Настройки

Укажите год
-

Небесная энциклопедия

Космические корабли и станции, автоматические КА и методы их проектирования, бортовые комплексы управления, системы и средства жизнеобеспечения, особенности технологии производства ракетно-космических систем

Подробнее
-

Мониторинг СМИ

Мониторинг СМИ и социальных сетей. Сканирование интернета, новостных сайтов, специализированных контентных площадок на базе мессенджеров. Гибкие настройки фильтров и первоначальных источников.

Подробнее

Форма поиска

Поддерживает ввод нескольких поисковых фраз (по одной на строку). При поиске обеспечивает поддержку морфологии русского и английского языка
Ведите корректный номера.
Ведите корректный номера.
Ведите корректный номера.
Ведите корректный номера.
Укажите год
Укажите год
Применить Всего найдено 740. Отображено 100.
02-02-2012 дата публикации

PATH COMPUTATION METHOD, PATH COMPUTATION ELEMENT, NODE DEVICE, AND NETWORK SYSTEM

Номер: US20120026886A1
Автор: Sun Jun, Wang Yu
Принадлежит: Huawei Technologies Co., Ltd.

The present invention provides a path computation method, a Path Computation Element (PCE), a node device, and a network system. The method includes: receiving a path computation request message (S), where the path computation request message carries a network type identifier and traffic parameter constraint conditions of a path required to be computed, and the network type identifier indicates a type of a network where the path required to be computed locates; determining the network through the network type identifier, and computing the path in the network according to the traffic parameter constraint conditions (S); and sending a path computation response message (S), where the path computation response message carries the computed path. The problem of distinguishing and computing Traffic Engineer (TE) paths for various types of services in a multi-region convergence network is solved. 1. A path computation method , comprising:receiving a path computation request message, wherein the path computation request message includes data that defines a network type identifier and traffic parameter constraint conditions of a path required to be computed, and the network type identifier indicates a type of a network where the path required to be computed is located;determining the network through the network type identifier, and computing the path in the network according to the traffic parameter constraint conditions; andsending a path computation response message, wherein the path computation response message includes data that defines the computed path.2. The path computation method according to claim 1 , wherein the network type identifier indicates that the network where the path required to be computed is located is a Synchronous Digital Hierarchy (SDH) network claim 1 , and the traffic parameter constraint conditions comprise a signal type claim 1 , a concatenation type claim 1 , and a number of components;determining of the network through the network type ...

Подробнее
Номер записи: 1
02-02-2012 дата публикации

Fluorescent Methods and Materials for Directed Biomarker Signal Amplification

Номер: US20120028828A1
Автор: Baldocchi Russell, Fu Tsu-Ju, Gaylord Brent S., Hong Janice W., Sun Cheng-Jun
Принадлежит: SIRIGEN INC.

Methods and compositions are provided that include a multichromophore and/or multichromophore complex for identifying a target biomolecule. A sensor biomolecule, for example, an antibody can be covalently linked to the multichromophore. Additionally, a signaling chromophore can be covalently linked to the multichromophore. The arrangement is such that the signaling chromophore is capable of receiving energy from the multichromophore upon excitation of the multichromophore. Since the sensor biomolecule is capable of interacting with the target biomolecule, the multichromophore and/or multichromophore complex can provide enhanced detection signals for a target biomolecule. 171.-. (canceled)72. A multichromophore complex comprising:a multichromophore coupled to at least one biomolecule selected from the group consisting of a sensor biomolecule, a bioconjugate and a target biomolecule wherein,the multichromophore is covalently bound by a bioconjugation site pendant,a signaling chromophore that is the multichromophore or is covalently bound to the multichromophore complex, andthe multichromophore is a substituted conjugated polymer, a conjugated polymer segment or an oligomeric structure.731. The multichromophore complex of claim , wherein the multichromophore comprises a single bioconjugation site.741. The multichromophore complex of claim , wherein the signaling chromophore is covalently bound to the multichromophore complex.751. The multichromophore complex of claim , wherein the signaling chromophore is covalently bound to the multichromophore.761. The multichromophore complex of claim , wherein the signaling chromophore is covalently bound to the sensor biomolecule.771. The multichromophore complex of claim , wherein the signaling chromophore is an organic dye.781. The multichromophore complex of claim , wherein the multichromophore is a water-soluble conjugated polymer.791. The multichromophore complex of claim , wherein both the signaling chromophore and the ...

Подробнее
Номер записи: 2
16-02-2012 дата публикации

METHODS OF MODIFYING P53 ACETYLATION AND TREATING CANCER USING AVRA

Номер: US20120039798A1
Автор: Sun Jun
Принадлежит: UNIVERSITY OF ROCHESTER

The present invention relates to methods and compositions for the treatment of cancer. The methods and compositions involve the use of the effector protein AvrA, as well as variants or fragments thereof, or encoding nucleic acids. The AvrA effector protein is demonstrated to enhance p53 acetylation, disrupt the cell cycle progression in treated cells, and enhance the killing of cancer cells. In this way, the methods and compositions can treat cancerous conditions either alone or in combination with other therapies. 1. A method for inhibiting cancer cell proliferation comprising:introducing into a cancer cell (i) an isolated AvrA protein or polypeptide fragment thereof or (ii) a nucleic acid molecule encoding the isolated AvrA protein or polypeptide fragment, wherein said introducing is effective for inhibiting cell cycle progression of the cancer cell.2. The method of claim 1 , wherein the AvrA protein comprises an amino acid sequence that is at least about 90% identical to SEQ ID NO: 19.34-. (canceled)5. The method of claim 1 , wherein the AvrA protein or polypeptide fragment is administered.6. The method of claim 1 , wherein the nucleic acid molecule is administered.7. The method of claim 6 , wherein the nucleic acid molecule is present in an expression vector comprising a promoter operable in mammalian cells claim 6 , which promoter is operably coupled to the nucleic acid molecule.8. The method of claim 6 , wherein the nucleic acid molecule encodes an AvrA protein that is at least about 90% identical to SEQ ID NO: 19.9. (canceled)10. The method according to claim 1 , wherein the cancer cell is present in a solid tumor.11. The method according to claim 1 , wherein the cancer cell is metastatic cancer cell or circulating leukemia or lymphoma cell.12. A method of treating a patient for cancer comprising:administering to a patient having cancer a therapeutically effective dose of (i) an isolated AvrA protein or polypeptide fragment thereof, or (ii) a nucleic acid ...

Подробнее
Номер записи: 3
16-02-2012 дата публикации

PRIMARY ALCOHOL PRODUCING ORGANISMS

Номер: US20120040426A1
Автор: Burgard Anthony P., Pharkya Priti, Sun Jun
Принадлежит: GENOMATICA, INC.

The invention provides a non-naturally occurring microbial organism having a microbial organism having at least one exogenous gene insertion and/or one or more gene disruptions that confer production of primary alcohols. A method for producing long chain alcohols includes culturing these non-naturally occurring microbial organisms. 1. A non-naturally occurring microbial organism , comprising a microbial organism having a malonyl-CoA-independent fatty acid synthesis (FAS) pathway and an acyl-reduction pathway comprising at least one exogenous nucleic acid encoding a malonyl-CoA-independent FAS pathway enzyme expressed in sufficient amounts to produce a primary alcohol , said malonyl-CoA-independent FAS pathway comprising ketoacyl-CoA acyltransferase or ketoacyl-CoA thiolase , 3-hydroxyacyl-CoA dehydrogenase , enoyl-CoA hydratase and enoyl-CoA reductase , said acyl-reduction pathway comprising an acyl-CoA reductase and an alcohol dehydrogenase , wherein said microbial organism further comprises one or more gene disruptions , said one or more gene disruptions occurring in genes encoding enzymes that couple primary alcohol production to growth of said non-naturally occurring microbial organism when said gene disruption reduces an activity of said enzyme , whereby said one or more gene disruptions confers production of primary alcohols onto said non-naturally occurring microbial organism.2. The non-naturally occurring microbial organism of claim 1 , wherein said microbial organism comprises two exogenous nucleic acid each encoding a malonyl-CoA-independent FAS pathway enzyme.3. The non-naturally occurring microbial organism of claim 1 , wherein said microbial organism comprises three exogenous nucleic acid each encoding a malonyl-CoA-independent FAS pathway enzyme.4. The non-naturally occurring microbial organism of claim 1 , wherein said microbial organism comprises four exogenous nucleic acid each encoding a malonyl-CoA-independent FAS pathway enzyme.5. The non- ...

Подробнее
Номер записи: 4
23-02-2012 дата публикации

Document image processing method and apparatus

Номер: US20120045129A1
Автор: Hao Yu, Jun Sun, SATOSHI Naoi, Yoshinobu Hotta
Принадлежит: Fujitsu Ltd

A method for processing a document image includes: performing horizontal and vertical text line extraction on the document image; providing an overlapping matrix, a value of an element of the overlapping matrix indicating an overlapping relation between horizontal and vertical text lines; merging the overlapping matrix in the vertical and horizontal direction; determining one or more text overlapping regions in the document image, based on the values of the elements of the merged overlapping matrix; counting the total number of strokes or pixel points in the horizontal and vertical text lines, respectively, within one of the one or more text overlapping regions; and determining an orientation of the text overlapping region is horizontal if the total number of strokes or pixel points in the horizontal text lines is larger than that in the vertical text lines, otherwise, determining the orientation is vertical.

Подробнее
Номер записи: 5
23-02-2012 дата публикации

Method of and apparatus for processing images

Номер: US20120045131A1
Автор: He Yuan, HOTTA Yoshinobu, NAOI Satoshi, Sun Jun, YU Hao
Принадлежит: FUJITSU LIMITED

Ruled lines are extracted and fitted into a real 2-D space. Correspondence between fitted cells and template cells of a ruled line template is determined. For each pair of cells corresponding to each other, the position of each pixel in the template cell is mapped into a real position in the real 2-D space based on an affine transformation between the cells. A pixel value based on pixel values of a plurality of pixels in the image with positions adjacent to the real position is generated as a pixel value of the pixel in the template cell corresponding to the real position. A synthesized image corresponding to the image is generated by merging the ruled lines of the ruled line template with the pixels in the template cells having the pixel values as generated. A form template is obtained based on the synthesized images corresponding to the plurality of images. 1. An apparatus for processing images comprising:a ruled line extracting device which extracts ruled lines from each of a plurality of images and fits the extracted ruled lines into a real two dimensional space;a correspondence determining device which determines correspondence between fitted cells enclosed by the fitted ruled lines and template cells of a ruled line template by aligning the extracted ruled lines for each of the images with the ruled line template;a position mapping device which, with respect to each pair of cells which correspond to each other, maps the position of each of pixels in the template cell into a real position in the real two dimensional space based on an affine transformation between the pair of cells;a pixel value generating device which generates a pixel value based on pixel values of a plurality of pixels in the image with positions adjacent to the real position, as a pixel value of the pixel in the template cell corresponding to the real position;an image generating device which generates a synthesized image corresponding to the image by merging the ruled lines of the ruled ...

Подробнее
Номер записи: 6
15-03-2012 дата публикации

Method and apparatus for processing an image comprising characters

Номер: US20120063687A1
Автор: Hao Yu, Jun Sun, SATOSHI Naoi
Принадлежит: Fujitsu Ltd

Method and apparatus for processing an image including a character are disclosed. The method may include: searching in a set of characters one or more characters having highest similarities of shape to a character in the set of characters, hereinafter the character being referred to as a first character, the one or more searched characters forming a similar character list of the first character; searching in the set of characters one or more characters having highest similarities of shape to each character in the similar character list of the first character, to form a similar character list of each character in the similar character list of the first character; and selecting in the similar character lists one or more characters having a high mutual similarity between each other, as a character cluster.

Подробнее
Номер записи: 7
15-03-2012 дата публикации

Method for preparing meropenem using zinc powder

Номер: US20120065392A1
Автор: Byung Goo Lee, Hee Kyoon Yoon, Seong Cheol Moon, Soo Jin Choi, Sun Ah Jun, Sung Woo Park, Yeon Jung Yoon, Yoon Seok Song
Принадлежит: Daewoong Bio Inc, Daewoong Pharmaceutical Co Ltd

The present invention relates to an improved method for synthesizing meropenem trihydrate [(1R,5S,6S)-2-[((2′S,4′S)-2′-dimethylaminocarbozyl)pyrrolidin-4′-ylthio]-6-[(R)-1-hydroxyethyl]-1-methylcarbapen-2-em-3-carboxylic acid, trihydrate], which is a novel carbapenem antibiotic.

Подробнее
Номер записи: 8
28-06-2012 дата публикации

Nanostructured Biosensor Containing Neuropathy Target Esterase Activity

Номер: US20120160708A1
Автор: KOHLI Neeraj, Lee Ilsoon, Richardson Rudy J., Srivastava Devesh, Sun Jun, WORDEN Robert M.
Принадлежит:

The present invention provides compositions, devices and methods for detecting esterase activity. The present invention also provides devices and methods of detecting esterase inhibitors, for example, organophosphates. In particular, the present invention provides a biosensor comprising Neuropathy Target Esterase (NTE) polypeptides. Further, the present invention relates to medicine, industrial chemistry, agriculture, and homeland security. 1. A device , comprising: a linker attached to an electrode , said linker positioned between said electrode and an enzyme immobilizing layer , said layer interacting with an oxidase and an esterase.2. The device of claim 1 , wherein said enzyme immobilizing layer comprises a plurality of ammonium ions.3. The device of claim 1 , wherein said enzyme immobilizing layer comprises poly-L-lysine.4. The device of claim 1 , wherein said linker comprises thioctic acid.5. The device of claim 1 , wherein said esterase is a neuropathy target esterase.6. The device of claim 1 , wherein said oxidase is a tyrosinase.7. The device of claim 1 , wherein said electrode is an amperometric electrode.8. A device claim 1 , comprising: a linker attached to an electrode claim 1 , said linker positioned between said electrode and a first enzyme immobilizing layer claim 1 , said first layer interacting with an oxidase claim 1 , said oxidase positioned between said first enzyme immobilizing layer and a second enzyme immobilizing layer claim 1 , said second layer interacting with an esterase.9. The device of claim 8 , wherein said first and second enzyme immobilizing layers comprises a plurality of ammonium ions.10. The device of claim 8 , wherein said first and second layers comprises poly-L-lysine.11. The device of claim 8 , wherein said linker comprises thioctic acid.12. The device of claim 8 , wherein said oxidase is a tyrosinase.13. The device of claim 8 , wherein said esterase is a neuropathy target esterase.14. The device of claim 8 , wherein said ...

Подробнее
Номер записи: 9
05-07-2012 дата публикации

NON-VOLATILE MEMORY DEVICES AND SYSTEMS INCLUDING THE SAME, AND METHODS OF PROGRAMMING NON-VOLATILE MEMORY DEVICES

Номер: US20120170365A1
Автор: KANG Dong Ku, Kim Seung-bum, KIM Tae-Young, Park Sun-Jun
Принадлежит: SAMSUNG ELECTRONICS CO., LTD.

A method is for programming a memory block of a non-volatile memory device. The non-volatile memory device is operatively connected to a memory controller, and the memory block defined by a plurality of word lines located between a string select line and a common source line corresponding to the string select line. The method includes programming a first sub-block of the memory block, determining in the non-volatile memory device when a reference word line is programmed during programming of the first sub-block, and partial erasing a second sub-block of the memory block upon determining that the reference word line is programmed during programming of the first sub-block. 1. A method of programming a memory block of a non-volatile memory device operatively connected to a memory controller , the memory block defined by a plurality of word lines located between a string select line and a common source line corresponding to the string select line , the method comprising:programming a first sub-block of the memory block;determining in the non-volatile memory device when a reference word line is programmed during programming of the first sub-block;partial erasing a second sub-block of the memory block upon determining that the reference word line is programmed during programming of the first sub-block.2. The method of claim 1 , further comprising programming the second sub-block of the memory block after partial erasing the second sub-block.3. The method of claim 1 , wherein the partial erasing of the second sub-block is executed by the non-volatile memory device without receiving a corresponding partial erase command from the memory controller.4. The method of claim 1 , wherein the programming of the first sub-block comprises sequentially programming a first word line of the memory block through the reference word line of the memory block claim 1 , wherein the first word line through the reference word line define the first sub-block of the memory block.5. The method of ...

Подробнее
Номер записи: 10
06-09-2012 дата публикации

MICROORGANISMS FOR THE PRODUCTION OF 1,4-BUTANEDIOL AND RELATED METHODS

Номер: US20120225463A1
Автор: Burgard Anthony P., Burk Mark J., Haselbeck Robert, NIU Wei, Osterhout Robin E., Pujol-Baxley Catherine J., Sun Jun, Trawick John D., VAN DIEN Stephen J., Yim Harry
Принадлежит: GENOMATICA, INC.

The invention provides non-naturally occurring microbial organisms comprising a 1,4-butanediol (BDO) pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO and further optimized for expression of BDO. The invention additionally provides methods of using such microbial organisms to produce BDO. 1. A non-naturally occurring microbial organism , comprising a microbial organism having a 1 ,4-butanediol (BDO) pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO , wherein said microbial organism is genetically modified to express exogenous succinyl-CoA synthetase; to express exogenous alpha-ketoglutarate decarboxylase; to express exogenous succinate semialdehyde dehydrogenase and 4-hydroxybutyrate dehydrogenase and optionally 4-hydroxybutyryl-CoA/acetyl-CoA transferase; to express exogenous butyrate kinase and phosphotransbutyrylase; to express exogenous 4-hydroxybutyryl-CoA reductase; and to express exogenous 4-hydroxybutanal reductase; to express exogenous pyruvate dehydrogenase; to disrupt a gene encoding an aerobic respiratory control regulatory system; to express an exogenous NADH insensitive citrate synthase; to express exogenous phosphoenolpyruvate carboxykinase.2Escherichia coli. The non-naturally occurring microbial organism of claim 1 , wherein the succinyl-CoA synthetase is encoded by the sucCD genes.3Mycobacterium bovis. The non-naturally occurring microbial organism of claim 1 , wherein said alpha-ketoglutarate decarboxylase is encoded by the sucA gene.4Porphyromonas gingivalis. The non-naturally occurring microbial organism of claim 1 , wherein the succinate semialdehyde dehydrogenase (CoA-dependent) claim 1 , 4-hydroxybutyrate dehydrogenase and 4-hydroxybutyryl-CoA/acetyl-CoA transferase are encoded by W83 genes.5Clostridium acetobutilicum. The non-naturally occurring microbial organism of claim 1 , ...

Подробнее
Номер записи: 11
06-09-2012 дата публикации

MICROORGANISMS AND METHODS FOR THE BIOSYNTHESIS OF BUTADIENE

Номер: US20120225466A1
Автор: Burgard Anthony P., Burk Mark J., Osterhout Robin E., Pharkya Priti, Sun Jun
Принадлежит: GENOMATICA, INC.

The invention provides non-naturally occurring microbial organisms having a butadiene pathway. The invention additionally provides methods of using such organisms to produce butadiene. 1. A process for the production of butadiene comprising:(a) culturing by fermentation in a sufficient amount of nutrients and media a non-naturally occurring microbial organism that produces crotyl alcohol; and(b) converting crotyl alcohol produced by culturing said non-naturally occurring microbial organism to butadiene.2. The process of claim 1 , wherein step (b) is performed by chemical dehydration in the presence of a catalyst.3. The process of claim 1 , wherein said non-naturally occurring microbial organism comprises a crotyl alcohol pathway comprising at least one exogenous nucleic acid encoding a crotyl alcohol pathway enzyme expressed in a sufficient amount to produce crotyl alcohol claim 1 , said crotyl alcohol pathway comprising an acetyl-CoA:acetyl-CoA acyltransferase claim 1 , an acetoacetyl-CoA reductase claim 1 , a 3-hydroxybutyryl-CoA dehydratase claim 1 , a crotonyl-CoA reductase (aldehyde forming) claim 1 , a crotonaldehyde reductase (alcohol forming) claim 1 , a crotonyl-CoA hydrolase claim 1 , synthetase claim 1 , or transferase claim 1 , a crotonate reductase claim 1 , a crotonyl-CoA reductase (alcohol forming) claim 1 , a glutaconyl-CoA decarboxylase claim 1 , a glutaryl-CoA dehydrogenase claim 1 , a 3-aminobutyryl-CoA deaminase claim 1 , or a 4-hydroxybutyryl-CoA dehydratase.4. The process of claim 3 , wherein said microbial organism comprises two claim 3 , three or four exogenous nucleic acids each encoding a crotyl alcohol pathway enzyme.56-. (canceled)7. The process of claim 3 , wherein said crotyl alcohol pathway comprises a pathway selected from the group consisting of:an acetyl-CoA:acetyl-CoA acyltransferase, an acetoacetyl-CoA reductase, a 3-hydroxybutyryl-CoA dehydratase, a crotonyl-CoA reductase (aldehyde forming), and a crotonaldehyde reductase ( ...

Подробнее
Номер записи: 12
11-10-2012 дата публикации

METHOD AND DEVICE FOR IMPLEMENTING SHARED MESH PROTECTION AND OPTICAL NETWORK SYSTEM

Номер: US20120257886A1
Автор: Cai Junzhou, Sun Jun
Принадлежит: Huawei Technologies Co., Ltd.

Embodiments of the present invention disclose a method for implementing shared mesh protection includes: receiving, by a first node, a message of a second type sent by a second node, where the message of the second type carries a second positive incoming sublabel allocated by the second node for a protection path of a first service and the second positive incoming sublabel is used to indicate a specified feature of recovery information of the first service; allocating, by the first node, a first positive outgoing label for the protection path of the first service based on the second positive incoming sublabel, where the first positive outgoing label corresponds to the second positive incoming sublabel; and transmitting the recovery information of the first service to the second node based on an indication of the first positive outgoing sublabel when knowing that a working path of the first service is faulty. 1. A method for implementing shared mesh protection , the method comprising:receiving, by a first node, a message of a second type sent by a second node, wherein the message of the second type carries a second positive incoming sublabel allocated by the second node for a protection path of a first service and the second positive incoming sublabel is used to indicate a specified feature of recovery information of the first service;allocating a first positive outgoing sublabel for the protection path of the first service based on the second positive incoming sublabel, wherein the first positive outgoing sublabel corresponds to the second positive incoming sublabel; andtransmitting the recovery information of the first service to the second node based on an indication of the first positive outgoing sublabel when knowing that a working path of the first service is faulty.2. The method according to claim 1 , wherein:the second positive incoming sublabel is used to indicate a sub-APS overhead that bears the recovery information of the first service or a service ...

Подробнее
Номер записи: 13
20-12-2012 дата публикации

IMAGE PROCESSING METHOD, IMAGE PROCESSING DEVICE AND SCANNER

Номер: US20120320427A1
Автор: NAOI Satoshi, Sun Jun, Zheng Danian
Принадлежит: FUJITSU LIMTED

An image processing method generally includes: obtaining a vanishing point on a curved surface in a two-dimension image; extracting all the straight line segments between a top contour line and a bottom contour line of the curved surface by the vanishing point; removing a perspective distortion to get parallel straight line segments; obtaining the lengths of the straight line segments, obtaining the true width of each of the straight line segments in a three-dimension space and the depth increment of the straight line segments according to the lengths; obtaining the expanded width of each straight line segment according to the true width and the depth increment; obtaining the total expanded width of the curved surface to transform it into a flat surface; transforming image contents on the curved surface onto the flat surface. 1. An image processing method , comprising:obtaining a vanishing point on a curved surface in a two-dimension image obtained by an imaging apparatus;extracting all the straight lines between the vanishing point and a longer one of a top contour line and a bottom contour line of the curved surface by a width in a specific unit on the curved surface, the straight lines being adjacent to each other and intersecting at the vanishing point;removing a perspective distortion of the curved surface so that the intersecting straight lines become parallel straight lines;obtaining lengths of straight line segments of the straight lines between the top contour line and the bottom contour line and obtaining a true width of each of the straight line segments in a three-dimension space and a depth increment of the straight line segment according to the lengths;obtaining an expanded width of each of the straight line segments according to the true width and the depth increment;summing the expanded widths of all the straight line segments into the total expanded width of the curved surface in order to transform the curved surface into a flat surface; ...

Подробнее
Номер записи: 14
20-12-2012 дата публикации

IMAGE PROCESSING METHOD AND IMAGE PROCESSING APPARATUS

Номер: US20120321198A1
Автор: He Yuan, NAOI Satoshi, Sun Jun, YU Hao
Принадлежит: FUJITSU LIMITED

An image processing method includes estimating corners of a contour of an object area in an obtained image, searching for contour lines of the object area between every two points which are offset from the estimated corners within a predetermined degree or distance along a direction away from the object area respectively, and determining intersection points of the contour lines as final corners of the contour of the object area, and determining contour lines between the final corners as a final contour of the object area. 1. An image processing method , including:estimating corners of a contour of an object area in an obtained image;searching for contour lines of the object area between every two points which are offset from the estimated corners within a predetermined degree along a direction away from the object area respectively, and determining intersection points of the contour lines as final corners of the contour of the object area; anddetermining contour lines between the final corners as a final contour of the object area.2. The method according to claim 1 , wherein the searching includes:offsetting the estimated corners within the predetermined degree respectively along a principal orientation away from the object area and along a direction away from the object area and being perpendicular to the principal orientation, to obtain offset points in the principal orientation and offset points in the direction perpendicular to the principal orientation respectively;tracking contour lines of the object area in the principal orientation between every two offset points in the principal orientation respectively, and tracking contour lines of the object area in the direction perpendicular to the principal orientation between every two offset points in the direction perpendicular to the principal orientation respectively; anddetermining intersection points between the contour lines in the principal orientation and the contour lines in the direction perpendicular to ...

Подробнее
Номер записи: 15
03-01-2013 дата публикации

METHOD OF AND DEVICE FOR IDENTIFYING DIRECTION OF CHARACTERS IN IMAGE BLOCK

Номер: US20130004077A1
Автор: NAOI Satoshi, Sun Jun
Принадлежит: FUJITSU LIMITED

The present embodiments disclose a method of and device for identifying the direction of characters in an image block. The method includes: performing optical character recognition processing on the image block by assuming various directions as assumed character directions to obtain sub image blocks, recognized characters corresponding to the sub image blocks and correctness measures thereof in each assumed character directions; in sub image blocks in the assumed character directions with ° mutual relation, searching for a minimum matching pair of the sub image blocks; adjusting the sub image blocks in the searched minimum matching pair to eliminate the effect, on an identification result, of different numbers of sub image blocks in various assumed character directions; calculating an accumulative correctness measure in each assumed character directions based on the adjusted sub image blocks; and identifying the direction of characters in the image block according to the accumulative correctness measures. 1. A method of identifying a direction of characters in an image block , comprising:performing optical character recognition processing on the image block by assuming various directions as assumed character directions, respectively, to obtain sub image blocks, recognized characters corresponding to the sub image blocks and correctness measures in each of the assumed character directions;in sub image blocks in the assumed character directions with a 180° mutual relation therebetween, searching for a minimum matching pair of the sub image blocks, wherein the minimum matching pair is two sets of sub image blocks in the assumed character directions with a 180° mutual relation therebetween, which have corresponding positions, identical sizes and a minimum number of sub image blocks;adjusting the sub image blocks in the searched minimum matching pair, to eliminate an effect, on an identification result, of different numbers of sub image blocks in the assumed character ...

Подробнее
Номер записи: 16
10-01-2013 дата публикации

MICROORGANISMS FOR PRODUCING BUTADIENE AND METHODS RELATED THERETO

Номер: US20130011891A1
Автор: Burgard Anthony P., Burk Mark J., Osterhout Robin E., Pharkya Priti, Sun Jun
Принадлежит:

The invention provides non-naturally occurring microbial organisms having a butadiene or crotyl alcohol pathway. The invention additionally provides methods of using such organisms to produce butadiene or crotyl alcohol. 1. A non-naturally occurring microbial organism , comprising a microbial organism having a butadiene pathway comprising at least one exogenous nucleic acid encoding a butadiene pathway enzyme expressed in a sufficient amount to produce butadiene; said non-naturally occurring microbial organism further comprising:(a) a reductive TCA pathway comprising at least one exogenous nucleic acid encoding a reductive TCA pathway enzyme, wherein said at least one exogenous nucleic acid is selected from an ATP-citrate lyase, a citrate lyase, a citryl-CoA synthetase, a citryl-CoAlyase, a fumarate reductase, and an alpha-ketoglutarate:ferredoxin oxidoreductase;{'sub': '2', '(b) a reductive TCA pathway comprising at least one exogenous nucleic acid encoding a reductive TCA pathway enzyme, wherein said at least one exogenous nucleic acid is selected from a pyruvate:ferredoxin oxidoreductase, a phosphoenolpyruvate carboxylase, a phosphoenolpyruvate carboxykinase, a CO dehydrogenase, and an Hhydrogenase; or'}{'sub': '2', '(c) at least one exogenous nucleic acid encodes an enzyme selected from a CO dehydrogenase, an Hhydrogenase, and combinations thereof;'}wherein said butadiene pathway comprises a pathway selected from:(i) an acetyl-CoA:acetyl-CoA acyltransferase, an acetoacetyl-CoA reductase, a 3-hydroxybutyryl-CoA dehydratase, a crotonyl-CoA reductase (aldehyde forming), a crotonaldehyde reductase (alcohol forming), a crotyl alcohol kinase, a 2-butenyl-4-phosphate kinase and a butadiene synthase;(ii) an acetyl-CoA:acetyl-CoA acyltransferase, an acetoacetyl-CoA reductase, a 3-hydroxybutyryl-CoA dehydratase, a crotyl alcohol kinase, a 2-butenyl-4-phosphate kinase, a butadiene synthase and crotonyl-CoA reductase (alcohol forming);(iii) an acetyl-CoA:acetyl-CoA ...

Подробнее
Номер записи: 17
24-01-2013 дата публикации

METHOD OF AND DEVICE FOR IDENTIFYING DIRECTION OF CHARACTERS IN IMAGE BLOCK

Номер: US20130022271A1
Автор: NAOI Satoshi, Sun Jun
Принадлежит: FUJITSU LIMITED

The embodiments disclose a method of and a device for identifying direction of characters in image block. The method includes: performing optical character recognition processing on the image block by assuming various directions as assumed character directions to obtain sub image blocks, recognized characters and correctness measures in each assumed direction; in sub image blocks in the assumed directions with a 180° mutual relation, searching for a minimum matching pair; when there is one sub image block in each assumed direction in a minimum matching pair and recognized characters belonging to the minimum matching pair are the same rotation invariant character or belong to the same rotation invariant character pair, adjusting their correctness measures to the same; calculating an accumulative correctness measure in each assumed direction based on the adjusted results; and identifying the direction of the characters in the image block according to the accumulative correctness measures. 1. A method of identifying the direction of characters in an image block , comprising:performing optical character recognition processing on the image block by assuming various directions as assumed character directions, respectively, to obtain sub image blocks, recognized characters corresponding to the sub image blocks and correctness measures thereof in each of the assumed character directions;in sub image blocks in the assumed character directions with a 180° mutual relation therebetween, searching for a minimum matching pair of the sub image blocks, wherein the minimum matching pair is two sets of sub image blocks in the assumed character directions with a 180° mutual relation therebetween, which have corresponding positions, identical sizes and a minimum number of sub image blocks;when there is one sub image block in each of the two assumed character directions in a minimum matching pair and recognized characters corresponding to the two sub image blocks belonging to the ...

Подробнее
Номер записи: 18
24-01-2013 дата публикации

Method of and device for identifying direction of characters in image block

Номер: US20130022272A1
Автор: Jun Sun, SATOSHI Naoi
Принадлежит: Fujitsu Ltd

The present embodiments disclose a method of and a device for identifying the direction of characters in an image block. The method includes: performing optical character recognition processing on the image block by assuming various directions as assumed character directions, respectively, to obtain sub image blocks, recognized characters corresponding to the sub image blocks and correctness measures thereof in each of the assumed character directions; determining a language group to which the characters in the image block belong; adjusting a correctness measure corresponding to a sub image block which corresponds to a recognized character not belonging to the determined language group in each of the assumed character directions; calculating an accumulative correctness measure in each of the assumed character directions based on the adjusted correctness measure; and identifying the direction of the characters in the image block according to the accumulative correctness measures.

Подробнее
Номер записи: 19
31-01-2013 дата публикации

IMAGE PROCESSING DEVICE AND METHOD

Номер: US20130027419A1
Автор: NAOI Satoshi, Sun Jun, Zheng Danian
Принадлежит: FUJITSU LIMITED

An image processing device including: a local mean image generating section; a binarization image generating section configured to generate a binarization image, wherein pixels corresponding to high frequency regions and low frequency regions have a first and second grey scales, respectively; a ternarization image generating section configured to divide, based on comparison between the image and the local mean image, first grey scale regions in the binarization image into regions having the first grey scale and regions having a third grey scale; a filling section configured to recognize connected regions having the second grey scale in the ternarization image, to fill the connected regions with the first grey scale or with the third grey scale according to grey scale of pixels at boundaries of the connected regions; and a recognizing section configured to recognize strokes according to consistency of grey scale at object boundaries in the filled ternarization image. 1. An image processing device , comprising:a local mean image generating section configured to generate a local mean image of an image to be processed;a binarization image generating section configured to generate a binarization image of said image, where pixels corresponding to high frequency regions in said image have a first grey scale and pixels corresponding to low frequency regions in said image have a second grey scale;a ternarization image generating section configured to divide, based on comparison between said image and the local mean image, regions having the first grey scale in the binarization image into regions having the first grey scale and regions having a third grey scale, so as to generate a ternarization image of said image;a filling section configured to recognize connected regions having the second grey scale in the ternarization image, to fill the connected regions with the first grey scale when a ratio of an amount of pixels having the first grey scale to that of pixels having the ...

Подробнее
Номер записи: 20
07-02-2013 дата публикации

MICROORGANISMS FOR PRODUCING 1,4-BUTANEDIOL AND METHODS RELATED THERETO

Номер: US20130034884A1
Автор: Burgard Anthony P., Osterhout Robin E., Pharkya Priti, Sun Jun
Принадлежит: GENOMATICA, INC.

The invention provides non-naturally occurring microbial organisms comprising a 1,4-butanediol (BDO), 4-hydroxybutyryl-CoA, 4-hydroxybutanal or putrescine pathway comprising at least one exogenous nucleic acid encoding a BDO, 4-hydroxybutyryl-CoA, 4-hydroxybutanal or putrescine pathway enzyme expressed in a sufficient amount to produce BDO, 4-hydroxybutyryl-CoA, 4-hydroxybutanal or putrescine and further optimized for expression of BDO. The invention additionally provides methods of using such microbial organisms to produce BDO, 4-hydroxybutyryl-CoA, 4-hydroxybutanal or putrescine. 1. A non-naturally occurring microbial organism , comprising a microbial organism having a 1 ,4-butanediol pathway comprising at least one exogenous nucleic acid encoding a 1 ,4-butanediol pathway enzyme expressed in a sufficient amount to produce 1 ,4-butanediol; said non-naturally occurring microbial organism further comprising:(i) a reductive TCA pathway comprising at least one exogenous nucleic acid encoding a reductive TCA pathway enzyme, wherein said at least one exogenous nucleic acid is selected from an ATP-citrate lyase, a citrate lyase, a citryl-CoA synthetase, a citryl-CoA lyase, a fumarate reductase, isocitrate dehydrogenase, and an alpha-ketoglutarate:ferredoxin oxidoreductase;{'sub': '2', '(ii) a reductive TCA pathway comprising at least one exogenous nucleic acid encoding a reductive TCA pathway enzyme, wherein said at least one exogenous nucleic acid is selected from a pyruvate:ferredoxin oxidoreductase, a phosphoenolpyruvate carboxylase, a phosphoenolpyruvate carboxykinase, a CO dehydrogenase, and an Hhydrogenase; or'}{'sub': '2', '(iii) at least one exogenous nucleic acid encodes an enzyme selected from a CO dehydrogenase, an Hhydrogenase, and combinations thereof;'}wherein said 1,4-butanediol pathway comprises a pathway selected from:(a) 4-hydroxybutanoate dehydrogenase, succinyl-CoA synthetase, CoA-dependent succinic semialdehyde dehydrogenase, and α-ketoglutarate ...

Подробнее
Номер записи: 21
14-02-2013 дата публикации

Semiconductor device and method for fabricating the same

Номер: US20130037961A1
Автор: Jong-Sik Bang, Jun-Hyeub Sun, Su-Young Kim, Sung-Kwon Lee
Принадлежит: Hynix Semiconductor Inc

A semiconductor device that may prevent an unexposed substrate and generation of bowing profile during a process for forming an open region having a high aspect ratio, and a method for fabricating the semiconductor device. The semiconductor device includes a first material layer formed over a substrate, an open region formed in the first material layer that exposes the first material layer, a second material layer formed on sidewalls of the open region, wherein the second material layer is a compound material including an element of the first material layer, and a conductive layer formed inside the open region.

Подробнее
Номер записи: 22
28-02-2013 дата публикации

CLEANING DEVICE HAVING ONBOARD REPLACEABLE CLEANING PAD AND ONBOARD REPLACEABLE CLEANING SOLUTION

Номер: US20130047358A1
Автор: Huang Sun-Jun Alan, Lane Richard Lee, SCHULLER David William, Shafer Adam Robert-George, TEUFEL Rainer Bernhard, Zemskov Igor Ivanovich
Принадлежит:

A device for cleaning debris from a target surface. The device has a sole plate with permanent cleaning material, such as bristles, and a removable/replaceable pad. The device also has a replaceable, on-board supply of cleaning solution. The pad/cleaning solution may be replaced when depleted and replaced with a new pad/cleaning solution or may simply be replaced with a new pad/cleaning solution when that pad/cleaning solution is more suitable for a particular cleaning task. 1. A device for cleaning debris from a target surface and having a front , rear and a longitudinal centerline , said device comprising:a sole plate deformable in use and having a top and a bottom generally opposed thereto, said bottom of said sole plate defining a first plane and further comprising a space for removably receiving a pad thereon;a plurality of bristles extending towards the front of said device, said bristles being cantilevered from a bristle surface, said bristle surface being non-coplanar with said bottom of said sole plate;a receptacle for receiving a cleaning solution and/or a container of cleaning solution therein; andoptionally a manual actuator for dispensing cleaning solution from the container, through a nozzle and onto the target surface.2. A device for cleaning debris from a target surface , said device comprising:a resiliently deformable sole plate having a top and a bottom generally opposed thereto, said bottom of said sole plate comprising space to removably receive a pad attachable to the bottom of said sole plate;a handle joined to the top of said sole plate;a plurality of bristles cantilevered from said handle and extending downwardly towards said a target surface to be cleaned and outwardly away from said sole plate; anda receptacle for receiving a cleaning solution or a container of cleaning solution and being at least partially disposed within said handle.3. A kit comprising a device for cleaning debris from a target surface , said kit comprising:a device ...

Подробнее
Номер записи: 23
14-03-2013 дата публикации

MICROORGANISMS FOR PRODUCING METHACRYLIC ACID AND METHACRYLATE ESTERS AND METHODS RELATED THERETO

Номер: US20130065279A1
Автор: Burgard Anthony P., Burk Mark J., Osterhout Robin E., Pharkya Priti, Sun Jun
Принадлежит: GENOMATICA, INC.

The invention provides a non-naturally occurring microbial organism having a methacrylic acid, methacrylate ester, 3-hydroxyisobutyrate and/or 2-hydroxyisobutyrate pathway. The microbial organism contains at least one exogenous nucleic acid encoding an enzyme in a methacrylic acid pathway. The invention additionally provides a method for producing methacrylic acid, methacrylate ester, 3-hydroxyisobutyrate and/or 2-hydroxyisobutyrate. The method can include culturing methacrylic acid, methacrylate ester, 3-hydroxyisobutyrate and/or 2-hydroxyisobutyrate producing microbial organism, where the microbial organism expresses at least one exogenous nucleic acid encoding a methacrylic acid pathway enzyme in a sufficient amount to produce methacrylic acid, methacrylate ester, 3-hydroxyisobutyrate and/or 2-hydroxyisobutyrate, under conditions and for a sufficient period of time to produce methacrylic acid, methacrylate ester, 3-hydroxyisobutyrate and/or 2-hydroxyisobutyrate. 1. A non-naturally occurring microbial organism having a methacrylic acid pathway , said microbial organism comprising at least one exogenous nucleic acid encoding a methacrylic acid pathway enzyme expressed in a sufficient amount to produce methacrylic acid , said methacrylic acid pathway comprising a pathway selected from:(a) citramalate synthase, citramalate dehydratase (citraconate forming), and citraconate decarboxylase;(b) citramalate synthase, citramalate dehydratase (citraconate forming), citraconate isomerase, and mesaconate decarboxylase;(c) citramalate synthase, citramalate dehydratase (mesaconate forming), citraconate isomerase, and citraconate decarboxylase;(d) citramalate synthase, citramalate dehydratase (mesaconate forming), and mesaconate decarboxylase;(e) citramalyl-CoA lyase, citramalyl-CoA transferase, synthetase or hydrolase, citramalate dehydratase (citraconate forming), and citraconate decarboxylase;(f) citramalyl-CoA lyase, citramalyl-CoA transferase, synthetase or hydrolase, ...

Подробнее
Номер записи: 24
21-03-2013 дата публикации

MICROORGANISMS FOR THE PRODUCTION OF 1,4-BUTANEDIOL

Номер: US20130071886A1
Автор: Burgard Anthony P., Burk Mark J., Osterhout Robin E., Sun Jun
Принадлежит: GENOMATICA, INC.

The invention provides non-naturally occurring microbial organisms comprising a 1,4-butanediol (BDO) pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO. The invention additionally provides methods of using such microbial organisms to produce BDO. 110-. (canceled)11. A recombinant microorganism comprising nucleic acid sequences encoding polypeptides that convert 4-hydroxybutyrate (4-HB) to 4-hydroxybutanal and 4-hydroxybutanal to 1 ,4-butanediol (1 ,4-BDO) , thereby biosynthesizing 1 ,4-BDO from carbon sources provided to the recombinant microorganism.12. The recombinant microorganism of comprising nucleic acid sequences encoding polypeptides for at least one of the following pathways:(a) a pathway that converts citrate to cis-aconitate to D-isocitrate to alpha ketoglutarate to succinate semialdehyde to the 4-HB;(b) a pathway that converts acetyl-CoA to acetoacetyl-CoA to 3-hydroxybutryryl-CoA to crotonyl-CoA to vinylacetyl-CoA to 4-hydroxybutyryl-CoA to the 4-HB; or(c) a pathway that converts succinate to succinate semialdehyde (optionally including via succinyl-CoA) to the 4-HB; thereby providing 4-HB.13. A recombinant microorganism comprising a biosynthetic pathway with aconitase claim 11 , isocitrate dehydrogenase claim 11 , and alpha ketoglutarate decarboxylase enzymatic activities.14. The recombinant microorganism of additionally comprising 4-hydroxybutyrate dehydrogenase claim 13 , aldehyde dehydrogenase claim 13 , and 1 claim 13 ,3 propanediol dehydrogenase enzymatic activities.15. The recombinant microorganism of claim 13 , additionally comprising a biosynthetic pathway with acetyl-CoA acetyltransferase claim 13 , beta-hydroxybutyryl-CoA dehydrogenase claim 13 , crotonase claim 13 , vinylacetyl-CoA-isomerase claim 13 , 4-hydroxybutyryl-CoA dehydratase claim 13 , and 4-hydroxybutyrate CoA transferase enzymatic activities.16. The recombinant microorganism of claim 13 , ...

Подробнее
Номер записи: 25
18-04-2013 дата публикации

SECONDARY BATTERY

Номер: US20130095363A1
Автор: Han Moon-Hong, Kim Chang-Seob, LEE Sang-jin, Park Sang-Jin, Yong Jun-Sun
Принадлежит:

A secondary battery including an electrode assembly; a case containing the electrode assembly; a cap plate covering an opening of the case; a safety device on the cap plate; a stiffener on the safety device and holding the safety device against the cap plate; and an electrode terminal electrically connected to the electrode assembly and fixing the safety device and the stiffener to the cap plate. 1. A secondary battery comprising:an electrode assembly;a case containing the electrode assembly;a cap plate covering an opening of the case;a safety device on the cap plate;a stiffener on the safety device and holding the safety device against the cap plate; andan electrode terminal electrically connected to the electrode assembly and fixing the safety device and the stiffener to the cap plate.2. The secondary battery of claim 1 , wherein the safety device comprises a body portion claim 1 , and a first lead extending from a side of the body portion.3. The secondary battery of claim 2 , wherein the electrode terminal extends through a through-hole of the first lead and a through-hole of the stiffener and fixes the first lead and the stiffener to the cap plate by compression.4. The secondary battery of claim 2 , wherein the stiffener has a cantilever beam structure including a fixed end at a first position corresponding to the first lead claim 2 , and a free end at a second position corresponding to the body portion.5. The secondary battery of claim 4 , wherein the stiffener presses the body portion against the cap plate at the second position.6. The secondary battery of claim 4 , wherein the first position is offset with respect to a central position of the cap plate.7. The secondary battery of claim 2 , wherein the stiffener extends substantially parallel to the first lead.8. The secondary battery of claim 2 , wherein the safety device further comprises a second lead extending from another side of the body portion.9. The secondary battery of claim 8 ,wherein the cap plate ...

Подробнее
Номер записи: 26
18-04-2013 дата публикации

SECONDARY BATTERY

Номер: US20130095364A1
Автор: Kim Chang-Seob, LEE Sang-jin, Park Sang-Jin, Roh Sae-Weon, Yong Jun-Sun
Принадлежит:

A secondary battery including: an electrode assembly; a case containing the electrode assembly; a cap plate covering an opening of the case; a safety device on the cap plate and including a first lead; and an electrode terminal electrically connecting the electrode assembly and the first lead, the cap plate including a conductive member and an insulating portion, and the first lead is supported on the insulating portion, and the conductive member and the insulating portion being integrally formed. 1. A secondary battery comprising:an electrode assembly;a case containing the electrode assembly;a cap plate covering an opening of the case;a safety device on the cap plate and comprising a first lead; andan electrode terminal electrically connecting the electrode assembly and the first lead,wherein the cap plate comprises a conductive member and an insulating portion, and the first lead is supported on the insulating portion, andwherein the conductive member and the insulating portion are integrally formed.2. The secondary battery of claim 1 , wherein the electrode terminal extends through a through-hole of the first lead and a through-hole of the cap plate.3. The secondary battery of claim 2 , wherein the electrode terminal extends through the through-hole of the cap plate at a first position that is offset with respect to a central position of the cap plate.4. The secondary battery of claim 2 , wherein the insulating portion and the electrode terminal contact each other around a perimeter of the electrode terminal to seal the through-hole of the cap plate.5. The secondary battery of claim 2 , wherein the insulating portion extends through the through-hole of the cap plate and comprises a first portion extending beyond the through-hole of the cap plate on a first side of the cap plate claim 2 , and a second portion extending beyond the through-hole of the cap plate on a second side of the cap plate opposite the first side claim 2 , the first and second portions being ...

Подробнее
Номер записи: 27
02-05-2013 дата публикации

MICROORGANISMS FOR THE PRODUCTION OF 1,4-BUTANEDIOL

Номер: US20130109069A1
Автор: Burgard Anthony P., Burk Mark J., Osterhout Robin E., Sun Jun
Принадлежит: GENOMATICA, INC.

The invention provides non-naturally occurring microbial organisms comprising a 1,4-butanediol (BDO) pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO. The invention additionally provides methods of using such microbial organisms to produce BDO. 1. A non-naturally occurring microbial organism having a 1 ,4-butanediol (BDO) pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO , said BDO pathway comprising 4-aminobutyrate CoA transferase , 4-aminobutyryl-CoA hydrolase , 4-aminobutyrate-CoA ligase , 4-aminobutyryl-CoA oxidoreductase (deaminating) , 4-aminobutyryl-CoA transaminase , or 4-hydroxybutyryl-CoA dehydrogenase.2. The non-naturally occurring microbial organism of claim 1 , wherein said BDO pathway further comprises 4-hydroxybutyryl-CoA reductase (alcohol forming) claim 1 , 4-hydroxybutyryl-CoA reductase claim 1 , or 1 claim 1 ,4-butanediol dehydrogenase.34-. (canceled)54. The non-naturally occurring microbial organism of claim claim 1 , wherein said microbial organism comprises three exogenous nucleic acids encoding 4-aminobutyrate CoA transferase claim 1 , 4-aminobutyryl-CoA hydrolase claim 1 , or 4-aminobutyrate-CoA ligase; 4-aminobutyryl-CoA oxidoreductase (deaminating) or 4-aminobutyryl-CoA transaminase; and 4-hydroxybutyryl-CoA dehydrogenase.6. The non-naturally occurring microbial organism of claim 5 , wherein said BDO pathway further comprises 4-hydroxybutyryl-CoA reductase (alcohol forming) claim 5 , 4-hydroxybutyryl-CoA reductase claim 5 , or 1 claim 5 ,4-butanediol dehydrogenase.78-. (canceled)9. A method for producing BDO claim 1 , comprising culturing the non-naturally occurring microbial organism of under conditions and for a sufficient period of time to produce BDO.1011-. (canceled)12. A non-naturally occurring microbial organism having a BDO pathway comprising at least one exogenous ...

Подробнее
Номер записи: 28
16-05-2013 дата публикации

SECURITY CAMERA AND METHOD FOR CONTROLLING AUTO-FOCUSING OF THE SAME

Номер: US20130120571A1
Автор: Baek Ho, Choi Pyoung-Hwa, Jun Sun, Lee Byung-Yun, LEE Sang-min
Принадлежит: ITX Security Co., Ltd.

A security camera and a method of controlling auto-focusing of the security camera. The security camera continuously performs auto-focusing during a period of time, from the time of power-on and the start of a boot sequence until the time of completion of the camera installation, and stops the auto-focusing thereafter. Accordingly, it is possible to improve the durability of a camera mechanical system and to achieve easy installation and manipulation of the camera. 1. A security camera comprising:an initial auto-focusing (AF) setting unit configured to continuously perform auto-focusing during a predetermined period of time, from a time of power on and start of a boot sequence until a time of completion of installation of the security camera, and stop the auto-focusing after the completion of installation.2. The security camera of claim 1 , further comprising:a pan-tilt (PT)/auto-focusing (AF) setting unit configured to perform further auto-focusing in response to an PT operation.3. The security camera of claim 1 , additionally performing auto-focusing in response to a clapping sound and stopping the auto-focusing thereafter.4. A method for controlling auto-focusing of a security camera claim 1 , the method comprising:executing a boot sequence upon power-on; andperforming auto-focusing for a predetermined period of time for which the security camera is installed and stopping the auto-focusing after the installation is completed.5. The method of claim 4 , further comprising:detecting a pan-tilt operation; andperforming auto-focusing in response to the detected pan-tilt operation and stopping the auto-focusing thereafter. This application claims the benefit under 35 U.S.C. §119(a) of Korean Patent Application No. 10-2011-0118452, filed on Nov. 14, 2011, in the Korean Intellectual Property Office, the entire disclosure of which is incorporated herein by reference for all purposes.1. FieldThe following description relates to a security camera, and more particularly, to ...

Подробнее
Номер записи: 29
04-07-2013 дата публикации

MAGNETIC COMPONENT AND MANUFACTURING METHOD THEREOF

Номер: US20130169403A1
Автор: Sun Jun
Принадлежит: DELTA ELECTRONICS (SHANGHAI) CO., LTD.

A magnetic component and manufacturing method thereof are described. The manufacturing method includes the following steps: (1) coating an insulation material on the surface of a magnetic core to form an insulation magnetic core; (2) bending the conducting material into a predetermined shape to form a preformed conductive body; and (3) assembling the mold conducting body with the insulation magnetic core to form a magnetic component. The method of the present invention easily manufactures the magnetic component with a shrinkage size and good insulation characteristic between the preformed conductive body and the insulation magnetic core. 1. A manufacturing method of a magnetic component , the manufacturing method comprising the steps ofcoating an insulation material on a surface of a magnetic core to form an insulation magnetic core thereon;bending a conducting material into a predetermined shape to form a preformed conductive body; andassembling the preformed conductive body with the insulation magnetic core to form the magnetic component.2. The manufacturing method of claim 1 , wherein a surface region of the preformed conductive body is wrapped around three insulation strip layers.3. The manufacturing method of claim 1 , wherein a surface region of the preformed conductive body is covered with a casing unit.4. The manufacturing method of claim 1 , wherein a surface region of the preformed conductive body is attached by an adhesive tape.5. The manufacturing method of claim 1 , wherein a surface region of the preformed conductive body is coated by the insulation material.6. The manufacturing method of claim 1 , wherein the magnetic core comprises a lead angle portion.7. The manufacturing method of claim 1 , wherein the magnetic core is coated with the insulation material in either a uniform thickness or a non-uniform thickness.8. The manufacturing method of claim 1 , wherein the magnetic core is either wholly or partly coated with the insulation material.9. The ...

Подробнее
Номер записи: 30
18-07-2013 дата публикации

METHOD AND APPARATUS FOR CORRECTING CORNER POINT OF IMAGE AND IMAGE PROCESSING DEVICE

Номер: US20130182969A1
Автор: He Yuan, NAOI Satoshi, PAN Pan, Sun Jun
Принадлежит: FUJITSU LIMITED

The present invention discloses a method and apparatus for correcting a corner point of an image and an image processing device. The method includes: determining first candidate corner points of an initial corner point in a first local region; obtaining information related to the image in a second local region; selecting, among the first candidate corner points of the initial corner point, the first candidate corner points meeting a predetermined condition, as second candidate corner points of the initial corner point according to the information; and correcting the initial corner point using the second candidate corner points of the initial corner point. The apparatus is configured to perform the processes of the method. The image processing device includes the apparatus for correcting a corner point of an image. With the technology, a roughly detected corner point can be corrected. 1. A method for correcting a corner point of an image , comprising:with regard to each initial corner point of the image, determining first candidate corner points of the initial corner point in a first local region that contains the initial corner point, wherein the first local region has a first predetermined size;with regard to each initial corner point of the image, obtaining information related to the image in a second local region that contains the initial corner point, wherein the second local region has a second predetermined size and contains the first local region;selecting, among the first candidate corner points of each initial corner point, first candidate corner points which meet a predetermined condition, as second candidate corner points of the initial corner point according to the obtained information related to the image; andcorrecting each initial corner point using the second candidate corner points of the initial corner point.2. The method for correcting a corner point of an image according to claim 1 , wherein the determining first candidate corner points of the ...

Подробнее
Номер записи: 31
08-08-2013 дата публикации

CONDUCTIVE WIRE FOR TRANSFORMER AND MAGNETIC ELEMENT IN SWITCH POWER SUPPLY

Номер: US20130200973A1
Автор: Sun Jun
Принадлежит: DELTA ELECTRONICS (SHANGHAI) CO., LTD.

The present invention relates to a conductive wire for a transformer and a magnetic element in a switch power supply, the magnetic element comprises a transformer and a filter, the transformer comprises a winding base and a coil, the winding base comprises two base bodies and a cylinder locating between the two base bodies, the coil is formed by winding a plurality of the conductive wires in parallel on the cylinder, the conductive wire comprises a conductor and an insulator directly covering an outer periphery of the conductor, a profile of a section of the insulator is a rectangle, a surface contact is formed between the adjacent conductive wires provided in parallel on the cylinder via the profiles of the rectangle sections of the adjacent insulators, and a contact surface forming the surface contact is perpendicular to an axial line of the cylinder. 1. A conductive wire for a transformer , the transformer comprising a winding base and a coil , the winding base including two base bodies and a cylinder locating between the two base bodies , the coil being formed by winding a plurality of the conductive wires in parallel on the cylinder , the conductive wire having a conductor and an insulator directly covering an outer periphery of the conductor , wherein a profile of a section of the insulator is a rectangle , a surface contact is formed between the adjacent conductive wires provided in parallel on the cylinder via the profiles of the rectangle sections of the adjacent insulators , and a contact surface forming the surface contact is perpendicular to an axial line of the cylinder.2. The conductive wire for the transformer according to claim 1 , wherein the conductive wires are distributed on the whole cylinder along an axial direction of the cylinder.3. The conductive wire for the transformer according to claim 1 , wherein the coils has a plurality of layers claim 1 , a surface contact is formed between the corresponding conductive wires along a corresponding row ...

Подробнее
Номер записи: 32
15-08-2013 дата публикации

System and Method for Mass Production and Sale of Configurable and Personalized Tablet Computers

Номер: US20130211874A1
Автор: Bo Wu, Jun Sun, Yuhong Xiong
Принадлежит: Lashou Group Inc

A method to mass produce and sell electronic devices using open architecture manufacturing model and group-buying business model is provided. A group-buying company receives a plurality of offers to buy electronic devices from a plurality of consumers, and each offer is associated with a minimum requirement for each corresponding electronic device. The group-buying company determines one or more final device configurations of a plurality of electronic devices that satisfies the minimum requirements of all the offers, and all the electronic devices are substantially identical to be sold to the plurality of consumers as a group-buying deal. The group-buying company then arranges a single run of the identical electronic devices to be mass produced by a third entity. Finally, the group-buying company supplies the identical electronic devices to each of the plurality of consumers.

Подробнее
Номер записи: 33
05-09-2013 дата публикации

CURRENT INTERRUPTING DEVICE AND SECONDARY BATTERY USING THE SAME

Номер: US20130230745A1
Автор: Han Moon-Hong, Kim Chang-Seob, LEE Sang-jin, Yong Jun-Sun
Принадлежит: SAMSUNG SDI CO., LTD.,

A current interrupting device and a secondary battery including the same. The current interrupting device includes a thermal fuse; a pair of conductive plates that are respectively connected to two opposite ends of the thermal fuse; and a sealing member which surrounds and seals the thermal fuse, wherein each of the conductive plates includes a connecting unit which is connected to the thermal fuse, and wherein at least one of the pair of conductive plates includes a deformation inducing unit which is arranged close to the connecting unit and has a smaller cross-sectional area than a cross-sectional area of the connecting unit. 1. A current interrupting device , comprising:a thermal fuse;a pair of conductive plates respectively connected to two opposite ends of the thermal fuse; anda sealing member that surrounds and seals the thermal fuse, wherein each of the conductive plates comprises a connecting unit that is connected to the thermal fuse, and wherein at least one of the pair of conductive plates comprises a deformation inducing unit that is arranged adjacent to the connecting unit and has a smaller cross-sectional area than a cross-sectional area of the connecting unit.2. The current interrupting device of claim 1 , wherein the cross-sectional area of the deformation inducing unit is from about 30% to about 50% of the cross-sectional area of the connecting unit.3. The current interrupting device of claim 1 , wherein the deformation inducing unit comprises a notch arranged in a widthwise direction of the current interrupting device.4. The current interrupting device of claim 1 , wherein the deformation inducing unit comprises a notch arranged in a thickness-wise direction of the current interrupting device.5. The current interrupting device of claim 1 , wherein a thickness of the connecting unit and a thickness of the deformation inducing unit are smaller than a thickness of a body unit arranged opposite from the connecting unit of the conductive plate.6. The ...

Подробнее
Номер записи: 34
03-10-2013 дата публикации

IMAGE PROCESSING DEVICE, IMAGE PROCESSING METHOD AND APPARATUS

Номер: US20130259385A1
Автор: He Yuan, NAOI Satoshi, Sun Jun, Xie Shufu, YU Hao
Принадлежит: FUJITSU LIMITED

The present invention provides an image processing device, an image processing method and an apparatus so as to improve at least the precision of extracting document corners in image processing performed on an image captured for a document. The image processing device includes: an extracting unit for extracting boundaries of a document in a first direction and roughly-detected document corners, where the first direction is a horizontal direction or a vertical direction of the document image; a determining unit for determining candidate page corners on the boundaries in the first direction around the roughly-detected document corners; and a selecting unit for determining document corners of the document among the candidate page corners. With the foregoing technology of the invention, more precise document corners can be extracted, a better effect of image processing can be obtained, and applications in the field of image processing are possible. 1. An image processing device , comprising:an extracting unit configured to extract boundaries of a document in a first direction and roughly-detected document corners of the document in a document image captured for the document;a determining unit configured to determine candidate page corners of the document on the boundaries of the document in the first direction around the roughly-detected document corners; anda selecting unit configured to select the candidate page corners with the closest intra-page area pixel feature to a page corner pixel feature of the document among the candidate page corners as document corners of the document,wherein the first direction is a horizontal direction or a vertical direction of the document image.2. The image processing device according to claim 1 , wherein the extracting unit comprises:a first processing sub-unit configured to obtain a foreground area of the document image in a global binarization method to obtain edges of the foreground area and to determine intersections between the ...

Подробнее
Номер записи: 35
10-10-2013 дата публикации

Auxiliary device for mounting nail deformity correction device and nail deformity correction device mounted on a nail by the same

Номер: US20130267879A1
Автор: Dong Jun Sun
Принадлежит: GD Korea Co Ltd

There are provided an auxiliary device for mounting nail deformity correction device and a nail deformity correction device mounted on a nail by the same. The auxiliary device includes a resilient block that is placed in parallel with a finger and toe nail in a longitudinal direction of the finger and toe nail, and has elasticity to be elastically contracted and restored in a width direction of the finger and toe nail, and a pair of parallel protrusions that protrudes from an end of the resilient block to be inserted into an inside of the finger and toe nail, and is spaced apart from each other at a predetermined distance in the width direction of the finger and toe nail.

Подробнее
Номер записи: 36
17-10-2013 дата публикации

METHOD AND APPARATUS FOR PROCESSING SCANNED IMAGE

Номер: US20130272602A1
Автор: He Yuan, NAOI Satoshi, Sun Jun
Принадлежит: FUJITSU LIMITED

The present invention relates to a method and apparatus for processing a scanned image. The method for processing a scanned image comprises: a shaded region extracting step of extracting a region, which is shaded by a shading object and lies in a margin in the vicinity of an edge of the scanned image, as a shaded region; and a pixel value repairing step of repairing values of pixels, which lie both in a line segment and the shaded region, by using a linear model according to known values of pixels, which lie both in the line segment and the margin, the line segment passing through the shaded region and being parallel to the edge. 1. A method for processing a scanned image , comprising:a shaded region extracting step of extracting a region, which is shaded by a shading object and lies in a margin in the vicinity of an edge of the scanned image, as a shaded region; anda pixel value repairing step of repairing values of pixels, which lie both in a line segment and the shaded region, by using a linear model according to known values of pixels, which lie both in the line segment and the margin, the line segment passing through the shaded region and being parallel to the edge.2. The method according to claim 1 , further comprising:estimating noises of pixels, which lie both in a line segment and the shaded region, according to values of known noises of pixels, which lie both in the line segment and the margin, the line segment passing through the shaded region and being parallel to the edge; andadding the estimated noises to the values of the pixels which lie both in the line segment and the shaded region.3. The method according to claim 1 , wherein the shaded region extracting step comprises:providing a point in the shaded region;estimating a central value of pixels in a small window around the point;calculating a difference between the central value and a value of each of pixels in a big window around the point; andextracting the shaded region according to the ...

Подробнее
Номер записи: 37
24-10-2013 дата публикации

Secure and Authenticated Transactions with Mobile Devices

Номер: US20130278622A1
Автор: Sun Jun, Zhou Dong
Принадлежит: Netspectrum Inc.

Embodiments of the invention include a platform for using 2D barcodes to establish secure authenticated communication between two computing devices that are in proximity to each other. A two-tier application architecture using a single base app and dynamic add-on applets is used. 2D barcodes can be distinctively visually branded. According to other aspects, the security of mobile payment systems are enhanced by (1) a triangular payment settlement in which the sender and receiver of payment each submit transaction information independently to the same payment server; (2) sensitive information is split into two parts, one of which is stored on a mobile device, and the other of which is stored on a payment server, and the two parts are only combined and exist transiently in the payment server's volatile memory when executing a transaction; and (3) a process to securely update profile pictures associated with payment accounts. 1. A method of establishing communication between two computing devices in proximity , the method comprising displaying a barcode on a screen of a displayer device , the barcode including encoded routing information to enable a scanner device to communicate with the displayer device via a communication network.2. The method of claim 1 , wherein the barcode further comprises a security token for authenticating the displayer device.3. The method of claim 1 , wherein the barcode further comprises a security token for authenticating the scanner device.4. A method of establishing communication between two computing devices in proximity claim 1 , the method comprising:scanning a barcode displayed on a screen of a displayer device, the barcode including encoded routing information to enable a scanner device to communicate with the displayer device via a communication network;decoding the encoded routing information;contacting the displayer device via the communication network using the decoded routing information; andreceiving subsequent communication ...

Подробнее
Номер записи: 38
07-11-2013 дата публикации

IMAGE PROCESSING METHOD AND APPARATUS

Номер: US20130294696A1
Автор: NAOI Satoshi, PAN Yifeng, Sun Jun
Принадлежит: FUJITSU LIMITED

An image processing method and apparatus is provided. The image processing method includes steps of: generating a first scale binary image from an image, wherein the first scale is smaller than the original scale of the image; detecting at least one text line in the image based on the first scale binary image; generating a second scale binary image from the image, wherein the second scale is larger than the first scale; for each text line, calculating a similarity between corresponding sections in the first scale binary image and the second scale binary image, and removing the text line for which the similarity is lower than a predetermined level; for one or more of the remaining text line(s), performing OCR on corresponding section(s) in the second scale binary image to determine character orientation(s) of corresponding text line(s); and determining the orientation of the image according to the determined character orientation(s). 1. An image processing method , comprising steps of:generating a first scale binary image from an image, wherein the first scale is smaller than the original scale of the image;detecting at least one text line in the image based on the first scale binary image;generating a second scale binary image from the image, wherein the second scale is larger than the first scale;for each text line, calculating a similarity between a corresponding section in the first scale binary image and a corresponding section in the second scale binary image, and removing the text line for which the similarity is lower than a predetermined level as noise;for one or more of the remaining text line(s), performing optical character recognition on corresponding section(s) in the second scale binary image to determine character orientation(s) of corresponding text line(s); anddetermining the orientation of the image according to the character orientation(s).2. The method according to claim 1 , wherein prior to the step of determining the character orientation(s) ...

Подробнее
Номер записи: 39
05-12-2013 дата публикации

Document Processing Apparatus, Document Processing Method and Scanner

Номер: US20130322757A1
Автор: He Yuan, NAOI Satoshi, PAN Yifeng, Sun Jun
Принадлежит:

The disclosure provides a document processing apparatus, method and a scanner. The document processing apparatus includes: a text line extraction unit extracting a text line from an input document; a language classification unit determining whether an OCR process is necessary for a language of the input document; an OCR unit determining, by performing the OCR process, an OCR confidence in the case that it is determined that the OCR process is necessary; an graphic feature recognition unit determining an graphic feature recognition confidence; and a determination unit determining a combination confidence based on at least one of the determined graphic feature recognition confidences and the determined OCR confidences, and determining an orientation of the input document based on the combination confidences. This technical solution can determine better an orientation of the document, and is especially applicable when the quality of the image of the document is deteriorated. 1. A document processing apparatus , comprising:a text line extraction unit configured to extract at least one text line from an input document;a language classification unit configured to determine, by performing an graphic feature recognition process, whether or not an optical character recognition process is necessary for a language of the input document;an optical character recognition unit configured to determine, by performing the optical character recognition process, an optical character recognition confidence with respect to each candidate direction for each of at least some of the text lines, in the case that it is determined that the optical character recognition process is necessary for the language of the input document;an graphic feature recognition unit configured to determine, by performing the graphic feature recognition processing, an graphic feature recognition confidence with respect to each candidate direction for each text lines; anda determination unit configured to determine ...

Подробнее
Номер записи: 40
05-12-2013 дата публикации

BOUNDARY EXTRACTION METHOD AND APPARATUS

Номер: US20130322768A1
Автор: He Yuan, NAOI Satoshi, Sun Jun
Принадлежит:

The present invention discloses a boundary extraction method and apparatus, the method including: a gradient estimation step of estimating a gradient of each pixel in a captured image; a gradient adjustment step of adjusting, by enhancing a gradient of a target boundary of an object contained in the captured image and weakening a gradient of a noise boundary, the estimated gradient, so that the adjusted gradient is considered as a current gradient; and a boundary extraction step of extracting a boundary of the object based on the current gradient. According to the embodiments of the invention, in a case of using a non-contact imaging device to capture an image, it is possible to more accurately extract a boundary of an object contained in the captured image. 1. A boundary extraction method , comprising:a gradient estimation step of estimating a gradient of each pixel in a captured image;a gradient adjustment step of adjusting, by enhancing a gradient of a target boundary of an object contained in the captured image and weakening a gradient of a noise boundary, the estimated gradient, so that the adjusted gradient is considered as a current gradient; anda boundary extraction step of extracting a boundary of the object based on the current gradient.2. The method according to claim 1 , wherein in the gradient adjustment step claim 1 , the estimated gradient is weighed with a weight determined based on a gradient difference between two predetermined adjacent regions of each pixel point claim 1 , thus enhancing the gradient of the target boundary and weakening the gradient of the noise boundary.3. The method according to claim 2 , wherein the weight TB is determined based on the following formula:{'br': None, 'i': TB=D', 'D, 'sub': t', 'b, '/(+ε)'}{'sub': t', 't', 't', 'b', 'b', 'b', 't', 'b', '1', 't', 'b', 'b', 't', 'b, 'wherein D=max{f(N)}−min{f(N)}, D=max{f(N)}−min{f(N)}, Nand Nrepresent the two predetermined adjacent regions of each pixel point, Drepresents a ...

Подробнее
Номер записи: 41
05-12-2013 дата публикации

Image Processing Device, Image Processing Method, Scanner and Storage Medium

Номер: US20130322769A1
Автор: He Yuan, NAOI Satoshi, PAN Pan, Sun Jun
Принадлежит: FUJITSU LIMITED

The disclosure provides an image processing device, image processing method, scanner and storage medium. The image processing device is used for tracing a boundary of an object image in an image, the boundary being continuous and the rate of change in slope between adjacent points on the boundary being slow. The image processing device includes: a boundary estimation unit, adapted to estimate the location of the boundary of the object image; an interfering gradient processing unit, adapted to process an interfering gradient near the estimated boundary, so as to reduce the interfering gradient or remove the interfering gradient from the image; and a boundary tracing unit, adapted to trace the boundary in the image having the interfering gradient processed. By using the technique of the disclosure, the accuracy of tracing a boundary of an image is improved significantly. 1. An image processing device for tracing a boundary of an object image in an image , the boundary being continuous and the rate of change in slope between adjacent points on the boundary being slow , the image processing device comprising:a boundary estimation unit, adapted to estimate the location of the boundary of the object image;an interfering gradient processing unit, adapted to process an interfering gradient near the estimated boundary, so as to reduce the interfering gradient or remove the interfering gradient from the image; anda boundary tracing unit, adapted to trace the boundary in the image having the interfering gradient processed.2. The image processing device according to claim 1 , wherein the boundary estimation unit comprises:a segmentation unit, adapted to segment a portion of the image between two corners on the boundary into a predetermined number of segments; anda segment boundary estimation unit, adapted to estimate the location of the boundary respectively in each of the segments.3. The image processing device according to claim 2 , wherein the segment boundary estimation ...

Подробнее
Номер записи: 42
12-12-2013 дата публикации

SEMICONDUCTOR DEVICE WITH MULTI-LAYERED STORAGE NODE AND METHOD FOR FABRICATING THE SAME

Номер: US20130328196A1
Автор: KIM Su-Young, Lee Sang-oh, Sun Jun-Hyeub
Принадлежит:

A method for fabricating a semiconductor device includes forming a first dielectric structure over a second region of a substrate to expose a first region of the substrate, forming a barrier layer over an entire surface including the first dielectric structure, forming a second dielectric structure over the barrier layer in the first region, forming first open parts and second open parts in the first region and the second region, respectively, by etching the second dielectric structure, the barrier layer and the first dielectric structure, forming first conductive patterns filled in the first open parts and second conductive patterns filled in the second open parts, forming a protective layer to cover the second region, and removing the second dielectric structure. 1. A method for fabricating a semiconductor device , comprising:forming a first dielectric structure over a second region of a substrate to expose a first region of the substrate;forming a barrier layer over an entire surface including the first dielectric structure;forming a second dielectric structure over the barrier layer in the first region;forming first open parts and second open parts in the first region and the second region, respectively, by etching the second dielectric structure, the barrier layer and the first dielectric structure;forming first conductive patterns filled in the first open parts and second conductive patterns filled in the second open parts;forming a protective layer to cover the second region; andremoving the second dielectric structure.2. The method of claim 1 , wherein the forming of the first dielectric structure comprises:forming an etch stop layer over the substrate;forming a first dielectric layer over the etch stop layer;forming a first mask over the first dielectric layer to cover the second region; andetching the first dielectric layer and the etch stop layer using the first mask as an etch barrier to form a recess in the first region.3. The method of claim 1 , ...

Подробнее
Номер записи: 43
12-12-2013 дата публикации

APPARATUS, METHOD FOR EXTRACTING BOUNDARY OF OBJECT IN IMAGE, AND ELECTRONIC DEVICE THEREOF

Номер: US20130330009A1
Автор: He Yuan, NAOI Satoshi, PAN Pan, Sun Jun
Принадлежит:

The invention provides an apparatus and method for extracting a boundary of an object in an image and an electronic device. The apparatus includes: a position determining unit, configured to determine a start point and an end point of a boundary of an object in an image and to determine a position of a reference point relevant to the start point and the end point; a first direction determining unit, configured to determine a first direction of the boundary; a gradient map obtaining unit, configured to obtain a gradient map of a first region; a gradient attenuating unit, configured to attenuate in the gradient map the gradients of a second region; and an extracting unit, configured to extract a boundary of an object. The technology of the invention can improve the accuracy of boundary extracting, and can be applied in the field of image processing. 1. An apparatus for extracting a boundary of an object in an image , comprising:a position determining unit, configured to determine a start point and an end point of the boundary of the object in the image and to determine a position of a reference point relevant to the start point and the end point;a first direction determining unit, configured to determine a first direction of the boundary;a second direction determining unit, configured to determine a second direction intersecting the first direction;a gradient map obtaining unit, configured to determine in the image a first region comprising the start point, the end point and the reference point and to obtain a gradient map of the first region;a gradient attenuating unit, configured to determine at least one second region on at least one of two sides of the reference point along the second direction and to attenuate in the gradient map the gradients of the second region; andan extracting unit, configured to extract a boundary between the start point and the end point based on the attenuated gradient map to obtain the boundary of the object.2. The apparatus for ...

Подробнее
Номер записи: 44
19-12-2013 дата публикации

MASK PATTERN FOR HOLE PATTERNING AND METHOD FOR FABRICATING SEMICONDUCTOR DEVICE USING THE SAME

Номер: US20130337652A1
Автор: Lee Sang-oh, LEE Sung-Kwon, Sun Jun-Hyeub
Принадлежит:

A method for fabricating a semiconductor device includes forming an etching target layer over a substrate including a first region and a second region; forming a hard mask layer over the etching target layer; forming a first etch mask over the hard mask layer, wherein the first etch mask includes a plurality of line patterns and a sacrificial spacer layer formed over the line patterns; forming a second etch mask over the first etch mask, wherein the second etch mask includes a mesh type pattern and a blocking pattern covering the second region; removing the sacrificial spacer layer; forming hard mask layer patterns having a plurality of holes by etching the hard mask layer using the second etch mask and the first etch mask; and forming a plurality of hole patterns in the first region by etching the etching target layer using the hard mask layer patterns. 1. A mask pattern suitable for patterning holes in a cell matrix region , the mask pattern comprising:a plurality of lower level line patterns formed over a hard mask layer;a plurality of upper level line patterns extending in a direction crossing with the lower level line patterns, wherein the plurality of upper level line patterns are located at a vertically higher level than the plurality of lower level line patterns; anda blocking pattern covering an edge region of the cell matrix region.2. The mask pattern according to claim 1 , wherein the lower level line patterns comprise a plurality of first line patterns alternately disposed with a plurality of second line patterns claim 1 , and the upper level line patterns comprise third line patterns contacting the second line patterns and extending in a direction crossing with the first line patterns over the first and second line patterns.3. The mask pattern according to claim 2 , wherein the first line patterns claim 2 , the second line patterns claim 2 , the third line patterns and the blocking pattern each comprise a carbon-containing layer.4. The mask pattern ...

Подробнее
Номер записи: 45
09-01-2014 дата публикации

METHODS FOR INCREASING PRODUCT YIELDS

Номер: US20140011249A1
Автор: Burgard Anthony P., Osterhout Robin E., Pharkya Priti, Sun Jun
Принадлежит: GENOMATICA, INC.

A non-naturally occurring microbial organism includes a microbial organism having a reductive TCA or Wood-Ljungdahl pathway in which at least one exogenous nucleic acid encoding these pathway enzymes is expressed in a sufficient amount to enhance carbon flux through acetyl-CoA. A method for enhancing carbon flux through acetyl-CoA includes culturing theses non-naturally occurring microbial organisms under conditions and for a sufficient period of time to produce a product having acetyl-CoA as a building block. Another non-naturally occurring microbial organism includes at least one exogenous nucleic acid encoding an enzyme expressed in a sufficient amount to enhance the availability of reducing equivalents in the presence of carbon monoxide or hydrogen, thereby increasing the yield of redox-limited products via carbohydrate-based carbon feedstock. A method for enhancing the availability of reducing equivalents in the presence of carbon monoxide or hydrogen includes culturing this organism for a sufficient period of time to produce a product. 1. A non-naturally occurring microbial organism having a reductive TCA pathway , wherein said microbial organism comprises at least one exogenous nucleic acid encoding a reductive TCA pathway enzyme expressed in a sufficient amount to enhance carbon flux through acetyl-CoA , wherein said at least one exogenous nucleic acid is selected from an ATP-citrate lyase , citrate lyase , a fumarate reductase , and an alpha-ketoglutarate:ferredoxin oxidoreductase.27.-. (canceled)8. The non-naturally occurring microbial organism of further comprising an exogenous nucleic acid encoding an enzyme selected from a pyruvate:ferredoxin oxidoreductase claim 1 , an aconitase claim 1 , an isocitrate dehydrogenase claim 1 , a succinyl-CoA synthetase claim 1 , a succinyl-CoA transferase claim 1 , a fumarase claim 1 , a malate dehydrogenase claim 1 , an acetate kinase claim 1 , a phosphotransacetylase claim 1 , an acetyl-CoA synthetase claim 1 , an NAD ...

Подробнее
Номер записи: 46
06-02-2014 дата публикации

CAP ASSEMBLY, BATTERY PACK INCLUDING THE SAME, AND METHOD OF MANUFACTURING THE BATTERY PACK

Номер: US20140038031A1
Автор: Lee Hyun-Wook, LEE Sang-jin, Trofimoy Yuny, Yong Jun-Sun
Принадлежит: Samsung SDI Co., Ltd.

A cap assembly includes a protective circuit module; and an injection molded upper cap integral with the protective circuit module and configured to be coupled to an opening of a can housing an electrode assembly, wherein the upper cap comprises sealing portions that extend in a first direction away from the protective circuit module, and wherein the sealing portions are configured to contact an inner surface of the can. 1. A cap assembly comprising:a protective circuit module; andan injection molded upper cap integral with the protective circuit module and configured to be coupled to an opening of a can housing an electrode assembly, wherein the upper cap comprises sealing portions that extend in a first direction away from the protective circuit module, and wherein the sealing portions are configured to contact an inner surface of the can.2. The cap assembly of claim 1 , further comprising at least one connection tab that is electrically connected to the protective circuit module claim 1 , wherein the upper cap surrounds the protective circuit module and at least a portion of the connection tab.3. The cap assembly of claim 2 , wherein the connection tab extends in the first direction claim 2 , and an end of the connection tab is exposed from the upper cap.4. The cap assembly of claim 2 , further comprising a temperature element located between the protective circuit module and the connection tab.5. The cap assembly of claim 1 , wherein an electrolyte inlet penetrating the upper cap is located on the upper cap claim 1 , and wherein the electrolyte inlet is closed by a stopper.6. A battery pack comprising:a can having an opening;an electrode assembly accommodated in the can; and a protective circuit module; and', 'an injection molded upper cap integral with the protective circuit module and coupled to the can, wherein the upper cap comprises sealing portions that extend in a first direction away from the protective circuit module, and wherein the sealing portions ...

Подробнее
Номер записи: 47
20-02-2014 дата публикации

USER ACCOUNT RECOVERY

Номер: US20140053251A1
Автор: Chen You Lei, LIU Jin, Sun Shao Jun
Принадлежит: NOKIA SIEMENS NETWORKS OY

A user account recovery method is described. The method includes storing an account recovery token at both an identity management system (IDM) and a service provider. In response to an indication that a user cannot access an account, a request for the account recovery token is sent by the relevant service provider to the IDM. On confirming the identity of the user, the IDM retrieves the account recovery token and returns the token to the service provider. The service provider compares the token received from the IDM with one or more locally stored tokens to initiate an account recovery process (which process may, for example, include prompting the user to provide a new password for the account). 1. A method comprising:receiving, at a service provider, an account recovery request;sending a request for a first account recovery token to an identity management system;receiving the first account recovery token from said identity management system;comparing the received first account recovery token with one or more second account recovery tokens to which the service provider has access; andin the event that one of said one or more second account recovery tokens matches said first account recovery token, recovering a user account associated with said one of said one or more second account recovery tokens.2. A method as claimed in claim 1 , wherein recovering the user account comprises prompting the user to reset a credential for the user account.3. A method as claimed in claim 1 , wherein recovering the user account comprises informing the user of at least some credentials for the user account.4. A method as claimed in claim 1 , further comprising prompting the user to identify the identity management system.5. A method as claimed in any preceding claim 1 , wherein the account recovery request is initiated by a user.6. A method as claimed in claim 5 , wherein the request for a first account recovery token identifies the said user.7. A method as claimed in claim 5 , wherein ...

Подробнее
Номер записи: 48
27-02-2014 дата публикации

SEMICONDUCTOR DEVICE WITH SILICON-CONTAINING HARD MASK AND METHOD FOR FABRICATING THE SAME

Номер: US20140057442A1
Автор: JUNG Young-Kyun, LEE Sung-Kwon, Sun Jun-Hyeub
Принадлежит: SK HYNIX INC.

A semiconductor device includes a semiconductor substrate having an etch target layer provided on the surface thereof, and a hard mask layer formed over the etch target layer and including silicon, wherein the hard mask layer includes a dual structure including a first area and a second area having a larger etch rate than the first area, in order to increase an etching selectivity of the hard mask layer. 1. A semiconductor device comprising:a semiconductor substrate having an etch target layer provided on the surface thereof; anda hard mask layer formed over the etch target layer and including silicon,wherein the hard mask layer comprises a dual structure including a first area and a second area having a larger etch rate than the first area, in order to increase an etching selectivity of the hard mask layer.2. The semiconductor device of claim 1 , wherein the second area including an impurity is formed over the first area in the hard mask layer.3. The semiconductor device of claim 1 , wherein the second area comprises boron4. The semiconductor device of claim 1 , wherein the first area comprises an undoped polysilicon layer claim 1 , and the second area comprises a boron-doped polysilicon layer.5. The semiconductor device of claim 4 , wherein the doping concentration of boron in the boron-doped polysilicon layer has a range of about 1×10atoms/cmto 1×10atoms/cm.6. The semiconductor device of claim 1 , wherein the second area has a smaller thickness than the first area.7. A method for fabricating a semiconductor device claim 1 , comprising:forming an etch target layer over a semiconductor substrate;forming a silicon-containing layer over the etch target layer, the silicon-containing layer comprising a first area and a second area formed over the first area and having a smaller etch rate than the first area;patterning the silicon-containing layer; andetching the etch target layer using the patterned silicon-containing layer as an etch barrier.8. The method of claim 7 , ...

Подробнее
Номер записи: 49
02-01-2020 дата публикации

MULTI-KEY, CLOUD-SPECIFIC SECURITY

Номер: US20200004983A1
Автор: Chen Hongqiang, Chen Wei, Sun Jun
Принадлежит:

Techniques disclosed herein encrypt sensitive data being transmitted from one endpoint to another endpoint through intermediary cloud(s) so that the sensitive data is not visible to the intermediary cloud(s). Double data encryption, utilizing public and private key pairs generated at the endpoints, is used to anonymize the sensitive data, while other data transmitted along with the sensitive data remains unencrypted so that intermediary cloud(s) can process the unencrypted data. In a particular embodiment, one of the endpoints is an application running in a first cloud, the other endpoint is a web browser executing a web application, and the intermediary cloud(s) are additional cloud(s) with applications running therein that provide services to the first cloud or coordinate with the application running in the first cloud to provide a service. 1. A computer-implemented method performed by a first endpoint to transmit first and second data to a second endpoint via at least one cloud , the method comprising:receiving, from the second endpoint, a first public key;encrypting the first data using the first public key; andtransmitting the encrypted first data along with the second data that is not encrypted via the at least one cloud to the second endpoint,wherein the second data that is not encrypted is processed in the at least one cloud.2. The method of claim 1 , wherein the first data includes personally identifiable information.3. The method of claim 2 , wherein the personally identifiable information includes at least one of a name of a user claim 2 , a name of an enterprise claim 2 , a physical address of a user claim 2 , a physical address of an enterprise claim 2 , an e-mail address of a user claim 2 , an e-mail address of an enterprise claim 2 , a user age claim 2 , or a user gender.4. The method of claim 1 , wherein:the second data includes resource usage information; andthe processing of the second data in the at least one cloud includes at least one of ...

Подробнее
Номер записи: 50
14-01-2016 дата публикации

Hybrid Automobile and Power System Torque Control Method Thereof

Номер: US20160009269A1
Автор: Deng Xiaoguang, Sun Jun, Zhang Pengjun, Zhou Yuxing, ZHU Jun
Принадлежит:

A hybrid system torque control method and hybrid automobile using same, the method comprising the following steps: (1) analyzing the torque required by a driver; (2) allocating and coordinating the multiple-source torque. The method ensures a consistent driving feel within the range of real-time power source torque capacity, and facilitates hybrid system matching. 1. A hybrid power-train torque control method , power source components of the power-train including an engine and a motor , characterized in that the method comprises steps of: (1a) calculating a maximum torque achievable from the power-train;', "(1b) calculating a power-train load rate according to driver's instruction; and", '(1c) calculating the torque requirement based on the maximum torque and the power-train load rate; and, "(1) interpreting driver's torque requirement, including:"} (2a) distributing the torque requirement between the power sources, to obtain at least an engine pre-distributed torque for the engine and a motor pre-distributed torque for the motor; and', '(2b) acquiring an output torque of the engine in real time, calculating the difference between the output torque and the engine pre-distributed torque, and compensating the difference with the motor., '(2) torque distributing and coordinating between the power sources, including2. The hybrid power-train torque control method according to claim 1 , characterized in that: parameters information on the power source components of the current power-train and parameters information on an energy storage of the current power-train are acquired prior to calculating the maximum torque.3. The hybrid power-train torque control method according to claim 1 , characterized in that: the maximum torque is calculated in all operation modes.4. The hybrid power-train torque control method according to claim 1 , characterized in that: the power-train load rate is obtained by measuring accelerator pedal opening claim 1 , acquiring signals pertaining to ...

Подробнее
Номер записи: 51
27-01-2022 дата публикации

MICROORGANISMS AND METHODS FOR THE BIOSYNTHESIS OF BUTADIENE

Номер: US20220025411A1
Автор: Burgard Anthony P., Burk Mark J., Osterhout Robin E., Pharkya Priti, Sun Jun
Принадлежит:

The invention provides non-naturally occurring microbial organisms having a butadiene pathway. The invention additionally provides methods of using such organisms to produce butadiene. 1. A non-naturally occurring microbial organism , comprising a microbial organism having a butadiene pathway comprising at least one exogenous nucleic acid encoding a butadiene pathway enzyme expressed in a sufficient amount to produce butadiene , said butadiene pathway comprising a butadiene synthase , an acetyl-CoA:acetyl-CoA acyltransferase , an acetoacetyl-CoA reductase , a 3-hydroxybutyryl-CoA dehydratase , a crotonyl-CoA reductase (aldehyde forming) , a crotonaldehyde reductase (alcohol forming) , a crotyl alcohol kinase , a 2-butenyl-4-phosphate kinase , a crotonyl-CoA hydrolase , synthetase , or transferase , a crotonate reductase , a crotonyl-CoA reductase (alcohol forming) , a glutaconyl-CoA decarboxylase , a glutaryl-CoA dehydrogenase , an 3-aminobutyryl-CoA deaminase , a 4-hydroxybutyryl-CoA dehydratase or a crotyl alcohol diphosphokinase.2. The non-naturally occurring microbial organism of claim 1 , wherein said microbial organism comprises two exogenous nucleic acids each encoding a butadiene pathway enzyme.3. The non-naturally occurring microbial organism of claim 1 , wherein said microbial organism comprises three exogenous nucleic acids each encoding a butadiene pathway enzyme.4. The non-naturally occurring microbial organism of claim 1 , wherein said microbial organism comprises four exogenous nucleic acids each encoding a butadiene pathway enzyme.5. The non-naturally occurring microbial organism of claim 1 , wherein said butadiene pathway comprises an acetyl-CoA:acetyl-CoA acyltransferase claim 1 , an acetoacetyl-CoA reductase claim 1 , a 3-hydroxybutyryl-CoA dehydratase claim 1 , a crotonyl-CoA reductase (aldehyde forming) claim 1 , a crotonaldehyde reductase (alcohol forming) claim 1 , a crotyl alcohol kinase claim 1 , a 2-butenyl-4-phosphate kinase and a ...

Подробнее
Номер записи: 52
09-01-2020 дата публикации

METHODS FOR DIAGNOSING AND TREATING COLORECTAL CANCER

Номер: US20200010895A1
Автор: Sun Jun
Принадлежит:

A method for identifying a subject having at least an indication or predisposition for developing inflammatory bowel disease or colorectal cancer based upon the presence of AvrA protein, nucleic acids and antibodies is provided as is a method for treating infection-related colorectal cancer using a Wnt agonist. 1SalmonellaSalmonellaSalmonellaSalmonellaSalmonella. A method of identifying a subject having at least an indication or predisposition for developing inflammatory bowel disease or colorectal cancer comprising detecting in a blood or fecal sample from a subject , the subject having had a previous infection , the presence of AvrA protein , nucleic acids encoding AvrA protein , or an anti-AvrA antibody , wherein the presence of the AvrA protein , nucleic acids encoding AvrA protein , or an anti-AvrA antibody identifies the subject as having at least an indication or predisposition for developing inflammatory bowel disease or colorectal cancer.2Salmonella. The method of claim 1 , wherein the presence of AvrA protein is detected with an anti-AvrA antibody.3. The method of claim 2 , wherein the anti-AvrA antibody specifically binds to amino acid residues CGEEPFLPSDKADRY (SEQ ID NO:30) of AvrA protein.4Salmonella. The method of claim 1 , wherein the presence of nucleic acids encoding AvrA protein is detected by polymerase chain reaction using a set of primers having the nucleotide sequences of GAATGGAAGGCGTTGAATCTGC (SEQ ID NO:5) and GTTGTGCGCCTTGAGTATGTTTGTAA (SEQ ID NO:6).5. The method of claim 1 , wherein the presence of the anti-AvrA antibody is detected in an enzyme immunoassay using a multiwell plate claim 1 , wherein wells of the multiwell plate are coated with purified AvrA protein.6. The method of claim 1 , further comprising detecting the expression of Wnt1 in colorectal epithelial cells of the subject.7. The method of claim 6 , wherein the expression of Wnt1 is detected by polymerase chain reaction using a set of primers having the nucleotide sequences of ...

Подробнее
Номер записи: 53
14-01-2021 дата публикации

VEHICLE AND METHOD OF CONTROLLING THE SAME

Номер: US20210010818A1
Автор: Lee Jin Woo, Yeum Jun Sun
Принадлежит:

A vehicle and a method of controlling the same are provided. The vehicle may include a storage configured to store map information and store information, an inputter configured to receive an input of a destination and an item list from a user, and a controller configured to generate a traveling route of the vehicle based on the stored map information and the received destination, and determine at least one store of the plurality of stores that is located within a predetermined distance with respect to the generated travelling route and sells at least one item included in the received list of items, wherein the controller modifies the generated travelling route such that the vehicle passes through at least one store of the plurality of stores based on a location of at least one store of the plurality of stores. 1. A vehicle comprising:a storage configured to store map information and store information;an inputter configured to receive an input of a destination and an item list from a user; and generate a traveling route of the vehicle based on the stored map information and the received destination; and', 'determine at least one store of a plurality of stores that is located within a predetermined distance with respect to the generated travelling route and sells at least one item included in the received item list,, 'a controller configured towherein the controller is further configured to modify the generated travelling route such that the vehicle passes through at least one store of the plurality of stores based on a location of at least one store of the plurality of stores.2. The vehicle of claim 1 , wherein the controller is configured to:determine at least one store of the plurality of stores that sells all of the items included in the received item list;determine a total price of all the items sold by each store of the plurality of stores; anddetermine a store of the plurality of stores in which the total price of all the items is cheapest.3. The vehicle of ...

Подробнее
Номер записи: 54
12-01-2017 дата публикации

Magnetic assembly and power suppy system with same

Номер: US20170011830A1
Автор: Haijun Yang, Jun Sun, Yajiang Yan, Zengyi Lu
Принадлежит: Delta Electronics Shanghai Co Ltd

A magnetic assembly includes plural first magnetic cores, plural coil windings and a second magnetic core. Each of the plural first magnetic cores includes plural legs and a first connection part. The first connection part is connected with first terminals of the plural legs. The first connection part of the first magnetic core at an upper position is located adjacent to second terminals of the plural legs of the adjacent first magnetic core at a lower position. Each coil winding is wound around at least one leg of the plural legs of the corresponding first magnetic core so as to form a magnetic element of the corresponding converter. The second magnetic core is stacked over the plural first magnetic cores. The second magnetic core is located adjacent to the second terminals of the legs of the topmost first magnetic core.

Подробнее
Номер записи: 55
21-01-2016 дата публикации

METHOD OF MANUFACTURING LIGHT-EMITTING DEVICE PACKAGE

Номер: US20160020366A1
Автор: HWANG Sun-jun, JI Won-soo, KIM Do-hyuk
Принадлежит:

A method of manufacturing a light-emitting device package may include steps of preparing a light-emitting device package; holding the light-emitting device package on an inspection table; reflecting, by a reflection member, leaking blue light emitted by the light-emitting device package; capturing, by using a photographing unit, the light emitted by the light-emitting device package and the leaking blue light and generating an optical image; detecting, by a controller, the blue light from the optical image; determining a presence or absence of a defect of the light-emitting device package according to the detected blue light; and displaying the presence or absence of the defect of the light-emitting device package on a display unit.

Подробнее
Номер записи: 56
17-04-2014 дата публикации

SEMICONDUCTOR DEVICE AND METHOD OF FABRICATING THE SAME

Номер: US20140103441A1
Автор: Hwang Jun-Sun, Jang Kwang-Yong, Kim Ju-Youn, Park Jong-Joon, YOUN Jong-Mil
Принадлежит:

A semiconductor device includes an interlayer insulating film formed on a substrate, the insulating layer including a trench. A gate insulating layer is formed on a bottom surface of the trench and a reaction prevention layer is formed on the gate insulating layer on the bottom surface of the trench. A replacement metal gate structure is formed on the reaction prevention layer of the trench to fill the trench. 1. A semiconductor device comprising:a substrate having a first and second regions;an interlayer insulating film formed on the substrate and comprising a first trench which is disposed in the first region and a second trench which is disposed in the second region;a first transistor comprising a first gate insulating layer which is formed on a bottom surface of the first trench and has a first thickness, a reaction prevention layer which is formed on the first gate insulating layer on the bottom surface of the first trench, and a first replacement metal gate structure which is formed on the reaction prevention layer of the first trench to fill the first trench; anda second transistor comprising a second gate insulating layer which is formed in the second trench and has a second thickness smaller than the first thickness and a second replacement metal gate structure which is formed on the second gate insulating layer in the second trench.2. The semiconductor device of claim 1 , wherein the second gate insulating layer is formed along sidewalls and a bottom surface of the second trench claim 1 , and the first gate insulating layer is formed only on the bottom surface of the first trench.3. The semiconductor device of claim 1 , wherein the second gate insulating layer comprises a high-k insulating layer.4. The semiconductor device of claim 3 , wherein the second replacement metal gate structure comprises a capping layer formed on the second gate insulating layer claim 3 , wherein the capping layer comprises TiN and is formed along the sidewalls and bottom surface ...

Подробнее
Номер записи: 57
17-01-2019 дата публикации

Systems and methods for determining users associated with devices based on facial recognition of images

Номер: US20190019012A1
Автор: Farhan Khan, Jieqi Yu, Jun Sun, Wenjie Lin, Xun Wilson Huang, Zhiyang Wang
Принадлежит: Facebook Inc

Systems, methods, and non-transitory computer readable media can identify a user associated with a device based on a subset of media content items on the device based at least in part on analysis of the subset of media content items. A relationship between the user and one or more other users depicted in the media content items can be determined. A recommendation relating to sending at least one media content item on the device to at least of the one or more other users can be generated based on the determined relationship.

Подробнее
Номер записи: 58
18-01-2018 дата публикации

TECHNIQUES FOR MANAGING GROUPS ON A MOBILE PLATFORM

Номер: US20180020004A1
Автор: Ferguson David Ross, Sun Jun
Принадлежит: FACEBOOK, INC.

Techniques for managing groups on a mobile platform, comprising a mobile groups application. The mobile groups application including a groups management component to manage at least one group for a corresponding social networking application of a social networking system; and a groups rendering component to render a groups user interface (UI) view comprising at least one selectable group user interface element representative of the at least one group, the at least one selectable group UI element comprising a first selectable group UI element, wherein the first selectable group UI element is representative of a first group of the at least one group and the first group comprises at least one group member. 120-. (canceled)21. An apparatus , comprising:a processor circuit;memory operatively coupled to the processor circuit, the memory to store a mobile groups application for execution by the processor circuit, the mobile groups application comprising:a groups management component to manage a group for a corresponding social networking application of a social networking system, the group comprising at least one member of the social networking system, the groups management component configured to manage the group based at least in part on social group information from the social networking system; anda groups rendering component to render a groups user interface (UI) view based on the at least one group for the corresponding social networking application, the groups UI comprising at least one selectable group UI element representative of the group.221. The apparatus of claim , wherein the social group information comprises one or more of group privacy information , group cover image information , group description information , group name information , group owner information , or group membership information from the social networking service.231. The apparatus of claim , wherein the groups management component is further configured to input one or more search queries ...

Подробнее
Номер записи: 59
21-01-2021 дата публикации

METHOD AND SYSTEM FOR MANUFACTURING SOLAR CELLS AND SHINGLED SOLAR CELL MODULES

Номер: US20210020525A1
Автор: Ding Shiyin, Sun Jun, Yin Bingwei, Zhou Fushen
Принадлежит:

The present disclosure provides a method and system for manufacturing solar cells and shingled solar cell modules. The method as provided by the present disclosure includes performing scribing and dividing of the solar cells, sorting the obtained solar cell strips, and packaging the cell strips in the solar cell manufacturing process. The solar cell strips can be assembled directly after dismantling the package in the solar module manufacturing process. Therefore, the method can accomplish a smooth flow of manufacturing solar cells and shingled solar cell modules, reduce repeated processing steps, lower the risk of cracking and costs thereof, and optimize the current matching and the color consistency of the cell strips in the shingled solar cell modules. 1. A method of manufacturing a solar cell , comprising: texturing one or more surfaces of the wafer;', 'depositing amorphous silicon on surfaces of the wafer; and', 'depositing a transparent conductive oxide film on surfaces of the amorphous silicon;, 'pretreating a wafer byscreen-printing a precious metal paste on a surface of the pretreated wafer;sintering and curing the screen-printed wafer to form a solar cell;scribing the solar cell and dividing the solar cell into a plurality of solar cell strips; andperforming testing, appearance inspection and sorting on the plurality of solar cell strips respectively in the cell manufacturing process,wherein the sorting of the plurality of solar cell strips comprises sorting the solar cell strips into a plurality of different grades based upon the result of the testing and the appearance inspection.2. The method according to claim 1 , characterized in that scribing and dividing the solar cell comprises physical scribing and chemical scribing.3. The method according to claim 1 , characterized in that scribing and dividing the solar cell comprises laser scribing.4. The method according to claim 1 , characterized in that scribing and dividing the solar cell comprises linear ...

Подробнее
Номер записи: 60
21-01-2021 дата публикации

METHOD AND SYSTEM FOR MANUFACTURING SOLAR CELLS AND SHINGLED SOLAR CELL MODULES

Номер: US20210020526A1
Автор: Ding Shiyin, Sun Jun, Yin Bingwei, Zhou Fushen
Принадлежит:

The present disclosure provides a method and system for manufacturing solar cells and shingled solar cell modules. The method as provided by the present disclosure includes performing scribing and dividing of the solar cells, sorting the obtained solar cell strips, and packaging the cell strips in the solar cell manufacturing process. The solar cell strips can be assembled directly after dismantling the package in the solar module manufacturing process. Therefore, the method can accomplish a smooth flow of manufacturing solar cells and shingled solar cell modules, reduce repeated processing steps, lower the risk of cracking and costs thereof, and optimize the current matching and the color consistency of the cell strips in the shingled solar cell modules. 1. A method of manufacturing a solar cell comprising: texturing one or more surfaces of the wafer;', 'diffusing a p-type layer on a front side of the wafer to form PN junctions in the wafer;', 'removing the p-type layer at a back side and edges of the wafer and impurities on surfaces of the wafer formed during the junction diffusion by etching;', 'forming a silicon dioxide layer on the back side of the wafer;', 'forming a multicrystalline silicon layer on the silicon dioxide layer;', 'implanting phosphorus atoms into the multicrystalline silicon layer by ion implanting;', 'activating the phosphorus atoms implanted by annealing; and', 'depositing a first layer of film on the front side of the wafer, and a second layer of film on the front and back sides of the wafer;, 'pretreating a wafer, byscreen-printing a precious metal paste on a surface of the pretreated wafer;sintering and curing the screen-printed wafer to form a solar cell;performing laser scribing at a side of the solar cell away from a surface of the solar cell having the PN junctions and dividing the solar cell into a plurality of solar cell strips; andperforming testing, appearance inspection, and sorting on the plurality of solar cell strips ...

Подробнее
Номер записи: 61
21-01-2021 дата публикации

SOLAR CELLS FOR SHINGLED SOLAR CELL MODULE, SHINGLED SOLAR CELL MODULE, AND METHOD OF MAKING SOLAR CELLS

Номер: US20210020791A1
Автор: Chen Dengyun, Ding Shiyin, Sun Jun, Yin Bingwei, Zhang Zhengrong, Zhou Fushen
Принадлежит:

The present disclosure relates to solar cells for a shingled solar cell module, a shingled solar cell module, and a method of making solar cells for the shingled solar cell module. Said solar cell has a front side and a back side, a plurality of front side busbars being arranged on the front side, a plurality of back side busbars being arranged on the back side, the solar cell comprising a plurality of sections, each section comprising a front side busbar and a back side busbar located at edges thereof, the front side busbar of at least one section of the solar cell having an extension at one end or both ends, the extension extending along another edge of said at least one section intersecting with the above-mentioned edges. The shingled solar cell module is fabricated from solar cell strips split from the solar cell. 1. A solar cell for a shingled solar cell module , said solar cell having a front side and a back side , a plurality of front side busbars arranged on the front side , and a plurality of back side busbars arranged on the back side , comprising:a plurality of sections, each section comprising a front side busbar and a back side busbar located at edges thereof,wherein each front side busbar has a main body that extends along an edge of its respective section that is not an edge of the solar cell,wherein the solar cell has chamfers, and the front side busbar of at least one chamfered section of the solar cell has an extension at an end of its main body, the extension extending along an entire length of another edge of the chamfered section intersecting with the edge where the main body of the front side busbar of the section is located, and continues to extend along a partial or entire length of a chamfered edge of the chamfered section that abuts against the another edge,wherein the extension extends linearly with a non-constant width, andwherein the plurality of front side busbars include two front side busbars which are adjacent to each other, and the ...

Подробнее
Номер записи: 62
21-01-2021 дата публикации

SOLAR CELLS FOR SHINGLED SOLAR CELL MODULE, SHINGLED SOLAR CELL MODULE, AND METHOD OF MAKING SOLAR CELLS

Номер: US20210020792A1
Автор: Chen Dengyun, Ding Shiyin, Sun Jun, Yin Bingwei, Zhang Zhengrong, Zhou Fushen
Принадлежит:

The present disclosure relates to solar cells for a shingled solar cell module, a shingled solar cell module, and a method of making solar cells for the shingled solar cell module. Said solar cell has a front side and a back side, a plurality of front side busbars being arranged on the front side, a plurality of back side busbars being arranged on the back side, the solar cell comprising a plurality of sections, each section comprising a front side busbar and a back side busbar located at edges thereof, the front side busbar of at least one section of the solar cell having an extension at one end or both ends, the extension extending along another edge of said at least one section intersecting with the above-mentioned edges. The shingled solar cell module is fabricated from solar cell strips split from the solar cell. 1. A solar cell for a shingled solar cell module , said solar cell having a front side and a back side , a plurality of front side busbars arranged on the front side , and a plurality of back side busbars arranged on the back side , comprising:a plurality of sections, each section comprising a front side busbar and a back side busbar located at edges thereof,wherein each front side busbar has a main body that extends along an edge of its respective section that is not an edge of the solar cell,wherein the solar cell has chamfers, and the front side busbar of at least one chamfered section of the solar cell has an extension at an end of its main body, the extension extending along an entire length of another edge of the chamfered section intersecting with the edge where the main body of the front side busbar of the section is located, and continues to extend along a partial or entire length of a chamfered edge of the chamfered section that abuts against the another edge,wherein the extension extends linearly with a non-constant width, andwherein the plurality of front side busbars include two pairs of front side busbars, and two front side busbars of ...

Подробнее
Номер записи: 63
23-01-2020 дата публикации

Method and apparatus for managing effectiveness of information processing task

Номер: US20200026552A1
Автор: Bingfeng PI, Jun Sun, Shenbin ZHANG
Принадлежит: Fujitsu Ltd

Disclosed are a method and apparatus for managing effectiveness of an information processing task in a decentralized data management system. The method comprising: sending requests for multiple information processing tasks by a client to multiple execution subjects, transmitting information processing tasks in a sequential information processing task list in an order to the multiple execution subjects; caching the requested information processing tasks to a task cache queue, caching the sequential information processing task list as a whole to the task cache queue; judging whether each information processing task in the task cache queue satisfies a predetermined conflict condition; moving the information processing task to a conflict task queue if it is determined that the task satisfies the predetermined conflict condition, deleting the task from the conflict task queue and caching the task to the task cache queue when the predetermined conflict condition is not satisfied.

Подробнее
Номер записи: 64
23-01-2020 дата публикации

METHOD AND APPARATUS FOR PROCESSING INFORMATION BY COOPERATION OF MULTIPLE SUBJECTS

Номер: US20200026862A1
Автор: PI Bingfeng, Sun Jun, ZHANG Shenbin
Принадлежит: FUJITSU LIMITED

Disclosed are a method and apparatus for processing information by cooperation of multiple subjects, by submitting an information processing task to first multiple subjects; performing security analysis on information processing results obtained by executing the information processing task by the first multiple subjects, determining an updated processing manner of executing the information processing task based on a result of the security analysis; and submitting the information processing task to second multiple subjects according to the determined updated processing manner. Information processing results of executing the information processing task by the second multiple subjects are obtained, each of the second multiple subjects and each of the first multiple subjects save same information associated with the information processing task, and the information is updated based on the information processing results of executing the information processing task by the second multiple subjects. 1. A method for processing information by cooperation of multiple subjects , comprising:a first submitting of an information processing task to first multiple subjects;performing a security analysis with respect to first information processing results obtained by executing the information processing task by the first multiple subjects, and determining an updated processing manner of executing the information processing task based on a result of the security analysis; anda second submitting of the information processing task to second multiple subjects according to the determined updated processing manner, and obtaining second information processing results of executing the information processing task by the second multiple subjects,wherein each of the second multiple subjects and each of the first multiple subjects save same information associated with the information processing task, and the information is updatable based on the second information processing results of the ...

Подробнее
Номер записи: 65
05-02-2015 дата публикации

CONVOLUTIONAL-NEURAL-NETWORK-BASED CLASSIFIER AND CLASSIFYING METHOD AND TRAINING METHODS FOR THE SAME

Номер: US20150036920A1
Автор: FAN Wei, He Yuan, Sun Jun, Wu Chunpeng
Принадлежит: FUJITSU LIMITED

The present invention relates to a convolutional-neural-network-based classifier, a classifying method by using a convolutional-neural-network-based classifier and a method for training the convolutional-neural-network-based classifier. The convolutional-neural-network-based classifier comprises: a plurality of feature map layers, at least one feature map in at least one of the plurality of feature map layers being divided into a plurality of regions; and a plurality of convolutional templates corresponding to the plurality of regions respectively, each of the convolutional templates being used for obtaining a response value of a neuron in the corresponding region. 1. A convolutional-neural-network-based classifier , comprising:a plurality of feature map layers, at least one feature map in at least one of feature maps being divided into a plurality of regions; anda plurality of convolutional templates corresponding to the plurality of regions respectively, each of the convolutional templates being used for obtaining a response value of a neuron in the corresponding region.2. The convolutional-neural-network-based classifier of claim 1 , wherein the convolutional-neural-network-based classifier is configured for classifying an image claim 1 , and the image is divided into a plurality of image regions claim 1 , which correspond to the plurality of regions respectively claim 1 , according to a fixed scheme.3. The convolutional-neural-network-based classifier of claim 1 , wherein the convolutional-neural-network-based classifier is configured for classifying an image claim 1 , and the convolutional-neural-network-based classifier further comprises a image dividing unit which is configured for dividing the image into a plurality of image regions corresponding to the plurality of regions respectively.4. The convolutional-neural-network-based classifier of claim 3 , wherein the plurality of regions is divided based on a pixel distribution of the image.5. The convolutional- ...

Подробнее
Номер записи: 66
31-01-2019 дата публикации

MOTHERBOARD AND ELECTRONIC DEVICE USING THE SAME

Номер: US20190033940A1
Автор: Sun Jun, TONG MING-HUI, WANG TAI-CHEN
Принадлежит:

An electronic device proof against surge currrents arising from hot-swapping components comprises a platform controller hub chip, an electronic component, a serial peripheral interface, and a power supply unit. The power supply unit comprises a power supply and a Zener diode, the power supply outputs a first voltage to the Zener diode, the diode converts the received first voltage to a second voltage and outputs the second voltage to one or more electronic components and the platform controller chip. 1. A motherboard comprising:a platform controller hub (PCH) chip;an electronic component storing a basic input output system (BIOS) program and communicating with the PCH chip;a serial peripheral interface (SPI) coupling to the electronic component, the PCH chip coupling to the electronic component through the SPI; anda power supply unit coupling to the SPI and the PCH chip;wherein the power supply unit comprises a power supply and a Zener diode, the power supply outputs a first voltage to the Zener diode, the Zener diode converts the first voltage to a second voltage and outputs the second voltage to supply power for the electronic component and the PCH chip.2. The motherboard of claim 1 , wherein the SPI comprises a first detect pin claim 1 , a second detect pin claim 1 , a third detect pin claim 1 , a fourth detect pin claim 1 , a fifth detect pin claim 1 , a sixth detect pin claim 1 , a power supply pin claim 1 , and a ground pin; the ground pin power supply pin is grounded claim 1 , the power supply pin power supply pin is electrically coupled to the power supply unit claim 1 , and the first detect pin claim 1 , the second detect pin claim 1 , the third detect pin claim 1 , the fourth detect pin claim 1 , the fifth detect pin claim 1 , and the sixth detect pin of the SPI are electrically coupled to the PCH chip.3. The motherboard of claim 2 , wherein the PCH chip comprises a first signal pin claim 2 , a second signal pin claim 2 , a third signal pin claim 2 , a ...

Подробнее
Номер записи: 67
09-02-2017 дата публикации

SPUTTERING TARGET, OXIDE SEMICONDUCTING FILM, AND METHOD FOR MAKING THE SAME

Номер: US20170037506A1
Автор: CAO MING-JIE, Guo Li, OUYANG LIANG-QI, SUN RU-JUN, Zhao Ming, ZHUANG DA-MING
Принадлежит:

An oxide semiconductor film includes indium (In), cerium (Ce), zinc (Zn) and oxygen (O) elements, and a molar ratio of the In, Ce, and Zn as In:Ce:Zn is in a range of 2:1:(0.5 to 2). A method for making a oxide semiconductor film includes a step of forming an oxide film on a substrate by using a sputtering method and a sputtering target comprising InCeZnO, wherein x=0.5˜2. 1. An oxide semiconductor film comprising indium (In) , cerium (Ce) , zinc (Zn) and oxygen (O) elements , and a molar ratio of In , Ce , and Zn as In:Ce:Zn is in a range of 2:1(0.5 to 2) , a carrier density of about 10cmto about 10cm , a carrier mobility of about 5.0 cmVsto about 45.0 cmVs , and the oxide semiconductor film is an n-type semiconductor.2. The oxide semiconductor film of being an amorphous film.3. The oxide semiconductor film of having a band gap of about 3.0 eV to about 3.5 eV.4. A sputtering target comprising an indium cerium zinc oxide represented by InCeZnO claim 1 , wherein x=0.5-2.5. The sputtering target of claim 4 , wherein the InCeZnOis a crystal.6. A method for making a sputtering target comprising:{'sub': 2', '3', '2, 'mixing indium oxide (InO) powder, cerium oxide (CeO) powder, and zinc oxide (ZnO) powder to form a mixture, a molar ratio of indium (In), cerium (Ce), and zinc (Zn) as In:Ce:Zn in the mixture is 2:1:(0.5 to 2); and'}sintering the mixture at a temperature in a range from about 1250° C. to about 1650° C.7. The method of claim 6 , wherein the sintering comprises using a hot pressing method or a hot isostatic pressing method to simultaneously press and sinter the mixture claim 6 , the hot pressing method comprises applying a pressure of about 30 MPa to 100 MPa at the temperature of about 1250° C. to about 1650° C. for about 1 hour to about 24 hours to the mixture claim 6 , and the hot isostatic pressing method comprises applying a pressure of about 100 MPa to 300 MPa at the temperature of about 1250° C. to about 1650° C. for about 1 hour to about 40 hours to the ...

Подробнее
Номер записи: 68
08-02-2018 дата публикации

IMPLEMENTAL METHOD AND APPLICATION OF PERSONALIZED PRESENTATION OF ASSOCIATED MULTIMEDIA CONTENT

Номер: US20180041820A1
Автор: Chen Hao, Li Bo, Liu Ning, Sun Jun, XU Yiling, Zhang Lianghui, ZHANG Wenjun, ZHU Wenjie
Принадлежит: SHANGHAI JIAO TONG UNIVERSITY

An implementation method and an application of a personalized presentation of associated multimedia content are provided. The method includes steps of: by a multimedia content provider, uniformly completing full file content when producing a multimedia file, and classifying segments of the content through a marking method according to an importance and/or an association degree of the content, so as to produce different versions of the multimedia file; and selectively previewing and/or playing by a user according to the different versions. The present invention is a flexible and efficient method for scalable organization, storage and transmission in an Internet on-demand system, thereby adding a flexible organization mechanism for the media content that an existing multimedia protocol lacks, and solving problems of an existing multimedia system, such as low transmission efficiency, waste of storage resources and poor user experience. 1: An implementation method of a personalized presentation of associated multimedia content , comprising steps of: by a multimedia content provider , uniformly completing full file content when producing a multimedia file , and classifying segments of the full file content through a marking method according to an importance and/or an association degree of the content , so as to produce different versions of the multimedia file; and by a user , selectively previewing and/or playing according to the different versions.2. (canceled)3: The implementation method of the personalized presentation of the associated multimedia content claim 1 , as recited in claim 1 , specifically comprising steps of:Step 1, according to a version management of content classification, obtaining the multiple versions of the multimedia content; and generating a MPD (Media Presentation Description) file corresponding to the content classification, namely a version management tag of the content classification; andStep 2, requesting different versions of the ...

Подробнее
Номер записи: 69
24-02-2022 дата публикации

STORAGE DEVICE AND METHOD OF OPERATING THE SAME

Номер: US20220057965A1
Автор: HWANG Jun Sun, Lee Jung Hwan, SHON Kwan Su
Принадлежит: SK HYNIX INC.

The present technology relates to an electronic device. A storage device in which a memory device controls an ODT operation to improve operation performance of the memory device with a small number of pins includes a plurality of memory devices comprising a target memory device in which an operation is performed and non-target memory devices, and a memory controller configured to control the plurality of memory devices. Each of the plurality of memory devices includes an on die termination (ODT) flag generator configured to generate a flag that indicates that an ODT operation is possible for the non-target memory devices, and an ODT performer configured to determine whether the ODT operation is an ODT read operation for a read operation or an ODT write operation for a write operation based on the flag and configured to generate an enable signal that enables the ODT read operation or the ODT write operation. 1. A storage device comprising:a plurality of memory devices comprising a target memory device in which an operation is performed and non-target memory devices; anda memory controller configured to control the plurality of memory devices,{'claim-text': ['an on die termination (ODT) flag generator configured to generate a flag that indicates that an ODT operation is possible for the non-target memory devices; and', 'an ODT performer configured to determine whether the ODT operation is an ODT read operation for a read operation or an ODT write operation for a write operation based on the flag and configured to generate an enable signal that enables the ODT read operation or the ODT write operation.'], '#text': 'wherein each of the plurality of memory devices comprises:'}2. The storage device of claim 1 , wherein the flag distinguishes between the target memory device and the non-target memory devices.3. The storage device of claim 1 , wherein claim 1 , when the target memory device performs the read operation claim 1 , the ODT flag generator of the target memory ...

Подробнее
Номер записи: 70
16-02-2017 дата публикации

Microorganisms and methods for the biosynthesis of butadiene

Номер: US20170044572A1
Автор: Anthony P. Burgard, Jun Sun, Mark J. Burk, Priti Pharkya, Robin E. Osterhout
Принадлежит: Genomatica Inc

The invention provides non-naturally occurring microbial organisms having a butadiene pathway. The invention additionally provides methods of using such organisms to produce butadiene.

Подробнее
Номер записи: 71
18-02-2021 дата публикации

Cable connector assembly

Номер: US20210050694A1
Автор: Feng-Jun Sun, Jun Chen, Yang-Tsun Hsu, Yue-Jun Dong
Принадлежит: Foxconn Interconnect Technology Ltd, Foxconn Kunshan Computer Connector Co Ltd

A cable connector assembly includes: an electrical connector; a circuit board electrically connected to the electrical connector and including a first row of pads and a second row of pads located behind the first row of pads and separated from the first row of pads; and a cable electrically connected to the circuit board and including plural coaxial wires each including a center conductor and a shielding layer and plural single core wires each comprising a conductor; wherein the center conductors of the coaxial wires are soldered to the first row of pads of the circuit board, and the conductors of the single core wires and the shielding layers of the coaxial wires are soldered to the second row of pads of the circuit board.

Подробнее
Номер записи: 72
13-02-2020 дата публикации

Sheetlike composite, in particular for the production of dimensionally stable foodstuff containers, having a first colour application and a second colour application with a 2d-code

Номер: US20200047480A1
Автор: Christian König, Jun Sun, Miguel GAMITO
Принадлежит: SIG Combibloc Suzhou Ltd

Described is sheetlike composite comprising as layers of a layer sequence in a direction from an outer surface of the sheetlike composite to an inner surface of the sheetlike composite; a) an outer polymer layer, b) a carrier layer, and c) a barrier layer; wherein the sheetlike composite comprises a first composite region and a second composite region; wherein in the first composite region the sheetlike composite further comprises a first colour application, superimposing the outer polymer layer on a side of the outer polymer layer which is facing away from the inner surface of the sheetlike composite; wherein in the second composite region the sheetlike composite further comprises a second colour application, superimposing the outer polymer layer on the side of the outer polymer layer which is facing away from the inner surface of the sheetlike composite; wherein the second colour application comprises a 2D-code. Described is a process including steps of adapting an outer surface of a sheetlike composite precursor to a first value and to a further value, and steps of applying a first and a second ink composition to the outer surface; to a sheetlike composite obtainable by the process; to a container precursor and a closed container, each comprising a pre-cut section of one of the preceding sheetlike composites; to a use of one of the preceding sheetlike composites; and to a use of an inkjet printer.

Подробнее
Номер записи: 73
14-02-2019 дата публикации

MICROORGANISMS AND METHODS FOR THE BIOSYNTHESIS OF BUTADIENE

Номер: US20190048366A1
Автор: Burgard Anthony P., Burk Mark J., Osterhout Robin E., Pharkya Priti, Sun Jun
Принадлежит:

The invention provides non-naturally occurring microbial organisms having a butadiene pathway. The invention additionally provides methods of using such organisms to produce butadiene. 1. A process for the production of butadiene comprising:(a) culturing by fermentation in a sufficient amount of nutrients and media a non-naturally occurring microbial organism that produces crotyl alcohol; and(b) converting crotyl alcohol produced by culturing said non-naturally occurring microbial organism to butadiene.2. The process of claim 1 , wherein step (b) is performed by chemical dehydration in the presence of a catalyst.3. The process of claim 1 , wherein said non-naturally occurring microbial organism comprises a crotyl alcohol pathway comprising at least one exogenous nucleic acid encoding a crotyl alcohol pathway enzyme expressed in a sufficient amount to produce crotyl alcohol claim 1 , said crotyl alcohol pathway comprising an acetyl-CoA:acetyl-CoA acyltransferase claim 1 , an acetoacetyl-CoA reductase claim 1 , a 3-hydroxybutyryl-CoA dehydratase claim 1 , a crotonyl-CoA reductase (aldehyde forming) claim 1 , a crotonaldehyde reductase (alcohol forming) claim 1 , a crotonyl-CoA hydrolase claim 1 , synthetase claim 1 , or transferase claim 1 , a crotonate reductase claim 1 , a crotonyl-CoA reductase (alcohol forming) claim 1 , a glutaconyl-CoA decarboxylase claim 1 , a glutaryl-CoA dehydrogenase claim 1 , a 3-aminobutyryl-CoA deaminase claim 1 , or a 4-hydroxybutyryl-CoA dehydratase.4. The process of claim 3 , wherein said microbial organism comprises two claim 3 , three or four exogenous nucleic acids each encoding a crotyl alcohol pathway enzyme.56-. (canceled)7. The process of claim 3 , wherein said crotyl alcohol pathway comprises a pathway selected from the group consisting of:an acetyl-CoA:acetyl-CoA acyltransferase, an acetoacetyl-CoA reductase, a 3-hydroxybutyryl-CoA dehydratase, a crotonyl-CoA reductase (aldehyde forming), and a crotonaldehyde reductase ( ...

Подробнее
Номер записи: 74
03-03-2022 дата публикации

NFC QR CODE LABEL FOR PREVENTING FORGERY AND FALSIFICATION AND METHOD FOR PRODUCING NFC QR CODE LABEL

Номер: US20220067473A1
Автор: CHO Gyou jin, KALE Amol Marotrao, KIM You Shin, LEE Sunggeun, PARAJULI Sajjan, PARK Hye Jin, PARK Jinhwa, RAJKOIRALA Gyan, Shrestha Kiran, SUN Jun Feng, VANARAJ Welsey Prince, YADAV Pravesh
Принадлежит:

An NFC QR code label according to the present invention comprises: a rectenna for receiving a radio frequency signal from a terminal device and converting the signal into DC power; a ring oscillator activated by receiving the DC power supplied from the rectenna, and producing an oscillation signal having a predetermined frequency; and a light-em QR code flickering in response to the oscillation signal. The light-emitting QR code includes a QR code pattern formed by means of gravure printing using a nonconductor ink.

Подробнее
Номер записи: 75
25-02-2016 дата публикации

MICROORGANISMS FOR THE PRODUCTION OF 1,4-BUTANEDIOL

Номер: US20160053287A1
Автор: Burgard Anthony P., Burk Mark J., Osterhout Robin E., Sun Jun
Принадлежит:

The invention provides non-naturally occurring microbial organisms comprising a 1,4-butanediol (BDO) pathway comprising at least one exogenous nucleic acid encoding a BDO pathway enzyme expressed in a sufficient amount to produce BDO. The invention additionally provides methods of using such microbial organisms to produce BDO. 139-. (canceled)40. A recombinant microorganism adapted to biosynthesize 1 ,4-butanediol (“1 ,4-BDO”) , the recombinant microorganism comprising one or more nucleic acid sequences encoding one or more of 1) a first polypeptide providing acetyl-CoA acetyltransferase activity , 2) a second polypeptide providing β-hydroxybutyryl-CoA dehydrogenase activity; 3) a third polypeptide providing crotonase activity; a 4) fourth polypeptide providing vinylacetyl-CoA-Δ-isomerase and 4-hydroxybutyryl-CoA dehydratase activities; 5) a fifth polypeptide providing 4-hydroxybutyrate-CoA-hydrolase activity , and 6) a sixth polypeptide providing 1 ,3-propanediol dehydrogenase activity , wherein the recombinant microorganism biosynthesizes 1 ,4-BDO utilizing said polypeptides.41. The recombinant microorganism of claim 40 , wherein the one or more nucleic acid sequences comprise at least one of thiL claim 40 , hbd claim 40 , crt claim 40 , abfD claim 40 , abfT claim 40 , and dhaT.42. The recombinant microorganism of claim 40 , wherein the recombinant microorganism is adapted to biosynthesize 1 claim 40 ,4-BDO by condensing two acetyl-CoA moieties into acetoacetyl-CoA.43. The recombinant microorganism of claim 42 , comprising aldehyde dehydrogenase.44. (canceled)45. A recombinant microorganism adapted to biosynthesize 1 claim 42 ,4-butanediol (“1 claim 42 ,4-BDO”) claim 42 , the recombinant microorganism comprising one or more nucleic acid sequences encoding one or more of 1) a first polypeptide providing a-ketoglutarate decarboxylase activity claim 42 , 2) a second polypeptide providing 4-hydroxybutyrate dehydrogenase activity claim 42 , and 3) a third polypeptide ...

Подробнее
Номер записи: 76
25-02-2016 дата публикации

TECHNIQUES FOR MANAGING GROUPS ON A MOBILE PLATFORM

Номер: US20160057154A1
Автор: Ferguson David Ross, Sun Jun
Принадлежит: FACEBOOK, INC.

Techniques for managing groups on a mobile platform, comprising a mobile groups application. The mobile groups application including a groups management component to manage at least one group for a corresponding social networking application of a social networking system; and a groups rendering component to render a groups user interface (UI) view comprising at least one selectable group user interface element representative of the at least one group, the at least one selectable group UI element comprising a first selectable group UI element, wherein the first selectable group UI element is representative of a first group of the at least one group and the first group comprises at least one group member. 1. An apparatus , comprising:a processor circuit;memory operatively coupled to the processor circuit, the memory to store a mobile groups application for execution by the processor circuit, the mobile groups application comprising:a groups management component to manage at least one group for a corresponding social networking application of a social networking system; anda groups rendering component to render a groups user interface (UI) view comprising at least one selectable group user interface element representative of the at least one group, the at least one selectable group UI element comprising a first selectable group UI element, wherein the first selectable group UI element is representative of a first group of the at least one group and the first group comprises at least one group member.2. The apparatus of claim 1 , wherein the mobile groups application further comprises a groups authentication component to authenticate a user based at least partially on user account information representative of a user account for a user claim 1 , the user account information comprising at least a user authentication identifier.3. The apparatus of claim 1 , the groups management component to receive user groups membership information from the social networking application ...

Подробнее
Номер записи: 77
01-03-2018 дата публикации

BIO HUE LAMP

Номер: US20180056027A1
Автор: Broersma Rémy Cyrille, Peeters Martinus Petrus Joseph, SEKULOVSKI DRAGAN, SUN Yue Jun, Wegh René Theodorus
Принадлежит:

The invention provides a three-channel lighting apparatus with the option to support the human circadian rhythm. By choosing especially the blue LED and green phosphor, the range of biological activity that can be changed is optimized. By adjustment of the LED spectra a bigger range in melanopsin effectiveness factor, at the same CCT range (from daylight like CCT down to dimmed halogen), can be obtained. 1. A lighting apparatus configured to provide white light with a variable correlated color temperature , wherein the lighting apparatus comprises:a first light source configured to provide first light source light, wherein the first light source light comprises blue light having a first light source dominant wavelength selected from the range of 400-460 nm, wherein the first light source is configured to irradiate a first luminescent material with said first light source light, wherein the first luminescent material is configured to convert part of the first light source light into first luminescent material light, wherein the first luminescent material light comprises one or more of green and yellow light, and wherein the first luminescent material light has a first luminescent material dominant wavelength;a second light source configured to provide second light source light, wherein the second light source light comprises blue light having a second light source dominant wavelength selected from the range of 450-490 nm, wherein the second light source is configured to irradiate a second luminescent material with second light source light, and wherein the second luminescent material is configured to convert part of the second light source light into second luminescent material light, wherein the second luminescent material light comprises one or more of green and yellow light, and wherein the second luminescent material light has a second luminescent material dominant wavelength;a third light source configured to provide red light source light;a control unit, ...

Подробнее
Номер записи: 78
10-03-2022 дата публикации

Two-degree-of-freedom decoupled transmission apparatus for spatial adhesion pawl

Номер: US20220074471A1
Автор: Jinhai Wang, Jun Sun, Ting Song, Xiaolong Zhang, Zhigang Liu
Принадлежит: SHANGHAI AEROSPACE CONTROL TECHNOLOGY INSTITUTE

A two-degree-of-freedom decoupled transmission apparatus for a spatial adhesion pawl mainly includes a tangential loading transmission mechanism and a normal de-adhesion transmission mechanism. The tangential loading transmission mechanism adopts a bevel gear pair, such that the tangential loading transmission mechanism is arranged in a bending manner, and a tangential loading motor of the tangential loading transmission mechanism is collected inside the apparatus. The tangential loading motor is connected to a cam pull plate through the bevel gear pair, a worm gear reducer and a key, and drive the cam pull plate to rotate around a central shaft of an adhesion apparatus. Six transmission bolts on six adhesion units are respectively driven through six cam grooves on the cam pull plate to simultaneously perform centripetal driving on the adhesion units with a further increased force, so as to realize tangential and centripetal loading of the adhesion units.

Подробнее
Номер записи: 79
02-03-2017 дата публикации

APPARATUS AND METHOD FOR DOCUMENT IMAGE ORIENTATION DETECTION

Номер: US20170061207A1
Автор: Sun Jun
Принадлежит: FUJITSU LIMITED

An apparatus and method for document image orientation detection. When a ratio of a difference between similarities between a current text line and reference samples in two selected candidate orientations is greater than or equal to a first threshold value, 1 is added to a voting value of a candidate orientation corresponding to the largest similarity in the orientations, and when the ratio of the difference is less than the first threshold value, a product of the ratio of the difference and a parameter related to the first threshold value is added to the voting value of the candidate orientation corresponding to the largest similarity in the orientations. Hence, setting a voting value can efficiently lower influence of noise text lines, low-quality text lines and unsupported text lines on the orientation detection, thereby achieving accurate document image orientation detection. 1. An apparatus for document image orientation detection , comprising:a voting unit configured to vote for text lines in a document image line by line, the voting unit comprising:a first calculating unit configured to calculate similarities between a current text line and reference samples in multiple candidate orientations;a selecting unit configured to select two candidate orientations from the multiple candidate orientations where the similarities between the current text line and the reference samples in the two selected candidate orientations are largest and second largest;a second calculating unit configured to calculate a first ratio of a difference between the similarities between the current text line and the reference samples in the two selected candidate orientations; andan adding unit configured to add 1 to a voting value of a candidate orientation corresponding to the largest similarity in the two selected candidate orientations when the first ratio of the difference is greater than or equal to a first threshold value, and add a product of the first ratio of the difference and ...

Подробнее
Номер записи: 80
02-03-2017 дата публикации

TRAINING METHOD AND APPARATUS FOR NEUTRAL NETWORK FOR IMAGE RECOGNITION

Номер: US20170061246A1
Автор: Chen Li, FAN Wei, SATOSHI Naoi, Sun Jun, Wang Song
Принадлежит: FUJITSU LIMITED

A training method and a training apparatus for a neutral network for image recognition are provided. The method includes: representing a sample image as a point set in a high-dimensional space, a size of the high-dimensional space being a size of space domain of the sample image multiplied by a size of intensity domain of the sample image; generating a first random perturbation matrix having a same size as the high-dimensional space; smoothing the first random perturbation matrix; perturbing the point set in the high-dimensional space using the smoothed first random perturbation matrix to obtain a perturbed point set; and training the neutral network using the perturbed point set as a new sample. With the training method and the training apparatus, classification performance of a conventional convolutional neural network is improved, thereby generating more training samples, reducing influence of overfitting, and enhancing generalization performance of the convolutional neural network. 1. A training method for a neutral network for image recognition , comprising:representing a sample image as a point set in a high-dimensional space, a space size of the high-dimensional space being a domain size of a space domain of the sample image multiplied by an intensity size of an intensity domain of the sample image;generating a first random perturbation matrix having a same size as the high-dimensional space;smoothing the first random perturbation matrix;perturbing the point set in the high-dimensional space using a smoothed first random perturbation matrix to obtain a perturbed point set; andtraining the neutral network using the perturbed point set as a new sample.2. The training method according to claim 1 , wherein the domain size of the space domain is a width of the sample image multiplied by a height of the sample image claim 1 , and the intensity size of the intensity domain is D1×D2× . . . ×Dn claim 1 , where n is a dimension of the intensity domain claim 1 , D1 ...

Подробнее
Номер записи: 81
02-03-2017 дата публикации

SEMICONDUCTOR DEVICE

Номер: US20170062420A1
Автор: Chung Jae-yup, Hwang Jun-Sun, Jeong Bo-Cheol, KANG Dae-Lim, Lee Jeong-Hyo, Um Myung-Yoon, YOU Jung-gun
Принадлежит: SAMSUNG ELECTRONICS CO., LTD.

A semiconductor device including a first fin pattern and a second fin pattern which have respective short sides facing each other and are separated from each other, a first field insulating layer which is around the first fin pattern and the second fin pattern, a second field insulating layer and a third field insulating layer which are between the first fin pattern and the second fin pattern, a first gate which is formed on the first fin pattern to intersect the first fin pattern, a second gate which is formed on the second field insulating layer, and a third gate which is formed on the third field insulating layer, wherein upper surfaces of the second and third field insulating layers protrude further upward than an upper surface of the first field insulating layer, and a distance between the first gate and the second gate is equal to a distance between the second gate and the third gate. 1. A semiconductor device comprising:a first fin pattern and a second fin pattern which have respective short sides facing each other and are separated from each other;a first field insulating layer around the first fin pattern and the second fin pattern;a second field insulating layer and a third field insulating layer between the first fin pattern and the second fin pattern;a first gate on the first fin pattern to intersect the first fin pattern;a second gate on the second field insulating layer; anda third gate on the third field insulating layer,wherein upper surfaces of the second and third field insulating layers protrude further upward than an upper surface of the first field insulating layer, and a distance between the first gate and the second gate is equal to a distance between the second gate and the third gate.21. The semiconductor device , further comprising a third fin pattern between the second field insulating layer and the third field insulating layer , wherein the third fin pattern lies on the same line as the first and second fin patterns.3. The semiconductor ...

Подробнее
Номер записи: 82
04-03-2021 дата публикации

SOLAR CELLS FOR SHINGLED SOLAR CELL MODULE, SHINGLED SOLAR CELL MODULE, AND METHOD OF MAKING SOLAR CELLS

Номер: US20210066512A1
Автор: Chen Dengyun, Ding Shiyin, Sun Jun, Yin Bingwei, Zhang Zhengrong, Zhou Fushen
Принадлежит:

The present disclosure relates to solar cells for a shingled solar cell module, a shingled solar cell module, and a method of making solar cells for the shingled solar cell module. Said solar cell has a front side and a back side, a plurality of front side busbars being arranged on the front side, a plurality of back side busbars being arranged on the back side, the solar cell comprising a plurality of sections, each section comprising a front side busbar and a back side busbar located at edges thereof, the front side busbar of at least one section of the solar cell having an extension at one end or both ends, the extension extending along another edge of said at least one section intersecting with the above-mentioned edges. The shingled solar cell module is fabricated from solar cell strips split from the solar cell. 1. A solar cell for a shingled solar cell module , said solar cell having a front side and a back side , a plurality of front side busbars arranged on the front side , and a plurality of back side busbars arranged on the back side , comprising:a plurality of sections, each section comprising a front side busbar and a back side busbar located at edges thereof,wherein each front side busbar has a main body that extends along an edge of its respective section that is not an edge of the solar cell,wherein the solar cell has chamfers, and the front side busbar of at least one chamfered section of the solar cell has an extension at an end of its main body, the extension extending along an entire length of another edge of the chamfered section intersecting with the edge where the main body of the front side busbar of the section is located, and continues to extend along a partial or entire length of a chamfered edge of the chamfered section that abuts against the another edge,wherein the extension extends linearly with a non-constant width, andwherein the plurality of front side busbars include two pairs of front side busbars, where the two front side busbars ...

Подробнее
Номер записи: 83
04-03-2021 дата публикации

SOLAR CELLS FOR SHINGLED SOLAR CELL MODULE, SHINGLED SOLAR CELL MODULE, AND METHOD OF MAKING SOLAR CELLS

Номер: US20210066513A1
Автор: Chen Dengyun, Ding Shiyin, Sun Jun, Yin Bingwei, Zhang Zhengrong, Zhou Fushen
Принадлежит:

The present disclosure relates to solar cells for a shingled solar cell module, a shingled solar cell module, and a method of making solar cells for the shingled solar cell module. Said solar cell has a front side and a back side, a plurality of front side busbars being arranged on the front side, a plurality of back side busbars being arranged on the back side, the solar cell comprising a plurality of sections, each section comprising a front side busbar and a back side busbar located at edges thereof, the front side busbar of at least one section of the solar cell having an extension at one end or both ends, the extension extending along another edge of said at least one section intersecting with the above-mentioned edges. The shingled solar cell module is fabricated from solar cell strips split from the solar cell. 1. A solar cell for a shingled solar cell module , said solar cell having a front side and a back side , a plurality of front side busbars arranged on the front side , and a plurality of back side busbars arranged on the back side , comprising:a plurality of sections, each section comprising a front side busbar and a back side busbar located at edges thereof,wherein each front side busbar has a main body that extends along an edge of its respective section that is not an edge of the solar cell,wherein the solar cell has chamfers, and the front side busbar of at least one chamfered section of the solar cell has an extension at an end of its main body, the extension extending along an entire length of another edge of the chamfered section intersecting with the edge where the main body of the front side busbar of the section is located, and continues to extend along a partial or entire length of a chamfered edge of the chamfered section that abuts against the another edge,wherein the extension extends linearly with a non-constant width, andwherein the plurality of front side busbars include two front side busbars which are adjacent to each other, and the ...

Подробнее
Номер записи: 84
10-03-2016 дата публикации

NAIL DEFORMITY CORRECTION DEVICE AND MANUFACTURING METHOD FOR NAIL DEFORMITY CORRECTION DEVICE

Номер: US20160067079A1
Автор: JANG Dea Il, SUN Dong Jun
Принадлежит:

Provided is a nail deformity correction device for effectively correcting a fingernail/toenail by applying an appropriate correction force. The nail deformity correction device includes: a first body having a plate shape, elastically bent by an external force, and being attachable to the surface of a fingernail/toenail; a second body having a plate shape, overlapping the first body, fixed to the first body, and elastically bending with the first body; a core inserted between the first body and the second body and restored into a memorized shape in accordance with a temperature change; and contact portions formed by bringing portions of the first body and the second body in close contact with each other outside the core, in which the first body, the second body, and the core expand and correct a deformed portion of the fingernail/toenail. 1. A nail deformity correction device , comprising:a first body having a plate shape, elastically bent by an external force, and being attachable to the surface of a fingernail/toenail;a second body having a plate shape, overlapping the first body, fixed to the first body, and elastically bending with the first body;a core inserted between the first body and the second body and restored into a memorized shape in accordance with a temperature change; andcontact portions formed by bringing portions of the first body and the second body in close contact with each other outside the core,wherein the first body, the second body, and the core expand and correct a deformed portion of the fingernail/toenail, and at least a portion of the contact portion resists restoration of the core.2. The nail deformity correction device of claim 1 , wherein the contact portions have curvature-maintaining portions expanding outward from ends of the core.3. The nail deformity correction device of claim 2 , wherein the core memorizes a shape to expand straight in a longitudinal direction at a set temperature and the curvature-maintaining portions are ...

Подробнее
Номер записи: 85
27-02-2020 дата публикации

HYBRID POWER VEHICLE, HYBRID POWER DRIVING SYSTEM AND GEAR BOX

Номер: US20200062105A1
Автор: FAN Yuchuan, Ge Hailong, Gu Zhengmin, JIANG Deyan, Liu Xinyu, Sun Jun, WANG Jian, Xu Bin, Zhou Jian, ZHU Jun
Принадлежит:

A gear box of a hybrid power vehicle is provided, which includes a first gear box part and a second gear box part. The first gear box part includes one input shaft and two intermediate shafts, and the input shaft is configured to be connected to an internal combustion engine, a first driving toothed gear and a second driving toothed gear are provided on the input shaft, a first driven toothed gear and a second driven toothed gear are provided on a first intermediate shaft, a third driven toothed gear and a fourth driven toothed gear are provided on a second intermediate shaft; and the second gear box part includes a third intermediate shaft provided with a driving toothed gear of a first gear of the electric motor and the first or second intermediate shaft provided with a driven toothed gear of the first gear of the electric motor. 1. A gear box of a hybrid power vehicle , comprising:a first gear box part, anda second gear box part,wherein the first gear box part comprises four forward gears comprising a first gear to a fourth gear, or comprises fifth forward gears comprising a first gear to a fifth gear, and all the forward gears are switchable by selectively closing a plurality of synchronizers;the first gear box part comprises just one input shaft and just two intermediate shafts, the input shaft is configured to be connected to an internal combustion engine for transmission, a first driving toothed gear and a second driving toothed gear are provided on the input shaft, a first driven toothed gear engageable with the first driving toothed gear and a second driven toothed gear engageable with the second driving toothed gear are provided on a first intermediate shaft of the two intermediate shafts, a third driven toothed gear engageable with the first driving toothed gear and a fourth driven toothed gear engageable with the second driving toothed gear are provided on a second intermediate shaft of the two intermediate shafts, the first driven gears to the fourth ...

Подробнее
Номер записи: 86
08-03-2018 дата публикации

Fec Mechanism Based on Media Content

Номер: US20180069654A1
Автор: Guan Yunfeng, Huang Wei, Li Bo, Liu Ning, Sun Jun, Tang Xuguo, XU Yiling, ZHANG Wenjun
Принадлежит: SHANGHAI JIAO TONG UNIVERSITY

The invention provides an FEC (Forward error correction) mechanism based on media content. The mechanism classifies the media content, and endows it with different importance, and then changes the coding scheme according to the packets belonging to frames of different importance in combination with channel conditions and user experience, to conduct protection according to the importance of corresponding frames. By using the technical scheme of the invention, for the data congestion caused by excessive coding in the current FEC system, the media content is able to be classified and endowed with different importance, and controlled by signaling and indicating bit; different FEC coding strengths is able to be adopted; the duplication-expanding window fountain code with the unequal error protection performance is able to be further adopted, to achieve the maximum guarantee of media content quality and reduce the large amount of data caused by FEC. 1. An FEC (Forward error correction) mechanism based on media content , wherein the FEC mechanism is implemented by using any of following four methods:Method I: classifying the media content, and endowing the media content with different importance, and then changing a coding scheme according to packets belonging to frames of different importance in combination with channel conditions and user experience, to conduct protection according to the importance of corresponding frames;Method II: classifying the media content, and endowing the media content with the different importance; in an absence of shunting the original media data flow, transmitting data packets to a corresponding FEC encoder according to the importance of frames contained in a media packet in combination with the channel conditions and the user experience, to conduct different degrees of protection;Method III: classifying the media content, and endowing it with the different importance; in the absence of shunting the original media data flow, dynamically ...

Подробнее
Номер записи: 87
11-03-2021 дата публикации

METHOD AND DEVICE FOR GENERATING FINITE STATE AUTOMATA, AND RECOGNITION METHOD

Номер: US20210073470A1
Автор: Fang Lu, Sun Jun, Xia Yingju, Zheng Zhongguang
Принадлежит: FUJITSU LIMITED

The present disclosure relates to a method and device for generating a finite state automata for recognizing a chemical name in a text, and a recognition method. According to an embodiment of the present disclosure, the method comprises substituting representation constants of categories of character segments appearing in an organic compound name set into the organic compound name set to obtain a conversion name set; updating the conversion name set based on a conversion name segment which repeatedly appears in the conversion name set; and generating the finite state automata based on the updated conversion name set. 1. A method for generating a finite state automata for recognizing a chemical name in a text , comprising:initializing including substituting representation constants of categories of character segments appearing in an organic compound name set into the organic compound name set to obtain a conversion name set;updating the conversion name set based on a conversion name segment which repeatedly appears in the conversion name set; andgenerating a finite state automata based on the updated conversion name set;wherein respective organic compound names in the organic compound name set are in Chinese.2. The method according to claim 1 , wherein the initializing further comprises initialization of a representation set including initializing a binary representation set and a repeated representation set to empty sets;a binary representation in the binary representation set is used for representing a conversion name segment of two different adjacent representation constants in the conversion name set; anda repeated representation in the repeated representation set is used for representing a conversion name segment in the conversion name set where the same representation constant continuously appears.3. The method according to claim 2 , wherein in the initializing includes the substituting representation claim 2 , only representation constants of selected ...

Подробнее
Номер записи: 88
11-03-2021 дата публикации

ROBUSTNESS ESTIMATION METHOD, DATA PROCESSING METHOD, AND INFORMATION PROCESSING APPARATUS

Номер: US20210073591A1
Автор: Shi Ziqiang, Sun Jun, Xia Wensheng, Zhong Chaoliang
Принадлежит: FUJITSU LIMITED

A robustness estimation method, a data processing method, and an information processing apparatus are provided. The method for estimating robustness a classification model obtained in advance through training based on a training data set, includes: for each training sample in the training data set, determining a target sample in a target data set that has a sample similarity with a respective training sample that is within a predetermined threshold range, and calculating a classification similarity between a classification result of the classification model with respect to the respective training sample and a classification result of the classification model with respect to the determined respective target sample; and determining, based on classification similarities between classification results of respective training samples in the training data set and classification results of corresponding target samples in the target data set, classification robustness of the classification model with respect to the target data set. 1. A robustness estimation method for estimating robustness of a classification model which is obtained in advance through training based on a training data set , the method comprising:for each training sample in the training data set, determining a respective target sample in a target data set that has a sample similarity with a respective training sample that is within a predetermined threshold range, and calculating a classification similarity between a classification result of the classification model with respect to the respective training sample and a classification result of the classification model with respect to the determined respective target sample; anddetermining, based on classification similarities between classification results of respective training samples in the training data set and classification results of corresponding target samples in the target data set, classification robustness of the classification model with respect ...

Подробнее
Номер записи: 89
11-03-2021 дата публикации

METHODS FOR ESTIMATING ACCURACY AND ROBUSTNESS OF MODEL AND DEVICES THEREOF

Номер: US20210073665A1
Автор: Shi Ziqiang, Sun Jun, Xia Wensheng, Zhong Chaoliang
Принадлежит: FUJITSU LIMITED

The present disclosure relates to methods for estimating an accuracy and robustness of a model and devices thereof. According to an embodiment of the present disclosure, the method comprises calculating a parameter representing a possibility that a sample in the first dataset appears in the second dataset; calculating an accuracy score of the model with respect to the sample in the first dataset; calculating a weighted accuracy score of the model with respect to the sample in the first dataset, based on the accuracy score, by taking the parameter as a weight; and calculating, as the estimation accuracy of the model with respect to the second dataset, an adjusted accuracy of the model with respect to the first dataset according to the weighted accuracy score. 1. A method for estimating an estimation accuracy of a model for classifying which is trained with a first dataset with respect to a second dataset , the method comprising:calculating a parameter representing a possibility that a sample in the first dataset appears in the second dataset;calculating an accuracy score of the model with respect to the sample in the first dataset;calculating a weighted accuracy score of the model with respect to the sample in the first dataset, based on the accuracy score, by taking the parameter as a weight; andcalculating, as the estimation accuracy of the model with respect to the second dataset, an adjusted accuracy of the model with respect to the first dataset according to the weighted accuracy score.2. The method according to claim 1 , wherein the parameter is a density ratio; andthe density ratio represents a ratio of a probability density of the sample in the second dataset to a probability density of the sample in the first database.3. The method according to claim 2 , wherein the density ratio is determined based on a shift compensation network.4. The method according to claim 3 , wherein the shift compensation network comprises a first discriminator and a second ...

Подробнее
Номер записи: 90
28-02-2019 дата публикации

METHOD AND WIRELESS COMMUNICATION SYSTEM FOR TRAFFIC MOBILITY BETWEEN HETEROGENEOUS ACCESS NETWORKS

Номер: US20190069194A1
Автор: JUN Sun Mi, KIM Jae Ho, Park No Ik
Принадлежит:

A traffic mobility method between heterogeneous access networks of a wireless communication system includes, as a user equipment (UE) multiply accesses a first access network and a second access network, configuring a first transmission path corresponding to the first access network and a second transmission path corresponding to the second access network with respect to the UE, by a gateway, determining whether traffic mobility is performed on each traffic flow based on a traffic mobility policy of the each traffic flow served to the UE through the first transmission path and a transmission state of the second access network, by a control entity, and changing a transmission path of a traffic flow on which traffic mobility is determined, to the second transmission path from the first transmission path, by the gateway. 1. A method of traffic mobility between heterogeneous access networks of a wireless communication system , the method comprising:as a user equipment (UE) multiply accesses a first access network and a second access network, configuring a first transmission path corresponding to the first access network and a second transmission path corresponding to the second access network with respect to the UE, by a gateway;determining whether traffic mobility is performed on each traffic flow served to the UE based on a traffic mobility policy of the each traffic flow served to the UE through the first transmission path and a transmission state of the second access network, by a control entity; andchanging a transmission path of a traffic flow on which traffic mobility is determined, to the second transmission path from the first transmission path, by the gateway.2. The method of claim 1 , wherein the first access network and the second access network use different wired and wireless access technologies.3. The method of claim 1 , wherein the configuring includes:as the UE accesses the first access network, configuring the first transmission path of the UE, a first ...

Подробнее
Номер записи: 91
17-03-2016 дата публикации

Microorganisms for Producing 1,3-Butanediol and Methods Related Thereto

Номер: US20160076060A1
Автор: Burgard Anthony P., Burk Mark J., Osterhout Robin E., Pharkya Priti, Sun Jun
Принадлежит:

Provided herein is a non-naturally occurring microbial organism having a 1,3-butanediol (1,3-BDO) pathway and comprising at least one exogenous nucleic acid encoding a 1,3-BDO pathway enzyme expressed in a sufficient amount to produce 1,3-BDO. In some embodiments, the pathway includes reducing equivalents from CO or hydrogen. In certain embodiments, a 1,3-BDO pathway proceeds by way of central metabolites pyruvate, succinate or alpha-ketoglutarate. Also provided herein is a method for producing 1,3-BDO, includes culturing such microbial organisms under conditions and for a sufficient period of time to produce 1,3-BDO. 2. The non-naturally occurring microbial organism of claim 1 , wherein said microbial organism further comprises an exogenous nucleic acid encoding an enzyme selected from the group consisting of a pyruvate:ferredoxin oxidoreductase claim 1 , an aconitase claim 1 , an isocitrate dehydrogenase claim 1 , a succinyl-CoA synthetase claim 1 , a succinyl-CoA transferase claim 1 , a fumarase claim 1 , a malate dehydrogenase claim 1 , an acetate kinase claim 1 , a phosphotransacetylase claim 1 , an acetyl-CoA synthetase claim 1 , an NAD(P)H:ferredoxin oxidoreductase claim 1 , a ferredoxin claim 1 , and combinations thereof.3. The non-naturally occurring microbial organism of claim 1 , wherein said microbial organism further comprises an exogenous nucleic acid encoding an enzyme selected from the group consisting of a succinyl-CoA synthetase claim 1 , a succinyl-CoA transferase claim 1 , a fumarase claim 1 , a malate dehydrogenase claim 1 , and combinations thereof.4. The non-naturally occurring microbial organism of claim 1 , wherein said microbial organism comprises two claim 1 , three claim 1 , four claim 1 , five claim 1 , six claim 1 , seven claim 1 , eight or nine exogenous nucleic acids claim 1 , each encoding a 1 claim 1 ,3-BDO pathway enzyme.5. The non-naturally occurring microbial organism of claim 1 , wherein said microbial organism comprises ...

Подробнее
Номер записи: 92
05-06-2014 дата публикации

MICROORGANISMS AND METHODS FOR THE BIOSYNTHESIS OF BUTADIENE

Номер: US20140155567A1
Автор: Burgard Anthony P., Burk Mark J., Osterhout Robin E., Pharkya Priti, Sun Jun
Принадлежит: GENOMATICA, INC.

The invention provides non-naturally occurring microbial organisms having a butadiene pathway. The invention additionally provides methods of using such organisms to produce butadiene. 1. A non-naturally occurring microbial organism , said microbial organism having a butadiene pathway and comprising at least one exogenous nucleic acid encoding a butadiene pathway enzyme expressed in a sufficient amount to produce butadiene , said butadiene pathway comprising converting crotonyl-CoA to crotyl-alcohol using one or more butadiene pathway enzymes , wherein said butadiene pathway enzymes are selected from the group consisting of a crotonyl-CoA reductase (aldehyde forming) , a crotonaldehyde reductase (alcohol forming) a crotonyl-CoA hydrolase , synthetase , or transferase , a crotonate reductase , and a crotonyl-CoA reductase (alcohol forming).2. The non-naturally occurring microbial organism of claim 1 , wherein said microbial organism comprises two exogenous nucleic acids each encoding a butadiene pathway enzyme.34-. (canceled)5. The non-naturally occurring microbial organism of claim 1 , wherein said butadiene pathway enzymes comprise a crotonyl-CoA reductase (aldehyde forming) claim 1 , and a crotonaldehyde reductase (alcohol forming).6. The non-naturally occurring microbial organism of claim 1 , wherein said butadiene pathway enzymes comprise a crotonyl-CoA reductase (alcohol forming).7. (canceled)8. The non-naturally occurring microbial organism of claim 1 , wherein said butadiene pathway enzymes comprise a crotonyl-CoA hydrolase claim 1 , synthetase or transferase and a crotonate reductase.9. The non-naturally occurring microbial organism of claim 1 , wherein said butadiene pathway further comprises converting crotyl alcohol to butadiene using butadiene pathway enzymes claim 1 , wherein said butadiene pathway enzymes are a crotyl alcohol kinase claim 1 , a 2-butenyl-4-phosphate kinase and a butadiene synthase.10. The non-naturally occurring microbial organism of ...

Подробнее
Номер записи: 93
17-03-2016 дата публикации

ORGANIC LAYER DEPOSITION APPARATUS AND METHOD OF MANUFACTURING ORGANIC LIGHT-EMITTING DISPLAY APPARATUS USING THE SAME

Номер: US20160079569A1
Автор: JUN JAE-SUN
Принадлежит:

An organic layer deposition apparatus includes a conveyer unit and a deposition unit that has one or more organic layer deposition assemblies configured to deposit an organic layer on a moving substrate. The conveyer unit includes a moving unit configured to move a substrate fixed thereto, a first conveyer unit configured to move the moving unit in a first direction during which an organic material is deposited on the substrate fixed to the moving unit, and a second conveyer unit configured to move the moving unit in a second direction opposite to the first direction after deposition is completed and the substrate is separated from the moving unit. The first conveyer unit and the second conveyer unit are configured to move through the deposition unit. 1. An organic layer deposition apparatus , the apparatus comprising:a deposition unit comprising one or more organic layer deposition assemblies configured to deposit an organic layer on a moving substrate, a deposition source configured to discharge a deposition material; and', 'a patterning slit sheet disposed to face the deposition source,', a first fixing frame;', 'a second fixing frame attached to the first fixing frame, said second fixing frame having at least one portion whose thickness is less than thicknesses of other portions; and', 'a pattern sheet that is fixed to the second fixing frame to face the deposition source, and which has a plurality of pattern slits., 'wherein the patterning slit sheet comprises], 'wherein each of the one or more organic layer deposition assemblies comprises2. The apparatus of claim 1 , wherein the second fixing frame comprises:a first fixing portion to which the pattern sheet is fixed;a second fixing portion to which the first fixing frame is fixed; andat least one etching portion formed on at least one of the first fixing portion and the second fixing portion and has at least one portion whose thickness is different from a thickness of the at least one of the first fixing ...

Подробнее
Номер записи: 94
05-03-2020 дата публикации

MAGNETIC ASSEMBLY AND POWER SUPPLY SYSTEM WITH SAME

Номер: US20200075204A1
Автор: LU ZENGYI, Sun Jun, Yan Yajiang, YANG Haijun
Принадлежит:

A magnetic assembly includes plural first magnetic cores, plural coil windings and a second magnetic core. Each of the plural first magnetic cores includes plural legs and a first connection part. The first connection part is connected with first terminals of the plural legs. The first connection part of the first magnetic core at an upper position is located adjacent to second terminals of the plural legs of the adjacent first magnetic core at a lower position. Each coil winding is wound around at least one leg of the plural legs of the corresponding first magnetic core so as to form a magnetic element of the corresponding converter. The second magnetic core is stacked over the plural first magnetic cores. The second magnetic core is located adjacent to the second terminals of the legs of the topmost first magnetic core. 1. A power supply system comprising plural converters , wherein the plural converters are connected with each other in parallel , and the plural converters receive an input voltage and convert the input voltage into an output voltage , wherein the plural converters comprise a magnetic assembly , and the magnetic assembly comprises:plural first magnetic cores stacked over each other from bottom to top, wherein each of the plural first magnetic cores comprises plural legs and a first connection part, and the first connection part is connected with first terminals of the plural legs, wherein the first connection part of the first magnetic core at an upper position is located adjacent to second terminals of the plural legs of the adjacent first magnetic core at a lower position;plural coil windings, wherein each coil winding is wound around at least one leg of the plural legs of the corresponding first magnetic core so as to form a magnetic element of the corresponding converter; anda second magnetic core stacked over the plural first magnetic cores, wherein the second magnetic core is located adjacent to the second terminals of the legs of the topmost ...

Подробнее
Номер записи: 95
12-06-2014 дата публикации

Method and Device for Controlling Video Quality Fluctuation Based on Scalable Video Coding

Номер: US20140161176A1
Автор: CHEN Keji, Guo Zongming, Sun Jun, WANG Yilei
Принадлежит:

Disclosed are a method and an apparatus for controlling video quality fluctuation based on scalable video coding. The method includes: performing scalable video coding on video data to be transmitted to generate a base layer and at least one enhancement layer; sending the video data after the scalable video coding to a terminal device; determining a currently expected bit rate according to a transmission status of the video data on a currently used channel, the currently expected bit rate being the maximum data transmission bit rate that the predicted currently used channel can sustain; acquiring the currently highest enhancement layer according to the currently expected bit rate, the sum of all bit rates occupied when transmitting video data under the currently highest enhancement layer being no larger than the currently expected bit rate; and sending the video data under the currently highest enhancement layer to the terminal device. 1. A method for controlling video quality fluctuation based on a scalable video coding , comprising:performing the scalable video coding on video data to be transmitted, and generating one base layer and at least one enhancement layer;sending the video data to be transmitted after the scalable video coding to a terminal device;determining a currently expected bit rate according to the transmission status of the video data sent to the terminal device on a currently used channel, said currently expected bit rate being the predicted maximum data transmission bit rate that can be carried by the currently used channel;acquiring a currently highest enhancement layer according to said currently expected bit rate, the sum of all bit rates occupied when transmitting the video data under said currently highest enhancement layer being no larger than said currently expected bit rate; andsending the video data under said currently highest enhancement layer to the terminal device.2. The method for controlling video quality fluctuation based on the ...

Подробнее
Номер записи: 96
12-06-2014 дата публикации

MICROORGANISMS AND METHODS FOR THE COPRODUCTION 1,4-BUTANEDIOL AND GAMMA-BUTYROLACTONE

Номер: US20140162327A1
Автор: Burgard Anthony P., Burk Mark J., Haselbeck Robert, NIU Wei, Osterhout Robin E., Sun Jun, Trawick John D.
Принадлежит:

The invention provides non-naturally occurring microbial organisms comprising 1,4-butanediol (14-BDO) and gamma-butyrolactone (GBL) pathways comprising at least one exogenous nucleic acid encoding a 14-BDO and GBL pathway enzyme expressed in a sufficient amount to produce 14-BDO and GBL. The invention additionally provides methods of using such microbial organisms to produce 14-BDO and GBL. 1. A method for producing 1 ,4-butanediol (14-BDO) and gamma-butyrolactone (GBL) , comprising culturing a non-naturally occurring microbial organism under conditions and for a sufficient period of time to produce 14-BDO and 4-hydroxybutyryl-CoA followed by spontaneous lactonization of 4-hydroxybutyryl-CoA to form GBL , wherein said 14-BDO is produced at an intracellular concentration of at least 1 M , wherein said GBL is produced at an intracellular concentration of between 0.001 mM and 10 mM , wherein said non-naturally occurring microbial organism comprises a 14-BDO pathway and a 4-hydroxybutyryl-CoA pathway ,said 14-BDO pathway comprising at least one exogenous nucleic acid encoding a 14-BDO pathway enzyme expressed in a sufficient amount to produce 14-BDO, said 14-BDO pathway comprising:a 4-hydroxybutyryl-CoA reductase (alcohol forming), a succinyl-CoA reductase (aldehyde forming), an alpha-ketoglutarate decarboxylase, a 4-hydroxybutyrate dehydrogenase, a 4-hydroxybutyrate reductase, a 1,4-butanediol dehydrogenase, a succinate reductase, a succinyl-CoA transferase, a succinyl-CoA hydrolase, a succinyl-CoA synthetase, a glutamate dehydrogenase, a glutamate transaminase, a glutamate decarboxylase, an 4-aminobutyrate dehydrogenase, an 4-aminobutyrate transaminase, a 4-hydroxybutyrate kinase, a phosphotrans-4-hydroxybutyrylase, a 4-hydroxybutyryl-CoA reductase (aldehyde forming), a 4-hydroxybutyryl-phosphate reductase, a succinyl-CoA reductase (alcohol forming), a 4-hydroxybutyryl-CoA transferase, a 4-hydroxybutyryl-CoA hydrolase, a 4-hydroxybutyryl-CoA synthetase, an alpha- ...

Подробнее
Номер записи: 97
12-06-2014 дата публикации

SEMICONDUCTOR DEVICE AND METHOD FOR FABRICATING THE SAME

Номер: US20140162453A1
Автор: BANG Jong-Sik, KIM Su-Young, LEE Sung-Kwon, Sun Jun-Hyeub
Принадлежит: SK HYNIX INC.

A semiconductor device that may prevent an unexposed substrate and generation of bowing profile during a process for forming an open region having a high aspect ratio, and a method for fabricating the semiconductor device. The semiconductor device includes a first material layer formed over a substrate, an open region formed in the first material layer that exposes the first material layer, a second material layer formed on sidewalls of the open region, wherein the second material layer is a compound material including an element of the first material layer, and a conductive layer formed inside the open region. 15-. (canceled)6. A method for fabricating a semiconductor device , comprising:forming a first material layer over a substrate;forming a hard mask pattern over the first material layer;forming a first pattern by using the hard mask pattern as an etch barrier and etching a portion of the first material layer;forming a second material layer on a surface of the first pattern by performing a surface treatment to the first material layer;forming a second pattern by using the hard mask pattern as an etch barrier and etching the first material layer under the first pattern until the substrate is exposed; andforming a conductive layer inside an open region that is formed of the first pattern and the second pattern.7. The method of claim 6 , wherein the second material layer has an etch selectivity to the first material layer claim 6 , and the second material layer is formed by transforming the first material layer through the surface treatment.8. The method of claim 7 , wherein the first material layer comprises a silicon layer claim 7 , and the second material layer comprises a silicon insulation layer.9. The method of claim 6 , wherein the surface treatment is performed through one method selected from the group consisting of oxidation claim 6 , nitration claim 6 , and oxynitrocarburising.10. The method of claim 9 , wherein the surface treatment is performed ...

Подробнее
Номер записи: 98
22-03-2018 дата публикации

IMAGE VIEWPOINT TRANSFORMATION APPARATUS AND METHOD

Номер: US20180082456A1
Автор: FAN Wei, Liu Wei, Sun Jun
Принадлежит: FUJITSU LIMITED

Embodiments provide an image viewpoint transformation apparatus and method. The method includes: extracting multiple straight lines based on a gray scale map of a document image; performing classification for the multiple straight lines according to a horizontal direction and a vertical direction; extracting multiple text lines based on a binary map of the document image; performing classification for the multiple text lines according to a horizontal direction and a vertical direction; selecting two vertical lines and two horizontal lines from the extracted and classified straight lines and text lines; calculating a transformation matrix based on a rectangle formed by the selected two vertical lines and two horizontal lines; and transforming the document image by using the transformation matrix to obtain a viewpoint transformed image. Hence, even if a captured document image is incomplete, a perspective transformation matrix may be accurately obtained, thereby better performing image viewpoint transformation. 1. An image viewpoint transformation apparatus , the image viewpoint transformation apparatus comprises: a straight line extracting unit configured to extract multiple straight lines based on a gray scale map of a document image;', 'a straight line classifying unit configured to perform classification for the multiple straight lines according to a horizontal direction and a vertical direction;', 'a text line extracting unit configured to extract multiple text lines based on a binary map of the document image;', 'a text line classifying unit configured to perform classification for the multiple text lines according to the horizontal direction and the vertical direction;', 'a line selecting unit configured to select two vertical lines and two horizontal lines from extracted and classified straight lines and text lines;', 'a matrix calculating unit configured to calculate a transformation matrix based on a rectangle formed by the two vertical lines and two ...

Подробнее
Номер записи: 99
12-03-2020 дата публикации

NEURAL NETWORK ARCHITECTURE SEARCH APPARATUS AND METHOD AND COMPUTER READABLE RECORDING MEDIUM

Номер: US20200082275A1
Автор: Sun Jun, Sun Li, WANG Liuan
Принадлежит: FUJITSU LIMITED

Disclosed are a neural network architecture search apparatus and method and a computer readable recording medium. The neural network architecture search method comprises: defining a search space used as a set of architecture parameters describing the neural network architecture; performing sampling on the architecture parameters in the search space based on parameters of a control unit, to generate at least one sub-neural network architecture; performing training on each sub-neural network architecture by minimizing a loss function including an inter-class loss and a center loss; calculating a classification accuracy and a feature distribution score, and calculating a reward score of the sub-neural network architecture based on the classification accuracy and the feature distribution score; and feeding back the reward score to the control unit, and causing the parameters of the control unit to be adjusted towards a direction in which the reward scores are larger. 1. A neural network architecture search apparatus , comprising:a unit for defining search space for neural network architecture, configured to define a search space used as a set of architecture parameters describing the neural network architecture;a control unit configured to perform sampling on the architecture parameters in the search space based on parameters of the control unit, to generate at least one sub-neural network architecture;a training unit configured to, by utilizing all samples in a training set, with respect to each sub-neural network architecture of the at least one sub-neural network architecture, calculate an inter-class loss indicating a separation degree between features of samples of different classes and a center loss indicating an aggregation degree between features of samples of a same class, and to perform training on each sub-neural network architecture by minimizing a loss function including the inter-class loss and the center loss;a reward calculation unit configured to, by ...

Подробнее
Номер записи: 100