of any one of - claim 1 , wherein the hydrophobic water-insoluble polymer has an inherent viscosity (IV) of about 0.15 to about 0.25 dL/g.7. The composition of any one of - claim 1 , wherein the low molecular weight biocompatible glycol has a molecular weight between about 76 Daltons and about 1 claim 1 ,450 Daltons.8. The composition of any one of - claim 1 , wherein the low molecular weight biocompatible glycol is selected from Polyethylene glycol (PEG) claim 1 , methoxypolyethylene glycol (mePEG) and propylene glycol.9. The composition of any one of - claim 1 , wherein the low molecular weight biocompatible glycol is selected from PEG and mePEG.10. The composition of ...

Clusterin Antisense Therapy for Treatment of Cancer

A method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefits in the treatment of cancer comprising administering from 40 to 640 mg anti-clusterin antisense oligonucleotide to a patient in need of treatment for a cancer expressing clusterin is provided. The method may include administering chemotherapeutic agent or agents, radiotherapy, and/or hormone ablation therapy. The invention also encompasses pharmaceutical compositions formulated to provide a dosage of 40 to 640 mg, and use of antisense in formulating a medicament. 1. A method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefits in the treatment of cancer comprising the step of administering from 40 to 640 mg anti-clusterin antisense oligonucleotide to a patient in need of treatment for a cancer expressing clusterin.2. The method of claim 1 , wherein the amount of anti-clusterin antisense oligonucleotide administered is from 300 to 640 mg.3. The method of or claim 1 , wherein the anti-clusterin antisense oligonucleotide has the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1).4. The method of or claim 1 , wherein the anti-clusterin antisense oligonucleotide has the sequence ATTGTCTGAGACCGTCTGGTC (Seq. ID No. 2).5. The method of or claim 1 , wherein the anti-clusterin antisense oligonucleotide has the sequence GCTGGGCGGAGTTGGGGGCCT (Seq. ID No. 3).6. The method of or claim 1 , wherein the anti-clusterin antisense oligonucleotide consists of a sequence as listed in any one of Seq ID Nos. 4-12.7. The method of any one of to claim 1 , wherein the anti-clusterin antisense oligonucleotide is administered once in a seven day period.8. The method of any one of to claim 1 , wherein the anti-clusterin antisense oligonucleotide is administered 3 times a week.9. The method of any one of to claim 1 , wherein the anti-clusterin antisense oligonucleotide is administered on day 1 claim 1 , 3 and 5 of a first seven day ...

Clusterin Antisense Therapy for Treatment of Cancer

A method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefits in the treatment of cancer comprising administering from 40 to 640 mg anti-clusterin antisense oligonucleotide to a patient in need of treatment for a cancer expressing clusterin is provided. The method may include administering chemotherapeutic agent or agents, radiotherapy, and/or hormone ablation therapy. The invention also encompasses pharmaceutical compositions formulated to provide a dosage of 40 to 640 mg, and use of antisense in formulating a medicament. 1. A method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefits in the treatment of cancer comprising the step of administering from 40 to 640 mg anti-clusterin antisense oligonucleotide to a patient in need of treatment for a cancer expressing clusterin.2. The method of claim 1 , wherein the amount of anti-clusterin antisense oligonucleotide administered is from 300 to 640 mg.3. The method of claim 1 , wherein the anti-clusterin antisense oligonucleotide has the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1).4. The method of claim 1 , wherein the anti-clusterin antisense oligonucleotide has the sequence ATTGTCTGAGACCGTCTGGTC (Seq. ID No. 2).5. The method of claim 1 , wherein the anti-clusterin antisense oligonucleotide has the sequence GCTGGGCGGAGTTGGGGGCCT (Seq. ID No. 3).6. The method of claim 1 , wherein the anti-clusterin antisense oligonucleotide consists of a sequence as listed in any one of Seq ID Nos. 4-12.7. The method of claim 1 , wherein the anti-clusterin antisense oligonucleotide is administered once in a seven day period.8. The method of claim 1 , wherein the anti-clusterin antisense oligonucleotide is administered 3 times a week.9. The method of claim 1 , wherein the anti-clusterin antisense oligonucleotide is administered on day 1 claim 1 , 3 and 5 of a first seven day period of a treatment cycle.10. The method of claim 1 , ...

B1SP FUSION PROTEIN THERAPEUTICS, METHODS, AND USES

Provided are methods, uses and pharmaceutical compositions for treatment of cancer with a B1SP fusion protein in a biologically effective amount sufficient to cause cell death of a prostate cancer cell or to inhibit proliferation of the prostate cancer cells. The cancer may be prostate cancer, breast cancer, ovarian cancer, bladder cancer, kidney cancer, glioblastoma or endometrial cancer. The prostate cancer may be an androgen receptor (AR) positive prostate cancer and the B1SP fusion protein may include a sema domain, a structural stabilization domain; and a half life extending moiety. 1. A method for treating cancer comprising administering a biologically effective amount of a B1SP fusion protein to a cancer cell , wherein the B1SP fusion protein comprises:(a) a sema domain;(b) a structural stabilization domain; and(c) a half life extending moiety.2. The method of claim 1 , wherein the B1SP fusion protein further comprises one or more of a linker and a hinge between the structural stabilization domain and the half life extending domain.3. The method of or claim 1 , wherein the structural stabilization domain is SCAQHLDCASCLAHRDPYCG WCVLLGRCSRRSECSRGQGPEQ.4. The method of claim 1 , or claim 1 , wherein said biologically effective amount is an amount sufficient to cause cell death of a cancer cell or to inhibit proliferation of the cancer cell.5. The method of claim 4 , wherein the cancer cell is prostate cancer claim 4 , breast cancer claim 4 , ovarian cancer claim 4 , bladder cancer claim 4 , kidney cancer claim 4 , glioblastoma or endometrial cancer.6. The method of or claim 4 , wherein the cancer cell is prostate cancer.7. The method of claim 4 , or claim 4 , wherein the prostate cancer is an androgen receptor (AR) positive prostate cancer.8. The method of any one of - claim 4 , wherein half life extending moiety is selected from: a fragment crystallizable region (Fc region); immunoglobulin-binding domaindomain B (IgBD); Novozymes Albufuse Albumin; serum ...

Derivatized Hyperbranched Polyglycerols

Herein are provided derivatized hyperbranched polyglycerols (“dHPGs”). The dHPG comprises a core comprising a hyperbranched polyglycerol derivatized with CCalkyl chains and a shell comprising at least one hydrophilic substituent bound to hydroxyl groups of the core, wherein the hyperbranched polyglycerol comprises from about 1 to about 200 moles of the at least one hydrophilic substituent. The dHPGs are for use as agents for the delivery of a drug or other biologically active moiety to the urinary tract, the digestive tract, the airways, the vaginal cavity and cervix and the peritoneal cavity to treat indications such as cancer, which may be useful in the treatment of or the manufacture of a medicament, in the preparation, of a pharmaceutical composition for the treatment of cancer, as a pre-treatment or co-treatment to improve drug uptake in a tissue. Furthermore, there are provided methods of making dHPGs. 1114.-. (canceled)115. A hyperbranched polyglycerol comprising:{'sub': 8', '10, 'a core comprising hyperbranched polyglycerol derivatized with Calkyl chains, Calkyl chains, or a combination thereof; and'}{'sub': 2', '3, 'sup': '+', 'a shell comprising at least one hydrophilic substituent and at least one functional group, wherein the at least one hydrophilic substituent comprises methoxypolyethylene glycol (MePEG) or polyethylene glycol (PEG) and the at least one functional group comprises —NHor —NH,'}{'sub': 2', '3, 'sup': '+', 'wherein the hyperbranched polyglycerol comprises from about 1 to about 200 moles of —NHor —NH per mole of the hyperbranched polyglycerol.'}116. The hyperbranched polyglycerol according to claim 115 , wherein the hyperbranched polyglycerol comprises from about 1 to about 100 moles of —NHor —NH per mole of the hyperbranched polyglycerol.117. The hyperbranched polyglycerol according to claim 115 , wherein the hyperbranched polyglycerol comprises from about 30 to about 100 moles of —NHor —NH per mole of the hyperbranched polyglycerol.118. ...

Compositions and Methods for Treatment of Prostate and Other Cancers

Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp27 mRNA, for example human hsp27 mRNA, is administered to an individual suffering from prostate cancer or some other cancer expressing elevated levels of hsp 27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically acceptable carrier, and packaged in dosage unit form. A preferred dosage unit form is an injectable dosage unit form. 124-. (canceled)25. A method for treatment of a cancer characterized by elevated expression of hsp27 as compared to non-cancerous tissue of the same type in an individual suffering from the cancer , comprising the step of administering to the individual a therapeutic composition effective to reduce the amount of active hsp27 in the cancer cells , wherein said therapeutic composition comprises an antisense oligonucleotide ,said antisense oligonucleotide having a length of 12 to 35 bases;said antisense oligonucleotide comprises at least 10 bases that are complementary to a subsequence of at least 10 contiguous bases within SEQ ID No: 91, andsaid subsequence of contiguous bases comprises at least 10 contiguous bases selected from the group consisting of(a) bases 551-580 of SEQ ID NO: 91;(b) bases 661-681 of SEQ ID NO: 91;(c) bases 744-764 of SEQ ID NO: 91;(d) bases 131-161 of SEQ ID NO: 91;(e) bases 241-261 of SEQ ID NO: 91; and(f) bases 361-371 of SEQ ID NO: 91.26. The method of claim 25 , wherein the cancer is bladder cancer.27. The method of claim 25 , wherein the cancer is pancreatic cancer.28. The method of claim 25 , wherein the cancer is lung cancer.29. The method of claim 25 , wherein the cancer is ...

Compositions and Methods for Treatment of Prostate and Other Cancers

Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp27 mRNA, for example human hsp27 mRNA, is administered to an individual suffering from prostate cancer or some other cancer expressing elevated levels of hsp 27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically acceptable carrier, and packaged in dosage unit form. A preferred dosage unit form is an injectable dosage unit form. 124-. (canceled)25. A pharmaceutical composition comprising a therapeutic agent effective to reduce the amount of active hsp27 in cancerous cells exposed to the therapeutic agent , and a pharmaceutically acceptable carrier , wherein the therapeutic agent comprises an RNAi molecule , wherein said RNAi molecule is from 18 to 23 nucleotides in length; wherein said RNAi molecule consists of a single-stranded sequence or two complementary sequences in a double stranded form that is/are the RNA counterpart of sequence of bases of the same length as the RNAi molecule within Seq ID No. 91 or complementary to Seq. ID No. 91.26. The composition of claim 25 , wherein the siRNA comprises the sequence of bases as set forth in any of Seq. ID No. 83-90.27. The composition of claim 25 , wherein the siRNA comprises the sequence of bases as set forth in Seq. ID No. 84.28. The composition of claim 25 , wherein said RNAi molecule consists of a single stranded sequence or two complementary sequences in a double stranded form that is/are the RNA counterpart of sequence of bases of the same length as the RNAi molecule within Seq ID No. 91 and/or is complementary to a series of bases selected from the group consisting of bases 131 ...

Compositions and Methods for Treatment of Prostate and Other Cancers

Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp27 mRNA, for example human hsp27 mRNA, is administered to an individual suffering from prostate cancer or some other cancer expressing elevated levels of hsp 27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically acceptable carrier, and packaged in dosage unit form. A preferred dosage unit form is an injectable dosage unit form. 124-. (canceled)25. An oligonucleotide consisting of the sequence of bases as set forth shown in SEQ ID NO 82 , wherein the oligonucleotide is modified to enhance in vivo stability.26. The oligonucleotide of claim 25 , wherein the oligonucleotide has a phosphorothioate backbone modification.27. The oligonucleotide of claim 25 , wherein the oligonucleotide has an MOE modification.28. A method for treatment of a cancer characterized by elevated expression of hsp27 as compared to non-cancerous tissue of the same type in an individual suffering from the cancer claim 25 , comprising the step of administering to the individual a therapeutic composition effective to reduce the amount of active hsp27 in the cancer cells claim 25 , wherein said therapeutic composition comprises an antisense oligonucleotide consisting of the sequence of bases as set forth shown in SEQ ID NO 82 claim 25 , wherein the oligonucleotide is modified to enhance in vivo stability.29. The method of claim 28 , wherein the cancer is selected from the group consisting of prostate claim 28 , bladder claim 28 , lung claim 28 , breast claim 28 , osteosarcoma claim 28 , pancreatic claim 28 , colon claim 28 , melanoma claim 28 , testicular claim 28 , ...

Derivatized Hyperbranched Polyglycerols

Herein are provided derivatized hyperbranched polyglycerols (“dHPGs”). The dHPG comprises a core comprising a hyperbranched polyglycerol derivatized with CCalkyl chains and a shell comprising at least one hydrophilic substituent bound to hydroxyl groups of the core, wherein the hyperbranched polyglycerol comprises from about 1 to about 200 moles of the at least one hydrophilic substituent. The dHPGs are for use as agents for the delivery of a drug or other biologically active moiety to the urinary tract, the digestive tract, the airways, the vaginal cavity and cervix and the peritoneal cavity to treat indications such as cancer, which may be useful in the treatment of or the manufacture of a medicament, in the preparation, of a pharmaceutical composition for the treatment of cancer, as a pre-treatment or co-treatment to improve drug uptake in a tissue. Furthermore, there are provided methods of making dHPGs. 1114.-. (canceled)115. A hyperbranched polyglycerol comprising:{'sub': 8', '10, 'a core comprising hyperbranched polyglycerol derivatized with Calkyl chains, Calkyl chains, or a combination thereof, wherein the ratio of alkyl chains to glycerol units is greater at a center of the core compared to a periphery of the core; and'}{'sub': 2', '3, 'sup': '+', 'a shell comprising at least one hydrophilic substituent and at least one functional group, wherein the at least one hydrophilic substituent comprises methoxypolyethylene glycol (MePEG), polyethylene glycol (PEG), or a combination thereof, and the at least one functional group comprises —NHor —NH.'}116. The hyperbranched polyglycerol according to claim 115 , wherein the hyperbranched polyglycerol comprises from about 1 to about 200 moles of the at least one functional group per mole of the hyperbranched polyglycerol.117. The hyperbranched polyglycerol according to claim 115 , wherein the hyperbranched polyglycerol comprises from about 1 to about 100 moles of the at least one functional group per mole of the ...

Semaphorin 3c (sema3c) inhibitor therapeutics, methods, and uses

RNAi probes targeting cancer-related proteins

Compositions and methods for treatment of prostate and other cancers

Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp27 mRNA, for example human hsp27 mRNA, is administered to an individual suffering from prostate cancer or some other cancer expressing elevated levels of hsp27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically acceptable carrier, and packaged in dosage unit form. A preferred dosage unit form is an injectable dosage unit form.

RNAi probes targeting cancer-related proteins

RNAi sequences that are useful as therapeutics in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease. These sequences target clusterin, IGFBP-5, IGFBP-2, both IGFBP-2 and -5 simultaneously, Mitf, and B-raf. The invention further provides for the use of these RNAi sequences in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease, and a method of treating such conditions through the administration of the RNA molecules with RNAi activity to an individual, including a human individual in need of such treatment.

Treatment of Cancer by Inhibition of IGFBPs and Clusterin

Agents that reduce the amount of IGFBP-2 and/or IGFBP-5 and that are known to be useful in the treatment of cancer result in increased expression of the protein clusterin. Since clusterin can provide protection against apoptosis, this secondary effect detracts from the efficacy of the therapeutic agent. In overcoming this, the present invention provides a combination of therapeutic agents that is useful in the treatment of cancer. The combination includes an agent that reduces the amount of IGFBP-2 and/or IGFBP-5 and that stimulates expression of clusterin as a secondary effect, and an oligonucleotide that is effective to reduce the amount of clusterin in cancer cells. In some embodiments of the invention, the agent that reduces IGFBP-2 and/or IGFBP-5 is a bispecific antisense species. The oligonucleotide may be an antisense oligonucleotide or an RNAi oligonucleotide.

Rnai probes targeting cancer-related proteins

RNAi sequences that are useful as therapeutics in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease. These sequences target clusterin, IGFBP-5, IGFBP-2, both IGFBP-2 and -5 simultaneously, Mitf, and B-raf. The invention further provides for the use of these RNAi sequences in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease, and a method of treating such conditions through the administration of the RNA molecules with RNAi activity to an individual, including a human individual in need of such treatment.

Rnai probes targeting cancer-related proteins

RNAi sequences that are useful as therapeutics in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease. These sequences target clusterin, IGFBP-5, IGFBP-2, both IGFBP-2 and -5 simultaneously, Mitf, and B-raf. The invention further provides for the use of these RNAi sequences in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease, and a method of treating such conditions through the administration of the RNA molecules with RNAi activity to an individual, including a human individual in need of such treatment.

Treatment of cancer by inhibition of IGFBPs and clusterin

Agents that reduce the amount of IGFBP-2 and/or IGFBP-5 and that are known to be useful in the treatment of cancer result in increased expression of the protein clusterin. Since clusterin can provide protection against apoptosis, this secondary effect detracts from the efficacy of the therapeutic agent. In overcoming this, the present invention provides a combination of therapeutic agents that is useful in the treatment of cancer. The combination includes an agent that reduces the amount of IGFBP-2 and/or IGFBP-5 and that stimulates expression of clusterin as a secondary effect, and an oligonucleotide that is effective to reduce the amount of clusterin in cancer cells. In some embodiments of the invention, the agent that reduces IGFBP-2 and/or IGFBP-5 is a bispecific antisense species. The oligonucleotide may be an antisense oligonucleotide or an RNAi oligonucleotide.

Combination of anti-clusterin oligonucleotide with androgen receptor antagonist for the treatment of prostate cancer

A method for treating a mammalian subject afflicted with prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) an androgen receptor antagonist having the structure (I) or a pharmaceutically acceptable salt thereof, each in an amount that when in combination with the other is effective treat the mammalian subject.

Combination of anti-clusterin oligonucleotide with hsp90 inhibitor for the treatment of prostate cancer

The disclosure relates to the use of an oligonucleotide which reduces clusterin expression and a Heat Shock Protein 90 (Hsp90) inhibitor of the formula shown in the abstract figure for the treatment of prostate cancer. The disclosure also relates to pharmaceutical compositions comprising an amount of an oligonucleotide which reduces clusterin expression, and an Hsp90 inhibitor.

Compositions and methods for treatment of prostate and other cancers

The present invention makes use of therapeutic agents which target heat shoc k protein (hsp) 27 in vivo to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp 27. In accordance with the invention, a therapeutic agent, f or example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp 27 mRNA, for example human hsp 27 mRNA, is administered to an idvidivual suffering from prostate cancer or some other cancer expressing elevated levels of hsp 27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically aceptable carrier, and package d in dosage unit form. A preferred dosage unit form is in injectable dosage un it form.

Combination therapy for cancer using HSP27 inhibitor and EGFR tyrosine kinase inhibitors or anti-folates

Combination therapy for cancer makes use of HSP27 inhibitors and EGFR tyrosine kinase inhibitors or antifolates.

polymeric paste compositions for drug release

Esta invenção provê composições para a liberação controlada localizada de um ou mais fármacos em um indivíduo. Mais particularmente, são descritas aqui composições compreendendo um polímero hidrofóbico insolúvel em água, um glicol biocompatível de baixo peso molecular, e um ou mais fármacos. As composições aqui descritas também podem incluir opcionalmente um copolímero di-bloco e/ou um agente intumescente. This invention provides compositions for the localized controlled release of one or more drugs in an individual. More particularly, compositions comprising a hydrophobic water-insoluble polymer, a low molecular weight biocompatible glycol, and one or more drugs are described herein. The compositions described herein can also optionally include a di-block copolymer and / or an intumescent agent.

Rnai probes targeting cancer-related proteins

RNAi sequences that are useful as therapeutics in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease. These sequences target clusterin, IGFBP-5, IGFBP-2, both IGFBP-2 and -5 simultaneously, Mitf, and B-raf. The invention further provides for the use of these RNAi sequences in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease, and a method of treating such conditions through the administration of the RNA molecules with RNAi activity to an individual, including a human individual in need of such treatment.

Combination of anti-clusterin oligonucleotide with hsp90 inhibitor for the treatment of prostate cancer

Combination therapy for cancer using hsp27 inhibitor and egfr tyrosine kinase inhibitors or anti-folates

Combination therapy for cancer makes use of HSP27 inhibitors and EGFR tyrosine kinase inhibitors or antifolates.

Combination of anti-clusterin oligonucleotide with Hsp90 inhibitor for the treatment of prostate cancer

The present invention provides a method for treating a mammalian subject affected by prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) a Heat Shock Protein 90 (Hsp90) inhibitor each in an amount that when in combination with the other is effective to treat the mammalian subject. The present invention also provides pharmaceutical compositions comprising an amount of an oligonucleotide which reduces clusterin expression, and a Hsp90 inhibitor for use in treating a mammalian subject affected by prostate cancer. Also provided are oligonucleotides which reduce clusterin expression for use in combination with a Hsp90 inhibitor in treating a mammalian subject affected by prostate cancer, and a composition for treating a mammalian subject affected by prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) a Hsp90 inhibitor each in an amount that when in combination with the other is effective to treat the mammalian subject.

Oligonucleotides for treatment of prostate and other cancers

Treatment of melanoma by reduction in clusterin levels

Treatment of melanoma is achieved through reduction in the effective amount of clusterin in melanoma cells. Thus, in accordance with one aspect of the invention, there is provided a method for treatment of melanoma in a mammalian subject, preferably a human, comprising the step of administering to the subject a therapeutic agent effective to reduce the effective amount of clusterin in the melanoma cells. The therapeutic agent may be, for example, an antisense ODN or small inhibitory RNA (siRNA) compound targeted to clusterin. The present invention also provides a method for regulating expression of bcl-xL in a subject or cell line comprising administering to the subject or cell line an agent effective to modulate the amount of clusterin expression. In particular, in clusterin expressing cells, the expression of bcl-xL is down-regulated when the effective amount of clusterin is reduced. Such inhibition is significant because bcl-xL is known to act as an inhibitor of apoptosis.

Combination of anti-clusterin oligonucleotide with androgen receptor antagonist for the treatment of prostate cancer

A method for treating a mammalian subject afflicted with prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) an androgen receptor antagonist having the structure (I) or a pharmaceutically acceptable salt thereof, each in an amount that when in combination with the other is effective treat the mammalian subject.

Polymeric paste compositions for drug delivery

This invention provides compositions for controlled localized release of one or more drugs within a subject. More particularly, described herein are compositions comprising a hydrophobic water-insoluble polymer, a low molecular weight biocompatible glycol, and one or more drugs. The compositions described herein may also optionally include a di-block copolymer and/or a swelling agent.

Semaphorin 3c (sema3c) inhibitor therapeutics, methods, and uses

Provided are methods, uses and pharmaceutical compositions for treatment of prostate cancer with a SEMA3C inhibitor in a biologically effective amount sufficient to cause cell death of a prostate cancer cell or to inhibit proliferation of the prostate cancer cells. The prostate cancer may be an androgen receptor (AR) positive prostate cancer and the SEMA3C inhibitor may be selected from one or more of the following: an antibody, a SEMA3C peptide, an antisense RNA, a siRNA, a shRNA or a small molecule.

Compositions and Methods for Treatment of Prostate and Other Cancers

Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp27 mRNA, for example human hsp27 mRNA, is administered to an individual suffering from prostate cancer or some other cancer expressing elevated levels of hsp27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically acceptable carrier, and packaged in dosage unit form. A preferred dosage unit form is an injectable dosage unit form.

Polymeric paste compositions for drug delivery

This invention provides compositions for controlled localized release of one or more drugs within a subject. More particularly, described herein are compositions comprising a hydrophobic water-insoluble polymer, a low molecular weight biocompatible glycol, and one or more drugs. The compositions described herein may also optionally include a di-block copolymer and/or a swelling agent.

Combination of anti-clusterin oligonucleotide with androgen receptor antagonist for the treatment of prostate cancer

A method for treating a mammalian subject afflicted with prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) an androgen receptor antagonist having the structure (I) or a pharmaceutically acceptable salt thereof, each in an amount that when in combination with the other is effective treat the mammalian subject.

B1SP fusion protein therapeutics, methods, and uses

Provided are methods, uses and pharmaceutical compositions for treatment of cancer with a B1SP fusion protein in a biologically effective amount sufficient to cause cell death of a prostate cancer cell or to inhibit proliferation of the prostate cancer cells. The cancer may be prostate cancer, breast cancer, ovarian cancer, bladder cancer, kidney cancer, glioblastoma or endometrial cancer. The prostate cancer may be an androgen receptor (AR) positive prostate cancer and the B1SP fusion protein may include a sema domain, a structural stabilization domain; and a half life extending moiety.

Clusterin antisense therapy for treatment of cancer

A method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefits in the treatment of cancer comprising administering from 40 to 640 mg anti-clusterin antisense oligonucleotide to a patient in need of treatment for a cancer expressing clusterin is provided. The method may include administering chemotherapeutic agent or agents, radiotherapy, and/or hormone ablation therapy. The invention also encompasses pharmaceutical compositions formulated to provide a dosage of 40 to 640 mg, and use of antisense in formulating a medicament.

Treatment of cancer by inhibition of IGFBPs and clusterin

Agents that reduce the amount of IGFBP-2 and/or IGFBP-5 and that are known to be useful in the treatment of cancer result in increased expression of the protein clusterin. Since clusterin can provide protection against apoptosis, this secondary effect detracts from the efficacy of the therapeutic agent. In overcoming this, the present invention provides a combination of therapeutic agents that is useful in the treatment of cancer. The combination includes an agent that reduces the amount of IGFBP-2 and/or IGFBP-5 and that stimulates expression of clusterin as a secondary effect, and an oligonucleotide that is effective to reduce the amount of clusterin in cancer cells. In some embodiments of the invention, the agent that reduces IGFBP-2 and/or IGFBP-5 is a bispecific antisense species. The oligonucleotide may be an antisense oligonucleotide or an RNAi oligonucleotide.

Clusterin antisense therapy for treatment of cancer

A method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefits in the treatment of cancer comprising administering from 40 to 640 mg anti-clusterin antisense oligonucleotide to a patient in need of treatment for a cancer expressing clusterin is provided. The method may include administering chemotherapeutic agent or agents, radiotherapy, and/or hormone ablation therapy. The invention also encompasses pharmaceutical compositions formulated to provide a dosage of 40 to 640 mg, and use of antisense in formulating a medicament.

B1SP fusion protein therapeutics, methods, and uses

Provided are methods, uses and pharmaceutical compositions for treatment of cancer with a B1SP fusion protein in a biologically effective amount sufficient to cause cell death of a prostate cancer cell or to inhibit proliferation of the prostate cancer cells. The cancer may be prostate cancer, breast cancer, ovarian cancer, bladder cancer, kidney cancer, glioblastoma or endometrial cancer. The prostate cancer may be an androgen receptor (AR) positive prostate cancer and the B1SP fusion protein may include a sema domain, a structural stabilization domain; and a half life extending moiety.

Compositions and methods for treatment of prostate and other cancers

Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp27 mRNA, for example human hsp27 mRNA, is administered to an individual suffering from prostate cancer or some other cancer expressing elevated levels of hsp 27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically acceptable carrier, and packaged in dosage unit form. A preferred dosage unit form is an injectable dosage unit form.

Treatment of melanoma by reduction in clusterin levels

Treatment of melanoma is achieved through reduction in the effective amount of clusterin in melanoma cells of in a mammalian subject, preferably a human. A therapeutic agent effective to reduce the effective amount of clusterin in the melanoma cells is administered to the subject. The therapeutic agent may be, for example, an antisense ODN or small inhibitory RNA (siRNA) compound targeted to clusterin. bcl-xL in a subject or cell line can also be regulated by administering to the subject or cell line an agent effective to modulate the amount of clusterin expression. In particular, in clusterin expressing cells, the expression of bcl-xL is down-regulated when the effective amount of clusterin is reduced. Such inhibition is significant because bcl-xL is known to act as an inhibitor of apoptosis.

Polymeric paste compositions for drug delivery

This invention provides compositions for controlled localized release of one or more drugs within a subject. More particularly, described herein are compositions comprising a hydrophobic water-insoluble polymer, a low molecular weight biocompatible glycol, and one or more drugs. The compositions described herein may also optionally include a di-block copolymer and/or a swelling agent.

Polymeric paste compositions for drug delivery

This invention provides compositions for controlled localized release of one or more drugs within a subject. More particularly, described herein are compositions comprising a hydrophobic water-insoluble polymer, a low molecular weight biocompatible glycol, and one or more drugs. The compositions described herein may also optionally include a di-block copolymer and/or a swelling agent.

Monocarboxylate transporter 4 (mct4) antisense oligonucleotide (aso) inhibitors for use as therapeutics in the treatment of cancer

Provided herein are compositions, method and uses for modulating MCT4 activity or for the treatment of cancer. The compositions comprise antisense oligonucleotides (ASO) for administration to a cancer cell, wherein the cancer cell may be characterized by elevated expression of MCT4. The cancer may be selected from one or more of: prostate cancer; renal cell carcinoma; breast cancer; cervical cancer; liver cancer; bladder cancer; and small cell lung cancer pr. The prostate cancer may be castration-resistant prostate cancer (CRPC).

Bispecific oligonucleotide for the treatment of cns malignancies

Pharmaceutical compositions for treatment of CNS malignancies comprising a sequence of bases that is complementary to portions of both the gene encoding IGFBP-2 and the gene encoding IGFBP-5 are provided. Methods of using the pharmaceutical composition in the treatment of CNS malignancy via various modes of administration are also provided.

Bispecific oligonucleotide for the treatment of cns malignancies

Pharmaceutical compositions for treatment of CNS malignancies comprising a sequence of bases that is complementary to portions of both the gene encoding IGFBP-2 and the gene encoding IGFBP-5 are provided. Methods of using the pharmaceutical composition in the treatment of CNS malignancy via various modes of administration are also provided.

Bispecific oligonucleotide for the treatment of cns malignancies

Pharmaceutical compositions for treatment of CNS malignancies comprising a sequence of bases that is complementary to portions of both the gene encoding IGFBP-2 and the gene encoding IGFBP-5 are provided. Methods of using the pharmaceutical composition in the treatment of CNS malignancy via various modes of administration are also provided.

Bispecific oligonucleotide for the treatment of cns malignancies

Pharmaceutical compositions for treatment of CNS malignancies comprising a sequence of bases that is complementary to portions of both the gene encoding IGFBP-2 and the gene encoding IGFBP-5 are provided. Methods of using the pharmaceutical composition in the treatment of CNS malignancy via various modes of administration are also provided.

Mucoadhersive polymeric drug delivery compositions and methods

Tratamientos, métodos y usos de la proteína de fusión B1SP

Se proporcionan métodos, usos y composiciones farmacéuticas para el tratamiento del cáncer con una proteína de fusión B1SP en una cantidad biológicamente eficaz suficiente para provocar la muerte celular de una célula de cáncer de próstata o para inhibir la proliferación de las células de cáncer de próstata. El cáncer puede ser cáncer de próstata, cáncer de mama, cáncer de ovario, cáncer de vejiga, cáncer de riñón, glioblastoma o cáncer de endometrio. El cáncer de próstata puede ser un cáncer de próstata positivo para receptor de andrógenos (AR) y la proteína de fusión B1SP puede incluir un dominio sema, un dominio de estabilización estructural; fracción que prolonga la vida media. (Traducción automática con Google Translate, sin valor legal)

Dual targeting antisense oligonucleotides as apoptotic inhibtor therapeutic compostions and methods for their use in the treatment of cancer

Provided herein are compositions, method and uses for modulating IAP activity or for the treatment of cancer. The compositions comprise dual-targeting antisense oligonucleotides (dASO) for administration to a cancer cell, wherein the cancer cell may be characterized by elevated expression of one of more of BIRC6, cIAP1 or survivin. The cancer may be selected from one or more of: prostate cancer; childhood de novo acute myeloid leukemia; colorectal cancer; neuroblastoma; melanoma; and non-small cell lung cancer. The prostate cancer may be castration-resistant prostate cancer (CRPC).

Combination therapy for cancer using HSP27 inhibitor and EGFR tyrosine kinase inhibitors or anti-folates

Combination therapy for cancer makes use of HSP27 inhibitors and EGFR tyrosine kinase inhibitors or etiolates.

Compositions and methods for treatment of prostate and other cancers

Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp27 mRNA, for example human hsp27 mRNA, is administered to an individual suffering from prostate cancer or some other cancer expressing elevated levels of hsp 27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically acceptable carrier, and packaged in dosage unit form. A preferred dosage unit form is an injectable dosage unit form.

Derivatized hyperbranched polyglycerols

Herein are provided derivatized hyperbranched polyglycerols (“dHPGs”). The dHPG comprises a core comprising a hyperbranched polyglycerol derivatized with C 1 C 20 alkyl chains and a shell comprising at least one hydrophilic substituent bound to hydroxyl groups of the core, wherein the hyperbranched polyglycerol comprises from about 1 to about 200 moles of the at least one hydrophilic substituent. The dHPGs are for use as agents for the delivery of a drug or other biologically active moiety to the urinary tract, the digestive tract, the airways, the vaginal cavity and cervix and the peritoneal cavity to treat indications such as cancer, which may be useful in the treatment of or the manufacture of a medicament, in the preparation, of a pharmaceutical composition for the treatment of cancer, as a pre-treatment or co-treatment to improve drug uptake in a tissue. Furthermore, there are provided methods of making dHPGs.

Combination of anti-clusterin oligonucleotide with Hsp90 inhibitor for the treatment of prostate cancer

The present invention provides a method for treating a mammalian subject affected by prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) a Heat Shock Protein 90 (Hsp90) inhibitor each in an amount that when in combination with the other is effective to treat the mammalian subject. The present invention also provides pharmaceutical compositions comprising an amount of an oligonucleotide which reduces clusterin expression, and a Hsp90 inhibitor for use in treating a mammalian subject affected by prostate cancer. Also provided are oligonucleotides which reduce clusterin expression for use in combination with a Hsp90 inhibitor in treating a mammalian subject affected by prostate cancer, and a composition for treating a mammalian subject affected by prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) a Hsp90 inhibitor each in an amount that when in combination with the other is effective to treat the mammalian subject.

Compositions and methods for treatment of prostate and other cancers

Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp27 mRNA, for example human hsp27 mRNA, is administered to an individual suffering from prostate cancer or some other cancer expressing elevated levels of hsp 27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically acceptable carrier, and packaged in dosage unit form. A preferred dosage unit form is an injectable dosage unit form.