Processes for synthesis of 1,3,3,3-tetrafluoropropene

Disclosed is a process for the synthesis of 1,3,3,3-tetrafluoropropene which comprises, in one embodiment, reacting a compound of CF3X1 with a compound of CX2H═CHX3, wherein X1, X2, and X3 are each independently selected from the group consisting of fluorine, chlorine, bromine and iodine, to produce a reaction product comprising a compound of CF3CH═CHX3, wherein X3 is as described above; and when X3 is not fluorine, fluorinating the compound to produce 1,3,3,3-tetrafluoropropene. The process in another embodiment comprises preparing tetrafluoropropene comprising thermally cracking one or more compounds capable of producing a reaction mixture which preferably comprises diflurocarbene radicals and vinylidene fluoride, and converting said reaction mixture into—tetrafluoropropene (1,3,3,3-tetrafluoropropene).

Artificial reality environment with glints displayed by an extra reality device

The present embodiments relate to display of glints associated with real-world objects in an environment displayed on an extra reality (XR) device. The glint can include a virtual object associated with a real-world object, such as an indication of a social interaction associated with a real-world object, a content item tagged to an object, etc. The system as described herein can present glints on a display of an XR device based on a distance between the XR device and a location associated with the glint. Responsive to selection of a glint in the environment, additional information can be presented relating to the glint or another action can be taken, such as to open an application. In some instances, a glint can include a series of search results relating to a corresponding real-world object to provide additional information relating to the real-world object.

MAGNESIUM HALIDE COMPLEXES, CATALYST COMPONENTS AND CATALYSTS FOR OLEFIN POLYMERIZATION PREPARED THEREFROM

The component of magnesium halide adduct is represented by MgX2 mROH nE pH2O, in which X is chlorine, bromine, C1-C14alkoxy or aryloxy; R is C1-C12 alkyl, C3-C10 cycloalkyl or C6-C10 aryl; E is represented by the general formula (II), wherein R1 and R2 which can be the same or different to each other, are hydrogen or linear or branched C1-C10 hydrocarbon groups, C3-C10 cycloalkyl, C6-C10 aryl, C7-C10 alkaryl or aralkyl, optionally, the said aryl or alkylaryl or arylalkyl is substituted by one or more halogen in the aromatic ring, R1 and R2 can form ring or fused ring. R3 and R4 have the same meaning of R1 and R2 except that they can't be hydrogen, m is 1-5, n is 0.005-1.0, and p is 0-0.8. Spherical catalyst component and catalyst made from the above spherical magnesium halide adduct and their use in polymerising the alpha-olefins CH2=CHR and their mixture are provided, in which R is hydrogen or C1-C12 alkyl or aryl.

Methods and systems of streaming refrigerant in a heat exchanger

Embodiments are disclosed to help create longitudinal refrigerant streams, for example, in a shell and tube type evaporator, so as to manage refrigerant and/or lubricant in the evaporator. In some embodiments, the shell side of the evaporator may include a plurality of longitudinally extended pans stacked in a vertical direction. In some embodiments, refrigerant can be directed onto a top pan. The refrigerant can form a longitudinal refrigerant stream along the pan and flow down to the next pan in the vertical direction and form another longitudinal refrigerant stream. Each of the pans may form a refrigerant pool to help exchange heat with a process fluid carried in heat exchanger tubes. By forming longitudinal refrigerant streams in the pans, heat exchange efficiency may be improved and a lubricant content in refrigerant streams may be concentrated toward a bottom of the evaporator.

Catalyst for olefin polymerization and use of the same

The present application discloses a catalyst for olefin polymerization, comprising a product of the following components: (A) solid titanium-containing catalyst component comprising magnesium, titanium and halogen as essential components; (B) organo-aluminum compound catalyst component, and (C) silicon ether compound catalyst component, the silicon ether compound being represented by a general formula (I): wherein R 1 -R 12 and A are as defined in the description.

Catalyst component for olefin polymerization reaction, catalyst, and use thereof

X-ray scanning method and system

X-ray scanning methods and systems are provided in embodiments of the present inventions. According to one illustrative implementation, an exemplary method may comprise: collecting background data when no X-ray is emitted; collecting air data when X-rays are emitted and there is no object to be scanned in an inspection channel; scanning an object to collect original scanning data; and preprocessing the original scanning data according to the background data and the air data to acquire scanned image data. In some embodiments, when performing an X-ray scanning of a static object, implementations may measure the background data and the air data and process the scanning data, thereby solving noise issues caused by mechanical vibration and thus improving the measurement accuracy.

Speaker

A speaker is provided in the present disclosure. The speaker includes a magnetic circuit system for providing magnetic field, a diaphragm, a suspension, a drive mechanism and a horizontal former, which is retained on the surface of the diaphragm directly facing the magnetic circuit system. The diaphragm is suspended above the magnetic circuit system for generating sound by vibrating. The suspension is used to suspend the diaphragm above the magnetic circuit system. The drive mechanism is disposed under the diaphragm and can interact with the magnetic circuit system so as to drive the diaphragm to vibrate in order to generate sound. The horizontal former is retained on the surface of the diaphragm directly facing the magnetic circuit system, wherein the horizontal former is provided with a communication space which communicates the space under the diaphragm and the space under the suspension.

METHOD FOR PRODUCING VINYL ACETATE

The present invention discloses a method for producing vinyl acetate. Inert gas is introduced into cycling gas to improve the explosion limit of oxygen, enlarge a stable area of a reaction system and improve the oxygen concentration of the reaction system, thus reducing the reaction temperature, prolonging the service life of a catalyst, and improving the selectivity of the vinyl acetate. The inert gas is nitrogen or a mixture of nitrogen and methane. The concentration of the inert gas at the inlet of a reactor is 8 to 30 mol %. The molar concentration of the oxygen at the inlet of the reactor is 10.5 to 12 mol %. 1. A method for producing vinyl acetate , wherein inert gas is introduced into cycling gas , and the concentration of the inert gas at the inlet of a reactor is 8 to 30 mol %.2. The method for producing vinyl acetate of claim 1 , wherein the inert gas is nitrogen or a mixture of nitrogen and methane.3. The method for producing vinyl acetate of claim 2 , wherein the volume ratio of nitrogen to methane is 4:1 to 4:2 when the introduced inert gas is the mixture of nitrogen and methane.4. The method for producing vinyl acetate of claim 1 , wherein the concentration of the oxygen at the inlet of the reactor is 10.5 to 12 mol %.5. The method for producing vinyl acetate of claim 1 , wherein the temperature of the reactor is 110-180° C. The present invention relates to a method for producing vinyl acetate. According to the present method, inert gas is introduced into cycling gas to expand a stable area and improve the concentration of oxygen at the inlet of a reactor, thus reducing the reaction temperature, prolonging the service life of a catalyst, improving the selectivity of the vinyl acetate, reducing the production cost, and enhancing the market competitiveness of vinyl acetate products.Vinyl acetate (VAC) is an important organic chemical raw material which can generate such derivatives as polyvinyl alcohol (PVA), ethylene vinyl acetate copolymer (EVA), ...

Circuit and method for preventing screen flickering, drive circuit for display panel, and display apparatus

Circuit and method for preventing screen flickering, a drive circuit for a display panel, and a display apparatus are provided, relating to the field of display technology. The circuit for preventing screen flickering includes a control sub-circuit configured to control a gate drive circuit of the display panel to output a gate cut-off level during a power-on period of the display panel. The gate drive circuit of the display panel is controlled to output the gate cut-off level during the power-on period, the gate cut-off level is provided to gate lines of the display panel such that TFTs connected to the gate lines are in cut-off state during the power-on period.

Nanometer-precision six-degree-of-freedom magnetic suspension micro-motion table and application thereof

A nanometer precision six-DOF magnetic suspension micro-stage and the application thereof are provided which are mainly used in semiconductor photolithography devices. The micro-stage includes a cross support and four two-DOF actuators. Each 2-DOF actuator comprises a vertically polarized permanent magnet, a horizontal force coil and a vertical force coil; the permanent magnet being mounted on an end of the cross support, the horizontal force coil and the vertical force coil being arranged on a side of and below the permanent magnet respectively and being spaced apart from the permanent magnet; the cross support and four vertically polarized permanent magnets constitute a mover of the micro-stage; the horizontal force coil and the vertical force coil being fixed by a coil framework respectively and constituting a stator of the micro-stage; and the stator being mounted on a base of the micro-stage. A dual-wafer table positioning system of a photolithography machine may be constructed by ...

Catalyst component for olefin polymerization, catalyst, and use thereof

Disclosed is a catalyst component for olefin polymerization. The catalyst component comprises magnesium, titanium, halogen and an internal electron donor. The internal electron donor includes an imine compound with a ketone group as shown in Formula I. Disclosed further is a method of preparing the catalyst component, and a catalyst for olefin polymerization containing the catalyst component. When the catalyst is used in olefin polymerization reaction especially propene polymerization reaction, the catalyst has a high activity and a long term activity and good hydrogen response, and the obtained polymer has characteristics of an adjustable isotactic index and a relatively wide molecular weight distribution.

Method and device for driving display panel and display device

A method for driving a display panel, a device for driving a display panel and a display device are provided. The method for driving a display panel includes: acquiring a GOA signal corresponding to a current frame of image, where the GOA signal includes a plurality of clock signals; determining a transmission channel corresponding to each of the plurality of clock signals, and generating a correspondence relationship between the clock signals and respective transmission channels, where the transmission channels are used to deliver the clock signals from a GOA control signal generator to a GOA circuit of the display panel, the current frame of image is different from at least one frame of image previous to the current frame of image with respect to the correspondence relationship between the clock signals and respective transmission channels; and transmitting the clock signals by using the determined transmission channels.

Transparent conducting components and related electro-optic modulator devices

New electro-optic (EO) phase modulator devices and geometries, as can be constructed using a transparent conductive component.

METHOD FOR PRODUCING FLUORINATED ORGANIC COMPOUNDS

Disclosed are processes for the production of fluorinated olefins, preferably adapted to commercialization of CF3CF═CH2 (1234yf). Three steps may be used in preferred embodiments in which a feedstock such as CCl2═CClCH2Cl (which may be purchased or synthesized from 1,2,3-trichloropropane) is fluorinated (preferably with HF in gas-phase in the presence of a catalyst) to synthesize a compound such as CF3CCl═CH2, preferably in a 80-96% selectivity. The CF3CCl═CH2 is preferably converted to CF3CFClCH3 (244-isomer) using a SbCl5 as the catalyst which is then transformed selectively to 1234yf, preferably in a gas-phase catalytic reaction using activated carbon as the catalyst. For the first step, a mixture of Cr2O3 and FeCl3/C is preferably used as the catalyst to achieve high selectivity to CF3CCl═CH2 (96%). In the second step, SbCl5/C is preferably used as the selective catalyst for transforming 1233xf to 244-isomer, CF3CFClCH3. The intermediates are preferably isolated and purified by distillation ...

CATALYST COMPONENT FOR OLEFIN POLYMERIZATION REACTION AND CATALYST COMPRISING SAME

A Robust PBCH-IC Method In LTE Advanced

A Physical Broadcast Channel (PBCH) Interference Cancellation (PBCH-IC) solution is presented herein. The PBCH-IC provides accurate and efficient techniques for cancelling interference from a serving cell PBCH. In one embodiment, PBCH symbols previously determined for an aggressor cell are canceled from a PBCH sequence currently received by the wireless device to produce a serving cell PBCH free of interference. In another embodiment, the PBCH symbols of the aggressor cell are reconstructed in the frequency domain and converted to the time domain to generate an aggressor PBCH sequence. The aggressor PBCH sequence is then subtracted from the received PBCH sequence to cancel the aggressor cell interference. 128-. (canceled)29. A method of cancelling aggressor cell interference , in a wireless device , from a physical broadcast channel (PBCH) sequence received by a wireless device from a serving cell and an aggressor cell using a joint frequency domain and time domain process , wherein the serving cell comprises a serving network node that serves the wireless device , the method comprising:applying a denoise process to channel estimates associated with the aggressor cell in the time domain to remove noise from the channel estimates to determine denoised channel estimates;converting the denoised channel estimates from the time domain to the frequency domain to determined denoised frequency domain channel estimates;determining generated PBCH symbols for the aggressor cell based on a master information block corresponding to the aggressor cell in the received PBCH sequence;reconstructing aggressor PBCH symbols for the aggressor cell in the frequency domain based on the denoised frequency domain channel estimates and the generated PBCH symbols;converting the reconstructed aggressor PBCH symbols from the frequency domain to the time domain to generate a reconstructed PBCH sequence; andsubtracting the reconstructed PBCH sequence from the received PBCH sequence in the time ...

Polyol ester compounds useful in preparation of a catalyst for olefins polymerization, process for preparing the same and use thereof

The present application relates to polyol ester compounds, having general formula (I): R 1 CO—O—CR 3 R4-A-CR 5 R 6 —O—CO—R 2 (I) wherein, R, and R 2 groups, which may be identical or different, can be substituted or unsubstituted hydrocarbyl having 1 to 20 carbon atoms, R 3 -R 6 groups, which may be identical or different, can be selected from the group consisting of hydrogen, halogen or substituted or unsubstituted hydrocarbyl having 1 to 20 carbon atoms, R 1 -R 6 groups optionally contain one or more hetero-atoms replacing carbon, hydrogen atom or the both, said hetero-atom is selected from the group consisting of nitrogen, oxygen, sulfur, silicon, phosphorus and halogen atom, two or more of R 3 -R 6 groups can be linked to form saturated or unsaturated monocyclic or polycyclic ring; A is a single bond or bivalent linking group with chain length between two free radicals being 1-10 atoms, wherein said bivalent linking group is selected from the group consisting of aliphatic, alicyclic and aromatic bivalent radicals, and can carry C 1 -C 20 linear or branched substituents; one or more of carbon atom and/or hydrogen atom on the substituents can be replaced by a hetero-atom selected from the group consisting of nitrogen, oxygen, sulfur, silicon, phosphorus, and halogen atom, and two or more said substituents on the linking group as well as above-mentioned R 3 -R 6 groups can be linked to form saturated or unsaturated monocyclic or polycyclic ring. The compounds of formula (I) find use in preparing a catalyst for olefin polymerization.

Light protection device for mixing multiple light sources

A light projection device includes a mixing tube having an open exit end, and a plurality of light sources, each of the plurality of light sources positioned to emit a light stream toward the open exit end of the mixing tube. A diffuser is disposed between the plurality of light sources and the open exit end of the mixing tube, the diffuser configured to diffuse at least one light stream from the plurality of light sources into a diffused light stream. A template is positioned proximate the open exit end of the mixing tube and configured to shape the diffused light stream from the diffuser into a patterned light stream.

Method and system for identifying protein domain based on protein three-dimensional structure image

Disclosed is a method and system for identifying a protein domain based on a protein three-dimensional structure image. According to the present application, the protein domain is identified based on a structure similarity, the identification errors and omissions of the protein domain caused by protein multi-sequence alignment errors when sequence consistency is not high can be effectively solved. According to the present application, the point cloud segmentation model based on the dynamic graph convolutional neural network is constructed, and by integrating global structural features and local structural features, segmentation of the protein domain and acquisition of semantic labels of the protein domain can be completed at the same time.

Accent lighting system for an interior cabin of a vehicle

An accent lighting system is configured to provide accented light onto a desired location. The accent lighting system includes an accent adapter assembly that is configured to securely couple to a light source. The accent adapter assembly includes an accenting plate that is configured to accent light that is emitted from the light source. A method of securing an accent lighting system within an internal cabin of a vehicle includes removing an existing light source from an aperture of a composite panel, securing an accent adapter assembly to the existing light source to form the accent lighting system, and securing the accent lighting system in the aperture of the composite panel.

catalyst component for olefin polymerization, catalyst for olefin polymerization, catalyst for polymerizing olefin prépolimerização, method for olefin polymerization

Silicon ether compounds and a method for the preparation thereof

The present invention relates to silicon ether compounds having a general formula (I), a method for the preparation thereof and use thereof as a component of catalysts for polymerization of olefins. In particular, in propylene polymerization, catalyst systems comprising the silicon ether compounds as external electron donor component exhibit good hydrogen response, and can be used to prepare polymer having high isotacticity at high yield. wherein R₁-R₁₀ groups are as defined in the description.

Robust PBCH-IC method in LTE advanced

A Physical Broadcast Channel (PBCH) Interference Cancellation (PBCH-IC) solution is presented herein. The PBCH-IC provides accurate and efficient techniques for cancelling interference from a serving cell PBCH. In one embodiment, PBCH symbols previously determined for an aggressor cell are canceled from a PBCH sequence currently received by the wireless device to produce a serving cell PBCH free of interference. In another embodiment, the PBCH symbols of the aggressor cell are reconstructed in the frequency domain and converted to the time domain to generate an aggressor PBCH sequence. The aggressor PBCH sequence is then subtracted from the received PBCH sequence to cancel the aggressor cell interference.

Antibodies specific for cancer associated antigen SM5-1 and uses thereof

The invention concerns antibodies which is specific for SM5-1 antigen expressed in melanoma, breast cancer and hepatocellular carcinoma, and polynucleotides encoding the antibodies. The invention further concerns use of such antibodies and/or polynucleotides in diagnosing and treating malignancies.

HUMANIZED ANTI-HUMAN CD34 ANTIBODY, THE PREPARATION METHOD AND USES THEREOF

The present invention provides a humanized anti-human CD34 antibody and the preparation method thereof. The humanized anti-human CD34 antibody retains the affinity and specificity of its original murine-derived antibody. The antibody can be conjugated with magnetic nano materials to prepare immunomagnetic beads to screen marrow hemopoietic stem cells. It can effectively reduce the incidence rate of HAMA and improve the security of clinical transplantation of hemopoietic stem cells and can be used in treatment of certain malignant hematologic diseases and solid tumors.

Light Projection Device for Mixing Multiple Light Sources

A light projection device includes a mixing tube having an open exit end, and a plurality of light sources, each of the plurality of light sources positioned to emit a light stream toward the open exit end of the mixing tube. A diffuser is disposed between the plurality of light sources and the open exit end of the mixing tube, the diffuser configured to diffuse at least one light stream from the plurality of light sources into a diffused light stream. A template is positioned proximate the open exit end of the mixing tube and configured to shape the diffused light stream from the diffuser into a patterned light stream. 1. A light projection device comprising:a mixing tube having an open exit end;a plurality of light sources, each of the plurality of light sources positioned to emit a light stream toward the open exit end of the mixing tube;a diffuser disposed between the plurality of light sources and the open exit end of the mixing tube, the diffuser configured to diffuse at least one light stream from the plurality of light sources into a diffused light stream; anda template positioned proximate the open exit end of the mixing tube and configured to shape the diffused light stream from the diffuser into a patterned light stream.2. The light projection device of claim 1 , in which the diffuser comprises a prism.3. The light projection device of claim 2 , in which the prism comprises an entrance surface facing the plurality of light sources claim 2 , the entrance surface being non-smooth.4. The light projection device of claim 3 , in which the entrance surface comprises ridges formed in a rosette pattern.5. The light projection device of claim 1 , in which each of the plurality of light sources comprises a light-emitting diode (LED).6. The light projection device of claim 1 , in which the plurality of light sources includes an LED module having four LED lights.7. The light projection device of claim 1 , in which the template comprises a gobo.8. The light projection ...

Commutation failure prediction method, device and storage medium based on energy accumulation features of inverter

The disclosure discloses a commutation failure prediction method, device and storage medium based on energy accumulation features of inverter. The method includes the following steps: collecting instantaneous values of three-phase valve side current and calculating the derivatives of the three-phase valve side current according to the instantaneous values of three-phase valve side current; the derivative includes positive, negative and zero states; according to the derivatives of the three-phase valve side current, determining the locations of incoming valve and ongoing valve; based on the valve side current of the incoming valve and ongoing valve, calculating energy accumulation features of the 12-pulse inverter; predicting whether the commutation failure from the incoming valve to the ongoing valve will happen according to the states of the derivatives of the three-phase valve side current and the energy accumulation features of the 12-pulse inverter.

Method and composition for diagnosis of melanocytic lesions

This invention relates to monoclonal antibodies that recognize an antigen specific to melanocytic lesions. These antibodies are useful in methods of isolating melanoma cells and diagnosing melanocytic lesions. These antibodies are also useful for immunotherapy against melanoma.

ETHYLENE DEGRADATION CATALYST AND PREPARATION METHOD AND USE THEREOF

The present disclosure discloses an ethylene degradation catalyst and a preparation method and a use thereof.

CATALYST COMPONENT FOR OLEFIN POLYMERIZATION REACTION AND CATALYST COMPRISING SAME

A catalyst component for olefin polymerization comprising magnesium, titanium, halogen and electron donor, wherein the electron donor is selected from at least one of the diol diester compounds, when the diol diester comprised contains a certain amount of isomer with Fischer projection formula as shown in Formula (II), the activity and stereospecificity of the catalyst are greatly improved, especially in the production of polymers with high melt index, the isotactic index of the obtained polymers is improved substantially.

ACCENT LIGHTING SYSTEM FOR AN INTERIOR CABIN OF A VEHICLE

An accent lighting system is configured to provide accented light onto a desired location. The accent lighting system includes an accent adapter assembly that is configured to securely couple to a light source. The accent adapter assembly includes an accenting plate that is configured to accent light that is emitted from the light source. A method of securing an accent lighting system within an internal cabin of a vehicle includes removing an existing light source from an aperture of a composite panel, securing an accent adapter assembly to the existing light source to form the accent lighting system, and securing the accent lighting system in the aperture of the composite panel. 1. An accent lighting system that is configured to provide accented light onto a desired location , the accent lighting system comprising:an accent adapter assembly that is configured to securely couple to a light source, wherein the accent adapter assembly comprises an accenting plate that is configured to accent light that is emitted from the light source.2. The accent lighting system of claim 1 , wherein the accent adapter assembly further comprises a lens that is configured to capture the light emitted from the light source and direct the light into the accenting plate.3. The accent lighting system of claim 1 , wherein the accent adapter assembly further comprises a lens that is configured to focus accented light that passes through the accenting plate onto the desired location.4. The accent lighting system of claim 1 , wherein the accent adapter assembly further comprises:a sleeve that is configured to securely couple to the light source, wherein the sleeve includes a base that is configured to securely couple to the light source, and a mounting tube;an adjustment housing having first and second ends, wherein the first end is secured to the mounting tube; anda bezel comprising a securing base coupled to the second end of the adjustment housing, and an outer flange that is configured to ...

Transparent conducting components and related electro-optic modulator devices

New electro-optic (EO) phase modulator devices and geometries, as can be constructed using a transparent conductive component.

Booster circuit, shutdown circuit, methods for driving the same, and display apparatus

The embodiments of the present disclosure propose a booster circuit and a method for driving the same, a shutdown circuit and a method for driving the same, and a display apparatus. The booster circuit includes a first input sub-circuit coupled to a first input signal terminal, a first voltage signal terminal, and an output signal terminal, and configured to transmit a first voltage signal at the first voltage signal terminal to the output signal terminal under control of a first input signal at the first input signal terminal; a second input sub-circuit coupled to a second input signal terminal, the first voltage signal terminal and a first node, and configured to transmit the first voltage signal at the first voltage signal terminal to the first node under control of a second input signal at the second input signal terminal; and a first storage sub-circuit coupled to the output signal terminal and the first node, and configured to cause a level of an output signal at the output signal ...

Methods for improvement of lung function using TGF-beta inhibitors

The invention concerns methods for improvement of lung function by administering non-peptide small molecule inhibitors of TGF-β specifically binding to the type I TGF-β receptor (TGFβ-R1). Preferably, the inhibitors are quinazoline derivatives.

Preparation and application of anti-tumor bifunctional fusion proteins

Provided herein is a chimeric protein, which chimeric protein comprises a Flt3 ligand, or a biologically active fragment thereof, and a proteinuous or peptidyl tumoricidal agent, and uses thereof, particularly in the treatment of malignancy.

Fluorine-containing compounds and polymers derived therefrom

An optical device comprising a polymer comprising at least one repeating unit derived from a compound of the following formula: W—Y—O-Z wherein W is hydrogen, X or X—O—, X is a monovalent unsaturated organic moiety; Y is a divalent organic moiety; and Z a monovalent fluorinated organic moiety.

Silicon ether compounds and a method for the preparation thereof

The present invention relates to silicon ether compounds having a general formula (I), a method for the preparation thereof and use thereof as a component of catalysts for polymerization of olefins. In particular, in propylene polymerization, catalyst systems comprising the silicon ether compounds as external electron donor component exhibit good hydrogen response, and can be used to prepare polymer having high isotacticity at high yield. wherein R1-R10 groups are as defined in the description.

MEDICAL RECORD OUTPUT MANAGEMENT METHOD AND MEDICAL RECORD OUTPUT SYSTEM

The present invention provides a medical record output method, comprising: a) providing a first identification code, wherein the first identification code comprises patient identity information; b) acquiring the first identification code; c) acquiring output terminal identity information; d) analyzing a medical record state of a corresponding patient according to the first identification code; and e) sending a medical record of the patient to a corresponding output terminal or a medical record interaction interface when the medical record state of the patient is ready-to-output. A medical record output system is further provided. 1. A medical record output method , comprising:a) providing a first identification code, wherein the first identification code comprises patient identity information;b) acquiring the first identification code;c) acquiring output terminal identity information;d) analyzing a medical record state of a corresponding patient according to the first identification code; ande) sending a medical record of the patient to a corresponding output terminal or a medical record interaction interface when the medical record state of the patient is ready-to-output.2. The medical record output method according to claim 1 , wherein step d) further comprises:d1) transmitting related information of the first identification code to a medical record output server through the medical record interaction interface;d2) transmitting the output terminal identity information to the medical record output server through the medical record interaction interface;d3) performing matching analysis on the identity information included in the first identification code and medical record identity information by the medical record output server, and generating the medical record state of the corresponding patient; andd4) sending the medical record state to the medical record interaction interface.3. The medical record output method according to claim 1 , further comprising:sending ...

Method and device for locating equipment-level oscillation sources of DFIG grid-connected system

The application relates to a method and device for locating equipment-level oscillation sources of DFIG grid-connected system, which belongs to the technical field of wind generation, and solves the problem of stable operation of the wind power grid-connected system at the current stage. The method comprises: constructing the energy correlation topology network of the components in DFIG; analyzing the dynamic energy flows between the components during the oscillation process; calculating magnitudes of the causality between the dynamic energy flows; building a causality diagram of oscillation transmission in the DFIG; analyzing the distribution of the magnitude of the causality in the diagram, determining the oscillation transmission routes and locating the oscillation sources.

Standing rice spoon

Image Capturing Method and Terminal Device

An image capturing method and a terminal device are provided. The method includes entering a camera application to start a lens and display a viewfinder interface, converting an original image captured by the lens into a red-green-blue (RGB) image, and decreasing luminance of the RGB image to be less than first luminance or increasing the luminance of the RGB image to be greater than second luminance, to obtain a first image; converting the RGB image into N frames of high-dynamic-range (HDR) images, and fusing color information of pixels in any same location on the first image and the N frames of HDR images to obtain a final image.

Catalyst component for olefin polymerization, and catalyst containing the same

The present invention provides a catalyst component for olefin polymerization, obtained by a reaction of magnesium, titanium, halogen and an internal electron donor, the internal electron donor comprising an imine compound as shown in Formula Z. The present invention also provides a preparation method of the catalyst component, and a catalyst for olefin polymerization containing the same. When the catalyst of the present invention is used for olefin polymerization reaction, the catalyst has a high activity, and a slow rate of activity decay, and the obtained polymer has a high isotacticity index, and a wide molecular weight distribution.

Movable holding device, operation unit displacement device, and image forming system

A movable holding device includes: a base; an attachment unit to which an operation unit is to be attached; and a connecting unit that extends in a longitudinal direction, has recessed members forming a space with each other and being connected to each other so that a relative movement thereof changes a position of the attachment unit with respect to the base, and has one longitudinal end portion connected to the base and another longitudinal end portion connected to the attachment unit.

Ethylene degradation catalyst and preparation method and use thereof

The present disclosure discloses an ethylene degradation catalyst and a preparation method and a use thereof.

Median filter for image processing

A device determines multiple sets of parameter values associated with an array of pixels to be used to process an image. Each set of parameter values corresponds to a set of pixels, included in the array, that are aligned along a first dimension of the array. The device determines a set of median values corresponding to each of the multiple sets of parameter values. The device determines a median of medians value that is a median of the set of median values. The device excludes a portion of parameter values, included in the multiple sets of parameter values, from a comparison set used to determine an overall median value, and determines a first median parameter value of the comparison set. The device determines the overall median value based on comparing the first median parameter value and the median of medians value, and provides the overall median value.

REACTIVE ORGANOSILICON THIXOTROPIC AGENT, ORGANOSILICON ENCAPSULATION ADHESIVE AND LED ELEMENT

Disclosed is a reactive organosilicon thixotropic agent, an organosilicon encapsulation adhesive containing the reactive organosilicon thixotropic agent, and an LED element encapsulated by using the organosilicon encapsulation adhesive. In the present disclosure, the reactive organosilicon thixotropic agent is prepared by a hydrosilylation reaction of cyclic hydrogen-containing polysiloxane or branched hydrogen-containing polysiloxane that contains phenyl with unsaturated polyether under the condition that the ratio of the total quantity of SiH bonds in the cyclic hydrogen-containing polysiloxane or the branched hydrogen-containing polysiloxane to the total quantity of olefinic bonds in the unsaturated polyether is greater than 1, can provides the organosilicon encapsulation adhesive with stable thixotropic property, high transparency, and excellent mechanical property and adhesion property at the same time, and thus an LED element having great encapsulation property is manufactured.

Coordinating virtual interactions with a mini-map

Aspects of the present disclosure are directed to a mini-map coordination system that can facilitate interactions between co-located and non-co-located users by providing a min-map through an artificial reality system. The mini-map can be a representation of a virtual space that corresponds to a real-world space in which some users are located and that other users join virtually. Users can join the space by entering the real-world space or by remotely logging into the virtual space. Users who have joined the virtual space can be represented in the mini-map by avatars. Users moving their avatars around the mini-map can trigger interactions, such as automatically initiating a holographic call between the users whose avatars come within a threshold distance of each other. The system can allow remote users to observe social norms such as requiring a user to “knock” before their avatar is allowed to enter a private space.

CIRCUIT AND METHOD FOR PREVENTING SCREEN FLICKERING, DRIVE CIRCUIT FOR DISPLAY PANEL, AND DISPLAY APPARATUS

Circuit and method for preventing screen flickering, a drive circuit for a display panel, and a display apparatus are provided, relating to the field of display technology. The circuit for preventing screen flickering includes a control sub-circuit configured to control a gate drive circuit of the display panel to output a gate cut-off level during a power-on period of the display panel. The gate drive circuit of the display panel is controlled to output the gate cut-off level during the power-on period, the gate cut-off level is provided to gate lines of the display panel such that TFTs connected to the gate lines are in cut-off state during the power-on period. 1. A circuit for preventing screen flickering , which is applicable to a drive circuit for a display panel , the drive circuit comprising a gate drive circuit , wherein the circuit for preventing screen flickering comprises:a control sub-circuit configured to control the gate drive circuit to output a gate cut-off level during a power-on period of the display panel.2. The circuit for preventing screen flickering according to claim 1 , wherein the gate drive circuit comprises a noise reduction module which is configured to pull an output level of the gate drive circuit to the gate cut-off level when a noise reduction voltage signal received by the noise reduction module is a turn-on level; andwherein the control sub-circuit is configured to control the noise reduction voltage signal outputted to the noise reduction module to be the turn-on level during the power-on period.3. The circuit for preventing screen flickering according to claim 2 , wherein the control sub-circuit is configured to output an external input voltage signal of the drive circuit as the noise reduction voltage signal to the noise reduction module during the power-on period.4. The circuit for preventing screen flickering according to claim 1 , wherein the gate drive circuit comprises a first noise reduction module and a second noise ...

SPEAKER

A speaker is provided in the present disclosure. The speaker includes a magnetic circuit system for providing magnetic field, a diaphragm, a suspension, a drive mechanism and a horizontal former, which is retained on the surface of the diaphragm directly facing the magnetic circuit system. The diaphragm is suspended above the magnetic circuit system for generating sound by vibrating. The suspension is used to suspend the diaphragm above the magnetic circuit system. The drive mechanism is disposed under the diaphragm and can interact with the magnetic circuit system so as to drive the diaphragm to vibrate in order to generate sound. The horizontal former is retained on the surface of the diaphragm directly facing the magnetic circuit system, wherein the horizontal former is provided with a communication space which communicates the space under the diaphragm and the space under the suspension.

Speaker

A speaker is provided in the present disclosure. The speaker includes a magnetic circuit system, a vibration system and an auxiliary system suspending the vibration system above the magnetic circuit system. The magnetic circuit system comprises a yoke, permanent magnets assembled on the yoke, and a magnetic gap near the permanent magnets. The yoke comprises an upper surface for assembling the permanent magnets, a lower surface opposite to the upper surface, side surfaces connecting the upper surface and the lower surface, and communication conduits extending through the upper surface and the side surface to communicate the magnetic gap and the space outside the speaker.

Integrated signal manipulator for manipulating optical signals

An integrated signal manipulator for manipulating an optical signal. The optical signal manipulator is integrated on a single material substrate by etching a curved grating mirror. The curved grating mirror decomposes a first optical signal into focused spectral components. These focused spectral components are manipulated by signal-processing elements that are realized on the same material substrate. The manipulated spectral components are then combined by another curved grating mirror, on the same material substrate, to generate a second optical signal.

Adhesive articles for medical applications

Adhesive articles suitable for use in medical applications include a siloxane-based pressure sensitive adhesive layer, and a breathable conformable backing having a first surface and a second surface. The siloxane-based pressure sensitive adhesive layer is coated on the first surface of the breathable conformable backing, and the second surface of the breathable conformable backing comprises a treated surface. The siloxane-based pressure sensitive adhesive layer can be attached to skin and other adhesive articles can be releasably adhered to the treated surface to form adhesive constructions.

Transparent conducting components and related electro-optic modulator devices

New electro-optic (EO) phase modulator devices and geometries, as can be constructed using a transparent conductive component.

Image capturing method and terminal device

An image capturing method and a terminal device are provided. The method includes entering a camera application to start a lens and display a viewfinder interface, converting an original image captured by the lens into a red-green-blue (RGB) image, and decreasing luminance of the RGB image to be less than first luminance or increasing the luminance of the RGB image to be greater than second luminance, to obtain a first image; converting the RGB image into N frames of high-dynamic-range (HDR) images, and fusing color information of pixels in any same location on the first image and the N frames of HDR images to obtain a final image.

Catalyst component for olefin polymerization, catalyst, and use thereof

The present disclosure provides a solid catalyst component for olefin polymerization, comprising magnesium, titanium, a halogen, and an electron donor, wherein the electron donor is at least one selected from the group consisting of diol diester compounds as shown in Formula (I). The catalyst according to the present disclosure has significantly improved polymerization activity, hydrogen response, and stereoselectivity. According to the present disclosure, when the catalyst system containing a diol diester compound as shown in Formula (I) of the present disclosure is used in olefin polymerization, the catalyst shows good comprehensive performance, including high catalytic activity. In particular, in the presence of highly concentrated hydrogen, the catalyst has an improved hydrogen response and/or isotacticity of the polymers obtained can be significantly improved. The catalyst of the present disclosure is beneficial for obtaining polymers with a high melt index and high isotacticity, and for development of polymers of different grades. 1. (canceled)2. (canceled)3. (canceled)4. A catalyst component for olefin polymerization , comprising magnesium , titanium , a halogen , and an electron donor , wherein the electron donor is at least one selected from the group consisting of diol diester compounds , wherein the diol diester compounds are one or more selected from the group consisting of2,4-hexanediol-bis(4-ethyl benzoate),2,4-hexanediol-bis(4-n-propyl benzoate),2,4-hexanediol-bis(4-n-butyl benzoate),2,4-hexanediol-bis(4-iso-butyl benzoate),2,4-hexanediol-bis(4-tert-butyl benzoate),2,4-hexanediol-bis(4-hexyl benzoate),3-methyl-2,4-hexanediol-bis(4-ethyl benzoate),3-methyl-2,4-hexanediol-bis(4-n-propyl benzoate),3-methyl-2,4-hexanediol-bis(4-n-butyl benzoate),3-methyl-2,4-hexanediol-bis(4-iso-butyl benzoate),3-methyl-2,4-hexanediol-bis(4-tert-butyl benzoate),3-methyl-2,4-hexanediol-bis(4-hexyl benzoate),3-ethyl-2,4-hexanediol-bis(4-ethyl benzoate),3-ethyl-2,4- ...

AMPHIPHILIC DENDRIMERS COMPLEXED WITH SIRNA FOR TREATMENT OF CANCER

The invention pertains to amphiphilic dendrimers complexed with Bcl3 siRNA. The amphiphilic dendriplexes described herein are biodegradable and exhibit enhanced siRNA delivery. The amphiphilic dendriplexes containing Bcl3 siRNA inhibit cancer cell/tumor growth in vitro and in vivo without toxicity. Accordingly, an embodiment of the invention provides a method of treating a cancer, particularly, nasopharyngeal carcinoma, by administering to a subject in need thereof, a therapeutic amount of amphiphilic dendrimers complexed with Bcl3 siRNA. Pharmaceutical compositions containing the amphiphilic dendrimers complexed with Bcl3 siRNA are also provided. 1. A method for treating a cancer , the method comprising administering to a patient in need thereof a pharmaceutically effective amount of an amphiphilic dendrimer complexed with a Bcl3 siRNA.2. The method of claim 1 , wherein the cancer is nasopharyngeal carcinoma (NPC).3. The method of claim 1 , wherein the siRNA and the amphiphilic dendrimer have an N/P ratio of 2.5 to 15 claim 1 , 5 to 15 claim 1 , or 5 to 10.4. The method of claim 3 , wherein the siRNA and the amphiphilic dendrimer have the N/P ratio of about 5.5. The method of claim 1 , wherein the pharmaceutically effective amount of the amphiphilic dendrimer complexed with a Bcl3 siRNA produces Bcl3 siRNA concentration in the subject's body of 2.5 nM to 50 nM claim 1 , 10 nM to 50 nM claim 1 , or 20 nM to 50 nM.6. The method of claim 5 , wherein the pharmaceutically effective amount of the amphiphilic dendrimer complexed with a Bcl3 siRNA produces Bcl3 siRNA concentration in the subject's body of about 10 nM or 20 nM.7. The method of claim 1 , wherein the Bcl3 siRNA has the sequence of SEQ ID NO: 1.8. A pharmaceutical composition comprising an amphiphilic dendrimer complexed with a Bcl3 siRNA.9. The pharmaceutical composition of claim 8 , wherein the siRNA and the amphiphilic dendrimer have an N/P ratio of 2.5 to 15 claim 8 , 5 to 15 claim 8 , or 5 to 10.10. The ...

Catalyst component for olefin polymerization, catalyst, and use thereof

Disclosed is a catalyst component for olefin polymerization. The catalyst component comprises magnesium, titanium, halogen and an internal electron donor. The internal electron donor includes an imine compound with a ketone group as shown in Formula I. Disclosed further is a method of preparing the catalyst component, and a catalyst for olefin polymerization containing the catalyst component. When the catalyst is used in olefin polymerization reaction especially propene polymerization reaction, the catalyst has a high long-term activity and good hydrogen response, and the obtained polymer has characteristics of an adjustable isotactic index and a relatively wide molecular weight distribution.

Catalyst component for olefin polymerization and catalyst comprising the same

The present invention provides a catalyst component for polymerization of olefin CH 2 ═CHR, in which R is hydrogen or C 1 -C 12 alkyl or aryl, comprising magnesium, titanium, a halogen and an electron donor compound (a) which is at least one selected from the group consisting of dibasic ester compounds of the formula (I), and said catalyst component optionally further comprising an electron donor compound (b) selected from the group consisting of aliphatic dicarboxylic esters and aromatic dicarboxylic esters, and/or an electron donor compound (c) selected from the group consisting of 1,3-diether compounds of formula (IV): wherein, R 1 , R′ and A are as defined in the description, wherein R I -R VIII are as defined in the description, and a catalyst comprising the catalyst component.

Fluorinated polymers

Provided are compounds described by the formula: wherein W, X, Y, and Z are independently selected from the group consisting of hydrogen, fluorine, hydroxyl, substituted alkyl and unsubstituted alkyl. Also provided are methods of making compounds of the present invention, and polymers derived from one or more compounds of the present invention.

Single-phase reclosing method, device and storage medium for AC/DC system

The present disclosure is directed to a single-phase reclosing method, device and storage medium for AC/DC system. The method comprises: acquiring three-phase voltages at inverter-side AC bus close to the transformer, three-phase currents measured at the outlet of inverter-side AC line and three-phase voltages at inverter-side AC bus far from the transformer; calculating the energy calculation value and energy operation value of the fault line; identifying the fault nature of fault line within the maximum time delay, according to the energy calculation value and energy operation value of fault line and an energy criterion of transient/permanent fault; issuing a reclosing control signal based on the fault nature of fault line to realize effective reclosing of the fault line.

Fluorine-containing compounds and polymers derived therefrom

Provided are fluorine-containing compounds, and polymers derived therefrom, for use in compositions used for treating textile substrates. Also provided are methods of making fluorine-containing compounds and polymers derived therefrom, compositions comprising the compounds and/or polymers of the present invention, methods of treating substrates, and the treated products derived therefrom.

OSCILLATION ACTIVE DAMPING CONTROL METHOD AND SYSTEM FOR GRID-TIED TYPE-4 WIND TURBINE GENERATOR

The application relates to an oscillation active damping control method and system for grid-tied type-4 wind turbine generator. The method comprises: based on an interconnection model of multiple subsystems, constructing a stored energy function and a dissipated energy function of a current inner loop control subsystem, and interaction energy functions between the current inner loop control subsystem and other subsystems are constructed, then establishing an energy feedback model of Type-4 wind turbine generator; when the oscillation occurs, obtaining instantaneous angular frequency of the PLL, and then based on the energy feedback model, adjusting the current reference value of the q-axis current inner loop generated by the reactive power outer loop control subsystem, to make the stored energy function decrease with time, so as to suppress the oscillation.

Transparent conducting components and related electro-optic modulator devices

New electro-optic (EO) phase modulator devices and geometries, as can be constructed using a transparent conductive component.

Piperazinyl pyrimidine derivatives, preparation method and use thereof

Provided are piperazinyl pyrimidine derivatives of formula I having CCR4antagonism, and the preparation method, pharmaceutical composition and use thereof in the preparation of a medicament. The medicament is useful for the treatment and prevention of CCR4-related diseases.

Method and system for evaluating stability of HVDC receiving end system, and storage medium

The disclosure relates to a method and system for evaluating the stability of HVDC receiving end system and storage medium, which relates to the technical field of high voltage direct current transmission. The method includes: collecting voltage at a generator port, current at the generator port and rotational speed of the generator after eliminating fault; determining a corresponding relationship between the generator dynamic energy and the time according to the voltage at the generator port, the current at the generator port and the rotational speed of the generator; determining the attenuation intensity of the generator dynamic energy according to the corresponding relationship between the generator dynamic energy and the time; determining stability of the HVDC receiving end system according to the attenuation intensity of the generator dynamic energy.

SYSTEM AND METHOD OF LOCATING OSCILLATION SOURCES OF WIND POWER INTEGRATED SYSTEM BASED ON ENERGY SPECTRUMS

The present application proposes a method of locating oscillation sources of wind power integrated system based on energy spectrums. The method include: collecting information of voltage and current at the terminal of each generator and obtaining a dynamic energy curve of each generator over time; choosing the generators whose curve shows an upward trend in the dynamic energy over time curve into alternative generators; obtaining and processing energy spectrums of synchronous generator, DFIG with PLL, and/or an analogical energy spectrum of DFIG with virtual inertia among the alternative generators; selecting generator with maximum proportion of dominant oscillation mode as an oscillation source reference generator; and Calculating the similarity coefficients between energy spectrums of each remaining candidate generator and the oscillation source reference generator, determining the oscillation source generators. 1. A method of locating the oscillation sources of wind power integrated system based on energy spectrums , comprising the following steps:step 1: collecting the information of voltage and current at an output terminal of each generator in the system, and obtaining a dynamic energy curve of each generator over time;step 2: choosing generators whose curves show an upward trend in the dynamic energy curve over time into alternative generators;step 3: obtaining energy spectrums of synchronous generator, with a phase-locked loop, and/or an analogical Doubly-fed induction generator (DFIG) energy spectrum of DFIG with virtual inertia among the alternative generators;step 4: standardizing the amplitudes of the energy spectrums and/or the analogical energy spectrum, wherein a generator with maximum proportion of dominant oscillation mode is selected as an oscillation source reference generator; andstep 5: calculating the similarity coefficients between energy spectrums of each remaining alternative generator and the oscillation source reference generator in the ±0 ...

Method and device for detecting secondary synchronous signal, computer program and storage medium

The present invention provides a method and a device for detecting a secondary synchronous signal, a computer program and a storage medium. The method comprises: Step S1: extracting a first SSS sequence from a received signal according a PSS detection result; Step S2: performing rotation on the first SSS sequence, to obtain at least two second sequences including the first SSS sequence, channel paths corresponding to the at least two second sequences being located within a channel window in a time domain; Step S3: calculating a channel estimation result of each of the second sequences corresponding to each of SSS standard sequences; Step S4: selecting, according to the channel estimation result, valid channel paths corresponding to the respective SSS standard sequence from the channel paths corresponding to the second sequences; Step S5: calculating a signal-to-noise ratio corresponding to the respective SSS standard sequence according to the valid channel paths corresponding to the respective ...

Artificial reality environment with glints displayed by an extra reality device

The present embodiments relate to display of glints associated with real-world objects in an environment displayed on an extra reality (XR) device. The glint can include a virtual object associated with a real-world object, such as an indication of a social interaction associated with a real-world object, a content item tagged to an object, etc. The system as described herein can present glints on a display of an XR device based on a distance between the XR device and a location associated with the glint. Responsive to selection of a glint in the environment, additional information can be presented relating to the glint or another action can be taken, such as to open an application. In some instances, a glint can include a series of search results relating to a corresponding real-world object to provide additional information relating to the real-world object.

Catalyst component for olefin polymerization reaction and catalyst comprising same

A catalyst component for olefin polymerization comprising magnesium, titanium, halogen and electron donor, wherein the electron donor is selected from at least one of the diol diester compounds, when the diol diester comprised contains a certain amount of isomer with Fischer projection formula as shown in Formula (II), the activity and stereospecificity of the catalyst are greatly improved, especially in the production of polymers with high melt index, the isotactic index of the obtained polymers is improved substantially.

Method, apparatus, device and machine-readable medium for detecting abnormal data using an autoencoder

In an embodiment, a method includes: using at least two items of sequentially collected, mutually associated data to create at least two detection data sets, each including a first number of items of sequentially collected data in the at least two items of data; using an autoencoder to process the at least two detection data sets, to output result data sets respectively corresponding to the at least two detection data sets, the first number being equal to the number of neurons in an input layer of the autoencoder, and the autoencoder being trained using data having a regular pattern of variation identical to the at least two items of data; and determining, as abnormal data, data which does not have the regular pattern of variation in the at least two items of data, based upon the at least two detection data sets and the result data sets corresponding thereto.

Three-dimensional (3D) sensor performance evaluation

Systems and methods for evaluating the performance of three-dimensional (3D) sensors can include, for example, obtaining, via a 3D sensor in a testing apparatus, range information of a scene within a field-of-view (FOV) of the 3D sensor. The scene includes a plurality of targets disposed within the testing apparatus. Each of the plurality of targets is located at a different distance from the 3D sensor in the testing apparatus. A validation of the performance of the 3D sensor at the different distances is performed at a same point in time, based on the range information. An indication of a result of the validation is provided.

catalyst component for olefin polymerization, catalyst for olefin polymerization, catalyst prepolymerization for polymerizing olefin, method for olefin polymerization

Method to treat conditions associated with insulin signalling dysregulation

The invention discloses a method to identify proteins involved in the ISP. The invention also discloses suitable targets for the development of new therapeutics to treat, prevent or ameliorate pathological conditions associated with dysregulation of the ISP. The invention also relates to methods to treat, prevent or ameliorate said conditions and pharmaceutical compositions therefor, as well as to a method to identify compounds with therapeutic usefulness to treat pathological conditions associated with dysregulation of the ISP.

BOOSTER CIRCUIT, SHUTDOWN CIRCUIT, METHODS FOR DRIVING THE SAME, AND DISPLAY APPARATUS

The embodiments of the present disclosure propose a booster circuit and a method for driving the same, a shutdown circuit and a method for driving the same, and a display apparatus. The booster circuit includes a first input sub-circuit coupled to a first input signal terminal, a first voltage signal terminal, and an output signal terminal, and configured to transmit a first voltage signal at the first voltage signal terminal to the output signal terminal under control of a first input signal at the first input signal terminal; a second input sub-circuit coupled to a second input signal terminal, the first voltage signal terminal and a first node, and configured to transmit the first voltage signal at the first voltage signal terminal to the first node under control of a second input signal at the second input signal terminal; and a first storage sub-circuit coupled to the output signal terminal and the first node, and configured to cause a level of an output signal at the output signal terminal to be raised to a level higher than the first voltage signal. 1. A booster circuit , comprising:a first input sub-circuit coupled to a first input signal terminal, a first voltage signal terminal, and an output signal terminal, and configured to transmit a first voltage signal at the first voltage signal terminal to the output signal terminal under control of a first input signal at the first input signal terminal;a second input sub-circuit coupled to a second input signal terminal, the first voltage signal terminal and a first node, and configured to transmit the first voltage signal at the first voltage signal terminal to the first node under control of a second input signal at the second input signal terminal; anda first storage sub-circuit coupled to the output signal terminal and the first node, and configured to cause a level of an output signal at the output signal terminal to be raised to a level higher than the first voltage signal.2. The booster circuit according ...

Paging decoding

A paging decoding method in a wireless communication device adapted to operate in association with a primary cell provided by a network node of a cellular communication system, wherein the primary cell has one or more neighboring cells is disclosed. The method comprises receiving a paging signal during a paging occasion, temporarily storing the received paging signal, attempting to decode the received paging signal based on one or more parameters of the primary cell, and (if decoding of the received paging signal based on one or more parameters of the primary cell is un-successful) attempting to decode the temporarily stored received paging signal based on parameters of one of the neighboring cells. In some embodiments, the method may further comprise selecting the one of the neighboring cells based on one or more of respective received signal strengths of the neighboring cells and respective received signal powers of the neighboring cells after receiving the paging signal during the paging ...

Antibodies specific for cancer associated antigen SM5-1 and uses thereof

The invention concerns antibodies which is specific for SM5-1 antigen expressed in melanoma, breast cancer and hepatocellular carcinoma, and polynucleotides encoding the antibodies. The invention further concerns use of such antibodies and/or polynucleotides in diagnosing and treating malignancies.

Display panel and display device

A display panel includes a plurality of source driving chips, a power management circuit, and a plurality of switching units. The power management circuit includes a first output terminal, and the first output terminal is configured to provide a digital power signal to the source driving chips; and the plurality of switching units are respectively arranged corresponding to at least one of the source driving chips, the switching units are connected to the first output terminal and the corresponding source driving chips, and at least part of the switching units are configured to turn on the corresponding source driving chips and the first output terminal in different time periods in response to different control signals.

System and method of locating oscillation sources of wind power integrated system based on energy spectrums

The present application proposes a method of locating oscillation sources of wind power integrated system based on energy spectrums. The method include: collecting information of voltage and current at the terminal of each generator and obtaining a dynamic energy curve of each generator over time; choosing the generators whose curve shows an upward trend in the dynamic energy over time curve into alternative generators; obtaining and processing energy spectrums of synchronous generator, DFIG with PLL, and/or an analogical energy spectrum of DFIG with virtual inertia among the alternative generators; selecting generator with maximum proportion of dominant oscillation mode as an oscillation source reference generator; and calculating the similarity coefficients between energy spectrums of each remaining candidate generator and the oscillation source reference generator, determining the oscillation source generators.

SPEAKER

A speaker is provided in the present disclosure. The speaker includes a magnetic circuit system, a vibration system and an auxiliary system suspending the vibration system above the magnetic circuit system. The magnetic circuit system comprises a yoke, permanent magnets assembled on the yoke, and a magnetic gap near the permanent magnets. The yoke comprises an upper surface for assembling the permanent magnets, a lower surface opposite to the upper surface, side surfaces connecting the upper surface and the lower surface, and communication conduits extending through the upper surface and the side surface to communicate the magnetic gap and the space outside the speaker. 1. A speaker , comprising:a magnetic circuit system,a vibration system, andan auxiliary system suspending the vibration system above the magnetic circuit system; permanent magnets assembled on the yoke,', 'a magnetic gap near the permanent magnets, and', an upper surface for assembling the permanent magnets,', 'a lower surface opposite to the upper surface,', 'side surfaces connecting the upper surface and the lower surface, and', 'communication conduits extending through the upper surface and the side surface to communicate the magnetic gap and the space outside the speaker., 'a yoke, which comprises], 'wherein the magnetic circuit system comprises2. The speaker of claim 1 , wherein the communication conduits extend through the upper surface and the lower surface of the yoke.3. The speaker of claim 1 , wherein the communication conduits are provided at the edge of the yoke.4. The speaker of claim 3 , wherein each of the communication conduits comprises a cut-out groove extending through the upper surface and the lower surface and a channel communicating the magnetic gap and the cut-out groove.5. The speaker of claim 4 , wherein the yoke is in the shape of rectangular plate claim 4 , which comprises two long axis edge portions and two short axis edge portions connecting the long axis edge portion; ...

Preparation and application of anti-tumor bifunctional fusion proteins

Provided herein is a chimeric protein, which chimeric protein comprises a Flt3 ligand, or a biologically active fragment thereof, and a proteinaceous or peptidyl tumoricidal agent, or a targeting agent which binds to a receptor expressed on a tumor, and uses thereof, particularly in the treatment of malignancy. Other embodiments and uses are disclosed.

CATALYST COMPOSITION FOR OLEFIN POLYMERIZATION AND APPLICATION OF SAME

The present disclosure discloses a catalyst composition for olefin polymerization, comprising the following components: a): a solid catalyst component containing magnesium, titanium, halogens, and at least one internal electron donor having a lone pair of electrons; b): an aluminum alkyl compound; and c): an external electron donor containing a first external electron donor C1, which is a malonate compound. In the present disclosure, a catalyst composition having an external electron donor that contains a malonate compound is used in olefin polymerization, in particular propene polymerization, and can significantly improve catalytic activity and hydrogen response of the catalyst and expand molecular weight distribution of polymers, which facilitates development of different polymers. 1. A catalyst composition for olefin polymerization , comprising the following components:a): a solid catalyst component containing magnesium, titanium, halogens, and at least one internal electron donor having a lone pair of electrons;b): an aluminum alkyl compound; andc): an external electron donor containing a first external electron donor C1, which is a malonate compound.3. The catalyst composition according to claim 2 , wherein Ris selected from the group consisting of substituted or non-substituted Cto Cstraight-chain alkyl groups claim 2 , Cto Cbranched-chain alkyl groups claim 2 , Cto Ccycloalkyl groups claim 2 , Cto Caryl groups claim 2 , Cto Calkaryl groups claim 2 , and Cto Caralkyl groups claim 2 , preferably from the group consisting of substituted or non-substituted Cto Cstraight-chain alkyl groups claim 2 , Cto Cbranched-chain alkyl groups claim 2 , Cto Ccycloalkyl groups claim 2 , and Cto Calkaryl groups; and{'sub': 7', '8', '1', '10', '1', '10', '3', '10', '6', '10', '7', '10', '1', '8', '2', '8', '3', '10', '6', '10', '7', '10, 'wherein, Rand R, identical with or different from each other, are selected from the group consisting of hydrogen, halogens, and substituted or ...

CATALYST COMPONENT FOR OLEFIN POLYMERIZATION REACTION AND CATALYST THEREOF

A catalyst component for olefin polymerization which contains magnesium, titanium, halogen and electron donors is provided in the present invention. The electron donors are selected from at least one succinate compounds of following general formula (I), and the content of said succinate compounds with the structure as shown in Formula (II) in said succinate compounds (I) is less than 100%, but not less than 51.0 wt %. Compared with the mesomer whose content with the structure as shown in Formula (II) is 100%, the catalyst component provided by the present invention not only greatly decreases the manufacturing cost, but also improves certain properties of the catalyst, for example the molecular weight distribution of polymer obtained by catalytic reaction using said catalyst is wider, which is beneficial for improving processing properties of polymers. The corresponding catalyst is also provided. 2. A catalyst component according to claim 1 , wherein in said succinate compounds as shown in Formula (I) claim 1 , the content of the succinate compound with the Fischer projection formula as shown in Formula (II) is 51.0 to 98.0 wt %.3. A catalyst component according to claim 1 , wherein in said succinate compounds as shown in Formula (I) claim 1 , the content of the succinate compound with the Fischer projection formula as shown in Formula (II) is 67.0 to 98.0 wt %.4. A catalyst component according to claim 1 , wherein in said succinate compounds as shown in Formula (I) claim 1 , the content of the succinate compound with the Fischer projection formula as shown in Formula (II) is 76.0 to 97.0 wt %.5. A catalyst component according to claim 1 , wherein in Formula (I) claim 1 , Rand Rare selected from methyl claim 1 , ethyl claim 1 , propyl claim 1 , isopropyl claim 1 , butyl claim 1 , isobutyl claim 1 , tertbutyl claim 1 , pentyl claim 1 , cyclopentyl claim 1 , cyclohexyl claim 1 , phenyl claim 1 , substituted phenyl claim 1 , alkylphenyl claim 1 , halogenated alkylphenyl ...

Portable power station

Transparent Conducting Components and Related Electro-Optic Modulator Devices

New electro-optic (EO) phase modulator devices and geometries, as can be constructed using a transparent conductive component.

Planetary gear train transmission device of hybrid vehicle

A planetary gear train transmission device of a hybrid vehicle is provided, which belongs to the technical field of transmissions. A transmission device of a hybrid vehicle based on a planetary gear train, which has a simple structure and is convenient to maintain is provided. The transmission device is composed of two motors, two clutches, one simple planetary gear train, and one complex planetary gear train. One motor is mainly used for generating power, and the other motor is used for driving the vehicle to move forward and brake to recover energy. Selection of different speed ratios and different working modes can be achieved by means of different combinations of the clutches and the planetary gear trains and different working states of the engine and the two motors. The present disclosure is convenient to control, has a compact structure, and adopts a few of parts.

Catalyst for olefin polymerization and use of the same

The present application discloses a catalyst for olefin polymerization, comprising a product of the following components: (A) solid titanium-containing catalyst component comprising magnesium, titanium and halogen as essential components; (B) organo-aluminum compound catalyst component, and (C) silicon ether compound catalyst component, the silicon ether compound being represented by a general formula (I): wherein R1-R12 and A are as defined in the description.

STABILITY EVALUATION METHOD AND SYSTEM OF DIRECT-DRIVE WIND TURBINE GENERATOR

The application involves a stability evaluation method and system of direct-drive wind turbine generator, which belongs to the technical field of wind power generation. It solves the problems of poor stability of direct-drive wind turbine generator, low safety performance, failure to realize mutual cooperation between online stability evaluation and parameter adjustment in the existing technology. Firstly, the variation of direct-drive wind turbine generator terminal voltage, current, power and PLL angle of direct-drive wind turbine generator is measured, the terminal energy and the energy negative gradient of direct-drive wind turbine generator is calculated. Then, the system stability is assessed according to the value of energy negative gradient, the influence of the critical parameters on system stability is analyzed and the preliminary adjustment strategy is proposed. It realizes the mutual cooperation between stability level evaluation and parameter adjustment, and improves the working efficiency of the system. 5. The stability evaluation method of direct-drive wind turbine generator according to claim 4 , assessing the system stability level according to η: when η is positive claim 4 , the system is stable and the bigger the value of η is claim 4 , the higher the system stability level is; when η is zero claim 4 , the system is critically stable; when η is negative claim 4 , the system will go unstable claim 4 , and as the absolute value of η increases claim 4 , system stability level will drop.7. A stability evaluation system of direct-drive wind turbine generator claim 4 , comprising: a PMU claim 4 , a first processor claim 4 , a second processor claim 4 , a third processor and result output terminal claim 4 , whereinthe PMU is used to collect variation of voltage, current, active power and PLL (Phase Locked Loop) angle at the terminal of direct-drive wind turbine generator;the first processor is used to calculate the terminal energy of direct-drive wind ...

Catalyst component for olefin polymerization and catalyst comprising the same

The present invention provides a catalyst component for polymerization of olefin CH 2 =CHR, in which R is hydrogen or C 1 -C 12 alkyl or aryl, comprising magnesium, titanium, a halogen and an electron donor compound (a) which is at least one selected from the group consisting of dibasic ester compounds of the formula (I), and said catalyst component optionally further comprising an electron donor compound (b) selected from the group consisting of aliphatic dicarboxylic esters and aromatic dicarboxylic esters, and/or an electron donor compound (c) selected from the group consisting of 1,3-diether compounds of formula (IV): wherein, R 1 , R′ and A are as defined in the description, wherein R I -R VIII are as defined in the description, and a catalyst comprising the catalyst component.

SYSTEMS AND METHODS FOR GENERATING CANDIDATE RECOMMENDATIONS

Systems, methods, and non-transitory computer-readable media can be configured to determine a set of candidates based at least in part on filtering criteria. A subset of candidates can be determined from the set of candidates based at least in part on one or more recruiter features associated with a recruiter. A recommendation can be provided to the recruiter for a candidate from among the subset of candidates based at least in part on a ranking of the subset of candidates.

Minimum resource fast fourier transform

A minimum resource FFT design may calculate the FFT for an input data series using minimal logic resources to implement the FFT. In one implementation, the FFT design may include a butterfly component for performing one or more complex addition and multiplication operations and outputting a plurality of results; a first memory coupled to the butterfly component, the first memory including a number of memory banks equal in number to the number of the plurality of the results; a second memory coupled to the butterfly component, the second memory including a number of memory banks equal in number to a number of the plurality of the results; and a control component to control reading and writing from the first and second memories and the butterfly component using a ping-pong access technique that reads and writes intermediate values to the first and second memories to implement the FFT.

Search System, Page Display Method and Client Terminal

A search system, a page display method, and a client terminal are disclosed. The search system includes a front-end server used for receiving a keyword provided by a client terminal, providing the keyword to a content search engine, and returning a content result set that is obtained to the client terminal; and the content search engine used for performing a search in a content resource pool based on the keyword to obtain the content result set, and providing the content result set to the front-end server. The present disclosure can provide a diversified search result to a user, thus facilitating browsing of the user and improving user experience. 1. A system comprising:one or more processors;memory; receive a keyword provided by a client terminal,', 'provide the keyword to the content search engine, and', 'return a content result set that is obtained to the client terminal; and, 'a front-end server stored in the memory and executable by the one or more processors to perform a search in a content resource pool based on the keyword to obtain the content result set, and', 'provide the content result set to the front-end server, wherein the content resource pool includes at least one of pieces of topic information or aggregate information of objects, and the content result set includes a piece of the topic information and/or a piece of the aggregate information that matches the keyword., 'a content search engine stored in the memory and executable by the one or more processors to2. The system of claim 1 , further comprising: obtain access data of the client terminal,', 'perform a search in the access data using the keyword to obtain a collaborative result set, and', 'return the collaborative result set to the front-end server, the collaborative search set including object information that matches with the keyword in the access data, wherein the front-end server is further used for providing the keyword to the collaborative search engine and providing the collaborative ...

NANOMETER-PRECISION SIX-DEGREE-OF-FREEDOM MAGNETIC SUSPENSION MICRO-MOTION TABLE AND APPLICATION THEREOF

A nanometer precision six-DOF magnetic suspension micro-stage and the application thereof are provided which are mainly used in semiconductor photolithography devices. The micro-stage includes a cross support and four two-DOF actuators. Each 2-DOF actuator comprises a vertically polarized permanent magnet, a horizontal force coil and a vertical force coil; the permanent magnet being mounted on an end of the cross support, the horizontal force coil and the vertical force coil being arranged on a side of and below the permanent magnet respectively and being spaced apart from the permanent magnet; the cross support and four vertically polarized permanent magnets constitute a mover of the micro-stage; the horizontal force coil and the vertical force coil being fixed by a coil framework respectively and constituting a stator of the micro-stage; and the stator being mounted on a base of the micro-stage. A dual-wafer table positioning system of a photolithography machine may be constructed by two said micro-stages in combination with a two-DOF large stroke linear motor. The present invention features simple structure, large driving force, small mass and absence of cable disturbance, and is possible to realize high precision, high acceleration six-DOF micro-motion. 19567596759528113. A nanometer precision six-DOF magnetic suspension micro-stage , characterized by comprising a cross support () and four 2-DOF actuators each comprising a vertically polarized permanent magnet () , a horizontal force coil () and a vertical force coil (); wherein , the permanent magnet () is mounted on an end of the cross support () , the horizontal force coil () and the vertical force coil () are arranged on one side of and below the permanent magnet () respectively and being spaced apart from the permanent magnet; said cross support () and the four vertically polarized permanent magnets () constitute a mover () of the micro-stage; the horizontal force coil and the vertical force coil are ...

Catalyst composition for olefin polymerization and application of same

The present disclosure discloses a catalyst composition for olefin polymerization, comprising the following components: a): a solid catalyst component containing magnesium, titanium, halogens, and at least one internal electron donor having a lone pair of electrons; b): an aluminum alkyl compound; and c): an external electron donor containing a first external electron donor C1, which is a malonate compound. In the present disclosure, a catalyst composition having an external electron donor that contains a malonate compound is used in olefin polymerization, in particular propene polymerization, and can significantly improve catalytic activity and hydrogen response of the catalyst and expand molecular weight distribution of polymers, which facilitates development of different polymers.

Methods and systems of streaming refrigerant in a heat exchanger

Embodiments are disclosed to help create longitudinal refrigerant streams, for example, in a shell and tube type evaporator, so as to manage refrigerant and/or lubricant in the evaporator. In some embodiments, the shell side of the evaporator may include a plurality of longitudinally extended pans stacked in a vertical direction. In some embodiments, refrigerant can be directed onto a top pan. The refrigerant can form a longitudinal refrigerant stream along the pan and flow down to the next pan in the vertical direction and form another longitudinal refrigerant stream. Each of the pans may form a refrigerant pool to help exchange heat with a process fluid carried in heat exchanger tubes. By forming longitudinal refrigerant streams in the pans, heat exchange efficiency may be improved and a lubricant content in refrigerant streams may be concentrated toward a bottom of the evaporator.

Fluorine-containing compounds and polymers derived therefrom

Provided are fluorine-containing compounds, and polymers derived therefrom, for use in compositions used for treating textile substrates. The present invention further provides methods of making fluorine-containing compounds and polymers derived therefrom, compositions comprising the compounds and/or polymers of the present invention, methods of treating substrates, and the treated products derived therefrom.

Catalyst component for olefin polymerization, catalyst, and use thereof

The present disclosure provides a solid catalyst component for olefin polymerization, comprising magnesium, titanium, a halogen, and an electron donor, wherein the electron donor is at least one selected from the group consisting of diol diester compounds as shown in Formula (I). The catalyst according to the present disclosure has significantly improved polymerization activity, hydrogen response, and stereoselectivity. According to the present disclosure, when the catalyst system containing a diol diester compound as shown in Formula (I) of the present disclosure is used in olefin polymerization, the catalyst shows good comprehensive performance, including high catalytic activity. In particular, in the presence of highly concentrated hydrogen, the catalyst has an improved hydrogen response and/or isotacticity of the polymers obtained can be significantly improved. The catalyst of the present disclosure is beneficial for obtaining polymers with a high melt index and high isotacticity, and for development of polymers of different grades.

Catalyst component for propene polymerization, preparation method thereof, and catalyst containing the same

The present invention discloses a catalyst component for propene polymerization, comprising titanium, magnesium, halogen, and internal electron donor A, wherein said internal electron donor A is selected from the compounds as shown in Formula I, in Formula I, R is selected from hydrogen, hydroxyl, and substituted or unsubstituted C1-C30hydrocarbyl, preferably from hydrogen, hydroxyl, and substituted or unsubstituted C1-C20alkyl, C6-C30aryl, C6-C30heteroaryl, C7-C30alkylaryl and C7-C30arylalkyl; R1and R2may be identical to or different from each other, and are selected from hydrogen and substituted or unsubstituted C1-C30hydrocarbyl, preferably from hydrogen and substituted or unsubstituted C1-C20alkyl, C6-C30aryl, C7-C30alkylaryl and C7-C30arylalkyl. According to the present invention, by using the compound as shown in Formula I as internal electron donor compound for propene polymerization, the catalyst has a higher activity, and a slow rate of delay of activity. The obtained polymer has ...

Multi-center synergetic cancer prognosis prediction system based on multi-source migration learning

Provided is a multi-center synergetic cancer prognosis prediction system based on multi-source migration learning. The system includes a model parameter setting module, a data screening module, and a multi-source migration learning module, wherein the model parameter setting module is responsible for setting cancer prognosis prediction model parameters; the data screening module is arranged at a clinical center, and a management center transmits the set model parameter to each clinical center, such that each clinical center inquires a sample feature and prognosis index data from a local database according to the model parameter, so as to preprocess the data; and the multi-source migration learning module includes a source model training unit, a migration weight calculation unit, and a target model calculation unit.

Mobile device holographic calling with front and back camera capture

Aspects of the present disclosure are directed to a holographic calling system providing holographic calling between an artificial reality device and a mobile device having both front and back facing cameras. The user of the mobile device can position it so one of the cameras is pointed toward their face and another camera captures the user's hand not holing the mobile device. The holographic calling system can automatically determine the position of the mobile device in relation to the user's face and hand. Once the mobile device is positioned within an appropriate capture zone, the captured images of the user's face are used to create a first representation of the sending user's face, the captured images of the user's hand are used to create a second representation of the sending user's hand. Each representation is provided as output from a receiving artificial reality device, positioned relative to each other.

METHOD FOR PRODUCING FLUORINATED ORGANIC COMPOUNDS

Disclosed are processes for the production of fluorinated olefins, preferably adapted to commercialization of CFCF═CH(1234yf). Three steps may be used in preferred embodiments in which a feedstock such as CCl═CClCHCl is fluorinated to synthesize a compound such as CFCCl═CH. The CFCCl═CHis preferably converted to CFCFClCH(244-isomer) using a SbClas the catalyst which is then transformed selectively to 1234yf. For the first step, a mixture of CrOand FeCl/C is preferably used as the catalyst to achieve high selectivity to CFCCl═CH(96%). In the second step, SbCl/C is preferably used as the selective catalyst for transforming 1233xf to 244-isomer, CFCFClCH. The intermediates are preferably isolated and purified by distillation and used in the next step without further purification, preferably to a purity level of greater than about 95%. 2. The method of wherein said converting step is a direct converting step.3. The method of wherein said converting step is an indirect converting step.4. The method of wherein said at least one compound of Formula (I) comprises a compound wherein n is 0 claim 1 , each X is independently H or Cl claim 1 , and Z is H.6. The method of wherein Z in said compound of Formula (II) is H.7. The method of wherein X is independently H or Cl.8. The method of wherein said at least one compound of Formula (I) comprises at least one tetrachloropropene.9. The method of wherein said at least one compound of Formula (IA) comprises at least one tetrachloropropene.10. The method of wherein said at least one compound of Formula (I) comprises CH═CClCCl.11. The method of wherein said at least one compound of Formula (I) comprises CCl═CClCHCl.12. The method of wherein said at least one compound of Formula (I) comprises CHCl═CClCClH.13. The method of wherein said at least one compound of Formula (I) is selected from the group consisting of CH═CClCCl claim 1 , CCl2=CClCHCl claim 1 , CHCl═CClCClH claim 1 , and combinations of these.14. The method of wherein said at ...

BIOMARKERS OF PROSTATE CANCER AND PREDICTING MORTALITY

Measurement of circulating C-peptide levels is useful for the prognostic evaluation of subjects, in particular for the prediction of adverse clinical outcomes, e.g., mortality, and the detection of fatal prostate cancer. 1. A method of evaluating risk of mortality for a subject with prostate cancer , the method comprising:(i) providing a sample from the subject;(ii) determining one or both of a level of C-peptide in the sample to obtain a test C-peptide value or determining the subject's body-mass-index ratio (BMI); and(iii) determining the subject's D'Amico risk by determining the subject's level of prostate-specific antigen (PSA), Gleason score, and clinical stage, wherein:(a) a subject with a level of PSA less than 10 μg/mL, a Gleason score equal to or less than 6, and a clinical T1 or T2 stage has a low D'Amico risk;(b) a subject with a level of 10-20 μg PSA/mL, a Gleason score of 7, or a clinical T1 or T2 stage has an intermediate D'Amico risk; and(c) a subject with a level of greater than 20 μg PSA/mL, a Gleason score equal to or greater than 8, or a clinical T3 stage has a high D'Amico risk;{'sup': '2', "wherein a subject with a test C-peptide value above a reference level of C-peptide, a BMI equal to or greater than 25 kg/m, and an intermediate or high D'Amico risk has an elevated risk of mortality."}2. The method of claim 1 , wherein a subject with a test C-peptide value is in the highest quartile compared to a level of C-peptide in a reference group claim 1 , a BMI of equal or greater than 25 kg/m claim 1 , and an intermediate or high D'Amico risk has an elevated risk of mortality.3. The method of claim 1 , wherein a subject with a BMI of equal or greater than 30 kg/mand an intermediate or high D'Amico risk has an elevated risk of mortality.4. The method of claim 1 , wherein the risk of mortality is from prostate cancer.5. The method of claim 1 , wherein the risk of mortality is within a specified time period.6. The method of claim 5 , wherein the ...

COMMUTATION FAILURE PREDICTION METHOD, DEVICE AND STORAGE MEDIUM BASED ON ENERGY ACCUMULATION FEATURES OF INVERTER

The disclosure discloses a commutation failure prediction method, device and storage medium based on energy accumulation features of inverter. The method includes the following steps: collecting instantaneous values of three-phase valve side current and calculating the derivatives of the three-phase valve side current according to the instantaneous values of three-phase valve side current; the derivative includes positive, negative and zero states; according to the derivatives of the three-phase valve side current, determining the locations of incoming valve and ongoing valve; based on the valve side current of the incoming valve and ongoing valve, calculating energy accumulation features of the 12-pulse inverter; predicting whether the commutation failure from the incoming valve to the ongoing valve will happen according to the states of the derivatives of the three-phase valve side current and the energy accumulation features of the 12-pulse inverter. 1. A commutation failure prediction method based on energy accumulation features of inverter , wherein the inverter is a 12-pulse inverter; the method comprising:collecting instantaneous values of three-phase valve side current and calculating derivatives of the three-phase valve side current according to the instantaneous values of three-phase valve side current, the derivative includes three states: positive, negative and zero;determining locations of incoming valve and ongoing valve in the 12-pulse inverter according to the derivatives of the three-phase valve side current; calculating energy accumulation features of the 12-pulse inverter based on the valve side current of the incoming valve and ongoing valve, the energy accumulation features include real-time energy difference and limit energy difference;predicting whether the commutation failure from the incoming valve to the ongoing valve will happen according to the states of the derivatives of the three-phase valve side current and the energy accumulation ...

NITROBENZYL DERIVATIVES OF ANTI-CANCER AGENTS

Provided herein are compounds of formula I: 121-. (canceled)26. The method of claim 22 , wherein Z is hydrogen; X is hydrogen; and Y is hydrogen or halo.27. The method of claim 22 , wherein A is C-Caryl.28. The method of claim 27 , wherein A is phenyl.29. The method of claim 22 , wherein A is 5-15 membered heteroaryl.30. The method of claim 29 , wherein A is pyridyl.31. The method of claim 29 , wherein A is —N═CRRwhere Rand Rare defined as in .32. The method of claim 22 , wherein each R is hydrogen.331. The method of claim 22 , wherein one of the R groups is hydrogen and the other R group is C-Calkyl claim 22 , or wherein both the R groups are non-hydrogen substituents as defined in claim .34. The method of claim 33 , wherein R is methyl.35. The method of claim 22 , wherein each of R claim 22 , R claim 22 , and Ris independently claim 22 , hydrogen or methyl and Ris —CH—CH— or —CH—C(Me)-.37. The method of claim 22 , wherein the cancer expresses AKR1Creductase.38. The method of claim 22 , wherein the cancer is selected from adrenal gland claim 22 , bone claim 22 , brain claim 22 , breast claim 22 , bronchi claim 22 , colon and/or rectum claim 22 , gallbladder claim 22 , head and neck claim 22 , kidneys claim 22 , larynx claim 22 , liver claim 22 , lung claim 22 , neural tissue claim 22 , pancreas claim 22 , prostate claim 22 , parathyroid claim 22 , skin claim 22 , stomach claim 22 , and thyroid; and acute and chronic lymphocytic and granulocytic tumors claim 22 , adenocarcinoma claim 22 , adenoma claim 22 , basal cell carcinoma claim 22 , cervical dysplasia and in situ carcinoma claim 22 , Ewing's sarcoma claim 22 , epidermoid carcinomas claim 22 , giant cell tumor claim 22 , glioblastoma multiforma claim 22 , hairy-cell tumor claim 22 , intestinal ganglioneuroma claim 22 , hyperplastic corneal nerve tumor claim 22 , islet cell carcinoma claim 22 , Kaposi's sarcoma claim 22 , leiomyoma claim 22 , leukemias claim 22 , lymphomas claim 22 , malignant carcinoid claim 22 ...

METHOD AND DEVICE FOR POSITIONING EQUIPMENT-LEVEL OSCILLATION SOURCES OF DFIG GRID-CONNECTED SYSTEM

The application relates to a method and device for positioning equipment-level oscillation sources of DFIG grid-connected system, which belongs to the technical field of wind generation, and solves the problem of stable operation of the wind power grid-connected system at the current stage. The method comprises: constructing the energy correlation topology network of the components in DFIG; analyzing the dynamic energy flows between the components during the oscillation process; calculating magnitudes of the causality between the dynamic energy flows; building a causality diagram of oscillation transmission in the DFIG; analyzing the distribution of the magnitude of the causality in the diagram, determining the oscillation transmission routes and locating the oscillation sources. 1. A method for positioning equipment-level oscillation sources of DFIG grid-connected system comprising:{'b': '1', 'step S: constructing energy correlation topology network of components in DFIG;'}{'b': '2', 'step S: analyzing dynamic energy flows between the components during oscillation process; and'}{'b': '3', 'step S: calculating magnitudes of causality between the dynamic energy flows; building a causality diagram of oscillation transmission in the DFIG: analyzing distribution of the magnitude of the causality in the diagram, determining oscillation transmission routes and locating the oscillation sources.'}23. The method for positioning equipment-level oscillation sources according to claim 1 , wherein the step S comprises:{'b': '301', 'step S: normalizing the dynamic energy flows;'}{'b': '302', 'step S: through vector autoregressive model, performing partial directional coherence analysis on the normalized dynamic energy flows, obtaining a matrix of magnitudes of the causality between the dynamic energy flows;'}{'b': '303', 'step S: combining the magnitude of the causality with dynamic energy correlation topology network of wind turbine, building the causality diagram of oscillation ...

METHOD FOR PRODUCING FLUORINATED ORGANIC COMPOUNDS

Disclosed is a process for producing fluorinated organic compounds, including hydrofluoropropenes, which preferably comprises converting at least one compound of Formula (I): 2. The method of wherein said converting step is a direct converting step.3. The method of wherein said converting step is an indirect converting step.4. The method of wherein said at least one compound of Formula (I) comprises a compound wherein each X on one terminal carbon is H and wherein each X on the other terminal carbon is independently selected from F claim 1 , Cl claim 1 , I or Br.6. The method of wherein Z in said compound of Formula (II) is H.7. The method of wherein each X is F.8. The method of wherein said at least one compound of Formula (I) comprises at least pentahalogenated compound.9. The method of wherein said at least one compound of Formula (IA) comprises at least one trichlorinated claim 5 , difluorinated propane.10. The method of wherein said at least one compound of Formula (I) comprises 1 claim 1 ,1 claim 1 ,1-trichloro-2 claim 1 ,2-difluoropropane (HCFC-242bb).11. The method of wherein said at least one compound of Formula (I) comprises 1 claim 1 ,1 claim 1 ,1 claim 1 ,2 claim 1 ,2-pentafluoropropane (HFC-245cb).12. The method of wherein said at least one compound of Formula (I) is selected from the group consisting of HCFC-242bb claim 1 , HFC-245cb and combinations of these.14. The method of wherein said first compound of Formula (IA) comprises at least 1 claim 13 ,1 claim 13 ,1-trichloro-2 claim 13 ,2-difluoropropane (HCFC-242bb) and said second compound of Formula (IA) comprises at least 1 claim 13 ,1 claim 13 ,1 claim 13 ,2 claim 13 ,2-pentafluoropropane (HFC-245cb).15. The method of wherein said at least one compound in accordance with Formula (II) comprises HFO-1234yf.16. The method of wherein said exposing step comprises at least one gas phase catalytic reaction.17. The method of wherein said converting step comprises at least one gas phase catalytic reaction. ...

Catalyst Component for Propene Polymerization, Preparation Method Thereof, and Catalyst Containing the Same

The present invention discloses a catalyst component for propene polymerization, comprising titanium, magnesium, halogen, and internal electron donor A, wherein said internal electron donor A is selected from the compounds as shown in Formula I, 2. The catalyst component according to claim 1 , wherein R is selected from hydrogen claim 1 , hydroxyl claim 1 , C-Calkyl claim 1 , and halogen or hydroxy substituted C-Caryl claim 1 , C-Cheteroaryl claim 1 , C-Carylalkyl and C-Calkylaryl; Rand Rmay be identical to or different from each other claim 1 , and are selected from hydrogen claim 1 , C-Calkyl and substituted or unsubstituted C-Caryl claim 1 , C-Calkylaryl claim 1 , and C-Carylalkyl.4. The catalyst component according to any one of to claim 1 , wherein said internal electron donor A is at least one selected from the group consisting of N-butylidene aniline claim 1 , 2 claim 1 ,6-dimethyl-N-butylidene aniline claim 1 , 4-chloro-N-butylidene aniline claim 1 , N-(2-methylpropylidene)aniline claim 1 , N-butylidene parabromoaniline claim 1 , 2 claim 1 ,6-diisopropyl-N-(2-methylpropylidene)aniline claim 1 , 2 claim 1 ,6-diisopropyl-N-butylidene aniline claim 1 , 4-trifluoromethyl-N-butylidene aniline claim 1 , 2 claim 1 ,4 claim 1 ,6-trimethyl-N-butylidene aniline claim 1 , N-(2-methylpropylidene)-1-butylamine claim 1 , N-(2-methylpropylidene)-2-butylamine claim 1 , N-hexylidene-1-hexylamine claim 1 , N-hexylidene-1-octylamine claim 1 , N-pentylidene-1-octylamine claim 1 , 2 claim 1 ,6-diisopropyl-N-heptamethyleneaniline claim 1 , 2 claim 1 ,6-diisopropyl-N-(2 claim 1 ,2-diphenyl ethylidene)aniline claim 1 , 2 claim 1 ,6-dimethyl-N-(2 claim 1 ,2-diphenylethylidene)aniline claim 1 , N-(2-phenylethylidene)-8-amino quinoline claim 1 , N-butylidene-3-amino quinoline claim 1 , 2 claim 1 ,6-dimethyl-N-hexylideneaniline claim 1 , 2 claim 1 ,6-diisopropyl-N-hexylideneaniline claim 1 , 2 claim 1 ,6-diisopropyl-N-(2-methylpropylidene)aniline claim 1 , 2 claim 1 ,6-dimethyl-N-(2- ...

DNA ALKYLATING AGENTS

Provided herein are compounds of formula I: wherein the variables are defined herein, processes of making them, and methods of treating cancer comprising administering such compounds. 3. The compound of or , wherein T is OP(Z)(NRCHCHCl) , OP(Z)(NRCHCHBr)2 , OP(Z)(NR)N(CHCHX)) , OP(Z)(N(CH)) , or OP(Z)(N(CHCHCl)) , wherein each Rindependently is hydrogen or C-Calkyl or 2 Rgroups together with the nitrogen atom they are bound to form 5-7 membered heterocyclyl group , Zis O or S , and Xis Cl , Br , or OMs.4. The compound of any , wherein T is OP(Z)(NHCHCHCl) , OP(Z)(NHCHCHBr)2 , OP(Z)(NH)(N(CHCHX)) , OP(Z)(N(CH)) , or OP(Z)(N(CHCHCl)) , wherein Xis defined as in .5. (canceled)6. The compound of claim 4 , wherein T is OP(O)(N(CHCH)) claim 4 , OP(O)(NHCHCHCl) claim 4 , OP(O)(NHCHCHBr) claim 4 , or OP(O)(NH)(N(CHCHCl)).7. The compound of claim 1 , wherein Z is hydrogen; X is hydrogen; or Y is hydrogen or halo.89-. (canceled)10. The compound of claim 1 , wherein A is optionally substituted C-Caryl.11. The compound of claim 10 , wherein A is optionally substituted phenyl.12. The compound of claim 1 , wherein A is optionally substituted 5-15 membered heteroaryl.13. The compound of claim 12 , wherein A is optionally substituted pyridyl.14. The compound of claim 12 , wherein A is —N═CRRwhere Rand Rare defined as in .15. The compound of claim 1 , wherein R is hydrogen or C-Calkyl.16. (canceled)17. The compound of claim 15 , wherein R is methyl.18. The compound of claim 1 , wherein the compound is TH 2870.19. A pharmaceutically acceptable composition comprising a compound of and at least a pharmaceutically acceptable excipient or carrier.20. A method of treating cancer comprising administering to a patient in need thereof a therapeutically effective amount of a compound of or a composition of thereby treating cancer.22. A method of treating cancer comprising determining the AKR1C3 reductase level of the cancer in a patient using an AKR1C3 antibody claim 1 , and administering to ...

Catalyst Component For Olefin Polymerization, and Catalyst Containing the Same

The present invention provides a catalyst component for olefin polymerization, obtained by a reaction of magnesium, titanium, halogen and an internal electron donor, the internal electron donor comprising an imine compound as shown in Formula Z. The present invention also provides a preparation method of the catalyst component, and a catalyst for olefin polymerization containing the same. When the catalyst of the present invention is used for olefin polymerization reaction, the catalyst has a high activity, and a slow rate of activity decay, and the obtained polymer has a high isotacticity index, and a wide molecular weight distribution. 2. The catalyst component according to claim 1 , wherein M is selected from one or more substituted or unsubstituted alkylene or C-Caryl C-Cfused aryl claim 1 , C-Cheteroaryl claim 1 , C-Calkaryl claim 1 , or C-Carylalkyl.3. The catalyst component according to or claim 1 , wherein M is one or more substituted alkylene which is substituted by oxygen claim 1 , sulfur claim 1 , nitrogen claim 1 , boron claim 1 , silicon claim 1 , phosphorus claim 1 , or halogen atom.4. The catalyst component according to claim 2 , wherein M is C-Cheteroaryl claim 2 , in which the heteroatom is oxygen claim 2 , sulfur claim 2 , nitrogen claim 2 , boron claim 2 , siiicon claim 2 , phosphorus claim 2 , or halogen atom.6. The catalyst component according to claim 5 , wherein in the imine compound as shown in Formula I claim 5 , each of R and R′ is independently selected from halogen atom substituted or unsubstituted C-Calkyl claim 5 , C-Calkaryl claim 5 , or C-Cfused aryl claim 5 , more preferably from methyl claim 5 , ethyl claim 5 , n-propyl claim 5 , isopropyl claim 5 , n-butyl claim 5 , isobutyl claim 5 , sec-butyl claim 5 , tert-butyl claim 5 , pentyl claim 5 , hexyl claim 5 , phenyl claim 5 , halogenated phenyl claim 5 , alkyl phenyl claim 5 , naphthyl claim 5 , or terphenyl.7. The catalyst component according to claim 5 , wherein in the inline ...

MULTI-CENTER SYNERGETIC CANCER PROGNOSIS PREDICTION SYSTEM BASED ON MULTI-SOURCE MIGRATION LEARNING

Provided is a multi-center synergetic cancer prognosis prediction system based on multi-source migration learning. The system includes a model parameter setting module, a data screening module, and a multi-source migration learning module, wherein the model parameter setting module is responsible for setting cancer prognosis prediction model parameters; the data screening module is arranged at a clinical center, and a management center transmits the set model parameter to each clinical center, such that each clinical center inquires a sample feature and prognosis index data from a local database according to the model parameter, so as to preprocess the data; and the multi-source migration learning module includes a source model training unit, a migration weight calculation unit, and a target model calculation unit. 2. The multi-center synergetic cancer prognosis prediction system based on multi-source migration learning according to claim 1 , wherein the system further comprises a model application module claim 1 , which is arranged at the management center claim 1 , receives the sample feature input by a user when setting the model parameter claim 1 , calls the target model to perform cancer prognosis prediction claim 1 , and presents a prediction result to the user.3. The multi-center synergetic cancer prognosis prediction system based on multi-source migration learning according to claim 1 , wherein the cancer prognosis prediction model adopts a logistic regression model claim 1 , a support vector machine model claim 1 , a decision tree model claim 1 , a neural network model claim 1 , or other models4. The multi-center synergetic cancer prognosis prediction system based on multi-source migration learning according to claim 1 , wherein the similarity Wamong the samples is cosine similarity claim 1 , Gaussian similarity or other models.5. The multi-center synergetic cancer prognosis prediction system based on multi-source migration learning according to claim 1 , ...

TRANSACTION MONITORING THROUGH A DUAL-LAYER DATASTORE BASED ON A HASH FILTER

A computer-implemented method includes receiving, at a datastore having a plurality of records of a transaction-monitoring system, a first record representing a first instance of a transaction. The datastore includes a first layer and a second layer. A first record hash code, based on the first record, is compared to a template hash code set that includes one or more template hash codes, where each template hash code corresponds to a respective transaction in a set of one or more known transactions. The first record is inserted into the first layer of the datastore. The first record is inserted into the second layer of the datastore, based at least in part on the first record hash code not being found in the template hash code set. 1. A computer-implemented method comprising:receiving, at a datastore comprising a plurality of records of a transaction-monitoring system, a first record representing a first instance of a transaction;wherein the datastore comprises a first layer and a second layer;comparing a first record hash code, based on the first record, to a template hash code set comprising one or more template hash codes, wherein each template hash code corresponds to a respective transaction in a set of one or more known transactions;inserting the first record into the first layer of the datastore; andinserting the first record into the second layer of the datastore, based at least in part on the first record hash code not being found in the template hash code set.2. The computer-implemented method of claim 1 , further comprising:receiving, at the datastore, a second record representing a second instance of the transaction;comparing a second record hash code, based on the second record, to the template hash code set;inserting the second record into the first layer of the datastore; andopting not to insert the second record into the second layer of the datastore, based at least in part on the second record hash code being found in the template hash code set.3. ...

MOVABLE HOLDING DEVICE, OPERATION UNIT DISPLACEMENT DEVICE, AND IMAGE FORMING SYSTEM

A movable holding device includes: a base; an attachment unit to which an operation unit is to be attached; and a connecting unit that extends in a longitudinal direction, has recessed members forming a space with each other and being connected to each other so that a relative movement thereof changes a position of the attachment unit with respect to the base, and has one longitudinal end portion connected to the base and another longitudinal end portion connected to the attachment unit. 1. A movable holding device comprising:a base;an attachment unit to which an operation unit is to be attached; anda connecting unit that extends in a longitudinal direction, has recessed members forming a space with each other and being connected to each other so that a relative movement thereof changes a position of the attachment unit with respect to the base, and has one longitudinal end portion connected to the base and another longitudinal end portion connected to the attachment unit.2. The movable holding device according to claim 1 , whereinthe connecting unit accommodates, in the space, a biasing member configured to maintain the position of the attachment unit with respect to the base.3. The movable holding device according to claim 2 , whereinthe biasing member is a spring member that applies a biasing force to the recessed members of the connecting unit.4. The movable holding device according to claim 2 , whereinthe biasing members are accommodated in the space in a state where one of the recessed members is released from the base and/or the attachment unit and another of the recessed members is connected to the base and/or the attachment unit.5. The movable holding device according to claim 1 , whereinthe recessed members of the connecting unit are rotatable to change a level thereof from a mounting surface on which the base is mounted, andthe connecting unit includes a covering member that maintains a covering state between the recessed members and the mounting surface ...

NITROBENZYL DERIVATIVES OF ANTI-CANCER AGENTS

Provided herein are compounds of formula I, wherein the variables are defined herein, processes of making them, and methods of treating cancer comprising administering such compounds. 7. The compound of claim 1 , wherein Z is hydrogen; X is hydrogen; and Y is hydrogen or halo.89-. (canceled)10. The compound of claim 1 , wherein A is optionally substituted C-Caryl.11. The compound of claim 10 , wherein A is optionally substituted phenyl.12. The compound of claim 1 , wherein A is optionally substituted 5-15 membered heteroaryl.13. The compound of claim 12 , wherein A is optionally substituted pyridyl.14. The compound of claim 12 , wherein A is —N═CRRwhere Rand Rare defined as in .15. The compound of claim 1 , wherein each R is hydrogen.16. The compound of claim 1 , wherein one of the R groups is hydrogen and the other R group is C-Calkyl claim 1 , or wherein both the R groups are non-hydrogen substituents as defined in .17. The compound of claim 16 , wherein R is methyl.18. The compound of claim 1 , wherein each of R claim 1 , R claim 1 , and Ris independently claim 1 , hydrogen or methyl and Ris —CH—CH— or CH—C(Me)—.19. A pharmaceutically acceptable composition comprising a compound of claim 1 , and at least a pharmaceutically acceptable excipient or carrier.20. A method of treating cancer comprising administering to a patient in need thereof a therapeutically effective amount of a compound of thereby treating cancer. The present invention provides compounds suitable as therapeutic agents and intermediates thereto, pharmaceutical compositions of such compounds and methods of treating cancer in cancer patients, and so relates to the fields of biology, chemistry, and medicine.Cancer is one of the major causes of human morbidity and mortality. Cancer treatment is challenging because it is difficult to kill cancer cells without damaging or killing normal cells. Damaging or killing normal cells during cancer treatment is a cause of adverse side effects in patients and can ...

AZIRIDINE CONTAINING DNA ALKYLATING AGENTS

Provided herein are compounds of formula (I)-(VI): 3. The compound of claim 2 , wherein Ris a non-hydrogen substituent claim 2 , Rand Rare hydrogen claim 2 , and Ris hydrogen or halo claim 2 , or Rand Rtogether form a 5 membered cycloalkyl group.4. The compound of claim 3 , wherein Ris hydrogen.5. The compound of claim 3 , wherein Ris halo.6. The compound of claim 3 , wherein Ris fluoro.7. The compound of claim 3 , wherein Ris NRR claim 3 , wherein each Rand Rindependently is hydrogen claim 3 , hydroxy claim 3 , C-Calkyl C-Calkenyl claim 3 , C-Calkynyl claim 3 , C-Ccycloalkyl claim 3 , C-Caryl claim 3 , 4-15 membered heterocycle claim 3 , 5-15 membered heteroaryl claim 3 , or —SO(C-Calkyl); or Rand Rtogether with the nitrogen atom they are bonded to form a 4-15 membered heterocycle or a 5-15 membered heteroaryl.8. The compound of claim 3 , wherein Ris a non-hydrogen substituent.9. The compound of claim 3 , wherein Ris a non-hydrogen substituent; Rand Rare hydrogen claim 3 , and Ris hydrogen or halo claim 3 , and Ris optionally substituted C-Calkyl.10. A pharmaceutical composition comprising the compound of and at least one pharmaceutically acceptable excipient.11. A method of treating cancer comprising administering to a patient in need thereof a therapeutically effective amount of the compound of . This application is a continuation application of U.S. application Ser. No. 15/736,285, filed on Dec. 13, 2017, which claims priority under 35 U.S.C. § 371 of International Application No. PCT/US2016/039092, filed Jun. 23, 2016, which claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 62/184,129, filed Jun. 24, 2015, the content of which is hereby incorporated by reference in its entirety.The present invention provides compounds suitable as therapeutic agents, pharmaceutical compositions of such compounds and methods of treating cancer in cancer patients, and so relates to the fields of biology, chemistry, and medicine.Cancer is one of the major ...

METHOD, APPARATUS AND DEVICE FOR DETECTING ABNORMAL DATA, AND MACHINE-READABLE MEDIUM

In an embodiment, a method includes: using at least two items of sequentially collected, mutually associated data to create at least two detection data sets, each including a first number of items of sequentially collected data in the at least two items of data; using an autoencoder to process the at least two detection data sets, to output result data sets respectively corresponding to the at least two detection data sets, the first number being equal to the number of neurons in an input layer of the autoencoder, and the autoencoder being trained using data having a regular pattern of variation identical to the at least two items of data; and determining, as abnormal data, data which does not have the regular pattern of variation in the at least two items of data, based upon the at least two detection data sets and the result data sets corresponding thereto. 1. A method for detecting abnormal data , comprising:using at least two items of data, sequentially collected and mutually associated, to create at least two detection data sets, wherein each detection data set, of the at least two detection data sets, includes a first number of items of sequentially collected data in the at least two items of data;using an autoencoder to process the at least two detection data sets, to output result data sets respectively corresponding to each of the at least two detection data sets, the first number of items being equal to a number of neurons in an input layer of the autoencoder, and the autoencoder being trained using training data having a regular pattern of variation identical to that of the at least two items of data; anddetermining, as abnormal data, data which does not have a regular pattern of variation in the at least two items of data, based upon the at least two detection data sets and the result data sets corresponding thereto.2. The method of claim 1 , wherein the determining claim 1 , as abnormal data claim 1 , of data which does not have the regular pattern of ...

AUGMENTING A PRESENTATION BASED ON A PREDICTED USER KNOWLEDGE BACKGROUND

A method includes predicting, using a machine learning model and based on a received set of user interactions on keywords appearing in a presentation, a knowledge background of the user indicating the user's degree of understanding of the presentation. The method also includes generating, based on the predicted knowledge background, a message comprising a description of a keyword in the presentation and coordinates where the description is to be positioned in the presentation and communicating the message to a device of the user. 1. A method comprising:predicting, using a machine learning model and based on a received set of user interactions on keywords appearing in a presentation on a device of a user, a knowledge background of the user indicating the user's degree of understanding of the presentation;generating, based on the predicted knowledge background, a message comprising a description of a keyword in the presentation and coordinates where the description is to be positioned in the presentation; andcommunicating the message to the device.2. The method of claim 1 , further comprising determining a set of weights for the keywords based on a frequency at which the user clicks on the keywords.3. The method of claim 1 , further comprising determining a set of weights for the keywords based on a length of time the user looks at the keywords.4. The method of claim 1 , further comprising:receiving feedback from the user about the description; andadjusting the machine learning model based on the feedback.5. The method of claim 4 , wherein the feedback comprises whether the user clicked on the description claim 4 , looked at the description claim 4 , or hovered a cursor over the description.6. The method of claim 4 , wherein the feedback comprises whether the user ignored or closed the description.7. The method of claim 1 , wherein the message further comprises a dimension of the description.8. An apparatus comprising:a memory; and ["predict, using a machine learning ...

PIPERAZINYL PYRIMIDINE DERIVATIVES, PREPARATION METHOD AND USE THEREOF

Provided are piperazinyl pyrimidine derivatives of formula I having CCRantagonism, and the preparation method, pharmaceutical composition and use thereof in the preparation of a medicament. The medicament is useful for the treatment and prevention of CCR-related diseases. 2. The compound or a racemate or a stereoisomer or a pharmaceutically acceptable salt or solvate thereof according to claim 1 , wherein the aryl is selected from the group consisting of phenyl claim 1 , naphthyl claim 1 , anthryl claim 1 , phenanthryl claim 1 , indenyl claim 1 , fluorenyl and acenaphthylenyl.3. The compound or a racemate or a stereoisomer or a pharmaceutically acceptable salt or solvate thereof according to claim 1 , wherein the heteroaryl is selected from the group consisting of: pyridyl claim 1 , pyrrolyl claim 1 , furyl claim 1 , thienyl claim 1 , pyrazolyl claim 1 , imidazolyl claim 1 , thiazolyl claim 1 , oxazolyl claim 1 , isoxazolyl claim 1 , indolyl claim 1 , benzofuranyl claim 1 , carbazolyl claim 1 , pyridazinyl claim 1 , pyrazinyl claim 1 , quinolyl claim 1 , isoquinolyl claim 1 , purinyl claim 1 , phenothiazinyl and phenoxazinyl.43. The compound of formula I or a racemate or a stereoisomer or a pharmaceutically acceptable salt or solvate thereof according to any one of to claims 1 , wherein the compound is selected from the group consisting of:1-{4-{4-[(2,4-dichlorobenzyl)amino]-6-[(2,2-dimethoxyethyl)methylamino]pyrimidin-2-yl}piperazin-1-yl}propanone;1-{4-{4-[(2,4-dichlorobenzyl)amino]-6-[(2,2-dimethoxyethyl)methylamino]pyrimidin-2-yl}piperazin-1-yl}-2-methylpropanone;1-{4-{4-[(2,4-dichlorobenzyl)amino]-6-[(2,2-dimethoxyethyl)methylamino]pyrimidin-2-yl}piperazin-1-yl}-3-methylthiopropanone;1-{4-{4-[bis(2-methoxyethyl)amino]-6-(2,4-dichlorobenzylamino)-pyrimidin-2-yl}piperazin-1-yl}propanone;1-{4-{4-[bis(2-methoxyethyl)amino]-6-(2,4-dichlorobenzylamino)-pyrimidin-2-yl}piperazin-1-yl}-2-methylpropanone;1-{4-{4-[bis(2-methoxyethyl)amino]-6-(2,4-dichlorobenzylamino)- ...

Method and Device for Calculating Reference Signal Received Power

The present invention provides a method and a device for calculating RSRP. The method comprises the steps of: calculating a first signal power estimation value, the first signal power estimation value being an average value of power of all received RSs; calculating a second signal power estimation value, the second signal power estimation value being an average value of power of all coherence blocks, and the power of each coherence block being the power of an average value of the channel estimation for all the RSs in the coherence block; determining a noise power estimation value according to the first signal power estimation value and the second signal power estimation value; and determining the RSRP according to the first signal power estimation value and the noise power estimation value, or according to the second signal power estimation value and the noise power estimation value. 1. A method for calculating Reference Signal Received Power (RSRP) , comprising:calculating a first signal power estimation value, the first signal power estimation value being an average value of power of all received Reference Signals (RSs);calculating a second signal power estimation value, the second signal power estimation value being an average value of power of all coherence blocks, and the power of each coherence block being power of an average value of the channel estimation for all the RSs in the coherence block;determining a noise power estimation value according to the first signal power estimation value and the second signal power estimation value; anddetermining the RSRP according to the first signal power estimation value and the noise power estimation value, or according to the second signal power estimation value and the noise power estimation value,wherein the coherence block consists of all Resource Elements (REs) within coherence time and a coherence bandwidth, a size of the coherence block depends on a current wireless channel environment, or a minimum coherence ...

Methods and systems of streaming refrigerant in a heat exchanger

Embodiments are disclosed to help create longitudinal refrigerant streams, for example, in a shell and tube type evaporator, so as to manage refrigerant and/or lubricant in the evaporator. In some embodiments, the shell side of the evaporator may include a plurality of longitudinally extended pans stacked in a vertical direction. In some embodiments, refrigerant can be directed onto a top pan. The refrigerant can form a longitudinal refrigerant stream along the pan and flow down to the next pan in the vertical direction and form another longitudinal refrigerant stream. Each of the pans may form a refrigerant pool to help exchange heat with a process fluid carried in heat exchanger tubes. By forming longitudinal refrigerant streams in the pans, heat exchange efficiency may be improved and a lubricant content in refrigerant streams may be concentrated toward a bottom of the evaporator.

Paging decoding

A paging decoding method in a wireless communication device adapted to operate in association with a primary cell provided by a network node of a cellular communication system, wherein the primary cell has one or more neighboring cells is disclosed. The method comprises receiving a paging signal during a paging occasion, temporarily storing the received paging signal, attempting to decode the received paging signal based on one or more parameters of the primary cell, and (if decoding of the received paging signal based on one or more parameters of the primary cell is un-successful) attempting to decode the temporarily stored received paging signal based on parameters of one of the neighboring cells. In some embodiments, the method may further comprise selecting the one of the neighboring cells based on one or more of respective received signal strengths of the neighboring cells and respective received signal powers of the neighboring cells after receiving the paging signal during the paging occasion. Corresponding computer program product, arrangement and wireless communication device are also disclosed.

ADHESIVE ARTICLES FOR MEDICAL APPLICATIONS

Adhesive articles suitable for use in medical applications include a siloxane-based pressure sensitive adhesive layer, and a breathable conformable backing having a first surface and a second surface. The siloxane-based pressure sensitive adhesive layer is coated on the first surface of the breathable conformable backing, and the second surface of the breathable conformable backing comprises a treated surface. The siloxane-based pressure sensitive adhesive layer can be attached to skin and other adhesive articles can be releasably adhered to the treated surface to form adhesive constructions. 1. An adhesive article comprising:a siloxane-based pressure sensitive adhesive layer; anda breathable conformable backing comprising a first surface and a second surface, wherein the siloxane-based pressure sensitive adhesive layer is coated on the first surface of the breathable conformable backing, and wherein the second surface of the breathable conformable backing comprises a treated surface, wherein the treated surface is not a pressure sensitive adhesive and wherein the treated surface provides increased adhesion to non-siloxane-based pressure sensitive adhesives when compared to the adhesion to the same backing without the treated surface.2. The adhesive article of claim 1 , wherein the siloxane-based pressure sensitive adhesive comprises an elastomeric siloxane polymer prepared from an amine-functional polysiloxane claim 1 , a hydroxyl-functional polysiloxane claim 1 , a hydride-functional polysiloxane claim 1 , an alkoxysilane-functional polysiloxane claim 1 , a vinyl-functional polysiloxane claim 1 , an allyl-functional polysiloxane claim 1 , a (meth)acrylate-functional polysiloxane claim 1 , a non-functional polysiloxanes or a combination thereof.3. The adhesive article of claim 2 , wherein elastomeric siloxane polymer comprises a urea-based siloxane copolymer claim 2 , oxamide-based siloxane copolymer claim 2 , amide-based siloxane copolymer claim 2 , urethane-based ...

PHOTOTHERAPY GEL PACK

A hot/cold therapy and light therapy (phototherapy) provide synergistic effects for a user. An improved gel pack is provided wherein a flexible circuit with at least one light source is provided. The at least one light source emits light through the gel and onto the target treatment area. The flexible circuit is sealed and embedded in the gel pack to allow the gel pack (including the flexible circuit therein) to be washed and cleaned easily. Furthermore, the improved gel pack may be assembled in a layered structure to provide the waterproof gel pack, e.g., sealing the gel in the gel pack and embedding a flexible circuit in the gel pack. To improve durability, the flexible circuit may be supported by a layer which forms the outer covering of the gel pack. 1. A phototherapy assembly , comprising:a first waterproof and flexible layer applicable onto the target treatment area;a second waterproof and flexible layer,a gel in between the first layer and the second layer;a flexible circuit in between the first layer and the second layer; andat least one light source for providing a therapeutic effect to a target treatment area of a living being, the at least one light source coupled to said flexible circuit; the first layer and the second layer are sealed to provide a waterproof gel pack having the flexible circuit embedded in the waterproof gel pack; and', {'b': '1', 'the at least one light source emits light through the gel and the first layer and onto the target treatment area.'}], 'wherein2. The phototherapy assembly of claim 1 , wherein said second layer supports the flexible circuit.3. The phototherapy assembly of claim 1 , wherein the first layer claim 1 , the gel claim 1 , the second layer claim 1 , and the flexible circuit are sealed together in a layered structure.4. The phototherapy assembly of claim 1 , further comprising a sealing material between the flexible circuit and the gel claim 1 , said sealing material sealing the gel with the first layer and sealing ...

PRIMER, KIT AND METHOD FOR DETECTING TAIHE BLACK CHICKEN EGG

This invention discloses a primer, a kit and a method for testing Taihe black chicken egg. The described primer includes: as shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4. The described test method comprises the following steps: extract the genomic DNA of the egg to be tested, propagate the genomic DNA by two-step PCR, and perform genotyping according to the base at 68 bp of the gene sequence of the second-step PCR product. If the base at that site is G, the egg is a Taihe black chicken egg; if the base at that site is C, the egg is a non-Taihe black chicken egg. The variable site targeted by this invention is unique to Taihe black chicken egg. 1. A primer for testing Taihe black chicken egg , characterized in that it comprises: SF1: cccccactcagagcgctctg , SR1: ggcggaccggcgcggcctta , SF2: ccgcgagaggccgtcaggcg , and SR2: ttgcgccctgggggcagcca.2. A method for detecting Taihe black chicken egg , characterized in that it comprises the following steps: extract the genomic DNA of the egg to be tested , perform the first-step PCR propagation with primer SF1: cccccactcagagcgctctg , SR1: ggcggaccggcgcggcctta , perform the second PCR propagation with the PCR product obtained from the first propagation as the template by using primer SF2: ccgcgagaggccgtcaggcg , SR2: ttgcgccctgggggcagcca , and perform genotyping according to the base at 68 bp of the gene sequence of the obtained second-step PCR product. If the base at that site is G , the egg is a Taihe black chicken egg; if the base at that site is C , the egg is a non-Taihe black chicken egg.3. The method for detecting Taihe black chicken egg according to is characterized in that in the first-step PCR propagation , the primer is SF1: tcagagcgctctg , SR1: ggcggaccggcgcggcctta according to ;30 μL, propagation system: the template DNA is 2 μL, 2×PCR mix is 15 μL, mixed primer is 0.6 μL, and the rest is water;Propagation procedure: 95° C. for 3 min; 94° C. for 15 s, 55° C. for 30 s, 72° C. for 20 s, 20 cycles; ...

STACKED TSV STRUCTURE AND MANUFACTURING METHOD THEREOF

A stacked TSV structure comprises: a logic region in which a first metal wiring layer is formed, a pixel region located on the logic region, in which a second metal wiring layer is formed, and a through-silicon via including a first via penetrating from the first metal wiring layer upward through the logic region to the second metal wiring layer, wherein a contact is filled and formed in the through-silicon via, the contact contacting the first metal wiring layer and the second metal wiring layer, thereby electrically connecting the first metal wiring layer to the second metal wiring layer. 1. A stacked TSV structure , comprising:a logic region in which a first metal wiring layer is formed;a pixel region located on the logic region, in which a second metal wiring layer is formed; anda through-silicon via including a first via penetrating from the first metal wiring layer upward through the logic region to the second metal wiring layer, wherein a contact is filled and formed in the through-silicon via, the contact contacting the first metal wiring layer and the second metal wiring layer, thereby electrically connecting the first metal wiring layer to the second metal wiring layer.2. The stacked TSV structure according to claim 1 , wherein:the through-silicon via further includes a second via penetrating through a logic substrate of the logic region to the first metal wiring layer.3. The stacked TSV structure according to claim 2 , wherein:the second via is communicated with the first via, and has a diameter larger than or equal to that of the first via.4. The stacked TSV structure according to claim 1 , further comprising:a first interlayer located between the logic region and the pixel region, the logic region and the pixel region being bonded together by the first interlayer; anda carrier wafer, carrying the logic region and the pixel region and being bonded with the logic region by a second interlayer.5. The stacked TSV structure according to claim 4 , wherein:the ...

Method and device for driving display panel and display device

A method for driving a display panel, a device for driving a display panel and a display device are provided. The method for driving a display panel includes: acquiring a GOA signal corresponding to a current frame of image, where the GOA signal includes a plurality of clock signals; determining a transmission channel corresponding to each of the plurality of clock signals, and generating a correspondence relationship between the clock signals and respective transmission channels, where the transmission channels are used to deliver the clock signals from a GOA control signal generator to a GOA circuit of the display panel, the current frame of image is different from at least one frame of image previous to the current frame of image with respect to the correspondence relationship between the clock signals and respective transmission channels; and transmitting the clock signals by using the determined transmission channels.

AZIRIDINE CONTAINING DNA ALKYLATING AGENTS

Provided herein are compounds of formula (I)-(VI), wherein the variables are defined herein, processes of making them, and methods of treating cancer comprising administering such compounds. 3. The compound of claim 2 , wherein Ris a non-hydrogen substituent claim 2 , Rand Rare hydrogen claim 2 , and Ris hydrogen or halo claim 2 , or Rand Rtogether form a 5 membered cycloalkyl group.4. The compound of claim 3 , wherein Ris hydrogen.5. The compound of claim 3 , wherein Ris halo.6. The compound of claim 3 , wherein Ris fluoro.7. The compound of claim 3 , wherein Ris NRR claim 3 , wherein each Rand Rindependently is hydrogen claim 3 , hydroxy claim 3 , C-Calkyl claim 3 , C-Calkenyl claim 3 , C-Calkynyl claim 3 , C-Ccycloalkyl claim 3 , C-Caryl claim 3 , 4-15 membered heterocycle claim 3 , 5-15 membered heteroaryl claim 3 , or —SO(C-Calkyl); or Rand Rtogether with the nitrogen atom they are bonded to form a 4-15 membered heterocycle or a 5-15 membered heteroaryl.13. The compound of claim 8 , wherein Ris hydrogen.14. The compound of claim 8 , wherein Ris C-Calkyl claim 8 , C-Calkenyl claim 8 , or C-Calkynyl.158. The compound of claim 8 , wherein Ris optionally substituted C-Calkyl.16. The compound of claim 9 , wherein Ris optionally substituted C-Calkyl.17. The compound of claim 10 , wherein Ris optionally substituted C-Calkyl.18. The compound of claim 11 , wherein Ris optionally substituted C-Calkyl.19. The compound of claim 3 , wherein Ris a non-hydrogen substituent.20. The compound of claim 3 , wherein Ris a non-hydrogen substituent; Rand Rare hydrogen claim 3 , and Ris hydrogen or halo claim 3 , and Ris optionally substituted C-Calkyl.21. A pharmaceutical composition comprising the compound of and at least one pharmaceutically acceptable excipient.22. A method of treating cancer comprising administering to a patient in need thereof a therapeutically effective amount of the compound of . This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional ...

Method and Device for Detecting Secondary Synchronous Signal, Computer Program and Storage Medium

The present invention provides a method and a device for detecting a secondary synchronous signal, a computer program and a storage medium. The method comprises: Step S1: extracting a first SSS sequence from a received signal according a PSS detection result; Step S2: performing rotation on the first SSS sequence, to obtain at least two second sequences including the first SSS sequence, channel paths corresponding to the at least two second sequences being located within a channel window in a time domain; Step S3: calculating a channel estimation result of each of the second sequences corresponding to each of SSS standard sequences; Step S4: selecting, according to the channel estimation result, valid channel paths corresponding to the respective SSS standard sequence from the channel paths corresponding to the second sequences; Step S5: calculating a signal-to-noise ratio corresponding to the respective SSS standard sequence according to the valid channel paths corresponding to the respective SSS standard sequence; and Step S6: determining a cell ID according to the SSS standard sequence corresponding to a maximum signal-to-noise ratio. According to the present invention, it is able to improve the accuracy of the SSS detection. 1. A method for detecting a secondary synchronous signal in a Long Term Evolution LTE system , comprising:Step S1: extracting a first secondary synchronous signal SSS sequence from a received signal according a primary synchronous signal PSS detection result;Step S2: performing rotation on the first SSS sequence, to obtain at least two second sequences including the first SSS sequence, wherein channel paths corresponding to the at least two second sequences being located within a channel window in a time domain;Step S3: calculating a channel estimation result of each of the second sequences corresponding to each of SSS standard sequences;Step S4: selecting, according to the channel estimation result, valid channel paths corresponding to the ...

Nonwoven fabric and polyurethane composite materials and methods for producing the same

The disclosure provides a composite material of nonwoven fabric and polyurethane produced without use of an adhesive and a method for producing the same. The composite material comprises a nonwoven fabric and a nonporous or porous polyurethane film, wherein the polyurethane film is laminated on the nonwoven fabric. The disclosure provides a method for producing the composite material as described above, comprising the steps of: firstly casting a polyurethane solution on a substrate so as to form a film, then laminating the film and a nonwoven fabric by flexibly adjusting the lamination process so as to form a composite material comprising the nonporous or porous polyurethane film and the nonwoven fabric. The composite material comprising a nonporous polyurethane film and a nonwoven fabric can be used for medical articles such as surgical gowns and drapes and the like, and the composite material comprising a porous polyurethane film and a nonwoven fabric can be used for medical articles such as absorbent pads, adhesive bandages, wound dressings and the like.

ENHANCED DYNAMIC MONITORING OF ON-DEMAND KEY PERFORMANCE INDICATORS

An on-demand key performance indicator (KPI) monitoring system includes an on-demand KPI structure module configured to dynamically generate an on-demand data structure of a KPI based on a KPI request input to a user interface. The KPI request includes a one or more targeted KPI objects. An agent collector module generates an on-demand KPI collection strategy based on the on-demand data structure. An object monitoring module collects KPI objects based on the on-demand KPI collection strategy. The collected KPI objects include the targeted KPI objects requested by the user, while excluding non-targeted KPI objects excluded from the user's KPI request. 1. An on-demand key performance indicator (KPI) monitoring system comprising:an on-demand KPI structure module configured to dynamically generate an on-demand data structure of a KPI based on a KPI request input to a user interface, the KPI request including at least one targeted KPI object;an agent collector module that generates an on-demand KPI collection strategy based on the on-demand data structure; andan object monitoring module configured to collect KPI objects based on the on-demand KPI collection strategy, the collected KPI objects including the at least one targeted KPI object while excluding non-targeted KPI objects excluded from the KPI request.2. The on-demand KPI monitoring system of claim 1 , wherein the on-demand KPI structure module comprises:a KPI storage pool configured to store a plurality of different KPIs;a KPI analyzer controller configured to obtain at least one targeted KPI from among the plurality of KPIs stored in the KPI storage pool, and to generate the on-demand data structure of a KPI based on the obtained at least one targeted KPI; andan on-demand KPI data storage unit in signal communication with the KPI analyzer controller, the on-demand KPI data storage unit configured to store the on-demand data structure of a KPI received from the KPI analyzer controller.3. The on-demand KPI ...

T-CELL IMMUNOTHERAPY

T-cells useful in T-cell immunotherapy comprise a CAR, TCR and/or nucleic acid sequence(s) encoding a CAR and/or a TCR. The T-cells also comprise HP-NAP, an immunological equivalent fragment thereof and/or nucleic acid sequence(s) encoding HAP-NAP and/or an immunological equivalent fragment thereof. The T-cells have improved effects in immunotherapy including improved cytotoxicity, stimulation of chemokine and cytokine secretion, promoting dendritic cell maturation and recruitment and activation of innate immune cells. 123.-. (canceled)24. A vector comprising:a nucleic acid sequence encoding a chimeric antigen receptor (CAR) and/or a nucleic acid sequence encoding a T-cell receptor (TCR); and{'i': 'Helicobacter pylori', 'a nucleic acid sequence encoding a neutrophil activating protein (HP-NAP) and/or a nucleic acid sequence encoding an immunological equivalent fragment of said HP-NAP.'}25. The vector according to claim 24 , wherein said vector is a virus vector.26. The vector according to claim 25 , wherein said virus vector is selected from the group consisting of a hybrid vector claim 25 , a lentiviral vector claim 25 , an adenoviral vector claim 25 , an adeno-associated viral vector and a retroviral vector.27. The vector according to claim 24 , wherein said nucleic acid sequence encoding said HP-NAP and/or said nucleic acid sequence encoding said immunological equivalent fragment of said HP-NAP is under transcriptional control of an inducible promoter.28. The vector according to claim 27 , wherein said inducible promoter is activated upon binding of an antigen to said CAR and/or said TCR.29. The vector according to claim 28 , wherein said inducible promoter is N nuclear factor of activated T-cells (NFAT) binding motifs followed by the minimal human interleukin 2 (IL-2) promoter claim 28 , N is 1-10.30. The vector according to claim 24 , wherein said nucleic acid sequence encoding said CAR and/or said nucleic acid sequence encoding said TCR is under ...

CATALYST COMPONENT FOR OLEFIN POLYMERIZATION, CATALYST, AND USE THEREOF

Disclosed is a catalyst component for olefin polymerization. The catalyst component comprises magnesium, titanium, halogen and an internal electron donor. The internal electron donor includes an imine compound with a ketone group as shown in Formula I. Disclosed further is a method of preparing the catalyst component, and a catalyst for olefin polymerization containing the catalyst component. When the catalyst is used in olefin polymerization reaction especially propene polymerization reaction, the catalyst has a high activity and a long term activity and good hydrogen response, and the obtained polymer has characteristics of an adjustable isotactic index and a relatively wide molecular weight distribution. 2. The catalyst component according to claim 1 , wherein based on the weight of the catalyst component claim 1 , a content of magnesium is in a range of 5 wt %-50 wt % claim 1 , a content of titanium is in a range of 1.0 wt %-8.0 wt % claim 1 , a content of halogen is in a range of 10 wt %-70 wt % claim 1 , a content of the internal electron donor is in a range of 0.1 wt %-20 wt %.3. The catalyst component according to claim 1 , wherein R is methyl claim 1 , ethyl claim 1 , n-propyl claim 1 , isopropyl claim 1 , n-butyl claim 1 , isobutyl claim 1 , sec-butyl claim 1 , tert-butyl claim 1 , pentyl claim 1 , hexyl claim 1 , hydroxyalkyl claim 1 , phenyl claim 1 , halogenated phenyl claim 1 , alkyl-substituted phenyl claim 1 , naphthyl claim 1 , biphenyl claim 1 , or a heterocycle-containing group; the heterocycle-containing group is preferably a pyrrole-containing group claim 1 , a pyridine-containing group claim 1 , a pyrimidine-containing group claim 1 , or a quinoline-containing group.4. The catalyst component according to claim 1 , wherein each of R-Ris independently selected from a group consisting of hydrogen claim 1 , methyl claim 1 , ethyl claim 1 , n-propyl claim 1 , isopropyl claim 1 , n-butyl claim 1 , tert-butyl claim 1 , and isobutyl.5. The catalyst ...

DNA ALKYLATING AGENTS

Provided herein are compounds of formula I: 2. The method of claim 1 , further comprisingdetermining the AKR1C3 reductase level of the cancer in the patient using an AKR1C3 antibody prior to the administration.3. The method of claim 2 , further comprising{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, 'administering to the patient the compound or the composition of if said AKR1C3 reductase level is equal to or greater than a predetermined value.'}4. The method of claim 1 , further comprisingisolating a sample from the patient,determining an intratumoral AKR1C3 reductase level of the cancer in the sample using an AKR1C3 antibody, andselecting the patient for therapy if the intratumoral AKR1C3 reductase level of the cancer is equal to or greater than a predetermined level.5. The method of claim 1 , wherein T is OP(O)(N(CHCH)) claim 1 , OP(O)(NHCHCHCl) claim 1 , OP(O)(NHCHCHBr) claim 1 , or OP(O)(NH)(N(CHCHCl)).6. The method of claim 1 , wherein A is optionally substituted C-Caryl.7. The method of claim 1 , wherein A is optionally substituted phenyl.8. The method of claim 1 , wherein A is optionally substituted 5-15 membered heteroaryl.9. The method of claim 9 , wherein A is optionally substituted pyridyl.10. The method of claim 9 , wherein A is —N═CRRwhere Rand Rare defined as in .11. The method of claim 1 , wherein R is methyl.13. The method of claim 1 , wherein the cancer is AKR1C3 reductase overexpressing cancer.14. The method of claim 13 , wherein the cancer is liver cancer claim 13 , non-small cell lung cancer or melanoma.15. The method of claim 1 , wherein the patient is a human. This application is a divisional application of U.S. patent application Ser. No. 15/557,053, filed on Sep. 8, 2017, which is a national stage application under 35 U.S.C. § 371 of International Application No. PCT/US2016/021581, filed Mar. 9, 2016, which in turn claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 62/131,163, filed Mar. 10, 2015, and U.S. ...

(R)- AND (S)-1-(3-(3-N,N-DIMETHYLAMINOCARBONYL)PHENOXYL-4-NITROPHENYL)-1-ETHYL-N,N'-BIS (ETHYLENE)PHOSPHORAMIDATE, COMPOSITIONS AND METHODS FOR THEIR USE AND PREPARATION

Provided herein are optically active compounds of the formulae (ii); and (III) and pharmaceutical compositions thereof. Also provided herein are processes of making these compounds and resolving the racemic mixture or the enrichment of same with in one of its enantiomers to provide (R)- and (S)-1-(3-(3-N,N-dimethylaminocarbonyl)phenoxyl-4-nitrophenyl)-1-ethyl-N,N′-bis(ethylene)phosphoramidate, and methods of treating cancer comprising administering such compounds. 3. The compound of claim 1 , wherein the compound has an enantiomeric excess of no less than 80%.4. The compound of claim 3 , wherein the compound has an enantiomeric excess of no less than 90%.5. The compound of claim 4 , wherein the compound has an enantiomeric excess of no less than 95%.6. The compound of claim 1 , wherein the compound is substantially pure.7. The compound of claim 6 , wherein the compound has a purity of at least 50%.8. The compound of claim 7 , wherein the compound has a purity of at least 90%.9. A pharmaceutical composition comprising the compound of claim 1 , and a pharmaceutically acceptable excipient.10. A method of treating claim 1 , or ameliorating one or more symptoms of a proliferative disease in a subject claim 1 , comprising administering to the subject a compound of .11. The method of claim 10 , wherein the disease is cancer including liver cancer claim 10 , hepatocellular carcinoma (HCC) claim 10 , non-small cell lung cancer claim 10 , melanoma claim 10 , prostate cancer claim 10 , breast cancer claim 10 , leukemia claim 10 , esophageal cancer claim 10 , renal cancer claim 10 , gastric cancer claim 10 , colon cancer claim 10 , brain cancer claim 10 , bladder cancer claim 10 , cervical cancer claim 10 , ovarian cancer claim 10 , head and neck cancer claim 10 , endometrial cancer claim 10 , pancreatic cancer claim 10 , a sarcoma cancer claim 10 , and rectal cancer.12. A method of inhibiting the growth of a cell claim 1 , comprising contacting the cell with a compound of .13. ...

CATALYST COMPONENT FOR OLEFIN POLYMERIZATION, CATALYST, AND USE THEREOF

Disclosed is a catalyst component for olefin polymerization. The catalyst component comprises magnesium, titanium, halogen and an internal electron donor. The internal electron donor includes an imine compound with a ketone group as shown in Formula I. Disclosed further is a method of preparing the catalyst component, and a catalyst for olefin polymerization containing the catalyst component. When the catalyst is used in olefin polymerization reaction especially propene polymerization reaction, the catalyst has a high long-term activity and good hydrogen response, and the obtained polymer has characteristics of an adjustable isotactic index and a relatively wide molecular weight distribution. 2. The catalyst component according to claim 1 , wherein based on the weight of the catalyst component claim 1 , a content of magnesium is in a range of 5 wt %-50 wt % claim 1 , a content of titanium is in a range of 1.0 wt %-8.0 wt % claim 1 , a content of halogen is in a range of 10 wt %-70 wt % claim 1 , a content of the internal electron donor is in a range of 0.1 wt %-20 wt %.3. The catalyst component according to claim 1 , wherein R is methyl claim 1 , ethyl claim 1 , n-propyl claim 1 , isopropyl claim 1 , n-butyl claim 1 , isobutyl claim 1 , sec-butyl claim 1 , tert-butyl claim 1 , pentyl claim 1 , hexyl claim 1 , hydroxyalkyl claim 1 , phenyl claim 1 , halogenated phenyl claim 1 , alkyl-substituted phenyl claim 1 , naphthyl claim 1 , biphenyl claim 1 , or a heterocycle-containing group; the heterocycle-containing group is preferably a pyrrole-containing group claim 1 , a pyridine-containing group claim 1 , a pyrimidine-containing group claim 1 , or a quinolone-containing group.4. The catalyst component according to claim 1 , wherein each of R claim 1 , R claim 1 , R claim 1 , and Ris independently selected from a group consisting of methyl claim 1 , ethyl claim 1 , n-propyl claim 1 , isopropyl claim 1 , n-butyl claim 1 , isobutyl claim 1 , sec-butyl claim 1 , tert-butyl ...

METHOD FOR PRODUCING FLUORINATED ORGANIC COMPOUNDS

Disclosed are processes for the production of fluorinated olefins, preferably adapted to commercialization of CFCF═CH(1234yf). Three steps may be used in preferred embodiments in which a feedstock such as CCl═CClCHCl (which may be purchased or synthesized from 1,2,3-trichloropropane) is fluorinated (preferably with HF in gas-phase in the presence of a catalyst) to synthesize a compound such as CFCCl═CH, preferably in a 80-96% selectivity. The CFCCl═CHis preferably converted to CFCFClCH(244-isomer) using a SbClas the catalyst which is then transformed selectively to 1234yf, preferably in a gas-phase catalytic reaction using activated carbon as the catalyst. For the first step, a mixture of CrOand FeCl/C is preferably used as the catalyst to achieve high selectivity to CFCCl═CH(96%). In the second step, SbCl/C is preferably used as the selective catalyst for transforming 1233xf to 244-isomer, CFCFClCH. The intermediates are preferably isolated and purified by distillation and used in the next step without further purification, preferably to a purity level of greater than about 95%. 1. A method for producing fluorinated organic compounds comprising converting at least one compound of Formula (I){'br': None, 'sub': m', 'n', 'm, 'C(X)CCl(Y)C(X)\u2003\u2003(I)'} {'br': None, 'sub': '3', 'CFCF═CHZ\u2003\u2003(II)'}, 'to at least one compound of Formula (II)'}where each X, Y and Z is independently H, F, Cl, I or Br, and each m is independently 1, 2 or 3, and n is 0 or 1.2. The method of wherein said converting step is a direct converting step.3. The method of wherein said converting step is an indirect converting step.4. The method of wherein said at least one compound of Formula (I) comprises a compound wherein n is 0 claim 1 , each X is independently H or Cl claim 1 , and Z is H.5. The method of wherein said at least one compound of Formula (I) comprises a compound Formula (IA):{'br': None, 'sub': 2', '3, 'C(X)═CClC(X)\u2003\u2003(IA)'}{'claim-ref': {'@idref': 'CLM-00001 ...

WOUND DRESSING HAVING GRID PATTERN

A wound dressing comprising a base film layer which is made of polymer and have a grid pattern on one surface of the substrate layer is provided. A method of making the wound dressing comprising the steps of coating a polymer solution on a patterned liner and drying the polymer solution is also provided. 15-. (canceled)6. A wound dressing comprising:a base film layer which comprises a polymer film having a grid pattern on one surface of the base film layer, andan adhesive layer or a hydrocolloid layer disposed on the opposite surface of the base film layer from the surface having the grid pattern,wherein the grid pattern of the polymer film is obtained by coating a polymer solution to a patterned liner having a complementary pattern to the grid pattern of the polymer film.7. The wound dressing according to claim 6 , wherein the polymer film is transparent.8. The wound dressing according to claim 6 , wherein the grid pattern has a vertical grid line and a horizontal grid line claim 6 , and the vertical and horizontal grid lines are at right angle to one another.9. The wound dressing according to further comprising a release liner on the opposite surface of the adhesive layer or the hydrocolloid layer from the base film layer.10. A method of making the wound dressing according to comprising the steps of:coating a polymer solution on the patterned liner, anddrying the polymer solution and replicating the grid pattern of the patterned liner to the surface of the base film layer. The present disclosure relates to a wound dressing having a grid pattern on its surface and a method of making the wound dressing.To measure the size of a wound is critical in documenting the progress of healing and in assessing the effectiveness of interventions on the healing processes in clinical and research settings. A wound dressing having a printed grid on the top surface of the dressing are used clinically. A grid made by printing tends to disappear over time or from rubbing, and ...

X-RAY SCANNING METHOD AND SYSTEM

X-ray scanning methods and systems are provided in embodiments of the present inventions. According to one illustrative implementation, an exemplary method may comprise: collecting background data when no X-ray is emitted; collecting air data when X-rays are emitted and there is no object to be scanned in an inspection channel; scanning an object to collect original scanning data; and preprocessing the original scanning data according to the background data and the air data to acquire scanned image data. In some embodiments, when performing an X-ray scanning of a static object, implementations may measure the background data and the air data and process the scanning data, thereby solving noise issues caused by mechanical vibration and thus improving the measurement accuracy. 1. An X-ray scanning method , comprising:collecting background data when no X-ray is emitted;collecting air data when X-rays are emitted and there is no object to be scanned in an inspection channel;scanning an object to collect original scanning data; andpreprocessing the original scanning data according to the background data and the air data to acquire scanned image data.2. The X-ray scanning method according to claim 1 , wherein the step of collecting the background data further comprises:averaging the background data to acquire averaged background data.3. The X-ray scanning method according to claim 2 , wherein the step of collecting the air data further comprises:averaging the air data to acquire averaged air data.4. The X-ray scanning method according to claim 3 , wherein the step of preprocessing the original scanning data according to the background data and the air data to acquire scanned image data further comprises:segmenting a scanning region into an object region containing therein the object and an air region without the object according to the original scanning data; andsearching the air data for particular air data closest to a value of original scanning data for the air region, ...

METHOD FOR PRODUCING FLUORINATED ORGANIC COMPOUNDS

Disclosed are processes for the production of fluorinated olefins, preferably adapted to commercialization of CFCF═CH(1234yf). Three steps may be used in preferred embodiments in which a feedstock such as CCl═CClCHCl (which may be purchased or synthesized from 1,2,3-trichloropropane) is fluorinated (preferably with HF in gas-phase in the presence of a catalyst) to synthesize a compound such as CFCCl═CH, preferably in a 80-96% selectivity. The CFCCl═CHis preferably converted to CFCFClCH(244-isomer) using a SbClas the catalyst which is then transformed selectively to 1234yf, preferably in a gas-phase catalytic reaction using activated carbon as the catalyst. For the first step, a mixture of CrOand FeCl/C is preferably used as the catalyst to achieve high selectivity to CFCCl═CH(96%). In the second step, SbCl/C is preferably used as the selective catalyst for transforming 1233xf to 244-isomer, CFCFClCH. The intermediates are preferably isolated and purified by distillation and used in the next step without further purification, preferably to a purity level of greater than about 95%. 1. A method for producing fluorinated organic compounds comprising converting at least one compound of Formula (I){'br': None, 'i': m', 'n', 'm, 'C(X)CCl(Y)C(X)\u2003\u2003(I)'} {'br': None, 'sub': '3', 'CFCF═CHZ\u2003\u2003(II)'}, 'to at least one compound of Formula (II)'}where each X, Y and Z is independently H, F, Cl, I or Br, and each m is independently 1, 2or 3, and n is 0or 1.2. The method of wherein said converting step is a direct converting step.3. The method of wherein said converting step is an indirect converting step.4. The method of wherein said at least one compound of Formula (I) comprises a compound wherein n is 0 claim 1 , each X is independently H or Cl claim 1 , and Z is H.5. The method of wherein said at least one compound of Formula (I) comprises a compound Formula (IA):{'br': None, 'sub': 2', '3, 'C(X)═CClC(X)\u2003\u2003(IA)'}{'claim-ref': {'@idref': 'CLM-00001', ' ...

Methods and systems of streaming refrigerant in a heat exchanger

Embodiments are disclosed to help create longitudinal refrigerant streams, for example, in a shell and tube type evaporator, so as to manage refrigerant and/or lubricant in the evaporator. In some embodiments, the shell side of the evaporator may include a plurality of longitudinally extended pans stacked in a vertical direction. In some embodiments, refrigerant can be directed onto a top pan. The refrigerant can form a longitudinal refrigerant stream along the pan and flow down to the next pan in the vertical direction and form another longitudinal refrigerant stream. Each of the pans may form a refrigerant pool to help exchange heat with a process fluid carried in heat exchanger tubes. By forming longitudinal refrigerant streams in the pans, heat exchange efficiency may be improved and a lubricant content in refrigerant streams may be concentrated toward a bottom of the evaporator.

MAINTAINING SYNCHRONIZATION OF COLLECTED DATA AND INSIGHTS

In an approach for maintaining data synchronization, a processor scans a set of data fields at each stage of a data analysis process. A processor generates a relationship tree model, wherein the set of data fields each correspond to a node in the relationship tree model. A processor prunes the relationship tree model. Responsive to an update to a data field of the set of data fields, a processor promulgates the update using the relationship tree model to generate an updated set of insight data. A processor outputs the updated set of insight data. 1. A computer-implemented method for maintaining data synchronization , the computer-implemented method comprising:scanning, by one or more processors, a set of data fields at each stage of a data analysis process;generating, by one or more processors, a relationship tree model, wherein the set of data fields each correspond to a node in the relationship tree model;pruning, by one or more processors, the relationship tree model;responsive to an update to a data field of the set of data fields, promulgating, by one or more processors, the update using the relationship tree model to generate an updated set of insight data; andoutputting, by one or more processors, the updated set of insight data.2. The computer-implemented method of claim 1 , further comprising:responsive to scanning the data field at each stage of the data analysis process, outputting, by one or more processors, a set of metadata associated with each data field of the set of data fields, wherein the set of metadata comprises a field name, a field type, a program module, a component, and other data fields that have a relationship with a particular data field.3. The computer-implemented method of claim 2 , wherein the field type is selected from the group consisting of raw data claim 2 , formatted data claim 2 , and insight data.4. The computer-implemented method of claim 2 , wherein the component is selected from the group consisting of a data collector ...

Polyol ester compounds useful in preparation of a catalyst for olefins polymerization, process for preparing the same and use thereof

The present application relates to polyol ester compounds, having general formula (I): R1CO-O-CR3R4-A-CR5R6-O-CO-R2 (I) wherein, R, and R2 groups, which may be identical or different, can be substituted or unsubstituted hydrocarbyl having 1 to 20 carbon atoms, R3-R6 groups, which may be identical or different, can be selected from the group consisting of hydrogen, halogen or substituted or unsubstituted hydrocarbyl having 1 to 20 carbon atoms, R1-R6 groups optionally contain one or more hetero-atoms replacing carbon, hydrogen atom or the both, said hetero-atom is selected from the group consisting of nitrogen, oxygen, sulfur, silicon, phosphorus and halogen atom, two or more of R3-R6 groups can be linked to form saturated or unsaturated monocyclic or polycyclic ring; A is a single bond or bivalent linking group with chain length between two free radicals being 1-10 atoms, wherein said bivalent linking group is selected from the group consisting of aliphatic, alicyclic and aromatic bivalent radicals, and can carry C1-C20 linear or branched substituents; one or more of carbon atom and/or hydrogen atom on the substituents can be replaced by a hetero-atom selected from the group consisting of nitrogen, oxygen, sulfur, silicon, phosphorus, and halogen atom, and two or more said substituents on the linking group as well as above-mentioned R3-R6 groups can be linked to form saturated or unsaturated monocyclic or polycyclic ring. The compounds of formula (I) find use in preparing a catalyst for olefin polymerization.

Metodo para la produccion de 2,3,3,3-tetrafluoropropeno.

Se presenta un método para la preparación de 2,3,3,3-tetrafluoropr openo que comprende la puesta en contacto de un reactivo que comprende CCl2=CFCH2Cl con un agente de fluorinación, como por ejemplo HF, en condiciones efectivas para producir un producto de la reacción que contiene CF3CF=CH2.

Catalyst component for olefin polymerization reaction and catalyst comprising same

Abstract:A catalyst component for olefin polymerization comprising magnesium, titanium, halogen and electron donor, wherein the electron donor is selected from at least oneof the diol diester compounds, when the diol diester comprised contains a certain amount of isomer with Fischer projection formula as shown in Formula (II), the activity and stereospecificity of the catalyst are greatly improved, especially in the production of polymers with high melt index, the isotactic index of the obtained polymers is improved substantially.

Catalyst component for propylene polymerization, preparation method therefor and catalyst having same

Catalyst component for use in olefin polymerization, catalyst, and applications thereof

Catalyst component for use in olefin polymerization, catalyst, and applications thereof

Polyol ester compounds useful in preparation of a catalyst for olefins polymerization, process for preparing the same and use thereof

magnesium halide complex, process for preparing the olefin complex, catalyst for polymerization of an olefin and process for polymerizing olefins

complexo de haleto de magnésio, processo para preparar o complexo de haleto de magnésio, componente catalisador útil em polimerizaçao olefinica, catalisador para apolimerizaçao de uma olefina e processo para polimerizar olefinas. a invenção provê um complexo de haleto de magnésio, lendo uma composição representada pela fórmula (1) mgx~ 2~.mrohneph~ 2~o (1) na qual x é cloreto, brometo, ou um alcoxi ou ariloxi de c~ 1~-c~ 14~; r é alquila de c~ 1~-c~ 12~, cicloalquila de c~ 3~-c~ 10~ ou arila de c~ 6~-c~ 10~; e é hidrocarboneto com di-hidrocarbiloxigeminado representado pela fórmula (ii) na qual r~ 1~ e r~ 2~, que são idênticos ou diferentes, são hidrogênio ou alquila linear ou ramificado de c~ 1~-c~ 10~,cicloalquila de c~ 3~-c~ 10~, arila de c~ 6~-c~ 10~, alquilarila ou arilalquila de c~ 7~-c~ 10~, os ditos arila, alquilarila e arilalquila sendo opcionalmente substituidos por um ou mais átomos de halogênio no anel aromático; opcionalmente r~ 1~ e r~ 2~ ligam-se um ao outro para formar um anel ou sistema de anel fundido; r~ 3~ e r~ 4~ têm os mesmos significados definidos para r~ 1~ e r~ 2~ outros que não hidrogênio; m está na faixa de 1 a 5; n está na faixa de 0,005 a 1,0; e p está na faixa de o a 0,8. a invenção refere-se ainda a um componente catalisador esférico e a um catalisador preparado com o complexo de haleto de magnésio esférico, e ao uso do catalisador na polimerização de cx-olefinas ch~ 2~=chr ou uma mistura das mesmas, na qual r é h, ou alquila ou arila tendo de 1 a 12 átomos de carbono. magnesium halide complex, process for preparing magnesium halide complex, catalyst component useful in olefinic polymerization, catalyst for olefin polymerization and process for polymerizing olefins. The invention provides a magnesium halide complex by reading a composition represented by the formula (1) mgx-2-mrohneph-2-o (1) wherein x is chloride, bromide, or a C1-4 alkoxy or aryloxy. -c ~ 14-; R is C1-6 alkyl, C1-3 cycloalkyl or C1-6 aryl; and is ...

Catalyst component for olefin polymerization reaction and catalyst thereof

Catalyst component for olefin polymerization, and catalyst containing the same

Provided is a catalyst component for olefin polymerization. The catalyst component is obtained by reacting magnesium, titanium, a halogen and an internal electron donor, and the internal electron donor comprises an imine compound shown by the general formula Z. Also provided are a method for preparing the catalyst component, and an olefin polymerization catalyst containing the catalyst component. When the catalyst of the present invention is used in an olefin polymerization reaction, the catalyst activity and the isotacticity index of the polymer obtained are high, the catalyst activity decays slowly, and the molecular weight distribution of the polymer obtained is wider.

Catalyst component for olefin polymerization, and catalyst containing the same

The present invention provides a catalyst component for olefin polymerization, obtained by a reaction of magnesium, titanium, halogen and an internal electron donor, the internal electron donor comprising an imine compound as shown in Formula Z. The present invention also provides a preparation method of the catalyst component, and a catalyst for olefin polymerization containing the same. When the catalyst of the present invention is used for olefin polymerization reaction, the catalyst has a high activity, and a slow rate of activity decay, and the obtained polymer has a high isotacticity index, and a wide molecular weight distribution.

Catalyst composition for olefin polymerization and use thereof

The present disclosure discloses a catalyst composition for olefin polymerization, comprising the following components: a): a solid catalyst component containing magnesium, titanium, halogens, and at least one internal electron donor having a lone pair of electrons; b): an aluminum alkyl compound; and c): an external electron donor containing a first external electron donor C1, which is a malonate compound. In the present disclosure, a catalyst composition having an external electron donor that contains a malonate compound is used in olefin polymerization, in particular propene polymerization, and can significantly improve catalytic activity and hydrogen response of the catalyst and expand molecular weight distribution of polymers, which facilitates development of different polymers.

Catalyst component for olefin polymerization reaction and catalyst comprising same

A CATALYST COMPONENT FOR OLEFIN POLYMERIZATION COMPRISING MAGNESIUM, TITANIUM, HALOGEN AND ELECTRON DONOR, WHEREIN THE ELECTRON DONOR IS SELECTED FROM AT LEAST ONE OF THE DIOL DIESTER COMPOUNDS, WHEN THE DIOL DIESTER COMPRISED CONTAINS A CERTAIN AMOUNT OF ISOMER WITH FISCHER PROJECTION FORMULA AS SHOWN IN FORMULA (II), THE ACTIVITY AND STEREOSPECIFICITY OF THE CATALYST ARE GREATLY IMPROVED, ESPECIALLY IN THE PRODUCTION OF POLYMERS WITH HIGH MELT INDEX, THE ISOTACTIC INDEX OF THE OBTAINED POLYMERS IS IMPROVED SUBSTANTIALLY.

Catalyst component for olefin polymerization and catalyst thereof

Catalyst component for olefin polymerization reaction and catalyst comprising same

Catalyst component for olefin polymerization reaction and catalyst thereof

catalytic component for olefin reaction polymerization and catalyst

componente catalítico para polimerização de reação de olefina e catalisador deste. a presente invenção refere-se a um componente catalítico para polimerização de olefina que contém magnésio, titânio, halogênio, e doadores de elétrons, é proporcionado na presente invenção. os doadores de elétrons, é proporcionado na presente invenção. os doadores de elétrons são selecionados de pelo menos um composto de succinato da seguinte fórmula geral (i), e o teor de referidos compostos de succinato com as estrutura conforme mostrada na fórmula (ii) nos referidos compostos de succinato (i) é menor do que 100%, mas não menor do que 51,0% em peso. comparado com o mesômero cujo teor com a estrutura conforme mostrada na fórmula (ii) é 100%, o componente catalítico proporcionado pela presente invenção não somente diminui grandemente o custo de produção, mas também aperfeiçoa certas propriedades do catalisador, por exemplo, a distribuição de peso molecular do polímero obtido pela reação catalítica usando referido catalisador é mais ampla, que é benéfica para propriedades de processamento aperfeiçoadas dos polímeros. o catalisador correspondente é também proporcionado. catalytic component for olefin reaction polymerization and catalyst thereof. The present invention relates to a catalyst component for olefin polymerization containing magnesium, titanium, halogen, and electron donors provided in the present invention. electron donors is provided in the present invention. electron donors are selected from at least one succinate compound of the following general formula (i), and the content of said succinate compounds having the structures as shown in formula (ii) in said succinate compounds (i) is less than 100% but not less than 51,0% by weight. Compared to the mesomer whose content with the structure as shown in formula (ii) is 100%, the catalytic component provided by the present invention not only greatly decreases the cost of production, but also enhances certain properties of the ...

Catalyst component for olefin polymerization reaction and catalyst comprising same

Method for producing fluorinated organic compounds

【課題】フッ化有機化合物の新規な調製方法を提供する。【解決手段】式（Ｉ）の少なくとも１つの化合物を、式（ＩＩ）の少なくとも１つの化合物に転換する工程を含む、フッ化有機化合物の製造方法である。Ｃ（Ｘ）ｍＣＣｌ（Ｙ）ｎＣ（Ｘ）ｍ（Ｉ）ＣＦ３ＣＦ＝ＣＨｚ（ＩＩ）（Ｘ、Ｙ及びＺは、各々独立に、Ｈ、Ｆ、Ｃｌ、Ｉ又はＢｒ；ｍは、各々独立に、１、２又は３；ｎは０又は１）【選択図】なし

Antibodies specific for cancer associated antigen sm5-1 and uses thereof

The invention concerns antibodies which is specific for SM5-1 antigen expressed in melanoma, breast cancer and hepatocellular carcinoma, and polynucleotides encoding the antibodies. The invention further concerns use of such antibodies and/or polynucleotides in diagnosing and treating malignancies.

CATALYST COMPONENT, CATALYST, AND PRE-POLYMERIZATION CATALYST FOR POLYMERIZING OLEFINS, AND PROCESS FOR OLEFIN POLYMERIZATION

Il est proposé un composant de catalyseur pour la polymérisation d'oléfines, un catalyseur pour la polymérisation d'oléfines, un catalyseur de pré-polymérisation obtenu par pré-polymérisation du catalyseur, et un procédé pour la polymérisation d'oléfines. Le composant de catalyseur pour la polymérisation d'oléfines inclut du magnésium, du titane, un halogène, un composé base de Lewis A tel que montré dans la formule (I), et un autre composé base de Lewis B, dans lequel un rapport molaire d'une quantité totale de composé A et de composé B par rapport au magnésium est dans une plage de (0,03 à 0,20): 1. Lorsque le catalyseur est utilisé dans la polymérisation d'oléfines, en particulier dans la polymérisation de propylène, le catalyseur a une haute activité. There is provided a catalyst component for the polymerization of olefins, a catalyst for the polymerization of olefins, a prepolymerization catalyst obtained by prepolymerization of the catalyst, and a process for the polymerization of olefins. The catalyst component for the polymerization of olefins includes magnesium, titanium, halogen, a Lewis A base compound as shown in formula (I), and another Lewis B base compound, in which a molar ratio of a total amount of Compound A and Compound B relative to magnesium is in a range of (0.03 to 0.20): 1. When the catalyst is used in the polymerization of olefins, particularly in the polymerization propylene, the catalyst has a high activity.

Polyol ester compounds useful in preparation of a catalyst for olefins polymerization, process for preparing the same and use thereof

The present application relates to polyol ester compounds, having general formula (I): R1CO-O-CR3R4-A-CR5R6-O-CO-R2 (I) wherein, R, and R2 groups, which may be identical or different, can be substituted or unsubstituted hydrocarbyl having 1 to 20 carbon atoms, R3-R6 groups, which may be identical or different, can be selected from the group consisting of hydrogen, halogen or substituted or unsubstituted hydrocarbyl having 1 to 20 carbon atoms, R1-R6 groups optionally contain one or more hetero-atoms replacing carbon, hydrogen atom or the both, said hetero-atom is selected from the group consisting of nitrogen, oxygen, sulfur, silicon, phosphorus and halogen atom, two or more of R3-R6 groups can be linked to form saturated or unsaturated monocyclic or polycyclic ring; A is a single bond or bivalent linking group with chain length between two free radicals being 1-10 atoms, wherein said bivalent linking group is selected from the group consisting of aliphatic, alicyclic and aromatic bivalent radicals, and can carry C1-C20 linear or branched substituents; one or more of carbon atom and/or hydrogen atom on the substituents can be replaced by a hetero-atom selected from the group consisting of nitrogen, oxygen, sulfur, silicon, phosphorus, and halogen atom, and two or more said substituents on the linking group as well as above-mentioned R3-R6 groups can be linked to form saturated or unsaturated monocyclic or polycyclic ring. The compounds of formula (I) find use in preparing a catalyst for olefin polymerization.

Polyol ester compounds useful in preparation of a catalyst for olefins polymerization, process for preparing the same and use thereof

The present application relates to polyol ester compounds, having general formula (I): R1CO-O-CR3R4-A-CR5R6-O-CO-R2 (I) wherein, R, and R2 groups, which may be identical or different, can be substituted or unsubstituted hydrocarbyl having 1 to 20 carbon atoms, R3-R6 groups, which may be identical or different, can be selected from the group consisting of hydrogen, halogen or substituted or unsubstituted hydrocarbyl having 1 to 20 carbon atoms, R1-R6 groups optionally contain one or more hetero-atoms replacing carbon, hydrogen atom or the both, said hetero-atom is selected from the group consisting of nitrogen, oxygen, sulfur, silicon, phosphorus and halogen atom, two or more of R3-R6 groups can be linked to form saturated or unsaturated monocyclic or polycyclic ring; A is a single bond or bivalent linking group with chain length between two free radicals being 1-10 atoms, wherein said bivalent linking group is selected from the group consisting of aliphatic, alicyclic and aromatic bivalent radicals, and can carry C1-C20 linear or branched substituents; one or more of carbon atom and/or hydrogen atom on the substituents can be replaced by a hetero-atom selected from the group consisting of nitrogen, oxygen, sulfur, silicon, phosphorus, and halogen atom, and two or more said substituents on the linking group as well as above-mentioned R3-R6 groups can be linked to form saturated or unsaturated monocyclic or polycyclic ring. The compounds of formula (I) find use in preparing a catalyst for olefin polymerization.

Catalyst component for olefin polymerization reaction and catalyst thereof

The present invention provides catalyst component for CH2 = CHR olefin polymerization and catalyst thereof wherein R is hydrogen or C1-­C12 alkyl or aryl, said catalyst component contains magnesium, titanium, halogen and electron donor compounds (a), said electron donor compounds (a) are selected from at least one diester compounds of following formula (I), said catalyst component also optionally contains electron donor compounds (b) and/or (c), said electron donor compounds (b) are selected from dibasic aliphatic carboxylic acid ester and dibasic aromatic carboxylic acid ester, said electron donor compounds (c) are selected from 1,3-diether compounds of formula (IV), wherein R', R1 and A are defined as in specification, wherein R'-RVIII are defined as in specification.

Catalyst component for use in olefin polymerization reaction, catalyst, and application

Provided in the present invention is a solid catalyst component for use in an olefin polymerization reaction, comprising magnesium, titanium, a halogen, and an electron donor. The electron donor is at least one selected from glycol ester compounds as represented by formula (I) as follows. A catalyst provided on the basis of the present invention is provided with greatly increased polymerization activity, hydrogen-modulation sensitivity, and stereospecificity. Based on the present invention, a catalyst system employing the glycol ester compounds as represent by formula (I) provided in the present invention is for use in olefin polymerization, provides great comprehensive performance, and is of high catalytic activity, particularly in a high hydrogen concentration, while the hydrogen-modulation sensitivity of the catalyst is increased and/or the isotactic index of a polymer acquired is increased significantly, thus facilitating preparation and acquisition of polymers of high melt flow index and high isotacticity and facilitating the development of polymers of different material designations.

Catalyst component for olefin polymerization reaction and catalyst thereof

The present invention provides a catalyst component for polymerization of olefin CH 2 =CHR, in which R is hydrogen or C 1 -C 12 alkyl or aryl, comprising magnesium, titanium, a halogen and an electron donor compound (a) which is at least one selected from the group consisting of dibasic ester compounds of the formula (I), and said catalyst component optionally further comprising an electron donor compound (b) selected from the group consisting of aliphatic dicarboxylic esters and aromatic dicarboxylic esters, and/or an electron donor compound (c) selected from the group consisting of 1,3-diether compounds of formula (IV): wherein, R 1 , R' and A are as defined in the description, wherein R I -R VIII are as defined in the description, and a catalyst comprising the catalyst component.

Magnesium halide adduct, olefins polymerization catalyst component and catalyst made therefrom

Catalyst component for olefin polymerization reaction and catalyst thereof

The present invention provides catalyst component for CH2 = CHR olefin polymerization and catalyst thereof wherein R is hydrogen or C1-­C12 alkyl or aryl, said catalyst component contains magnesium, titanium, halogen and electron donor compounds (a), said electron donor compounds (a) are selected from at least one diester compounds of following formula (I), said catalyst component also optionally contains electron donor compounds (b) and/or (c), said electron donor compounds (b) are selected from dibasic aliphatic carboxylic acid ester and dibasic aromatic carboxylic acid ester, said electron donor compounds (c) are selected from 1,3-diether compounds of formula (IV), wherein R', R1 and A are defined as in specification, wherein R'-RVIII are defined as in specification.

Catalyst component for olefin polymerization including dibasic ester, a catalyst comprising the same, and a process

The present invention provides a catalyst component for polymerization of olefin CH2=CHR, in which R is hydrogen or C1-C12 alkyl or aryl, comprising magnesium, titanium, a halogen and an electron donor compound (a) which is at least one selected from the group consisting of dibasic ester compounds of the formula (I), and said catalyst component optionally further comprising an electron donor compound (b) selected from the group consisting of aliphatic dicarboxylic esters and aromatic dicarboxylic esters, and/or an electron donor compound (c) selected from the group consisting of 1,3-diether compounds of formula (IV): (see formula I) wherein, R1, R' and A are as defined in the description, (see formula IV) wherein R I-R VIII are as defined in the description, and a catalyst comprising the catalyst component.

Catalyst component for olefin polymerization reaction and catalyst comprising same

A catalyst component for olefin polymerization comprising magnesium, titanium, halogen and electron donor, wherein the electron donor is selected from at least one of the diol diester compounds, when the diol diester comprised contains a certain amount of isomer with Fischer projection formula as shown in Formula (II), the activity and stereospecificity of the catalyst are greatly improved, especially in the production of polymers with high melt index, the isotactic index of the obtained polymers is improved substantially.