GENERATION OF TRANSGENIC CANOLA WITH LOW OR NO SATURATED FATTY ACIDS
This application is a continuation of co-pending application U.S. patent application Ser. No. 14/578,008, filed Dec. 19, 2014, which is a continuation-in-part of co-pending application U.S. patent application Ser. No. 13/168,742, filed Jun. 24, 2011, which is a continuation-in-part of co-pending application U.S. patent application Ser. No. 11/576,750, which is a national phase entry of PCT International Patent Application No. PCT/US05/36052, filed Oct. 7, 2005, designating the United States of America, and published, in English, as PCT International Publication No. WO 2006/042049 A2 on Apr. 20, 2006. PCT International Patent Application No. PCT/US05/36052 is a continuation of U.S. Provisional Patent Application No. 60/617,532, filed Oct. 8, 2004. The contents of the entirety of each of the foregoing are hereby incorporated in their entireties herein by this reference. Some embodiments generally relate to certain delta-9 desaturase enzymes, nucleic acids encoding these enzymes, and methods of expressing the same in a plant cell. Some embodiments relate to utilizing the activity of certain delta-9 desaturase enzymes to decrease the percent composition of saturated fatty acids in plant materials (e.g., seed) and increasing the percent composition of ω-7 fatty acids. Further embodiments relate to utilizing seed-specific promoters to preferentially express delta-9 desaturase enzymes in seeds. Also disclosed herein are plants and plant materials produced by methods in particular embodiments, and oil produced by those plants which contains less than 3.5% or less than 2.7% saturated fatty acids. Vegetable-derived oils have gradually replaced animal-derived oils and fats as the major source of dietary fat intake. However, saturated fat intake in most industrialized nations has remained at about 15% to 20% of total caloric consumption. In efforts to promote healthier lifestyles, the United States Department of Agriculture (USDA) has recently recommended that saturated fats make up less than 10% of daily caloric intake. To facilitate consumer awareness, current labeling guidelines issued by the USDA now require total saturated fatty acid levels be less than 1.0 g per 14 g serving to receive the “low-sat” label and less than 0.5 g per 14 g serving to receive the “no-sat” label. This means that the saturated fatty acid content of plant oils needs to be less than 7% and 3.5% to receive the “low-sat” or “no-sat” label, respectively. Since issuance of these guidelines, there has been a surge in consumer demand for “low-sat” and “no-sat” oils. To date, this demand has been met principally with canola oil, and to a much lesser degree with sunflower and safflower oils. While unsaturated fats (monounsaturated and polyunsaturated) are beneficial (especially when consumed in moderation), saturated and trans fats are not. Saturated fat and trans fat raise undesirable LDL cholesterol levels in the blood. Dietary cholesterol also raises LDL cholesterol and may contribute to heart disease even without raising LDL. Therefore, it is advisable to choose foods low in saturated fat, trans fat, and cholesterol as part of a healthful diet. The characteristics of oils, whether of plant or animal origin, are determined predominately by the number of carbon and hydrogen atoms in the oil molecule, as well as the number and position of double bonds comprised in the fatty acid chain. Most oils derived from plants are composed of varying amounts of palmitic (16:0), stearic (18:0), oleic (18:1), linoleic (18:2) and linolenic (18:3) fatty acids. Conventionally, palmitic and stearic acids are designated as “saturated,” because their carbon chains are saturated with hydrogen atoms, and hence have no double bonds; they contain the maximal number of hydrogen atoms possible. However, oleic, linoleic, and linolenic acids are 18-carbon fatty acid chains having one, two, and three double bonds, respectively, therein. Oleic acid is typically considered a monounsaturated fatty acid, whereas linoleic and linolenic are considered to be polyunsaturated fatty acids. The U.S.D.A. definition of “no sat” oil products, meaning those having less than 3.5% saturated fatty acid content, is calculated as the combined saturated fatty acid content by weight (as compared to the total amount of fatty acids). Canola oil has the lowest level of saturated fatty acids of all vegetable oils. “Canola” refers to rapeseed ( It is postulated that, in oilseeds, fatty acid synthesis occurs primarily in the plastid. The major product of fatty acid synthesis is palmitate (16:0), which appears to be efficiently elongated to stearate (18:0). While still in the plastid, the saturated fatty acids may then be desaturated by an enzyme known as acyl-ACP delta-9 desaturase, to introduce one or more carbon-carbon double bonds. Specifically, stearate may be rapidly desaturated by a plastidial delta-9 desaturase enzyme to yield oleate (18:1). In fact, palmitate may also be desaturated to palmitoleate (16:1) by the plastidial delta-9 desaturase, but this fatty acid appears in only trace quantities (0-0.2%) in most vegetable oils. Thus, the major products of fatty acid synthesis in the plastid are palmitate, stearate, and oleate. In most oils, oleate is the major fatty acid synthesized, as the saturated fatty acids are present in much lower proportions. Newly-synthesized fatty acids are exported from the plastid to the cytoplasm. Subsequent desaturation of plant fatty acids in the cytoplasm appears to be limited to oleate, which may be desaturated to linoleate (18:2) and linolenate (18:3) by microsomal desaturases acting on oleoyl or lineoleoyl substrates esterified to phosphatidyl choline (PC). In addition, depending on the plant, oleate may be further modified by elongation (to 20:1, 22:1, and/or 24:1), or by the addition of functional groups. These fatty acids, along with the saturated fatty acids, palmitate and stearate, are then assembled into triglycerides in endoreticular membranes. The plant acyl-ACP delta-9 desaturase enzyme is soluble. It is located in the plastid stroma, and uses newly-synthesized fatty acids esterified to ACP, predominantly stearyl-ACP, as substrates. This is in contrast to the other delta-9 desaturase enzymes, which are located in the endoplasmic reticular membrane (ER, or microsomal), use fatty acids esterified to Co-A as substrates, and desaturate both the saturated fatty acids, palmitate and stearate. U.S. Pat. Nos. 5,723,595 and 6,706,950 relate to a plant desaturase. The yeast delta-9 desaturase gene has been isolated from A different fungal acyl-CoA delta-9 desaturase from Disclosed herein are novel fungal delta-9 desaturase enzymes; nucleic acids comprising at least one nucleotide sequence encoding such a desaturase; and plants, plant materials (e.g., seed), plant parts, and plant commodity products comprising either of the foregoing. Aspects of some embodiments are exemplified by fungal delta-9 desaturase enzymes isolated from Some embodiments comprise an isolated nucleic acid molecule encoding a delta-9 desaturase enzyme comprising an amino acid sequence being at least 80% identical to a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28 SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, and SEQ ID NO:33. In particular examples, the nucleic acid molecule comprises a sequence being at least 60% identical to a sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:25. These and further embodiments may include an isolated delta-9 desaturase polypeptide comprising an amino acid sequence being at least 80% identical to a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28 SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, and SEQ ID NO:33. Also disclosed are methods of expressing at least one of the aforementioned nucleic acids and/or polypeptides in a plant cell. Particular embodiments take advantage of a delta-9 desaturase enzyme's activity, such that the percent composition of saturated fatty acids may be decreased in a plant, plant material (e.g., seed), and/or plant part comprising the plant cell, and/or a plant commodity product produced from any of the foregoing. In certain embodiments, ω-7 fatty acids may concomitantly be increased in the plant, plant material, plant part, and/or plant commodity product. Further embodiments take advantage of seed-specific expression to further lower the level of saturated fatty acids in seed oil. Some embodiments include a method for decreasing the amount of saturated fatty acids in a plant, plant material, plant part, and/or plant commodity product, the method comprising transforming a plant cell with a nucleic acid molecule encoding a delta-9 desaturase polypeptide of the invention, such that the amount of saturated fatty acids in the cell is decreased. Some embodiments include a method for creating a genetically engineered plant that comprises decreased amounts of saturated fatty acids in the plant compared to a wild-type plant of the same species. Such a method may comprise transforming a plant material (or plant cell) with a nucleic acid molecule encoding one or more delta-9 desaturase polypeptides, or one or more copies of a delta-9 desaturase polypeptide of the invention, and culturing the transformed plant material (or plant cell) to obtain a plant. In particular examples, a plant cell and/or plant material from an The foregoing and other features will become more apparent from the following detailed description of several embodiments, which proceeds with reference to the accompanying figures. The nucleic acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, as defined in 37 C.F.R. §1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand. In the accompanying sequence listing: SEQ ID NO:1 shows the amino acid sequence of SEQ ID NO:2 shows the nucleic acid sequence of the v3 of the SEQ ID NO:3 shows the nucleic acid sequence the first plant transcription unit (PTU) of pDAB7305. SEQ ID NO:4 shows the nucleic acid sequence of the second PTU of pDAB7305. SEQ ID NO:5 shows the nucleic acid sequence of the third PTU of pDAB7305. SEQ ID NOs:6-11 show the sequence of primers and probes that may be useful in some embodiments. SEQ ID NO:12 is an exemplary fragment of a SEQ ID NO:13 is an exemplary intronless MgD9DS clone SEQ ID NO:14 shows an exemplary nucleic acid sequence encoding a first SEQ ID NO:15 shows an exemplary nucleic acid sequence encoding a second exemplary SEQ ID NO:16 shows a coding region from an exemplary native delta-9 desaturase gene from SEQ ID NO:17 shows a coding region from an exemplary native delta-9 desaturase gene from SEQ ID NO:18 shows a coding region from an exemplary native delta-9 desaturase (LnD9DS-2 v1) gene from SEQ ID NO:19 shows the sequence of an exemplary canola-optimized delta-9 desaturase gene from SEQ ID NO:20 shows the sequence of an exemplary canola-optimized delta-9 desaturase gene from SEQ ID NO:21 shows the sequence of an exemplary canola-optimized delta-9 desaturase gene from SEQ ID NO:22 shows the sequence of a further exemplary canola-optimized delta-9 desaturase gene from SEQ ID NO:23 shows the sequence of a further exemplary canola-optimized delta-9 desaturase gene from SEQ ID NO:24 shows an exemplary nucleic acid sequence encoding an SEQ ID NO:25 shows a second exemplary nucleic acid sequence encoding an SEQ ID NO:26 shows the amino acid sequence of an exemplary native delta-9 desaturase from SEQ ID NO:27 shows the amino acid sequence of an exemplary native delta-9 desaturase from SEQ ID NO:28 shows the amino acid sequence of an exemplary native delta-9 desaturase from SEQ ID NO:29 shows the amino acid sequence encoded by nucleic acids as exemplified by SEQ ID NOs:24-25 (AnD9DS). SEQ ID NO:30 shows the amino acid sequence of another exemplary AnD9DS desaturase. SEQ ID NO:31 shows the amino acid sequence of an exemplary native delta-9 desaturase (ScOLE1) from SEQ ID NO:32 shows the N-terminal 68 residues (1-68) of an exemplary AnD9DS desaturase. SEQ ID NO:33 shows the C-terminal 175 residues (281-455) of an exemplary AnD9DS desaturase. We previously introduced a fungal acyl-CoA delta-9 desaturase from Disclosed herein are nucleic acid molecules encoding a delta-9 desaturase polypeptide comprising a nucleotide sequence being at least 60% identical to a sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:25. In some embodiments, the nucleic acid molecule may further comprise a gene regulatory element operably linked to the delta-9 desaturase polypeptide-encoding sequence. In particular embodiments, a gene regulatory element may be a phaseolin promoter, a phaseolin 5′ untranslated region, a phaseolin 3′ untranslated region (“UTR”), an In some embodiments, there may be several copies of the nucleic acid molecules encoding a delta-9 desaturase polypeptide, and each may be under the regulatory control of a different set of regulatory elements. More specifically, the gene regulatory elements may be phaseolin promoter and phaseolin 5′ UTR, and Also disclosed are delta-9 desaturase polypeptides comprising an amino acid sequence being at least 80% identical to a sequence selected from the group consisting of SEQ ID NO:1 as well as nucleic acid molecules encoding such delta-9 desaturase polypeptides, such as SEQ ID NO:2. In some embodiments, nucleic acid molecules and delta-9 desaturase polypeptides may be expressed in a plant material, cell, tissue, or whole plant, to decrease the amount of saturated fatty acids in the plant material, cells, tissues, or whole plants, relative to the amount observed in a wild-type plant of the same species. Alternative embodiments of the invention include methods for decreasing the amount of saturated fatty acids in the plant material, cell, tissue, or whole plant. Such methods may comprise transforming a plant material, cell, tissue, or whole plant with at least one of the aforementioned nucleic acid molecules, such that the amount of saturated fatty acids in the plant material, cell, tissue, or whole plant is decreased. Particular embodiments include methods for preferentially decreasing palmitic and/or stearic fatty acids in a plant material, cell, tissue, or whole plant. Methods disclosed herein may be performed, for example, on plants, or plant materials derived from plants (e.g., plants of the genus Fatty acid: As used herein, the term “fatty acid” refers to long chain aliphatic acids (alkanoic acids) of varying chain lengths, for example, from about C12 to C22, although both longer and shorter chain-length acids are known. The structure of a fatty acid is represented by the notation, x:yΔz, where “x” is the total number of carbon (C) atoms in the particular fatty acid, and “y” is the number of double bonds in the carbon chain in the position “z,” as counted from the carboxyl end of the acid. Metabolic pathway: The term, “metabolic pathway,” refers to a series of chemical reactions occurring within a cell, catalyzed by enzymes, to achieve either the formation of a metabolic product, or the initiation of another metabolic pathway. A metabolic pathway may involve several or many steps, and may compete with a different metabolic pathway for specific reaction substrates. Similarly, the product of one metabolic pathway may be a substrate for yet another metabolic pathway. Metabolic engineering: For the purposes of the present invention, “metabolic engineering” refers to the rational design of strategies to alter one or more metabolic pathways in a cell, such that the step-by-step modification of an initial substance into a product having the exact chemical structure desired is achieved within the overall scheme of the total metabolic pathways operative in the cell. Desaturase: As used herein, the term “desaturase” refers to a polypeptide that can desaturate (i.e. , introduce a double bond) in one or more fatty acids to produce a fatty acid or precursor of interest. A plant-soluble fatty acid desaturase enzyme may introduce a double bond regiospecifically into a saturated acyl-ACP substrate. Acyl-CoA desaturases introduce a double bond regiospecifically into a saturated fatty acyl-CoA substrate. The reaction involves activation of molecular oxygen by a two-electron reduced diiron center coordinated by a four-helix bundle that forms the core of the desaturase architecture. Of particular interest in some embodiments are acyl-CoA delta-9 desaturases. The delta-9-18:01-ACP desaturase is required by all plants for the maintenance of membrane fluidity. While this enzyme primarily desaturates stearoyl-ACP, it is also active to a minor extent with palmitoyl-ACP. Progeny plant: For the purposes of the present invention, “progeny plant,” refers to any plant, or plant material obtained therefrom, that may be obtained by plant breeding methods. Plant breeding methods are well-known in the art, and include natural breeding, artificial breeding, selective breeding involving DNA molecular marker analysis, transgenics, and commercial breeding. Plant material: As used herein, the term “plant material” refers to any cell or tissue obtained from a plant. Nucleic acid molecule: A polymeric form of nucleotides, which can include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. A nucleotide refers to a ribonucleotide, deoxynucleotide, or a modified form of either type of nucleotide. A “nucleic acid molecule” as used herein is synonymous with “nucleic acid” and “polynucleotide.” The term includes single- and double-stranded forms of DNA. A nucleic acid molecule can include either or both naturally occurring and modified nucleotides linked together by naturally occurring and/or non-naturally occurring nucleotide linkages. Nucleic acid molecules can be modified chemically or biochemically, or can contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of ordinary skill in the art. Such modification include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications, such as uncharged linkages (for example, methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (for example, phosphorothioates, phosphorodithioates, etc.), pendent moieties (for example, peptides), intercalators (for example, acridine, psoralen, etc.), chelators, alkylators, and modified linkages (for example, alpha anomeric nucleic acids, etc.). The term “nucleic acid molecule” also includes any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpinned, circular and padlocked conformations. Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. When recombinantly produced, operably linked nucleic acid sequences are generally contiguous and, where necessary to join two protein-coding regions, in the same reading frame. However, nucleic acids need not be contiguous to be operably linked. Regulatory element: As used herein, the term “regulatory element” refers to a nucleic acid molecule having gene regulatory activity; i.e., one that has the ability to affect the transcription or translation of an operably-linked transcribable nucleic acid molecule. Regulatory elements such as promoters, leaders, introns, and transcription termination regions are non-coding nucleic acid molecules having gene regulatory activity which play an integral part in the overall expression of genes in living cells. Isolated regulatory elements that function in plants are therefore useful for modifying plant phenotypes through the techniques of molecular engineering. By “regulatory element,” it is intended a series of nucleotides that determines if, when, and at what level a particular gene is expressed. The regulatory DNA sequences specifically interact with regulatory proteins or other proteins. As used herein, the term “gene regulatory activity” refers to a nucleic acid molecule capable of affecting transcription or translation of an operably linked nucleic acid molecule. An isolated nucleic acid molecule having gene regulatory activity may provide temporal or spatial expression or modulate levels and rates of expression of the operably linked nucleic acid molecule. An isolated nucleic acid molecule having gene regulatory activity may comprise a promoter, intron, leader, or 3′ transcriptional termination region. Promoters: As used herein, the term “promoter” refers to a nucleic acid molecule that is involved in recognition and binding of RNA polymerase II or other proteins such as transcription factors (trans-acting protein factors that regulate transcription) to initiate transcription of an operably linked gene. Promoters may themselves contain sub-elements such as cis-elements or enhancer domains that effect the transcription of operably linked genes. A “plant promoter” is a native or non-native promoter that is functional in plant cells. A plant promoter can be used as a 5′ regulatory element for modulating expression of an operably linked gene or genes. Plant promoters may be defined by their temporal, spatial, or developmental expression pattern. The nucleic acid molecules described herein may comprise nucleic acid sequences comprising promoters. Sequence identity: The term “sequence identity” or “identity,” as used herein in the context of two nucleic acid or polypeptide sequences, may refer to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins, it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge, hydrophobicity, or steric effects), and therefore do not change the functional properties of the molecule. Therefore, when sequences differ by conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution at the site of the non-identical residue. Sequences that differ by such conservative substitutions are said to have “sequence similarity” or “similarity.” Techniques for making this adjustment are well known to those of ordinary skill in the art. Typically, such techniques involve scoring a conservative substitution as a partial, rather than a full, mismatch, thereby increasing the percentage sequence identity. For example, where an identical amino acid is given a score between 0 and 1, and a non-conservative substitution is given a score of 0, a conservative substitution is given a score between 0 and 1. The scoring of conservative substitutions may be calculated, for example, as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif.). As used herein, the term “percentage of sequence identity” may refer to the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleotide or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percentage of sequence identity. Analogous position in an amino acid sequence: Nucleic acid and amino acid sequences may be aligned by the methods described in the following paragraphs. When aligned, a position in one sequence is in “an analogous position” with a position in the aligned sequence if the positions are identical within the consensus sequence. Methods for aligning sequences for comparison are well-known in the art. Various programs and alignment algorithms are described in: Smith and Waterman, The National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) is available on the Internet (at blast.ncbi.nlm.nih.gov/Blast.cgi), for use in connection with sequence-analysis programs, for example, blastp and blastn. A description of how to determine sequence identity using this program is available on the Internet through NCBI at blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs. For comparisons of amino acid sequences, the “Blast 2 sequences” function of the BLAST program (b12seq) is employed using the default parameters. Specific parameters may be adjusted within the discretion of one of skill in the art, to for example, provide a penalty for a mismatch or reward for a match. Transformed: As used herein, the term “transformed” refers to a cell, tissue, organ, or organism into which has been introduced a foreign nucleic acid molecule, such as a construct. The introduced nucleic acid molecule may be integrated into the genomic DNA of the recipient cell, tissue, organ, or organism such that the introduced polynucleotide molecule is inherited by subsequent progeny. A “transgenic” or “transformed” cell or organism also includes progeny of the cell or organism and progeny produced from a breeding program employing such a transgenic plant as a parent in, for example, a cross and exhibiting an altered phenotype resulting from the presence of a foreign nucleic acid molecule. An embodiment of the invention includes introducing delta-9 desaturases with specific acyl-CoA preferences (for example, for palmitic or stearic acid) in plant seeds. The specific acyl-CoA preference of the delta-9 desaturase enables targeting of certain specific saturated fatty acid pools (e.g., palmitate for conversion to monounsaturated products). Acyl-CoA delta-9 desaturases were selected for lowering the saturated fatty acid content in plants as they are not normally produced in plant systems to any appreciable extent. Polypeptides according to some embodiments of the present invention comprise an amino acid sequence showing increasing percentage identities when aligned with a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28 SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, and SEQ ID NO:33. Specific amino acid sequences within these and other embodiments may comprise sequences having, for example, at least about 70%, about 75%, about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% 96%, 97%, 98%, 99%, or 100% identity with the aforementioned sequences. In many embodiments, the amino acid sequence having the aforementioned sequence identity when aligned with the aforementioned sequences encode a peptide with enzymatic delta-9-18:0-ACP desaturase activity, or part of a such a peptide. C. Nucleic acids Some embodiments include nucleic acid molecules encoding a polypeptide described above. For example, nucleic acid sequences in some embodiments show increasing percentage identities when aligned with a sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:25. Specific nucleic acid sequences within these and other embodiments may comprise sequences having, for example, at least about 60%, about 65%, about 70%, about 75%, about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% 96%, 97%, 98%, 99%, or 100% identity with a sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:25. It is understood by those of ordinary skill in the art that nucleic acid molecules may be modified without substantially changing the amino acid sequence of an encoded polypeptide, for example, by introducing permissible nucleotide substitutions according to codon degeneracy. In some embodiments, nucleic acid molecules of the present invention comprise a gene regulatory element (e.g., a promoter). Promoters may be selected on the basis of the cell type into which the vector construct will be inserted. Promoters which function in bacteria, yeast, and plants are well-known in the art. The promoters may also be selected on the basis of their regulatory features. Examples of such features include enhancement of transcriptional activity, inducibility, tissue-specificity, and developmental stage-specificity. In plants, promoters that are inducible, of viral or synthetic origin, constitutively active, temporally regulated, and spatially regulated have been described. See, e.g., Poszkowski et al. (1989) Useful inducible promoters include, for example, promoters induced by salicylic acid or polyacrylic acids induced by application of safeners (substituted benzenesulfonamide herbicides), heat-shock promoters, a nitrate-inducible promoter derived from the spinach nitrate reductase transcribable nucleic acid molecule sequence, hormone-inducible promoters, and light-inducible promoters associated with the small subunit of RuBP carboxylase and LHCP families. Examples of useful tissue-specific, developmentally-regulated promoters include the β-conglycinin 7Sa promoter and seed-specific promoters. Plant functional promoters useful for preferential expression in seed plastid include those from proteins involved in fatty acid biosynthesis in oilseeds and from plant storage proteins. Examples of such promoters include the 5′ regulatory regions from such transcribable nucleic acid molecule sequences as phaseolin, napin, zein, soybean trypsin inhibitor, ACP, stearoyl-ACP desaturase, and oleosin. Another exemplary tissue-specific promoter is the lectin promoter, which is specific for seed tissue. More specifically, promoters may include the Other useful promoters include the nopaline synthase, mannopine synthase, and octopine synthase promoters, which are carried on tumor-inducing plasmids of To obtain higher expression of a heterologous gene(s), it may be preferred to reengineer the gene(s) so that it is more efficiently expressed in the expression host cell (e.g., a plant cell, for example, canola, rice, tobacco, maize, cotton, and soybean). Therefore, an optional additional step in the design of a gene encoding a delta-9 desaturase for plant expression (i.e., in addition to the provision of one or more gene regulatory elements) is reengineering of a heterologous gene protein coding region for optimal expression. Particular embodiments include redesigned genes that have been optimized to increase the expression level (i.e. produce more protein) in a transgenic canola plant cell or Due to the plasticity afforded by the redundancy/degeneracy of the genetic code (i.e., some amino acids are specified by more than one codon), evolution of the genomes in different organisms or classes of organisms has resulted in differential usage of synonymous codons. This “codon bias” is reflected in the mean base composition of protein coding regions. For example, organisms having genomes with relatively low G+C contents utilize more codons having A or T in the third position of synonymous codons, whereas those having higher G+C contents utilize more codons having G or C in the third position. Further, it is thought that the presence of “minor” codons within an mRNA may reduce the absolute translation rate of that mRNA, especially when the relative abundance of the charged tRNA corresponding to the minor codon is low. An extension of this reasoning is that the diminution of translation rate by individual minor codons would be at least additive for multiple minor codons. Therefore, mRNAs having high relative contents of minor codons in a particular expression host would have correspondingly low translation rates. This rate may be reflected by correspondingly low levels of the encoded protein. In engineering optimized genes encoding a delta-9 desaturase for expression in canola or The codon bias is the statistical distribution of codons that the expression host (e.g., a plant such as canola or In designing optimized coding regions for plant expression of delta-9 desaturase genes, the primary (“first choice”) codons preferred by the plant should be determined, as well as the second, third, fourth etc. choices of preferred codons when multiple choices exist. A new DNA sequence can then be designed which encodes the amino sequence of the delta-9 desaturase gene, wherein the new DNA sequence differs from the native DNA sequence (encoding the desaturase) by the substitution of expression host-preferred (first preferred, second preferred, third preferred, or fourth preferred, etc.) codons to specify the amino acid at each position within the amino acid sequence. The new sequence is then analyzed for restriction enzyme sites that might have been created by the modifications. The identified putative restriction sites are further modified by replacing these codons with a next-preferred codon to remove the restriction site. Other sites in the sequence which may affect transcription or translation of heterologous sequence are exon:intron junctions (5′ or 3′), poly-A addition signals, and/or RNA polymerase termination signals. The sequence may be further analyzed and modified to reduce the frequency of TA or CG doublets. In addition to these doublets, sequence blocks that have more than about six G or C nucleotides that are the same may also adversely affect transcription or translation of the sequence. Therefore, these blocks are advantageously modified by replacing the codons of first or second choice, etc. with the next-preferred codon of choice. The method described above enables one skilled in the art to modify gene(s) that are foreign to a particular plant so that the genes are optimally expressed in plants. The method is further illustrated in PCT application WO 97/13402. Thus, optimized synthetic genes that are functionally equivalent to desaturases/genes of some embodiments may be used to transform hosts, including plants. Additional guidance regarding the production of synthetic genes can be found in, for example, U.S. Pat. No. 5,380,831. Once a plant-optimized DNA sequence has been designed on paper or in silico, actual DNA molecules can be synthesized in the laboratory to correspond in sequence precisely to the designed sequence. Such synthetic DNA molecules may be cloned and otherwise manipulated exactly as if they were derived from natural or native sources. Some embodiments are directed to a method of producing a transformed cell that comprises one or more nucleic acid molecule(s) comprising a nucleic acid sequence at least 60% identical to a sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:25. Such nucleic acid molecules may also comprise, for example, non-coding regulatory elements, such as promoters. Other sequences may also be introduced into the cell along with the non-coding regulatory elements and transcribable nucleic acid molecule sequences. These other sequences may include 3′ transcriptional terminators, 3′ poly-adenylation signals, other untranslated sequences, transit or targeting sequences, selectable markers, enhancers, and operators. A method of transformation generally comprises the steps of selecting a suitable host cell, transforming the host cell with a recombinant vector, and obtaining the transformed host cell. Technology for introduction of DNA into cells is well-known to those of skill in the art. These methods can generally be classified into five categories: (1) chemical methods (Graham and Van der Eb (1973) The most commonly used methods for transformation of plant cells are: the To select or score for transformed plant cells regardless of transformation methodology, the DNA introduced into the cell may contain a gene that functions in a regenerable plant tissue to produce a compound that confers upon the plant tissue resistance to an otherwise toxic compound. Genes of interest for use as a selectable, screenable, or scorable marker include, but are not limited to, β-glucuronidase (GUS), green fluorescent protein (GFP), luciferase, and antibiotic or herbicide tolerance genes. Examples of antibiotic resistance genes include genes conferring resistance to the penicillins, kanamycin (and neomycin, G418, bleomycin); methotrexate (and trimethoprim); chloramphenicol; and tetracycline. For example, glyphosate resistance may be conferred by a herbicide resistance gene. Della-Cioppa et al. (1987) The transformed cells, identified by selection or screening and cultured in an appropriate medium that supports regeneration, may then be allowed to mature into plants. The presently disclosed methods may be used with any transformable plant cell or tissue. Transformable cells and tissues, as used herein, includes but is not limited to those cells or tissues that are capable of further propagation to give rise to a plant. Those of skill in the art recognize that a number of plant cells or tissues are transformable in which after insertion of exogenous DNA and appropriate culture conditions the plant cells or tissues can form into a differentiated plant. Tissue suitable for these purposes can include but is not limited to immature embryos, scutellar tissue, suspension cell cultures, immature inflorescence, shoot meristem, nodal explants, callus tissue, hypocotyl tissue, cotyledons, roots, and leaves. The regeneration, development, and cultivation of plants from transformed plant protoplast or explants are known in the art. Weissbach and Weissbach (1988) The regenerated transgenic plants may be self-pollinated to provide homozygous transgenic plants. Alternatively, pollen obtained from the regenerated transgenic plants may be crossed with non-transgenic plants, preferably inbred lines of agronomically important species. Conversely, pollen from non-transgenic plants may be used to pollinate the regenerated transgenic plants. The transgenic plant may pass along the transformed nucleic acid sequence to its progeny. The transgenic plant is preferably homozygous for the transformed nucleic acid sequence and transmits that sequence to all of its offspring upon, and as a result of, sexual reproduction. Progeny may be grown from seeds produced by the transgenic plant. These additional plants may then be self-pollinated to generate a true breeding line of plants. The progeny from these plants may be evaluated, among other things, for gene expression. The gene expression may be detected by several common methods such as western blotting, northern blotting, immunoprecipitation, and ELISA (Enzyme-Linked ImmunoSorbent Assay). The transformed plants may also be analyzed for the presence of the introduced DNA and the expression level and/or fatty acid profile conferred by the nucleic acid molecules and amino acid molecules of the present invention. Those of skill in the art are aware of the numerous methods available for the analysis of transformed plants. For example, methods for plant analysis include, but are not limited to, Southern blots or northern blots, PCR-based approaches, biochemical assays, phenotypic screening methods, field evaluations, and immunodiagnostic assays. Methods for specifically transforming dicots are well-known to those skilled in the art. Transformation and plant regeneration using these methods have been described for a number of crops including, but not limited to, members of the genus Methods for transforming monocots are also well-known in the art. Transformation and plant regeneration using these methods have been described for a number of crops including, but not limited to, barley ( Any plant may be chosen for use in the presently disclosed methods. Preferred plants for modification according to the present invention include, for example and without limitation, oilseed plants, It is apparent to those of skill in the art that a number of transformation methodologies can be used and modified for production of stable transgenic plants from any number of target crops of interest. In some embodiments, a transgenic seed may comprise a delta-9 desaturase polypeptide comprising an amino acid sequence being at least 80% identical to a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28 SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, and SEQ ID NO:33. In these and other embodiments, the transgenic seed may comprise a nucleic acid sequence being at least 60% identical to a sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:25. In certain embodiments, a transgenic seed may exhibit decreased levels of saturated fatty acids (for example, palmitic fatty acids and/or stearic fatty acids). The seeds may be harvested from a fertile transgenic plant, and may be used to grow progeny generations of transformed plants, including hybrid plant lines comprising at least one nucleic acid sequence as set forth above, and optionally at least one additional gene or nucleic acid construct of interest. Each document, patent, and reference cited herein is herein incorporated by its entirety. The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the invention to the particular features or embodiments described. The The Seed germination: Canola seeds (var. NEXERA 710™) were surface-sterilized in 10% Clorox™ for 10 minutes and rinsed three times with sterile distilled water (seeds are contained in steel strainers during this process). Seeds were planted for germination on ½ MS Canola medium (½ MS, 2% sucrose, 0.8% agar) contained in Phytatrays™ (25 seeds per Phytatray™) and placed in a Percival™ growth chamber with growth regime set at 25° C., photoperiod of 16 hours light and 8 hours dark for 5 days of germination. Pre-treatment: On day 5, hypocotyl segments of about 3 mm in length were aseptically excised, the remaining root and shoot sections were discarded (drying of hypocotyl segments was prevented by immersing the hypocotyls segments into 10 mL of sterile milliQ™ water during the excision process). Hypocotyl segments were placed horizontally on sterile filter paper on callus induction medium, MSK1D1 (MS, 1 mg/L kinetin, 1 mg/L 2,4-D, 3.0% sucrose, 0.7% phytagar) for 3 days pre-treatment in a PercivalTM growth chamber with growth regime set at 22-23° C., and a photoperiod of 16 hours light, 8 hours dark. Co-cultivation with Callus induction on selection medium: After 3 days of co-cultivation, the hypocotyl segments were individually transferred with forceps onto callus induction medium, MSK1D1H1 (MS, 1 mg/L kinetin, 1 mg/L 2,4-D, 0.5 gm/L MES, 5 mg/L AgNO3, 300 mg/L Timentin™, 200 mg/L carbenicillin, 1 mg/L Herbiace™, 3% sucrose, 0.7% phytagar) with growth regime set at 22-26° C. The hypocotyl segments were anchored on the medium but were not deeply embedded into the medium. Selection and shoot regeneration: After 7 days on callus induction medium, the callusing hypocotyl segments were transferred to Shoot Regeneration Medium 1 with selection, MSB3Z1H1 (MS, 3 mg/L BAP, 1 mg/L zeatin, 0.5 gm/L MES, 5 mg/L AgNO3, 300 mg/L Timentin™, 200 mg/L carbenicillin, 1 mg/L Herbiace™, 3% sucrose, 0.7% phytagar). After 14 days, the hypocotyl segments which had developed shoots were transferred to Regeneration Medium 2 with increased selection, MSB3Z1H3 (MS, 3 mg/L BAP, 1 mg/L Zeatin, 0.5 gm/L IVIES, 5 mg/L AgNO3, 300 mg/l Timentin™, 200 mg/L carbenicillin, 3 mg/L Herbiace™, 3% sucrose, 0.7% phytagar) with growth regime set at 22-26° C. Shoot elongation: After 14 days, the hypocotyl segments that had developed shoots were transferred from Regeneration Medium 2 to shoot elongation medium, MSMESH5 (MS, 300 mg/L Timentin™, 5 mg/l Herbiace™, 2% sucrose, 0.7% TC Agar) with growth regime set at 22-26° C. Shoots that were already elongated were isolated from the hypocotyl segments and transferred to MSMESH5. After 14 days the remaining shoots which had not elongated in the first round of culturing on shoot elongation medium were transferred to fresh shoot elongation medium, MSMESH5. At this stage all remaining hypocotyl segments which did not produce shoots were discarded. Root induction: After 14 days of culturing on the shoot elongation medium, the isolated shoots were transferred to MSMEST medium (MS, 0.5 g/L IVIES, 300 mg/L Timentin™, 2% sucrose, 0.7% TC Agar) for root induction at 22-26° C. Any shoots which did not produce roots after incubation in the first transfer to MSMEST medium were transferred for a second or third round of incubation on MSMEST medium until the shoots developed roots. PCR analysis: Transformed canola hypocotyl segments which regenerated into shoots comprising roots were further analyzed via a PCR molecular confirmation assay. Leaf tissue was obtained from the green shoots and tested via the PCR for the presence of the pat selectable marker gene. Any chlorotic shoots were discarded and not subjected to the PCR analysis. Samples that were identified as positive for presence of the pat selectable marker gene were kept and cultured on the MSMEST medium to continue development and elongation of the shoots and roots. The samples that were identified as not containing the pat selectable marker gene negative according to the PCR analysis were discarded. The transformed canola plants comprising shoots and roots that were PCR-positive for the presence of the pat selectable marker gene were transplanted into soil in a greenhouse. After establishment of the canola plants within soil, the canola plants were further analyzed to quantitate the copy number of the pat gene expression cassette via an Invader™ quantitative PCR assay and Southern blotting. Transgenic T0canola plants which were confirmed to contain at least one copy of the pat gene expression cassette were advanced for further analysis of the seed fatty acid profile. The seeds obtained from theses transgenic T0canola plants, i.e., T1canola seeds, were analyzed via a FAME analysis method to identify events which comprise a reduction in total saturated fatty acids (total saturated fatty acid content was determined by summing all of the saturated fatty acids, including short and long chain fatty acids) as compared to control plants. Segregating T1canola seeds were analyzed via a FAME analysis method to identify T0canola events which produced T1canola seeds comprising a reduction in total saturated fatty acids (C14:0, C16:0, C18:0, C20:0, C22:0, C24:0) as compared to seeds obtained from control plants grown in the same conditions. The sum of all Total Saturated Fatty Acids (TSFA) were quantitated and compared to a negative control plant. The FAME analysis was completed using the protocol described below on a single T1canola seed. A total of 24 single T1canola seed from each individual canola To event were assayed and the TSFA results from each single were quantitated. Single canola seed samples were homogenized in heptane containing triheptadecanoin (Nu-Chek prep) as a triacylglycerol internal standard, using steel ball mill. Prior to homogenization, a solution of 0.25 M of freshly prepared sodium methoxide (Sigma-Aldrich, St. Louis, Mo.) in methanol was added. Extraction was conducted at 40° C. with constant shaking. Endogenous fatty acid recoveries were normalized by the recovery of the methylated surrogate C17 fatty acid. Extraction of FAMEs (fatty acid methyl esters) was repeated three times and the heptane layers were pooled prior to analysis. The resulting FAMEs were analyzed by GC-FID using a capillary column BPX 70 from SGE (15 m×0.25 mm×0.25 μm). Each FAME was identified by retention time and quantified by the injection of a rapeseed oil reference mix from Matreya LLC (Pleasant Gap, Pa.) as a calibration standard with addition of appropriate long chain fatty acids (Nu-Chek Prep, Elysian Minn.). The bulk seed analysis consisted of 50 mg aliquot (10 to 15 seeds combined) and followed the same protocol described above with a slight modification. In order to drive the reaction of derivatization to completeness, the oil was first extracted three times with heptane. Then an aliquot of the combined oil extract, corresponding to 1 seed, was derivatized in FAMEs as described in the single seed protocol above. The completeness of the reaction was verified by checking for the presence of endogenous FAMEs in a fourth extraction/derivatization. Three transgenic canola events (Event 2182[12]-138.001, Event 2182[12]-125.001, and Event 2182[12]-156.001) were identified and selected for advancement to the Ti generation based on the FAME results which indicated a significant reduction in TSFA as compared to control canola plants. Two additional categories of plant fatty acid content were assayed. These categories included the Mono Unsaturated Fatty Acid (MUFA: C 16:1, C18:1 and C20:1) and Poly Unsaturated Fatty Acid (PUFA: C18:2 and C18:3) concentrations, are listed to show the effect of lowering TSFA in Ti seed. (Table 1). The mean TSFA of the transgenic canola events is reduced significantly as compared to the NEXERA 710™ non-transformed control plants. Concomitant to the reduction of TSFA an increase in MUFA content (C18:1 and C16:1) was observed. The increase in MUFA content is the direct result from the over-expression of the AnD9DS introducing a double bond at the 9thcarbon (Δ9) from the carboxylic function of saturated fatty acid. Interestingly, the PUFA content did not increase with the accumulation of MUFA substrate of phosphoglycerolipid desaturase FAD2 synthesizing C18:2. T1canola plant events were grown in a greenhouse and self-fertilized to fix the introgressed transgene in progeny plants. Invader™ quantitative PCR assays were completed on multiple T1canola plants from each transgenic event. These results indicated that the T1canola plants obtained from each of the three events contained about 2 or 3 copies of the pDAB7305 T-strand integration ( Bulked T2canola seeds were analyzed via the previously described FAME analysis method to identify T1canola plant lines which comprised a reduction in total saturated fatty acids as compared to control plants (NEXERA 710™). ( The TSFA (%) of the transgenic plants of the subject disclosure were quantitated and compared to the TSFA (%) obtained from the positive control, 218-11.30HL transgenic canola plants and the negative control, NEXERA 710™ plants. A small number of transgenic plants of the subject disclosure were identified to contain higher levels of TSFA, at levels similar to the negative control NEXERA 710™ plants. These plants are sibling nulls which resulted from segregation of the transgenes during self-fertilization, and do not contain any actively expressing copies of the transgenes of the subject disclosure. These results confirmed that the total saturated fatty acid content of the bulked T2canola seed was reduced below 3.5% in identified T1canola plant. The T2canola lines were further analyzed to determine which canola lines contained low copy numbers of the pDAB7305 T-strand integrant and produced the high T2seed yield. ( Individual canola plants of the subject disclosure were selected which contained less than 3.5% TSFA, produced more than 10 g of yield, and contained the lowest T-strand copy number. Based on these three criteria (levels of TSFA below 3.5%, high seed yield, and low copy number) seven canola plants were selected and advanced for further characterization of the TSFA profile. Copy number was determined from one plant per Ti line, using an Invader Assay. Table 2. These T2canola plant lines were transferred to the greenhouse, grown to maturity and self-fertilized. The T2canola plant lines were further analyzed molecularly and the T3seed was harvested for fatty acid profile analysis via FAME assay. Selected T2canola events which contained the pat gene expression cassette (and the closely linked AnD9DS gene expression cassettes) were characterized for their molecular integration pattern using quantitative PCR and Southern blot analysis. The presence of the AnD9DS gene expression cassette was confirmed via hydrolysis probe assays. Isolated T2 canola plants were initially screened via a hydrolysis probe assay, analogous to TAQMAN™, to confirm the presence of the pat transgenes. The data generated from these studies was used to determine the transgene copy number and used to select transgenic canola events for back crossing and advancement to subsequent generations. Tissue samples were collected in 96-well plates, tissue maceration was performed with a KLECOTM tissue pulverizer and stainless steel beads (Hoover Precision Products, Cumming, Ga.), in Qiagen RLT™ buffer. Following tissue maceration, the genomic DNA was isolated in high-throughput format using the Biosprint 96™ Plant kit (Qiagen, Germantown, Md.) according to the manufacturer's suggested protocol. Genomic DNA was quantified by Quant-IT Pico Green DNA assay kit™ (Molecular Probes, Invitrogen, Carlsbad, Calif.). Quantified genomic DNA was adjusted to around 2 ng/μL for the hydrolysis probe assay using a BIOROBOT3000™ automated liquid handler (Qiagen, Germantown, Md.). Transgene copy number determination by hydrolysis probe assay, analogous to TAQMAN® assay, was performed by real-time PCR using the LIGHTCYCLER®480 system (Roche Applied Science, Indianapolis, Ind.). Assays were designed for pat and an internal reference gene HMG1 (Weng et al. (2005). J. AOAC Int. 88(2):577-84) using the LIGHTCYCLER® Probe Design Software 2.0. For amplification, LIGHTCYCLER®480 Probes Master mix (Roche Applied Science, Indianapolis, Ind.) was prepared at 1× final concentration in a 10 μL volume multiplex reaction containing 0.4 μM of each primer for AnD9DS and pat and 0.2 μM of each probe (Table 3). A two-step amplification reaction was performed with an extension at 60° C. for 40 seconds with fluorescence acquisition. All samples were run and the averaged Cycle threshold (Ct) values were used for analysis of each sample. Analysis of real time PCR data was performed using LIGHTCYCLER® software release 1.5 using the relative quant module and is based on the ΔΔCt method. Controls included a sample of genomic DNA from a single copy calibrator and known two copy check that were included in each run. Table 4 lists the results of the hydrolysis probe assays. Copy number was determined from N plants per T1 line (and averaged, giving the value in Table 4), using an qPCR Assay. The results of the hydrolysis probe assay identified two lines (2182[12]-138.Sx001.Sx094 and 2182[12]-138.SX001.Sx090) which had a combination of relative standard deviation (shown in Table 4 as SD) and coefficient of variation (shown in Table 4 as CV %) that were comparable to the positive control plants (218-11.30(HL)). The 218-11.30(HL) control plants were previously identified to contain two fixed copies of the AnD9DS gene insertion (WO 2006042049). By comparing the selected canola lines (2182[12]-138.Sx001.Sx094 and 2182[12]-138.SX001.Sx090) to the 218-11.30(HL) control plants, specific canola lines were identified which would contain fixed copies of the pDAB7305 T-strand integrants. Southern blot analysis was used to establish the integration pattern of the inserted T-strand DNA fragment and identify canola lines which contained a full length AnD9DS gene expression cassette. Data were generated to demonstrate the integration and integrity of the transgene inserts within the canola genome. The detailed Southern blot analysis was conducted using a PCR amplified probe specific to the AnD9DS gene expression cassette. The hybridization of the probe with genomic DNA that had been digested with specific restriction enzymes identified genomic DNA fragments of specific molecular weights, the patterns of which were used to characterize the transgenic events for advancement to the next generation. Tissue samples were collected in 2 mL conical tubes and lyophilized for 2 days. Tissue maceration was performed with a KLECKO™ tissue pulverizer and tungsten beads. Following tissue maceration, the genomic DNA was isolated using a CTAB isolation procedure. The genomic DNA was further purified using the Qiagen Genomic Tips™ kit. Genomic DNA was quantified by Quant-IT Pico Green DNA™ assay kit (Molecular Probes, Invitrogen, Carlsbad, Calif.). Quantified genomic DNA was adjusted to a consistent concentration. For each sample, 4 μg of genomic DNA was thoroughly digested with the restriction enzyme BamHI (New England Biolabs, Beverley, Mass.). The digested DNA was concentrated by precipitation with Quick Precipitation Solution™ (Edge Biosystems, Gaithersburg, Md.) according to the manufacturer's suggested protocol. The genomic DNA was then resuspended in 25 μL of water at 65° C. for 1 hour. Resuspended samples were loaded onto a 0.8% agarose gel prepared in 1× TAE and electrophoresed overnight at 1.1 V/cm in 1× TAE buffer. The gel was sequentially subjected to denaturation (0.2 M NaOH/0.6 M NaCl) for 30 minutes, and neutralization (0.5 M Tris-HCl (pH 7.5)/1.5 M NaCl) for 30 minutes. Transfer of DNA fragments to nylon membranes was performed by passively wicking 20× SSC solution overnight through the gel onto treated IMMOBILON™ NY+ transfer membrane (Millipore, Billerica, Mass.) by using a chromatography paper wick and paper towels. Following transfer, the membrane was briefly washed with 2× SSC, cross-linked with the STRATALINKER™ 1800 (Stratagene, LaJolla, Calif.), and vacuum baked at 80° C. for 3 hours. Blots were incubated with pre-hybridization solution (Perfect Hyb plus, Sigma, St. Louis, Mo.) for 1 hour at 65° C. in glass roller bottles using a model 400 hybridization incubator (Robbins Scientific, Sunnyvale, Calif.). Probes were prepared from a PCR fragment containing the entire coding sequence. The PCR amplicon was purified using QIAEX II gel extraction kit™ and labeled with DIG DNA Labeling Kit™ (Roche Applied BioSciencse, Indianapolis, Ind.). Blots were hybridized overnight at 65° C. with denatured probe added directly to hybridization buffer. Following hybridization, blots were sequentially washed at 65° C. with 0.1× SSC/0.1% SDS for 40 minutes. Finally, the blots were exposed to storage phosphor imaging screens and imaged using a Molecular Dynamics Storm 860™ imaging system. The Southern blot analyses completed in this study were used to determine the copy number and confirm that selected events contained the AnD9DS gene expression cassette within the genome of canola. Table 5 provides the banding profile of multiple T2 plants from selected lines based on the criteria defined above in Table 2. The control lines did not contain the selectable marker confirming the PCR data. Most of the lines selected from the three events show a homogeneous band pattern (number and size) except line from event 2182[12]-125.Sx001.Sx014. All three T2 lines from event 2182[12]-138.Sx001 display T2 populations with consistent banding pattern. Selected plants from the T2canola lines were grown to maturity in the greenhouse. Seed was harvested from the plants. The seed was cleaned and the yield of seed per T2canola line was determined (Table 6). The yield of the seed from each line and compared to the yield of seed obtained from the untransformed control plants (Nexera™ 710GS) grown in the same conditions. Table 6 presents the yield results for the various plants which were obtained from each T2 canola line. These results illustrate that the yield was variable for each plant and line tested. But that the average amounts of yield of the T2 canola lines (2182[12]-125.Sx001.Sx014, 2182[12]-138.Sx001.Sx085, 2182[12]-138.Sx001.5x090, 2182[12]-138.Sx001.5x094, and 2182[12]-156.Sx001.5x049) were relatively similar and did not significantly deviate from the control plants (Nexera™ 710G5 and 218-11.30(HL)). Both, single and bulked T3canola seeds were analyzed via the previously described FAME analysis method to characterize the fatty acid profile of the lines to identify specific lines which resulted in a reduction in total saturated fatty acids as compared to control plants. The sum of the total saturated fatty acids were quantitated and compared to positive control and negative control plants. The results confirmed that the total saturated fatty acid and saturated fatty acid (as determined from the sum of palmitic and stearic acid content) content of the single and bulked T3canola seed was reduced below 3.5% in the selected canola plant lines. Surprisingly, two lines, 2182[12]-138.Sx001.Sx085 and 2182[12]-138.Sx001.Sx094, accumulated TSFA levels that averaged under 3.0%. Described for the first time are canola lines which are comprised of bulked seed that contains less than 3.0% saturated fatty acid. Table 7 and Table 8. In addition, a sub-set of canola lines were used for seed FAME analysis to determine the lowest level of total saturated fatty acid and saturated fatty acid levels which could be obtained in a single canola seed. The single seed FAME analysis was completed on seeds obtained from the canola lines that were selected based on the lowest total saturated fatty acid of bulked seed and the high levels of plant yield. A total of 288 individual seeds were analyzed per line using the FAME method. The summary of the analysis is presented in Table 9. All single seeds from selected plants have a mean TSFA below 2.8%, which is significantly below the 3.5% TSFA level. The lowest TSFA level is 2.25% at the single seed canola level. This is significantly lower than the TSFA level of 5.11% which was obtained in the Nexera™ 710G5 control plants. Finally, the maximum TSFA percentage in the transgenic canola lines does not excede 3.5% and the mean saturated level in single seed is 2.52% which is well below 3.5%. Table 9 and Table 7 shows the distribution of T2 mature seed bulk FAMES analysis for five populations of genetically homogenous canola lines as compared to the untransformed Nexera™ 710G5 controls and transformed 218-11.30(HL) positive control plants. The average of all the individual measurement (N) were determined to represent TSFA and saturated percentage for the population of canola plants. Canola lines, 2182[12]-138.Sx001.Sx085 and 2182[12]-138.Sx001.Sx094 are identified via bold print as these lines had an average TSFA percentage below 3.00 percent. Table 8 shows the lowest T3mature seed bulk FAMES and plant yield of single T2progeny plants obtained from event 2182[12]-138.Sx001 as compared to Nexera™ 710G5 control. The results displayed are for percentage of oil, percentage of TSFA, percentage of saturated fatty acids (as determined by summing the palmitic and stearic acid content), and seed yield. Table 9 shows the distribution of T3single seed FAMES analysis results from selected T2lines. The table shows the average (Mean), minimum (Min), and maximum (Max) TSFA and saturated fatty acid percentage, as compared to a Nexera™ 710G5 control canola plants that grown in the same condition. There was a reduction of total saturated fatty acids (TSFA) and saturated fatty acid level in T3seed of selected events as compared to a Nexera™ 710G5 control canola plants. Compositions and methods include genetically encoding and expressing a novel delta-9 desaturase in plant cells. In some embodiments, methods of expressing nucleic acids in a plant cell to take advantage of the delta-9 desaturase enzyme's activity, such that the percent composition of saturated fatty acids in plant seeds is decreased and there is a concomitant increase in Δ9 fatty acids. In other embodiments, amino acid sequences have delta-9 desaturase activity. Methods can involve expression of delta-9 desaturase in plant cells, plant materials, and whole plants for the purpose of increasing the amount of mono unsaturated fatty acids in whole plants, plant seeds, and plant materials, for example, seeds. 1. A method for decreasing the amount of saturated fatty acids in oil from a plant, the method comprising:
transforming plant material with a nucleic acid molecule comprising a heterologous gene regulatory element operably linked to a polynucleotide encoding a delta-9 desaturase enzyme comprising an amino acid sequence that is at least 80% identical to SEQ ID NO:1, wherein the plant material also comprises an extraplastidial desaturase selected from the group consisting of LnD9DS desaturase, HzD9DS desaturase, and MgD9DS desaturase; culturing the transformed plant material to obtain a plant; and extracting oil from the plant. 2. The method of 3. The method of 4. The oil obtained by the method of 5. The oil of 6. The oil from the plant of 7. Oil obtained from a plant seed which expresses an extraplastidial desaturase selected from the group consisting of LnD9DS desaturase, HzD9DS desaturase, and MgD9DS desaturase, and comprises a nucleic acid molecule comprising a polynucleotide encoding a delta-9 desaturase enzyme comprising an amino acid sequence that is at least 80% identical to SEQ ID NO:1. 8. The oil of 9. The oil of 10. The oil of 11. The oil of 12. Oil obtained from a seed plant comprising a polyunucleotide encoding a delta-9 desaturase enzyme compromising an amino acid sequence that is at least 80% identical to SEQ ID NO:1, and further comprising an extraplastidial desaturase selected from the group consisting of LnD9DS desaturase, HzD9DS desaturase, and MgD9DS desaturase. 14. Oil obtained from a plant material comprising a polynucleotide encoding a delta-9 desaturase enzyme comprising an amino acid sequence that is at least 80% identical to SEQ ID NO:1, and further comprising an extraplastidial desaturase selected from the group consisting of LnD9DS desaturase, HzD9DS desaturase, and MgD9DS desaturase. 15. The oil of 16. The oil of 17. The oil of 18. The oil of CROSS-REFERENCE TO RELATED APPLICATIONS
FIELD OF THE INVENTION
BACKGROUND
BRIEF SUMMARY OF THE INVENTION
BRIEF DESCRIPTION OF THE FIGURES
SEQUENCE LISTING
DETAILED DESCRIPTION
I. Overview of Several Embodiments
II. Abbreviations
III. Terms
IV. Metabolic Engineering Approaches to Decreasing Saturated Fatty Acids in a Host Cell, Tissue, or Organism
A. Overview
B. Polypeptides
D. Methods for Genetic Transformation of Plant Material
E. Transgenic Seeds
EXAMPLES
Example 1
Construct Design of pDAB7305
Example 2
Canola Transformation
Example 3
FAME Analysis of T1Canola Seeds Obtained From Transgenic pDAB7305 Canola Plants
Summary composition of single T1seed TSFA, MUFA and PUFA accumulations obtained from three transgenic canola events as compared to several NEXERA 710 ™ non-transformed control plants. TSFA (%) MUFA (%) PUFA (%) Event N* Mean Min Max Mean Min Max Mean Min Max 2182[12]-125.001 23 3.16 2.30 4.30 82.74 74.00 90.20 14.09 6.50 22.20 2182[12]-138.001 24 3.40 2.70 4.70 84.10 80.40 88.90 12.50 8.00 16.30 2182[12]-156.001 23 3.49 2.80 5.00 87.30 83.00 90.70 9.23 6.00 12.50 NEXERA 710.1.16 24 6.96 6.10 8.00 80.23 76.90 82.40 12.82 10.50 16.20 NEXERA 710.1.22 24 6.94 5.90 8.40 79.91 77.40 82.60 13.15 10.60 16.40 NEXERA 710.1.29 24 7.06 6.10 8.50 77.33 73.20 81.70 15.64 11.50 19.40 NEXERA 710.1.5— 24 6.99 6.20 7.80 82.71 78.50 84.40 10.28 8.20 13.90 N* indicates the number of individual T1seed analyzed for each plant progeny. Example 4
FAME Analysis of T2Canola Seeds Obtained From Transgenic pDAB7305 Canola Plants
The T2canola lines which were selected based on highest yield (seed weight), lowest PAT copy number (T1 plants) and lowest TSFA are listed. Seed PAT (Copy Event Plant Line Weight (g) Number) TSFA (%) 2182[12]- 2182[12]- 16.37 2.6 3.03 138.001 138.Sx001.sSx085 2182[12]- 16.58 2.2 3.11 138.Sx001.Sx090 2182[12]- 12.47 2.3 3.02 138.Sx001.Sx094 2182[12]- 18 3.0 3.31 138.Sx001.Sx029 2182[12]- 15.59 3.1 3.08 138.Sx001.Sx084 2182[12]- 2182[12]- 11.26 2.5 3.27 125.001 125.Sx001.Sx014 2182[12]- 2182[12]- 14.44 2.3 3.28 156.001 156.Sx001.Sx049 Example 5
Molecular Confirmation of T2 Canola Lines
AnD9DS Integration Confirmation via Hydrolysis Probe Assay
Primer and probe sequences used for hydrolysis probe assay of pat and internal reference (HMG1). Gene Detected Forward Primer Reverse Primer Probe Label PAT v5 SEQ ID NO: 6 SEQ ID NO: 7 SEQ ID NO: 8 FAM acaagagtggattgatgatcta ctttgatgcctatgtgacacgtaa ccagcgtaagcaataccagcca gagaggt acagt caacacc HMG1 SEQ ID NO: 9 SEQ ID NO: 10 SEQ ID NO: 11 HEX cctctctaccaccgtctcacat gatctggccggactgtttca cgctcctcagctaccacctcaac g ca Copy amount results for the AnD9DS events (T2 plants) as determined using the hydrolysis probe assay. PAT gene Event/Line N mean SD CV (%) 218-11.30(HL) 12 3.61 0.28 7.82 2182[12]-125.Sx001.Sx014 35 5.93 0.98 16.48 2182[12]-138.Sx001.Sx085 34 9.40 1.03 11.00 2182[12]-138.Sx001.Sx090 33 7.69 0.35 4.54 2182[12]-138.Sx001.Sx094 35 9.98 0.79 7.93 2182[12]-156.Sx001.Sx049 33 4.35 0.48 11.12 AnD9DS Genomic Integration Confirmation via Southern Blot Analysis.
Summary of Southern analysis completed on multiple T2canola lines from four transgenic events and the NEXERA 710 ™ canola control plants. The sizes of the observed bands for each sample were sized by comparison to a known standard run beside the samples on an agarose gel. Number Band Event- T2Line of Plants Numbers Size Observed (Kb) NEXERA 710 ™ 2 0 NA 218-11.30(HL) 2 4 5.8, 3.5, 1, 0.35* 2182[12]- 8 3 bands (2 plants) 9.2, 4.4, 3.5, 2.6, 0.5 125.Sx001.Sx014 and 4 bands (6 plants) 2182[12]- 8 4 9.2, 5.8, 3.5, 0.7 138.Sx001.Sx085 2182[12]- 8 4 9.2, 5.1, 2.5, 0.6 138.Sx001.Sx090 2182[12]- 8 4 9.2, 5.1, 2.5, 0.6 138.Sx001.Sx094 2182[12]- 8 2 4.5, 3.9 156.Sx001.Sx049 Example 6
T3 Seed Yield of Selected Canola Lines
ANNOVA analysis of the seed yield, measured as total grams, from canola transgenic lines and the untransformed Nexera ™ 710GS control plants. Yield results are not significantly different (p < 0.05) for plants that are connected by the same letter in parenthesis. Event/Line Plant Count Ratio Yield (g) 218-11.30(HL) 12 0.06186 5.7233333 (A, B) 2182[12]-125.Sx001.Sx014 35 0.18041 5.9874286 (A, B) 2182[12]-138.Sx001.Sx085 34 0.17526 6.8394118 (A) 2182[12]-138.Sx001.Sx090 33 0.17010 6.4887879 (A, B) 2182[12]-138.Sx001.Sx094 35 0.18041 5.0302857 (B) 2182[12]-156.Sx001.Sx049 33 0.17010 6.3715152 (A, B) Nexera ™ 710G5 12 0.06186 7.1666667 (A, B) Total 194 1.00000 — Example 7
FAME Analysis of T3Canola Seeds Obtained From Transgenic pDAB7305 Canola Plants
T2parent line N TSFA (%) Saturated (%) — — Mean Min Max Mean Min Max 218-11.30(HL) 12 3.94 3.75 4.21 3.39 3.19 3.65 2182[12]- 35 3.43 2.59 4.24 3.08 2.34 3.74 125.Sx001.Sx014 2182[12]- 34 2.92 2.53 3.65 2.68 2.31 3.36 138.Sx001.Sx085 2182[12]- 33 3.24 2.66 3.87 2.93 2.37 3.59 138.Sx001.Sx090 2182[12]- 35 2.98 2.50 3.52 2.68 2.24 3.21 138.Sx001.Sx094 2182[12]- 33 3.47 2.50 4.21 3.15 2.26 3.73 156.Sx001.Sx049 Nexera 710G5 12 6.43 6.14 6.69 5.19 4.89 5.40 2182[12]- 34.5 2.5 2.24 61.12 4.16 138.Sx001.Sx094.Sx112 2182[12]- 38.7 2.53 2.31 60.65 6.05 138.Sx001.Sx085.Sx070 2182[12]- 37.8 2.57 2.33 60.03 7.72 138.Sx001.Sx085.Sx076 2182[12]- 39.3 2.65 2.41 58.79 5.73 138.Sx001.Sx094.Sx122 2182[12]- 37.4 2.66 2.37 58.63 4.44 138.Sx001.Sx090.Sx062 Nexera 710GS.Sx552 43.7 6.28 5.15 2.33 6.97 Events/Line N TSFA (%) Saturated (%) — — Mean Min Max Mean Min Max 2182[12]- 43 2.60 2.27 3.02 2.33 2.05 2.64 138.Sx001.Sx085.Sx070 2182[12]- 48 2.57 2.27 3.12 2.40 2.16 2.85 138.Sx001.Sx085.Sx076 2182[12]- 48 2.66 2.36 3.16 2.52 2.26 2.99 138.Sx001.Sx090.Sx062 2182[12]- 48 2.51 2.25 2.78 2.38 2.13 2.61 138.Sx001.Sx094.Sx112 2182[12]- 37 2.73 2.44 3.46 2.46 2.13 3.18 138.Sx001.Sx094.Sx122 Nexera 710GS.Sx552 48 6.34 5.71 7.52 5.11 4.73 5.90




