복합 생약 추출물을 유효성분으로 함유하는 항바이러스용 조성물
The present invention refers to effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction cholesterol containing vesicular characteristic stomatitis virus active ingredient (Vesicular Stomatitis Virus, VSV), Newcastle disease virus (Newcastle disease virus, NDV), 71 (Enterovirus 71) and opening number of formula (foot fmcv mouth of disease virus) antiviral pharmaceutical composition for gene, food and health are disclosed. Vesicular characteristic stomatitis virus (Vesicular Stomatitis Virus, VSV) is vesicular characteristic stomatitis as causing viral pathogens, two serotypes (the D is it knows type new Jersey type) which infected in elder brothernew Jersey compatibility when representing a lesion outlined against pathogenic the D is it knows type more resistant to such as are known as disclosed. Mainly occurs only rarely results in disease in American continent united States of Americathe New Continent referred occurring intermittently generated and participates in the year 2004 multivalent withdrawals, Mexico south, central united States of America country, south United States of America northern, Brazil vesicular characteristic stomatitis representative requested a geographical area or the like are disclosed. Vesicular characteristic stomatitis vesicular clinical episodes is formed only the inverse number spheres (foot fmcv mouth Disease), vesicular (Vesicular Exanthema) triazines, such as swine vesicular disease (Swine Vesicular Disease) diseases that are transmitted because of an laboratory is to distinguish and rapid precision diagnosis in the inside of the pipe. If the apparent clinical symptoms such as diagnostics for automatically determining or reverse quadruple total enzyme represents a chain or separates virus for etiological agents, therapeutic clinical episodes is difficult if there is not an inspection method because separation etiological agents serum to an other. In the infected host animal usually 5 - 8 specific antibodies in the vesicular in characteristic stomatitis virus blood detection process is created wherein the story complement it joining the method, Guinea, enzyme-linked immunosorbant migration inhibitory factor etc.. In many kinds of animals of vesicular stomatitis virus salt station number secretariat Bureau bodies (O. I. E.) with List A classification methods to malignancy as opening by inverse number, generating the laser mirror number country a damage on the diseases are disclosed. Vesicular stomatitis virus susceptibility salt livestock comprises a horse, cow, sheep, whereby substantially all of goat and swine mammal, animal infection cold-bloodedness also determined that it is possible for 2000. It is characterized in that a salt of vesicular stomatitis virus when developing or ruminant animals is very safe, with tongue and lips, oromucosal, nipple and is formed around a number of severe vesicular epithelium, livestock value very drop substrate. In addition, the invited person of vesicular stomatitis virus can be infection, it has been reported to generate the similar slight illness wound diseases. Newcastle disease virus (Newcastle disease virus, NDV) as measles virus is Newcastle disease (Newcastle Disease, ND) causing, Newcastle bottle station number best 15 species one important livestock disease, acute respiratory disease and thermoformable, poultry farm is 100% when court number 1 species infected immune free improves the disclosed. Newcastle bottlewith elder brother and anti-pathogenic viruses pathogenic viruses or any strong generated by weak elder brotherunited States of America caused by 2000. Our steel area and the Newcastle disease virus, and our southeast Asia who are business case, China, and Taiwan is the Newcastle disease virus are potentially present in popular risk factor. Of poultry Newcastle bottle infection path secretions, feces, and infections such as avian respiratory waste incinerating a direct contact with air, and the like caused by oral, main symptoms include cough, respiratory distress, anorexia nervosa, which is a green hwang white diarrhea after such as diarrhea, arrest, a tic, pivoting movement, head, wing, leg distortion, check valve process appearing therein. Regardless of poultry Newcastle bottlein one zero generates all in one zero, clear infectious, not inoculated with vaccines in poultry farm rate 100% infected chicken results when generating a real number 1 species methods find warning participates in the terrible as smart card system, it is possible to continue generation as well as a National generated since increased poultry farming etc. as well as large increases an electrical connection. To today, Newcastle tool known therapeutics or healing technique is free for. (Picornaviridae family) belonging to the genus of formula of formula (Enterovirus) is very small sized pico [...] and 24 - 30 nm and a positive free virus decahedron coating are disclosed. Dielectric single strand RNA virus RNA leads to classification with each other. When to with reel virus, virus capsid (capsid) protein shells a dielectric surrounding [...] (pentamer) which is composed of 12, each [...] VP1, VP2, VP3, VP4 (polypeptide) or condition (protomer) constructed in four polypeptides consisting of two 5 configured as disclosed. For use in a non-human animal diseases causing to with reel virus Poliovirus (poliovirus) (a non-polio enteroviruses) control in the oligopeptide of formula fixed to, again cock company height virusto with reel virus A non-Poliovirus, cock company height virus B, echo, and other to with reel with virus classification with each other. The cause of body 15 and the latency period for one against Poliovirus vaccine 3 - 35 hereinafter cells, in particular 1 - 3 relate to a number of cells occurs. 1 - 4 cells infected-foods and gives the echo is primarily meningitis, upper respiratory tract infection, oscillation, other recessive diseases, such as infant diarrhea diseases other. A cock company height virus B group (group A is 23 species, B material is a 6 species) group and again divided into various diseases which cause the latency period for a new herpes virus 2 - 9 A cock company heightcock company height virus aerofoils with throat salt extremities nine bottles to skin-causes, virus B cock company height heart, pleura, pancreatic, disposed at the upper side chest pain liver diseases, myocardial salt, the core just the salt induced as follows. A group and a group of neuronal movement effected on both meninges B and sterile-meningitis and arrest can cause disclosed. During other to with reel virus columnto with reel virus classification types for facilitating classification to numerous to with reel virus, after years 1969 to newly isolated strains of number has read data are disclosed. The causes of acute hemorrhagic conjunctivitis virus on the year 1969 Africa republic of Ghana 70 during other formula formula in which very popular above, spraying dilute solutions of the 11 month since by this virus infections in America apollo call also be termed the landing apolloeye disease correlation peak value. The meningitis 71 other than formula (a hand-a foot and mouth disease) or herpes viruses are often extremities nine bottles causes-throat salt, preferably located on a wafer support brain death resulting serious complications that lead rare also other. In the year 1997 of formula 71 is very popular in Taiwan where even on the year over year 1998 and 2000 as domestic go flow tides. Opening the inverse number (foot fmcv mouth of disease, FMD) viral infection in an animal abnormally severe both cracks of vesicular disease prevention features number transmitted force. The fertilizer is mirror number due to station number list (List) (OIE) importance by methods of classification secretariat Bureau bodies which, transmits is upright in livestock etc. elements acting as a very important. (Piconaviridae) and virus pathogen is a single strand bipolar RNA pico my irrationality, 7 different [...] (Apthovirus) belonging to the genus and serotype (A, O, C, Asia1, SAT 1, SAT2 and SAT3) the classification is coming in now. Number may be developed which builds a current name is antiviral rod to attain, lamivudine treatment (lamibudine) and hepatitis B -1 human immunodeficiency virus, herpes viral infection treatment [...] (gancyclovir), protozoal infections (respiratory syncytial virus) or respiratory the total gun body virus written in various viral infection (ribavirin) used primarily limb which is allowed to commercially available such as ribavirin off and, influenza virus type A treatment (amantadine) authorized [...] similar material as well as inhibitors of influenza virus (rimantadine) only[...]it is a new mini, Oh number thus synthesized [...] (zanamivir, Relenza) also permitted on oseltamivir (oseltamivir, TAMIFLUTM) of commercially available and can be recycled. However, negative suction and [...] may be intravenous, oral route of administration is enabled recent appearance of resistant virus [...] rehmanniae vomiting etc. and high oral bioavailability of the reported side effects of faintness disadvantages at regular intervals (Ward P et al. , J. Antimicrob. Chemother. , 55 (supp1), p. I5 provided i21, 2005). Thus, vaccine and treatment on the development of the antiviral component together with a safe natural products side effect without number number required disclosed. The present invention the victims of the vesicular characteristic stomatitis virus derived from citrus, Newcastle disease virus, virus gene of viral origin diseases and treatment such as 71 and opening number to with reel number may be developed to automatically change study, herb used in effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, such as the virus-infected cells are cells in mixed extract said original and neck direction longevity and survival, which reduces a number of intracellular virus formate less, intracellular virus proliferation of billion number when the verify, mixed extract food product of the present invention compared to viral infections in some combination extract or extract of safflower billion number identifying said indication of total cholesterol vesicular characteristic stomatitis virus, Newcastle disease virus, to with reel virus 71 and opening number for active ingredient may be useful antiviral composition gene are disclosed by the present invention the arrears of work. The purpose of the invention is effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction cholesterol containing vesicular characteristic stomatitis virus active ingredient (Vesicular Stomatitis Virus, VSV), Newcastle disease virus (Newcastle disease virus, NDV), 71 and opening number of formula (Enterovirus 71) antiviral pharmaceutical composition for gene (foot fmcv mouth of disease virus), and health food under public affairs number are disclosed. In order to achieve said purposes, the present invention refers to effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction cholesterol containing vesicular characteristic stomatitis virus active ingredient (Vesicular Stomatitis Virus, VSV), Newcastle disease virus (Newcastle disease virus, NDV), number of formula 71 (Enterovirus 71) and opening (foot fmcv mouth of disease virus) gene selected from the group consisting of pharmaceutical composition for prevention and treatment of either virus number under public affairs substrate. In addition, the present invention refers to said active ingredient mixture extract containing vesicular characteristic stomatitis virus, Newcastle disease virus, a gene selected from the group consisting of formula 71 and opening number consisting of either virus number and non-allergic food under public affairs substrate. In addition, the present invention refers to said active ingredient mixture extract containing vesicular characteristic stomatitis, Newcastle disease, extremities nine bottles, meningitis, number selected from the group consisting of herpes-throat salt and vice versa opening either viral diseases and pharmaceutical composition for prevention and treatment number under public affairs substrate. In addition, the present invention refers to said active ingredient mixture extract containing vesicular characteristic stomatitis, Newcastle disease, extremities nine bottles, meningitis, number selected from the group consisting of herpes-throat salt and vice versa opening either viral diseases and health food for preventing and improving a number under public affairs substrate. Effect of the present invention, nozzle, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction active ingredient mixture extract compositions containing vesicular characteristic stomatitis virus (Vesicular Stomatitis Virus, VSV), Newcastle disease virus (Newcastle disease virus, NDV), 71 and opening number of formula (Enterovirus 71) gene (foot fmcv mouth of disease virus) longevity and survival of cells infected with the virus, which reduces a number of intracellular virus formate less, intracellular virus proliferation of billion number when the verify, mixed extract food product of the present invention compared to viral infections in some combination extract or extract of significant effect by making sure that the vesicular characteristic stomatitis virus billion number, Newcastle disease virus, inverse number of formula 71 and opening virus can be useful antiviral composition. Figure 1 shows a mixture extract of the present invention also a location indicating the virus infecting the vesicular characteristic stomatitis virus (Vesicular Stomatitis Virus, VSV) in cells by observation under fluorescence microscopy fluorescent light while number indicating the results desired are disclosed. Figure 2 shows a total cholesterol in cells of the present invention also present virus infecting the cell with cell survival after processing vesicular characteristic stomatitis virus indicating number are disclosed. *: The results of an experiment which experiment corresponded independently three times, then subject to analysis by Student's T-test p value 0. 05 determines when below was statistically significant. Figure 3 shows a mixture extract of the present invention a location Newcastle disease virus (Newcastle disease virus, NDV) also in cells to infection by observation under fluorescence microscopy fluorescent light while number indicating the result indicating the virus is desired are disclosed. Figure 4 shows a total cholesterol in cells of the present invention also after processing the cell survival virus infecting the Newcastle disease virus M mRNA present virus number indicating the measuring cells are disclosed. *: The results of an experiment which experiment corresponded independently three times, then subject to analysis by Student's T-test p value 0. 05 determines when below was statistically significant. Figure 5 shows a mixture extract of the present invention also a location 71 to infection in cells of formula (Enterovirus 71, EV71) photos and graph expressed in cell survival are disclosed. Figure 6 shows a mixture extract also of the present invention, processed extract and comparison example 1><extract of 12 and a location number indicating the virus infecting the Newcastle disease virus in cells following time indicating by observation under fluorescence microscopy fluorescent light while prevention results are disclosed. Figure 7 shows a mixture extract also of the present invention, processed extract and comparison example 1><extract of a location number indicating the virus infecting the Newcastle disease virus in 24 hours and by observation under fluorescence microscopy fluorescent light while prevention indicating results are disclosed. Figure 8 shows a mixture extract also of the present invention, processed extract and comparison example 1><extract of a location Newcastle disease virus infecting virus M mRNA in cells by measuring cell number indicating the present virus are disclosed. Hereinafter, the present invention are described detailed as follows. The present invention refers to effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction antiviral pharmaceutical composition containing cholesterol number under public affairs substrate. 1 parts by weight of said mixed extract flavonoid effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, lonicera, each original and neck direction 0. 5 to 5 parts by weight of extracted ratio preferably contains one selected from, said water mixture extract, C1 - C2 Of lower alcohols, or a combination of solvent is preferably prepared by the number by extracting, preferably said lower alcohol is methanol or ethanol. Said virus is vesicular characteristic stomatitis virus (Vesicular Stomatitis Virus, VSV), Newcastle disease virus (Newcastle disease virus, NDV), 71 (Enterovirus 71) and opening number of formula (foot fmcv mouth of disease virus) gene selected from the group consisting of preferably but not limited. Effect of the present invention, nozzle, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction extract or some combination of the food product mixture extract mixture extract alone (effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc and glycyrrhizae) safflower billion compared to viral infections characterized by an X-number. In the embodiment of the present invention in particular, the victims of the effect the present invention, nozzle, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction number total cholesterol to high pressure liquid coolant, mixed extract of the present invention vary characteristic stomatitis virus infection (trypan blue staining) fluorescence microscopy method results confirming the trip plate blue dyeing billion number effect, virus infecting mixture extract of the present invention compared to a location only when the virus when infecting virus whose fluorescence is reduced while number representing verify prevention have (reference 1 also), infecting virus mixture extract of the present invention compared to when only a location when the virus after infection is increased cell survival, the virus has been confirmed that the present shift cells (also reference 2). In addition, the present invention of the present invention mixed extract Newcastle disease virus infection billion number effect the victims of the fluorescence microscopy, trip plate blue dyeing method and rT-a pCR assay results confirm, virus infecting mixture extract of the present invention compared to when only a location number representing the virus when infecting virus whose fluorescence is reduced while making sure that the prevention (also 3 reference) have, virus infecting mixture extract of the present invention compared to when only a location when the virus after infection is increased cell survival, cell proliferation billion number has been confirmed that the virus is present (reference 4 also). In addition, the present invention the extract of the present invention mixed to with reel victims of the trip plate blue dyeing method results identified by fluorescence microscopy 71 billion number effect virus infection, virus when infecting virus infecting only after processing of the present invention compared to total cholesterol mixture extract of the present invention increases when the concentration of theCell survival along regions (reference 5 also) has been confirmed. In addition, the present invention of the present invention in addition to the victims of the comparison example 1><mixture extract product extract and extract of Newcastle disease virus infection and rT-a pCR result analyzed by identifying number effect billion fluorescence microscopy, fluorescence microscopy after time 12 and applying to the infecting Newcastle disease virus, food product of the present invention as compared to the comparison example 1><extract and extract of total cholesterol number representing a location when the virus infecting virus prevention while making sure that the fluorescence have formula (6 also reference), Newcastle disease virus infecting the 24 time and after applying to the fluorescence microscopy, fluorescence has been completed 12 than strongly against GDNF is confirmed, food product of the present invention as compared to the comparison example 1><extract and extract of total cholesterol number representing a location when the virus infecting virus whose fluorescence is significantly reduced when the prevention while verify (also reference 7), when analyzed by rT-a rCR confirmed, food product of the present invention treated extract of total cholesterol compared to comparison example 999000126 3999<extract and the virus after infection when the virus has been confirmed that the present cell proliferation significantly billion number (8 also reference). The, effect of the present invention, nozzle, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction mixed extract vesicular characteristic stomatitis virus, Newcastle disease virus, inverse number of formula 71 and opening syndrome virus infections cells cells longevity and survival, which reduces a number of intracellular virus formate less, when the verify intracellular virus proliferation of billion number, product of the present invention mixed extract compared to viral infections in some combination extract or extract of significant effect by making sure that the vesicular characteristic stomatitis virus billion number, Newcastle disease virus, number of formula 71 and opening antiviral composition can be useful for gene. Number said of the present invention commonly used pharmaceutical composition of the bath composition suitable carrier, excipient can be dilution number and number further comprises. Said of the present invention composition can be oral or parenteral administration, or external skin upon parenteral administration intraperitoneally scanning, scanning in colorectal cancer, hypodermic injection, intravenous injection, intramuscular injection or thorax scanning injection scheme is preferably in selecting, limited to are not correct. Said of the present invention composition, an acid number each according to conventional method, granules number, positive number, number capsule, suspension, emulsion, syrup, aerosol such as oral number type, external number, can be in the form of a sterile injection solution and left number elder brother anger number on a window. Said carriers included within the composition, number and peak dilution number excipients include lactoperoxidase, dextran lactose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate and mineral oil is cited. If guaranteed number number number under anger normally used, a specific number, number coupled, wet number, number disintegrating, dilution number number number or excipients such as surfactants using tank number with each other. Positive number number number is solid for oral administration, ring number, acid number, granules number, number or the like included in a capsule, such solid number number is a hot-water extraction, therefore, Ginseng and honey in a mixture of at least one excipient number for example, starch, calcium purification (calcium carbonate), sucrose (sucrose) or lactose (lactose), gelatin tank pressure is lowered number with each other. In addition, simple number excipients in addition to the magnesium stearate, talc such as lubricating number are also are used. For liquid oral suspension include number number number, number content, oil number, which number syrup like a simple dilution number corresponding commonly used in water, in addition to the paraffin droplet number various excipients, for example wet number, sweetener number, direction number, number and the like can be preserved. For parental administration number number is a sterile aqueous solution, non-aqueous for number, number suspension, oil number, freeze-dried number number, number left multiple myelomas are included. Non-aqueous for number, number suspension include propylene glycol (propylene glycol), polyethylene glycol, vegetable oil such as olive oil, an injectable [...] ethyl ester is used as the alkali such as can be. (Witepsol) include [...] left number for number, mark with goal, twin (tween) 61, carcass five fingers, the it soaked, can be characteristically preparing number is used as the alkali. The preferred dosage of the present invention composition to a patient's state and body weight, degree of disease, forms, according to the stated time routes of different but, can be appropriately selected by one skilled. However a strong to, said composition 1 0. 0001 to to 1 g/kg, preferably 0. 001 to 200 mg/kg preferably but not limited to administering. Said administration may be administered once per day, divided many times may be administered disapproval. Any surface or limit the scope of the present invention said dosage is way are not correct. In addition, the present invention refers to effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck directionunder public affairs health food mixture extract having antiviral bondable number 2000. 1 parts by weight of said mixed extract flavonoid effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, lonicera, each original and neck direction 0. 5 to 5 parts by weight of extracted ratio preferably contains one selected from, said water mixture extract, C1 - C2 Of lower alcohols, or a combination of solvent is preferably prepared by the number by extracting, preferably said lower alcohol is methanol or ethanol. Said virus is vesicular characteristic stomatitis virus, Newcastle disease virus, a gene selected from the group consisting of formula 71 and opening number consisting preferably but not limited. Effect of the present invention, nozzle, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction extract or some combination of the food product mixture extract mixture extract alone (effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc and glycyrrhizae) safflower billion compared to viral infections characterized by an X-number. Effect of the present invention, nozzle, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction mixed extract vesicular characteristic stomatitis virus, Newcastle disease virus, inverse number of formula 71 and opening syndrome virus infections cells cells longevity and survival, which reduces a number of intracellular virus formate less, when the verify intracellular virus proliferation of billion number, product of the present invention mixed extract compared to viral infections in some combination extract or extract of significant effect by making sure that the vesicular characteristic stomatitis virus billion number, Newcastle disease virus, virus inverse number of formula 71 and opening can be useful antiviral health food. In order to of the present invention mixed extract said antiviral such as used, in various publicly known method number field number or drug owing to the food by food itself or a cosmetically acceptable carrier can be tank, excipient number, and consequently dilution number orally can be taken as any food form number bath 1308. Preferably beverage, ring, granules, capsules or in the form of positive number. Health food product of the present invention, food when the food component is typically added so as to number bath further comprises a cosmetically acceptable can be. For example, if in addition to the bath of the present invention to number beverage mixture extract citric acid, liquid and an oligosaccharide, sugar, glucose, acetic acid, malic acid, further comprises at least one component capable of juice or the like. The present invention according to health functional foods for human health food can be active ingredient desired antiviral amount age, sex, weight, state, can be appropriately selected according to disease conditions, preferably adult reference 1 0. 01 g to 10. 0 g extent incorporated pleasant, such content can be achieved at a health food antiviral effect food. In addition, the present invention refers to effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction pharmaceutical composition for prevention and treatment of viral containing cholesterol number under public affairs substrate. 1 parts by weight of said mixed extract flavonoid effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, lonicera, each original and neck direction 0. 5 to 5 parts by weight of extracted ratio preferably contains one selected from, said water mixture extract, C1 - C2 Of lower alcohols, or a combination of solvent is preferably prepared by the number by extracting, preferably said lower alcohol is methanol or ethanol. Said viral disease is vesicular characteristic stomatitis, Newcastle disease, extremities nine bottles, meningitis, number selected from the group consisting of herpes-throat salt and vice versa opening preferably but not limited. Effect of the present invention, nozzle, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction extract or some combination of the food product mixture extract mixture extract alone (effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc and glycyrrhizae) safflower billion compared to viral infections characterized by an X-number. Effect of the present invention, nozzle, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction mixed extract vesicular characteristic stomatitis virus, Newcastle disease virus, inverse number of formula 71 and opening syndrome virus infections cells cells longevity and survival, which reduces a number of intracellular virus formate less, when the verify intracellular virus proliferation of billion number, product of the present invention mixed extract compared to viral infections in some combination extract or extract of significant effect by making sure that the vesicular characteristic stomatitis virus billion number, Newcastle disease virus, viral disease of formula 71 and opening inverse number virus can be useful pharmaceutical compositions for prevention and treatment. In addition, the present invention refers to effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction viral disease and non-allergic food containing cholesterol number under public affairs substrate. 1 parts by weight of said mixed extract flavonoid effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, lonicera, each original and neck direction 0. 5 to 5 parts by weight of extracted ratio preferably contains one selected from, said water mixture extract, C1 - C2 Of lower alcohols, or a combination of solvent is preferably prepared by the number by extracting, preferably said lower alcohol is methanol or ethanol. Said viral disease is vesicular characteristic stomatitis, Newcastle disease, extremities nine bottles, meningitis, number selected from the group consisting of herpes-throat salt and vice versa opening preferably but not limited. Effect of the present invention, nozzle, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction extract or some combination of the food product mixture extract mixture extract alone (effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc and glycyrrhizae) safflower billion compared to viral infections characterized by an X-number. Effect of the present invention, nozzle, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction mixed extract vesicular characteristic stomatitis virus, Newcastle disease virus, inverse number of formula 71 and opening syndrome virus infections cells cells longevity and survival, which reduces a number of intracellular virus formate less, when the verify intracellular virus proliferation of billion number, product of the present invention mixed extract compared to viral infections in some combination extract or extract of significant effect by making sure that the vesicular characteristic stomatitis virus billion number, Newcastle disease virus, viral disease of formula 71 and opening number for health food for preventing and improving gene can be useful. Hereinafter, the present invention in the embodiment by a detailed as follows. Stage, in the embodiment for the present invention is exemplified ephemeral is, in the embodiment of the present invention to not the limited to contents. <In the embodiment 1>effect, wind, Angelica gigas Nakai, food product, Blood glucose, Mint leaf, hwang E, watch beginning, Therefore, Gypsum, around route, gold, agent, user it buys, Granule, Ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction mixed extract number bath Once all domestic energy to the sample at night. Table 1 composition in water to about 49 g pumpkin 1 l after 1 time was left at room temperature to 100 parts by mass. Then, an extract was obtained in about 100 ml volume of 100 °C 3 hours total cholesterol, total cholesterol about 9 said freezing and drying. 6 g freeze dry matter by Congress. The present invention mixed extracts as well as said plane of the freeze. Mixed extract as hereinafter of the present invention are described. <Comparison example 1>effect, wind, Angelica gigas Nakai, food product, Blood glucose, Mint leaf, hwang E, watch beginning, Therefore, Gypsum, around route, gold, agent, user it buys, Granule, Ginger, talc and number of crude extract Once all domestic energy to the sample at night. Table 2 composition in water to about 43 g pumpkin 1 l after 1 time was left at room temperature to 100 parts by mass. Then, an extract was obtained in about 100 ml volume of extract 100 °C 3 time, freezing and drying said extract about 10. 5 g freeze dry matter by Congress. Said extracts as well as freeze plane of the present invention. As comparison example 1>hereinafter<mixed extract are described. <Comparison example 2>processed extract number bath Once domestic food product sample at night. After 1 time was about 50 g 1 l product water to 100 parts by mass is left at room temperature. Then, about 100 ml volume of food product extract 100 °C 3 time in an extract was obtained, about 8 g said freezing and drying the extract product freeze dry matter by Congress. The present invention product extracts as well as said plane of the freeze. Extract processed as hereinafter are described. <In the embodiment 2>cell culture Mouse macrophage cell line RAW 264. 7 10% bovine fetal serum (Fetal bovine serum, FBS) cells or human cervical cancer cell lines HeLa cells, 100 μg/ml DMEM (Dulbecco's modified Eagle's medium) 100 U/ml penicillin-resistant Streptococcus pneumoniae (penicilin) and Streptococcus feed (streptomycin) included in the him as using (Invitorgen Life Tehchnologies). Said cells 37 °C, 95% humidity, 5% CO2 Condition 2 to 3 when the new culture was cultured in incubator each involve passaging. <In the embodiment 3>of the present invention mixed extract Vesicular characteristic stomatitis virus(VSV-GFP) Identifying number billion infection <3-1> Identifying number of viral infections billion utilizing fluorescence microscopy Mixed extract of the present invention vary characteristic stomatitis virus infection billion number effect therefrom. Specifically, RAW 264. 7 cells 1 × 10 to 24 well plate5 DMEM/10% FBS containing medium 24 is to insulate the cells by dividing the culturing time, said in the embodiment <1-1>High pressure liquid coolant in mixed extract number 0. 9 mg/ml 12 him as further time after processing. After a further 12 hours then vesicular it is a characteristic stomatitis virus 1 MOI vSV-a gFP infecting him as. At this time, a positive controls to 1000 U/ml iFN β (interferon β) was used. Fluorescence microscopy observed through same. As a result also 1 as shown, when the processing of the present invention as compared to the virus after virus infection only total cholesterol while reducing the virus when infecting number representing the fluorescence has been confirmed that the prevention (also 1). <3-2> Trip plateBlue Dyeing (TrypanBlueStaining) Method of viral infections using identifying number billion Effects of the present invention mixed extract for trip plate blue dyeing method number billion vesicular characteristic stomatitis virus infection using cell survival and cell present virus number therefrom. Specifically, in the embodiment said <3-1>The culture cells cultured cells number 0 and the same method of media alone. 05% in phosphate buffer saline solution (phosphate buffered saline, PBS) suspending the trypsin-a eDTA processing cells by adding cells to 5 minutes then centrifuging each per well raising and lowering the aggregate was 2,000 rpm. A number added to a 1 ml PBS then again only a stand-alone while leaving the cell supernatant is mixed with cells following suspension and 0. 5% trypan blue (Gibco BRL) 2 minutes after mixing a comparable Image of the microscopes was counting living cells. At this time, as well as a positive controls to 1000 U/ml iFN β. For percentage of survival rates shown in a medium. As a result also 2 as shown, only when the virus of the present invention the virus after infection as compared to total cholesterol is increased cell survival when treated to infection, the virus has been confirmed that the present shift cells (2 also). <In the embodiment 4>of the present invention mixed extract Newcastle disease virus (NDV-GFP) Identifying number billion infection <4-1> Identifying number of viral infections billion utilizing fluorescence microscopy In the embodiment of the present invention effect said number of Newcastle disease virus infection billion total cholesterol <3-1>In Newcastle disease virus (nDV-a gFP) leaf then the same method has been confirmed. As a result also 3 as shown, when the processing of the present invention as compared to the virus after virus infection only total cholesterol while reducing the virus when infecting number representing the fluorescence has been confirmed that the prevention (3 also). <4-2> Trip plateBlue Dyeing and Reverse transcriptase Polymerase chain reaction (RT-PCR, Reversetranscription-a polymeraseChainReaction) Identifying number of viral infections using billion Effects of the present invention mixed extract Newcastle disease virus infection billion number for a dye is checked against a trip plate blue cell survival, rT-a pCR assays using cells present virus number therefrom Specifically, in the embodiment the trip plate blue dyeing <3-2>Using method identical to have, in the embodiment such an assay said rT a-pCR <3-1>A culture method using 4 °C cells stored in PBS was cut into scraper cells are separated. Said isolated cells 1,200 rpm, 4 °C 2 minutes centrifuging the supernatant in a pellet (pellet) has surpassed a obtained. Then, the performance of a protocol (Qiagen, Valencia, CA) number in number irradiation using a total RNA extracted from the RNeasy Plus Mini Kit. The A260/280 ratio (Versa Max microplate reader, Molecular Devices) obtained by dissolving a RNA using DEPC processing distilled to a purity and concentration measuring absorbance therefrom. Performing polymerase chain reaction (rT-a pCR) reverse transcriptase - Verbose mRNA expression has been confirmed. RNA oligo (dt) of a comparable15 PrimerAfter Power SYBR Green PCR Master Mix (Applied Biosystems) using a time-pCR cDNA into a PCR machine (Applied Biosystems) using PCR system 7500 Fast Real reagents with the conducting. PCR conditions in 20 seconds 50 °C, GAPDH protein in 10 minutes 95 °C Matrix (M) relative order between band strength shown. Said rT-a pCR primer used in table 3 represented such as disclosed. As a result also 4 as shown, only after processing of the present invention compared to total cholesterol when infecting virus when infecting virus is increased cell survival, cell proliferation billion number has been confirmed that the virus is present (4 also). <In the embodiment 5>of the present invention mixed extract Formula 71 (EV71) Identifying number billion infection Extract of the present invention mixed infection of formula 71 billion number effect therefrom. Specifically, 1 × 10 HeLa cells 24 well plate5 DMEM/10% FBS containing 24 h to insulate the cells by dividing the medium during the culturing, each 0 total cholesterol of the present invention. 5, 1, 2% 12 him as further time after processing. In a further 12 hours after 1 MOI EV71 of formula 71 then infecting him as. At this time, as well as a positive controls to 1000 U/ml iFN β. Have same observable via microscope, using culturing said cells in the embodiment <3-2>The trip plate blue dyeing method identical to the cell survival has been confirmed. As a result also 5 as shown, virus infection as compared to a location of the present invention only when the mixture extract of the present invention increases when the concentration of the virus infecting the mixture extractCell survival along regions (5 also) has been confirmed. <In the embodiment 6>of the present invention and other cholesterol formation of Newcastle disease virus (NDV- GFP) identifying number billion infection <6-1> 12 billion number identifying various viral infections has been completed formation of viral infections Mixture extract of the present invention, processed extract and extract of Newcastle disease virus infection in the embodiment example 1><billion number effect said comparison <3-1>The same method after processing each extract two concentration, Newcastle disease virus (nDV-a gFP) 12 and after time to infection has been confirmed. As a result also 6 as shown, food product of the present invention as compared to the comparison example 1><extract and extract of the virus after infection the virus mixture extract number representing a location when the fluorescence while significantly reducing the prevention has been confirmed (6 also). <6-2> 24 billion number identifying various viral infections has been completed formation of viral infections Mixture extract of the present invention, processed extract and extract of Newcastle disease virus infection in the embodiment example 1><billion number effect said comparison <3-1>The same method after processing each extract two concentration, Newcastle disease virus (nDV-a gFP) 24 and after time to infection has been confirmed. As a result also 7 as shown, Newcastle disease virus leaf then 12 time candidate disclosed whose fluorescence is strongly against GDNF, food product of the present invention as compared to the comparison example 1><extract and extract of total cholesterol number representing a location when the fluorescence while significantly reducing the virus infecting virus prevention has been confirmed (also 7). <6-3> RT-PCR Employing billion identifying number of viral infections Mixture extract of the present invention, processed extract and comparison example 1><extract of Newcastle disease virus infection billion number for said effects in the embodiment <4-2>After processing each extract method identical to the two concentration, rT-a pCR assays using cells present virus number therefrom. As a result also 8 as shown, Newcastle disease virus infecting only to 100% when the viewed, when about 75% have reduced proliferation of virus processing product extract, an extract of comparison example 1><about 55% virus proliferation is decreased while when processing, when processing of the present invention about 100% total cholesterol reducing proliferation of virus has been confirmed (also 8). The, food product of the present invention as compared to the comparison example 1><extract and extract of total cholesterol present virus when infecting cells after processing virus proliferation is significantly billion number has been confirmed. The present invention relates to a composition including mixed extract of Cnidium officinale MAKINO, Ledebouriella seseloides WOLFF, Angelica gigas, peony roots, Forsythia suspensa Vahl, Mentha arvensis leaves, ephedra, Canadian horseweed, rhuubarb, gypsum, Platycodonis Radix, skullcap, Atractylodes macrocephala Koidzumi, Gardenia jasminoides, Schizonepeta tenuifolia Briquet, ginger, talc, licorice, Epimedii Herba, Lonicera japonica, Polygala tenuifolia and Aucklandiae Radix. It is shown that the composition enhances survival of cells, reduces the number of viruses and inhibits intracellular proliferation of viruses in the cells infected with viruses, such as Vesicular Stomatitis Virus (VSV), Newcastle disease virus(NDV), Enterovirus 71 and Foot-and-mouth disease virus. It is also shown that the mixed extract provides a significantly higher effect in terms of inhibition of viral infection, as compared to Paeonia lactiflora extract or extract of a partial combination. Therefore, the composition can be useful as an antiviral composition against Vesicular Stomatitis Virus (VSV), Newcastle disease virus(NDV), Enterovirus 71 and Foot-and-mouth disease virus. Effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction mixture extract containing active ingredient pharmaceutical compositions for the prevention and treatment of vesicular characteristic stomatitis virus (Vesicular Stomatitis Virus, VSV). According to Claim 1, 1 parts by weight of said mixed extract flavonoid effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, lonicera, each original and neck direction 0. 5 to 5 parts by weight of mixed ratio characterized as an pharmaceutical composition. According to Claim 1, said mixture extract water, C1 - C2 Of lower alcohols, or a combination of pharmaceutical compositions prepared by the number characterized by extracting solvent. According to Claim 3, characterized in that said pharmaceutical composition is lower alcohols methanol or ethanol. Effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction extract containing vesicular characteristic stomatitis virus health food for preventing and improving mixing. According to Claim 5, 1 parts by weight of said mixed extract flavonoid effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, lonicera, each original and neck direction 0. 5 to 5 parts by weight of a mixture ratio selected from a extract of white as a health food. Effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, total cholesterol containing vesicular characteristic stomatitisneck direction original and active ingredient for prevention and treatment of pharmaceutical composition. According to Claim 7, 1 parts by weight of said mixed extract flavonoid effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, lonicera, each original and neck direction 0. 5 to 5 parts by weight of mixed ratio characterized as an pharmaceutical composition. Effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, flavonoid, lonicera, extracting and neck direction extract containing vesicular characteristic stomatitis health food for preventing and improving mixing. According to Claim 9, 1 parts by weight of said mixed extract flavonoid effect, wind, Angelica gigas Nakai, food product, blood glucose level, mint leaf, hwang E, watch beginning, therefore, gypsum, around route, gold, agent, user it buys, granule, ginger, talc, licorice, lonicera, each original and neck direction 0. 5 to 5 parts by weight of a mixture ratio selected from a extract of white as a health food. materials life Weight (g) Flavonoid 1. 69 Lonicera 1. 69 Extracting 1. 69 neck direction 1. 69 Effect 1. 69 Bearing 1. 69 Angelica gigas Nakai 1. 69 Food product 1. 69 Blood glucose 1. 69 Mint leaf 1. 69 hwang E 1. 69 watch beginning 1. 69 Therefore 1. 69 Gypsum 2. 62 around route 2. 62 Gold 2. 62 An agent 1. 31 User it buys 1. 31 Granule 1. 31 Ginger 4. 6 Talc 6. 37 Licorice 4. 5 materials life Weight (g) Effect 1. 69 Bearing 1. 69 Angelica gigas Nakai 1. 69 Food product 1. 69 Blood glucose 1. 69 Mint leaf 1. 69 hwang E 1. 69 watch beginning 1. 69 Therefore 1. 69 Gypsum 2. 62 around route 2. 62 Gold 2. 62 An agent 1. 31 Gardenia 1. 31 Granule 1. 31 Ginger 4. 5 Talc 6. 37 Licorice 4. 5 Gene object Primer Name Sequence Direction Sequence number aPMV-a 1 M aPMV provided _F 1M AGTGATGTGCTCGGACCTTC Forward Seq ID no: 1 aPMV provided _R 1M CCTGAGGAGAGGCATTTGCTA Reverse Seq ID no: 2 GAPDH GAPDH_F TGACCACAGTCCATGCCATC Forward Sequence number: 3 GAPDH_R GACGGACACATTGGGGGTAG Reverse Seq ID no: 4
