Bacterial nitroreductase for the reduction of CB 1954 and analogues thereof to a cytotoxic form

BACTERIAL NITROREDUCTASE FOR THE REDUCTION OF CB 1954 AND ANALOGUES Thereof to a'CVTOTOxIC FORM '

THIS INVENTION relates to the control of neoplastic tissue growth and is particularly concerned with the provision of new anti-tumour agents and with enzymes capable of converting prodrugs into anti-tumour agents.

The alkylating agent 5-(aziridin-l-yl)-2,4-dinitrobenzamide (hereinafter designated CB 1954) has been known, almost for 2Q years, as an interesting experimental compound of unique selectivity. Although CB 1954 is structurally quite closely related to numerous other known alkylating agents which have a relatively broad range of activity, CB 1954 exhibits considerable activity against the Walker tumour cells in vivo or in vitro but was thought to be virtually inactive against other tumours*

It was recently discovered that the selectivity of CB 1954 arose from the fact that it was not an anti-tumour agent per sc but was a prodrug for an anti-tumour agent generated from CB 1954 by a nitroreductase enzyme found in the Walker cell. This nitroreductase from the Walker cell was subsequently shown to be an enzyme known from other sources which was an ΝΑϋ(Ρ)Η dehydrogenase (quinine) classified as EC.1.6.99.2, see Robertson fi£ fil, J. Biol. Cham. 261. 15794-15799 (1986).

In the course of the previous investigations with CB 1954, it was found that the Walker cell enzyme EC.1.6.99.2 had the ability to reduce the 4-nitr© group of CB 1954 to the corresponding hydroxylamine and that it was the resulting 5-(aziridin-l-yl)-2-nitro-4-hydroxylamino-benzamide that was the active anti-tumour agent.

The use of prodrugs represents a clinically very valuable concept in cancer therapy since, particularly where the prodrug is to be converted to an anti-tumour agent under the influence of an enzyme that is linkable to a monoclonal antibody that will bind to a tumour associated antigen, the combination of such a prodrug with such an enzyme monoclonal/antibody conjugate represents a very powerful clinical agent,

We have now discovered new nitroreductases, obtainable from bacterial sources, that are of interest in that not only are they capable of converting CB 1954 into an active anti-tumour agent, but also, unlike EC.1.6.99.2, capable of converting CB 1954 analogues which are also prodrugs into active anti-tumour agents.

Figure 1 shows the results of an experiment in which CB 1954 (ΐ00μΜ) and reduced cofactor (500μΜ) were incubated with enzyme (2mg/ml) £. coli nitroreductase (A) or 25^g/ml Walker DT diaphorase (Β) in lOmM sodium phosphate buffer (ρΗ7) in air at 37°c. At various times aliquots (10μ1) were injected onto a Partisil SCX (240 χ 4.7mm) HPLC column and eluted isocratically (2ml/min) with lOOmM NaH₂PO«. The eluate was continuously monitored for absorption at 320, 260 and 360 nm and the concentration of CB 1954 calculated by integration of the peak corresponding to this compound on the HPLC trace.

Figure 2 shows the formation of actinomycin D (AMD) during incubation of an AMD prodrug with a nitroreductase of the present invention.

Figure 3 shows the formation of mitomycin C (MC) during incubation of an MC prodrug with a nitroreductase of the present invention,

Figure 4 shows the binding in vitro of an antibody-enzyme conjugate according to the invention to cells,

The present invention provides a nitroreductase, obtainable from a bacterium having the following characteristics as exemplified by examples isolated from Escherichia ccli £ and Bacillus apyiflligaiiASLifingt

1* It is a flavoprotein having a molecular weight in the range 20-60 Kilodaltons;

2 It requires either ΗΑ0Η or ΝΑ0(Ρ)Η or analogues thereof as a cofactor.

3. It has a Km for NADH or NAD(P)H in the range

1-100μΜ.

4. It is capable of reducing either or both nitro groups of CB 1954 and analogues thereof to a cytotoxic fora e.g. the hydroxylamine.

The nitroreductases of the invention occur naturally within the cells of £. Β , £. coli C and other £. coli strains e.g.

Κ12 type as well as other graa negative organisms e.g. Thermos acruaticus. and gram positive bacteria such as Bacillus affiYlQlismfaQjgns and Bacillus caldotenax. They can be recovered from such cells by disrupting the cells and subjecting the cell Contents to chromatographic separation and isolating the nitroreductase.

For example, the nitroreductase of the present invention from £. coli Β has been purified to homogeneity - see Table l and has been subjected to amino acid sequence analysis with the results set out in Table 2. The upper sequence shows the deduced amino acid sequence of the 219-mer nitroreductase obtained from Salmonella typhimurium as described by Watanabe et al. Nucl. Acids, Res. 1£, 1059 (1990). The lower sequence in bold type shows the sequence of the cyanogen bromide fragments of the £. coli Β nitroreductase as an example of the present invention showing a certain degree of homogeneity but sufficient differences to confirm that it is nitroreductase that is different from that of Watanabe £& α1 end the recently described Enterobacter cloacae nitroreductases, see Bryant fjfc al. j. Biol Cheffl. 266. 4126 (1991) or the Walker cell nitroreductase and is a previously unreported enzyme.

The amino acid sequence of the £. coli Β nitroreductase of the invention can also been derived from sequencing the nucleotides in the nitroreductase gene and these sequences are set out below in Table 3. The nucleotide sequence of fable 3 has been used to prepare the attached sequence listings,

WO 4

using the information in Table 3, a nitroreductase according to the present invention may be prepared by expressing DNA encoding the nitroreductase in a suitable expression vector contained in a host cell, and recovering the nitroreductase.

The expression vector may be, for example, a bacterial, yeast, insect or mammalian expression vector and the host cell will be selected to be compatible with the vector.

As indicated above, the new enzymes of the present invention are capable of reducing a nitro group in various substrate molecules and we have found that the enzymes are particularly useful in their ability to reduce the nitro group of various ρnitrobenzyloxycarbonyl derivatives of cytotoxic compounds to give "self-immolative" compounds that automatically decompose to release cytotoxic compounds.

The interest in the present approach resides in the fact that the cytotoxicity of various cytotoxic compounds containing amino or hydroxy substituents, particularly aromatic amino or hydroxy substituents give rise to p-nitrobenzyloxycarbonyl derivatives of the amino or hydroxy group which exhibit considerably less cytotoxicity than the amino or hydroxy parent compound. Thus, it is possible to use the p-nitrobenzyloxycarbonvl derivatives as prodrugs in a system of the type discussed above where the prodrug is converted into an anti-tumour agent under the influence of an enzyme that is linkable to a monoclonal antibody that will bind to the tumour associated antigen.

Accordingly, the present invention provides new compounds of the general formula:

1

and:

R^J-0. CO. 0 . ℮Η·

II

where R¹ and R² are groups such that the compound R‘NH₂ and R²OH are cytotoxic compounds.

It is preferred that compounds R‘NH₂ and R²OH are aromatic cytotoxic compounds and the compounds R‘NH₂ can be any one of the well known nitrogen mustard compounds, for example based on p-phenylene diamine. Thus, the compound R‘NH₂ can be:

III

or analogues of this compound with the general structure IV

IV

where R' and R" are Η, F or CH₃, and particularly where

R' - Η and R" * CH,;

or R' - CHj and R^M » Η;

or R' - Η and R" - F;

or R' * F and R^M » Η.

A further type of amino cytotoxic compound that can be used in accordance with the present invention are compounds such as actinomycin D, doxorubicin, daunomycin and mitomycin C. The structure of the pro-drugs derived from actinomycin D, doxorubicin and mitomycin C are shown below as 3Σ, ]£I and VII respectively.

SUBSTITUTE SHEET

- 7

PCT/GB 3 2/ο 194 7 it Hmtmaei Similar p-nitrobenzyloxy derivatives can be made at the amino substituent of other actinomycins and of the other cytotoxic compounds of the type mentioned above.

In addition to forming p-nitrobe.nzyloxycarbonyl derivatives at an amino group on a cytotoxic compound, similar derivatives can be made at a hydroxy group, particularly a phenolic hydroxy group of a cytotoxic compound. Here, attention is directed at the phenolic nitrogen mustard compounds, and a specific compound of the invention of this type is of the formula:

VIII

The new enzymes of the present invention are capable not only of reducing at least one of the nitro groups of CB 1954 but also at least one of the nitro groups of certain CB 1954 analogues, e.g. descarboxamido CB1954 (l-aziridin-l-yl-2,4-dinitrobenzamide - known as CB 1837) and N,N-dimethyl CB 1954 [N,N-dimethyl-(5-aziridin-l-yl-2,4-dinitrobenzamide also known as CB 10-107]. The new enzymes of the present invention are also capable of reducing the nitro groups of other aromatic nitro compounds such as 5-chloro-2,4-dinitrobenzamide, 3,5-dinitrobenzamide, 3-nitrobenzamide, 4-nitrobenzamide and 5-nitro-2-furaldehydesemicarbazone (nitrofurazone).

The present invention also provides hydroxylamino derivatives of the general formula X:

United Kingdom Patent Office

PCT International Application

SUBSTITUTE SHEET

8 id Wovtabw l?9|

wherein X¹ and X², which may be the same or different, are each NHOR⁵ or N0₂ with the proviso that X¹ and X² are not both N0₂, where R⁵ is Η or a carboxylic acyl or hydrocarbyl group as defined above in relation to formula. XX-and Υ is Η or CON(CH₃)₂, In the compounds of formula X containing two hydroxylamino groups, the group R can be the same or different but will normally be the same.

As mentioned above, the new p-nitrophenylbenzyloxy compounds of the invention of formulae I and II are of interest in that they have a reduced cytotoxicity compared to that of the cytotoxic compound r'nh₂ or R²OH from which they are derived and they are

I United Kingdom Patent Office SUBSTITUTE SHEET j PCT International Application

capable of acting as a substrate for the nitroreductase of the present invention. While the present invention is not dependent, for its definition, upon the exact mode of action of the nitroreductase on the compound of formula I or II, it is believed that the nitro group of the p-nitrophenyl-benzyloxycarbonyl residue is converted to the corresponding amino or hydroxylamino group and that the resulting p-aminobenzyloxycarbonyl or p-hydroxyl-aminobenzyloxycarbonyl compound automatically degrades under the reaction conditions used for the enzymatic reduction to release the cytotoxic compound and form p-aminobenzyl alcohol or p-hydroxylaminobenzyl alcohol and carbon dioxide as by products in accordance with the following reaction scheme:

NQ₂nitroreductase R'-NH-CO.O.CHj ^ ^-NH₂

The p-nitrobenzyloxycarbonyl compounds of the invention are conveniently prepared by methods of chemical synthesis known per se. For example, the amine or hydroxy cytotoxic compounds can be reacted with 4-nitrobenzyl chlorofornate under anhydrous conditions in the presence of a hydrogen chloride aceptof, particularly an alkylamine such as triethylamina. This reaction can be carried out in a dry organic solvent such as chloroform and the resulting compound of the invention of formula I or formula II isolated from the organic solvent by conventional methods such as chromatography.

The new compounds of the present invention IX and X will normally be prepared by subjecting the corresponding dinitro compound to the action of the new nitroreductase of the present invention. It is, of course, also possible to produce the new compounds of the present invention IX and X by chemical synthesis, using selective reducing agents followed by conversion of the resulting hydroxylamine to its corresponding ester or ether. The esters and ethers are more conveniently prepared semi-synthetically by carrying out the reduction of the nitro group with the nitroreductase of the present invention to give the corresponding hydroxylamine that is then converted by known chemical methods to the corresponding ester or ether.

One of the most convenient ways of producing the new nitroreductase of the invention is to recover the material from the cell contents of bacteria such as £. coli Β.

Alternatively, it is possible to clone the gene, isolatable from the bacteria, encoding the desired enzyme and to transfer the cloned gene, in a suitable vector system, into another host cell from which or in which it can be expressed.

In order to bring about the enzymatic reduction of €B 1954 and its analogues with the new enzymes of the present invention, it is necessary to have a cofactor present in the reaction system. The ability of the enzyme of the present invention to bring about this reduction can be demonstrated experimentally by the use of NADH or NAD(Ρ)Η as the cofactor but the use of such eofactors in clinical practice may be problematic in view of the ease with which ΝΑ0(Ρ)Η particularly is oxidised by other enzymes present in the body and the lack of selectivity of the cofactors between the various mammalian and non-mammalian enzymes. We have now found that the riboside of 1,4-dihydronicotinic acid is as least as effective as a cofactor in the nitroreductase reduction of CB 1954 and analogues thereof and moreover, because of its selectivity to the £. coli nitroreductase of the invention, is more suited to clinical use which makes its incorporation in a multi-component system of the type described below particularly valuable.

The riboside of 1,4-dihydro-nicotinic acid which can be used in the present invention as a cofactor is a new compound and forms part of the present invention. It can be prepared from commercially available nicotinic acid ribotide which is first converted to the corresponding riboside by enzymatic dephosphorylation e.g. using an alkaline phosphatase. The riboside, obtained by such enzymatic dephosphorylation, or by chemical synthesis, using the method described by Jarman, J.

Chem. Soc. (c) 918-920 (1969) can then be reduced, e.g. using an alkali metal hydrosulphite, to give l,4-dihydro-nicotinic acid riboside.

One of the most important practical applications of the new enzymes of the present invention is that they can be used in association with nitro compounds that are prodrugs for anti-tumour agents and so provide a system of cancer chemotherapy where the extent of exposure of the patient to the cytotoxic agent is limited, so far as possible, to those regions where there is the interaction between the prodtug and the nitroreductase of the invention. Thus, οή℮ aspect of the present invention is to provide a method of chemotherapy and a system for chemotherapy involving the conjoint use of the nitroreductase of the present invention in association with a nitro compound which is a prodrug for a cytotoxic compound.

The most or one of the most convenient ways of utilising the system of the present invention is to conjugate the nitroreductase of the present invention to a targeting agent such as a monoclonal antibody that will bind with a tumour-associated antigen.

As used herein, the term "monoclonal antibody" will be understood by those of skill in the art not simply to refer to antibodies produced by traditional hybridoma techniques, but also to cover antibodies and variants thereof produced by recombinant means. These include, for example, humanised antibodies such as those with a constant region from a human antibody grafted onto a non-human antibody variable region (see for example ΕΡ-λ-0 120 694), chimeric antibodies such as those with non-human complementarity determining regions (CDRs) grafted into a human variable region framework (see for example ΕΡ-Α-0 239 400) and single chain antibodies. Fragments of such monoclonal antibodies which retain their target binding activity are also included by the general term “monoclonal antibody". This includes Fab' and F(ab')₂ fragments.

The selection of monoclonal antibody will clearly be influenced by the nature of the target tumour but for the purposes of illustrating the present invention, reference may be made to the anti-CEA antibody Α5Β7.

As an alternative to the c^e of a monoclonal antibody, it is also envisaged that other targeting agents to which the nitroreductase of the present invention is conjugated may be used. For example, it is known that certain soluble macromolecules can be used for passive tumour targeting of certain tumour types. Many solid tumours possess vasculature that is hyperpermeable to macromolecules. Although the reasons for this are not clearly understood, the result is that such tumours can selectively accumulate circulating macromolecules.

The enhanced permeability and retention effect (ERR effect) is thought to constitute the mechanism of action of SMANCS (styrene/malaic-anhydride-neocarzinostatih), now in regular clinical use in Japan for the treatment of hepatoma. Another class of conjugates under investigation for antieancer activity is Ν-(2-hydroxypropyl)methacrylamide eopolymer-anthracycline conjugates (L. Seymour, Critical Reviews in Therapeutic Drug Carrier Systems, 9(2} 135-187 (1992)). Thus, conjugates of a polymer, including styrene/maleic-anhydride or Ν-(2-hydroxypropyl } methacrylamide copolymer, and the nitroreductase of the invention can be used place of conjugates of a monoclonal antibody and enzyme.

with this system, it is possible in a course of cancer chemotherapy to administer to the patient requiring the treatment the nitro compound which is the prodrug for the cytotoxic compound and the enzyme/targeting agent conjugate.

The prodrug and the conjugate can be administered simultaneously but it is often found preferable, in clinical practice, to administer the enzyme/agent conjugate before the prodrug, e.g. up to 72 hours before, in order to give the enzyme/agent conjugate an opportunity to localise in the region of the tumour target. By operating in this way, when the prodrug is administered, conversion of the prodrug to the cytotoxic agent tends to be confined to the regions where the enzyme/agent conjugate is localised, i.e. the region of the target tumour and damage to healthy cells caused by the premature release of the cytotoxic agent is minimised.

The degree of localisation of the enzyme/agent conjugate (in terms of the ratio of localized to freely circuiting active conjugate) can be further enhanced using the clearance and/or inactivation systems described in W089/10140. This involves, usually following administration of the conjugate and before administration of the prodrug, the administration of a component (a "second component") which is able to bind to the such part of the conjugate so as to inactivate the enzyme and/or accelerate the clearance of the conjugate from the blood. Such a component may include an antibody to the nitroreductase of the invention which is capable of inactivating the enzyme.

The second component may be linked to a macromolecule such as dextran, a liposome, albumin, macroglobulin or a blood group 0 erythrocyte so that the second component is restrained from leaving the vascular compartment. In addition or as an alternative, the second component may include a sufficient number of covalently bound galactose residues, or residues of other sugars such as lactose or mannose, so that it can bind the conjugate in plasma but be removed together with the conjugate from plasma by receptors for galactose or other sugars in the liver. The Second component should be administered and designed for use such that it will not, to any appreciable extent, enter the extravascular space of the tumour where it could inactivate localised conjugate prior to and during administration of the prodrug.

The exact dosage regime will, of course, need to be determined by individual clinicians for individual patients and this, in turn, will be controlled by the exact nature of the prodrug and the cytotoxic agent to be released from the prodrug but some general guidance can be given. Chemotherapy of this type will normally involve parenteral administration of both the prodrug and the enzyme/agent conjugate and administration by the intravenous route is frequently found to be the most practical.

Bearing in mind the manner in which the enzymes of the present invention are to be used, the present invention extends to pharmaceutical compositions comprising the enzyme, preferably conjugated to a targeting agent such as a monoclonal antibody capable of binding to a tumour-associated antigen in association with a pharmaceutically acceptable carrier or diluent, normally one suitable for parenteral administration.

The present invention also extends to pharmaceutical compositions comprising one or more of the p-nitrobenzyloxycarbonyl compounds of the present invention of formula I, formula IX, formula V, formula VI or formula vll in association with a pharmaceutically acceptable carrier or diluent, normal one for parenteral administration.

The present invention further extends to pharmaceutical compositions comprising the hydroxylamino anti-tumour agents of the present invention of formula IX or formula X in association with a pharmaceutically acceptable carrier or diluent, normally one for parenteral administration.

The present invention also provides a system for use in the control of neoplasia in a human or animal subject comprising the nitroreductases of the present invention, preferably conjugated with a targeting agent such as monoclonal antibody that will bind to a tumour-associated antigen, in association with at least one of a p-nitrobenzyloxycarbonyl compound of Formula I, II, V, VI or VII which is a prodrug for an anti-tumour agent and preferably a riboside or ribotide of nicotinic acid or nicotinamide to act as a cofactor for the enzyme. The present invention extends to a method of treating neoplasia in a human or animal host requring such treatment which comprises administering to the host an effective amount of a ρnitrobenzyloxycarbonyl compound of Formula I, II, V, VI or VII which is a prodrug for an anti-tumour agent and the enzyme of the present invention, preferably conjugated with a targeting agent such as a monoclonal antibody that will bind to a tumour-associated antigen, the enzyme preferably being used in association with an ribotide or riboside of nicotinic acid or nicotinamide as cofactor for the enzyme.

The present invention further provides a system for use in the control of neoplasia in a human or animal subject comprising a nitroreductase of the present invention, preferably conjugated with a targeting agent such as a monoclonal antibody that will bind to a tumour-associated antigen, in association with a nitro compound which is a prodrug for an anti-tumour agents of the formula IX or X and preferably a riboside or ribotide of nicotinic acid or nicotinamide to act as a cofactor for the enzyme. The present invention also provides a method of treating neoplasia in a human or animal host requiring such treatment which comprises administering to the host an effective amount of a nitro compound which is a prodrug for an anti-tumour agents of the formula IX or X and the enzyme of the present invention, preferably conjugated with a targeting agent such as a monoclonal antibody that will bind to a tumour-associated antigen# the enzyme preferably being used in association with an ribotide or riboside of nicotinic acid or nicotinamide as cofactor for the enzyme.

The various systems for use in the treatment of neoplasia described above optionally include the "second component" for accelerated clearance described above. Likewise, the methods of treatment of neoplasia described above optionally include as part of that method the use of the second component, an effective amount of which is administered after administration of the enzyme, in order to increase the ratio of localised to freely circulating enzyme. Reference may be made to W089/10140 for further particular details of the second component, and such details can be incorportated for use in the present invention.

The present invention is further illustrated by the following Examples.

Isolation and purification of a nitroreductase enzyme

from Ej-ggli Β.

200 grams of £. coli Β cell paste were resuspended to a total volume of 1 litre of 2OmM potassium phosphate buffer, pH 7, containing 0.3Η ammonium sulphate. The cells were broken ultrasonicslly using an MSE Soniprep 150 disintegrator (3 χ 30 seconds on full power with 50 second intervals to allow heat to dissipate). To aid clarification of the extract, DNase (23,000 Kunitz units/L) and RNase (2,400 Kunitz units/L) were added prior to centrifugation at 8,000g for 30 minutes to remove cell debris. The clear yellowish supernatant was passed through a 0.454m filter prior to chromatography.

The filtered extract was applied to a column

(25 χ 5 cm) of Phenyl-Sepharose CL-6B (Pharmacia) in 20ζηΜ potassium phosphate buffer, pH 7, containing 0.3Μ ammonium sulphate. After washing with 2 column volumes of starting buffer, the column was eluted with lOmM Tris-HCl buffer, pH 7.6. Active fractions were pooled and dialysed for 18 hours against 20mM Tris-HCl, pH 7.6, to remove traces of ammonium sulphate. The dialysed fractions were applied in 50 ml aliquots to Q-Sepharose-High Performance in 20mM Tris-HCl, pH 7.6, at a flow rate of 4 ml per minute. Elution was by a 0-0.2Μ gradient of KC1, the nitroreductase eluting at 0.1-0.12Η KC1. Active fractions were pooled and desalted into 20mM Bis Tris propane, pH 7, using a column (32 χ 6 cm) of sephadex G25 medium. These fractions were applied to Q-Sepharose High Performance (Hi-Load 26/10 column, Pharmacia) equilibrated in 2OmM Bis Tris propane, ρΗ7. Elution was by a 0-0.1Μ gradient of KCl. Nitroreductase eluted as the first major peak at 0.07-0.09Μ KCl.

Homogeneity of the final product was ascertained using precast 8-25% gradient gels for native polyacrylamide gel electrophoresis (Pharmacia Phastsystem). Electrophoresis was performed for 75vh.

The nitroreductase in crude and partially purified fractions was routinely assayed by its quinone reductase activity using menadione as substrate, NADH as co’-factor and cytochrome C as terminal electron acceptor.

Determination of Isoelectric Point

The isoelectric point of nitroreductase was determined by isoelectric focusing (Pharmacia Phastsystem, focusing for 400 vh) and chromatofocusing using a Mono Ρ column (Pharmacia Mono Ρ HR5/20, 2OmM Bis-Tris pH 6.3 and polybuffer 74, pH 4.0).

The £. coli nitroreductase was isolated as a pure protein with a molecular weight of 24kDa (as determined by both SDSpolyacrylamide gel electrophoresis and gel filtration chromatography). A second protein, which had quinone reductase activity but was inactive as a nitroreductase against £B 1954, partially co-elutes from Phenyl Sepharose and can be fully separated from the active enzyme by the ion exchange chromatography step on Q-Sepharose high performance (see Table 1) at pH 7.6. The two enzymes differ in molecular weight (inactive 55KDa; active 24KDa) and isoelectric point (inactive 5.2; active 5.1). The active protein has a yellow coloration suggesting the presence of a flavin coenzyme. After heating at 70°c for 20 minutes this flavin could be separated from the apoenzyme by ultrafiltration and shown to be FMN, rather than FAD, using HPLC.

The purification of a nitroreductase from JL. coli Β. The enzyme activity was assayed, at 37°C, by its quinone reductase activity using menadione (10μΜ) as substrate, NADH (500μΜ) as cofactor and cytochrome C (70μΜ) as terminal electron acceptor. A unit was defined as 1μΐηο1℮ of cytochrome C reduced per minute^

Q-Sepharose

(Bis-Tris propane,

ΡΗ7) 310 - 130 8

•This includes activity from enzymes not active against cb 1954

Fragments suitable for sequence analysis were produced by digestion of the enzyme with cyanogen bromide. The peptides which resulted from these digests were purified by reversephase HPLC, using a RP 300 column (25 χ 4.6 mm) (Brownlee) and a solvent gradient of 10-60% acetonitrile in water with 0.06% trifluoroacetic aid in each solvent. Sequence analysis was performed by automated Edman degradation using an Applied Biosystems 470Α gas phase protein sequencer (Kelvin Close, Warrington, ϋ.Κ.).

Amino acid sequence analysis of the nitroreductase

The £. coli nitroreductase as isolated above was subject to amino acid sequence analysis. In contrast to the enzyme isolated from the Walker Rumour, EC.l.6.99.2, the nitroreductase of the preset invention was not blocked at the N-terminus and gave a clear N-terminal sequence of 31 amino acid residues and a peptide, generated by digestion with cyanogen bromide, of a further 41 residues. These partial sequences are given in Table 2.

■TABLE 2

Amino acid sequences of the N-terminus of the £. coli Β nitroreductase and of a peptide obtained after digestion of the nitroreductase with cyanogen bromide (bold type) and a comparison with the deduced protein sequence of the nitroreductase from Salmonella tVpJhiOTElUffi (Watanabe

Nucleotide sequence of the nitroreductase gene

The nitroreductase gene of £. coli has been cloned and its nucleotide sequence determined by dideoxy sequence analysis of both strands. In Table 3 is shown the nucleotide sequence of 1167 base Nrul/Pst fragment which contains an open reading frame of 651 nucleotides encoding the nitroreductase. Putative sequence of Shine-Delgarno and transcriptional termination signal are indicated.

TABLE 3

Nrul TCGCGATCTGATCAACGATTCGTGGAATCTGGTGGTTGATGGTCTGGCTAAACGCGATCA 6 0

AAAAAGAGTGCGTCCAGGCTAAAGCGGAAATCTATAGCGCATTTTTCTCGCTTACCATTT 120

CTCGTTGAACCTTGTAATCTGCTGGCACGCAAAATTACTTTCACATGGAGTCTTTATGGA 180 m d

TATCATTTCTGTCGCCTTAAAGCGTCATTCCACTAAGGCATTTGATGCCAGCAAAAAACT 240 iisvalkrhstkafdaskkl

TACCCCGGAACAGGCCGAGCAGATCAAAACGCTACTGCAATACAGCCCATCCAGCACCAA 300 tpeqaeqiktl lgys psstn

CTCCCAGCCGTGGCATTTTATTGTTGCCAGCACGGAAGAAGGTAAAGCGCGTGTTGCCAA 360 sqpwhf ivasteegkarvak

ATCCGCTGCCGGTAATTACGTGTTCAACGAGCGTAAAATGCTTGATGCCTCGCACGTCGT 420 saagnyvfnerkmldashvv

GGTGTTCTGTGCAAAAACCGCGATGGACGATGTCTGGCTGAAGCTGGTTGTTGACCAGGA 480 vfcaktamddvw lklvvdqe

AGATGCCGATGGCCGCTTTGCCACGCCGGAAGCGAAAGCCGCGAACGATAAAGGTCGCAA 540 dadgrfatpeakaandkgrk

Belli GTTCTTCGCTGATATGCACCGTAAAGATCTGCATGATGATGCAGAGTGGATGGCAAAACA 600 ffad mhrkdlhddaewmakq

GGTTTATCTCAACGTCGGTAACTTCCTGCTCGGCGTGGCGGCTCTGGGTCTGGACGCGGT 6 6 0 vylnv gnfllqvaalgldav

ACCCATCGAAGGTTTTGACGCCGCCATCCTCGATGCAGAATTTGGTCTGAAAGAGAAAGG 720 piegfdaaildaefglkek g

CTACACCAGTCTGGTGGTTGTTCCGGTAGGTCATCACAGCGTTGAAGATTTTAACGCTAC 780 ytslvvvpvghhs vedfnat

GCTGCCGAAATCTCGTCTGCCGCAAAACATGACCTTAACCGAAGTGTAATTCTCTCTTGC 840 Ipksrlpqnitltev.

terminator CGGGCATCTGCCCGGCTATTTCCTCTCAGATTCTCCTGATTTGCATAACCCTGTTTCAGC 900

CGTCATCATAGGCTGCTGTTGTATAAAGGAGACGTTATGCAGGATTTAATATCCCAGGTT 960 GAAGATTTAGCGGGTATTGAGATCGATCACACCACCTCGATGGTGATGATTTTCGGTATT 1020 ATTTTTCTGACCGCCGTCGTGGTGCATATIATTTTGCATTGGGTGGTACTGCGGACCTTC 1080

GAAAAACGTGCCATCGCCAGTTCACGGCTTTGGTTGCAAATCATTACCCAGAATAAACTG 114 0 ESSI.

TTCCACCGTTTAGCTTTTACCCTGCAG 1167

SUBSTITUTE SHEET

Enzymatic reduction of CB 1954. CB 1954 (100μΜ and also containing [U-³H] CB 1954 at 1.6 χ 10^J dpm per nmole), NADH or NAD(P)H (500 μΜ) were incubated with the active enzyme obtained as described in Example 1, (generally 2μg/ml £. coli nitroreductase or 35ug/ml Walker NAD(Ρ)Η dehydrogenase (quinone) EC 1.6.99.2) in 10 mM sodium phosphate buffer

(pH 7) under either air or helium. At various times aliquots (10μ1) were injected onto a Partisphere SCX (110 X 4.7 mm) HPLC column and eluted isocratically (2 ml/min) with lOOmM NaH₂P0₄.

The eluate was continuously monitored for adsorption at 310, 260 and 360 nm and the spectra of eluting components recorded using a diode-array detector. Samples (0.5 ml) were collected and the tritium activity of each determined by liquid scintillation counting. This separation system could resolve all the expected reduction products.

To confirm further the identity of any reduction products, the above reduction mixture was also injected onto an ODS-5 reverse phase HPLC column and eluted (1 ml/min) with a methanol gradient (0-30% linear over 30 min, 30-100% linear over 10 min.) in 0.1 Η sodium phosphate buffer (pH 7).

Reduction of CB 1954 by the £. coli nitroreductase resulted in the formation of two products, shown to be, by comparison of retention times and spectral characteristics with known standards, 5-(a2itidin-l-yl)-4-hydroxylamino-2-nitrobenzamide and 5-(aziridin-l-yl)-2-hydroxylamino-4-nitrobenzamide. No other CB 1954 metabolites were found. In further confirmation of the formation of both the 2 and the 4-hydroxylamines by the nitroreductase of the invention, 33μΜ of 4-hydroxylamine was formed when 67μΜ of CB 1954 was reduced by the nitroreductase.

In contrast 50μΜ of 4-hydroxylamine was formed by the reduction of 5ύμΜ of CB 1954 by the Walker ΝΑ0(Ρ)Η dehydrogenase (quinone). Based on initial rates of 4-hydroxylamine formation nitroreductase is 31.2 fold more active per mg protein than ΝΑ0(Ρ)Η dehydrogenase (quinone) (or 62 fold more active by CB 1954 reduction) under the standard conditions used.

The rate of reduction of CB 1954 or product formation was the same when the co-factor was either ΝΑϋ(Ρ)Η or NADH and when the reduction was performed under helium.

To show that the nitroreductase was producing a cytotoxic 5 species, the reduction of CB 1954 was carried out in the presence of V79 cells, which are insensitive to CB 1954. As shown in Table 4, a dramatic cytotoxic effect was observed in Hamster V79 cells - but only under those conditions in which the nitroreductase reduced CB 1954.

TABLE 4

Substrate specificity of the Ε. coli nitroreductase enzyme

The ability of the £. coli nitroreductase of the invention to reduce nitro-compounds other than CB 1954 was determined by HPLC by following the decrease in the peak area of ΝΑΟΗ resulting from its oxidation. The experiments were carried out as above but the aliquots were injected onto a Partisphere SAX (110 χ 4.7 mm) HPLC column and eluted isocratically (1 ml/min) with 75mM NaH₂P0₄. The results are shown in Table 5.

I&BLE...5

The relative rates of reduction of various nitrobenzamides and nitrobenzenes with £. coli nitroreductase enzyme. Reduction rates were determined by the resulting oxidation of ΝΑ0Η. All reactions were carried out at 37*C in air, with NADH (500μΜ) as electron donor, at an initial substrate concentration of 100μΜ.

CB 1954

HE

1.0

2,4-dinitro-5-(2-hydroxy

ethy]amino)benzamide

2-amino-5-(aziridin-l-y1)-

4-nitrobenzamide

4-amino-5-(aziridin-l-yl) -

4-niwobenzamide

<0.01

22.4

75.5

0.06

<0.01

0.04

5-chloro-2,4-dinitrobenzamide

3,5-dinitrobenzamide

2- nitrobenzamide

3- nitrobenzamide

4- nitrobenzamide

5.1

<0.01

3.6

1.8

2,4-dinitrophenol

5-ηitro-2-furaldehydeseraicarbaζone

(ηitrofurazone)

Enzvine Kinetic and Inhibition Studies

Quinone reductase activities were assayed by a spectrophotometric method using menadione as a substrate and cytochrome c as a terminal electron acceptor as described in Knox si al, Biochem. Pharmacol., 22, 4671-4677, 1988. Initial rates of reaction were determined by linear regression analysis (r>0,995) and kinetic parameters determined from the resulting plots as described by Roberts g&al. Biochem. Pharmacol. 38.

4137-4143, 1989. Protein concentration was determined using the a conventional protein assay (Bio-Rad) calibrated against bovine serum albumin.

Kinetic parameters for the £. coli nitroreductase and Walker ΝΑ0(Ρ)Η, dehydrogenase (quinone) EC. 1.6.99.2, are given in Table 6. Although both enzymes have comparable Km's for CB 1954, the Km of the nitroreductase for NADH is about 10 fold less than the Walker enzyme. The absolute rates of reduction of CB 1954 (i.e. under saturating conditions) by the two enzymes is their k_M[ values and this is 90 fold higher for the £. coli nitroreductase. Menadione was also a substrate for both enzymes with little difference in their respective k^'s although the Km of nitroreductase for this substrate was 60 fold higher.

Dicoumarol was an inhibitor of the nitroreductase. No kinetic parameters could be measured with respect to NADH. With respect to menadione, dicoumarol was an uncompetitive inhibitor with a Ki' of 1.90 ± 0.38μΜ.

TABLE,β

Kinetic parameters for the £. coli Β nitroreductase and Walker NAD(Ρ)Η dehydrogenase (quinone).

ΜWAIKEE

The ability of the £. coli Β nitroreductase to activate compounds other than CB 1954 to a cytotoxic species.

As shown in Table 7, a large cytotoxic effect was observed in human MAWI cells by the prodrugs CB 1837 and CB 10-107 but only under those conditions when the prodrug was reduced by the nitroreductase enzyme.

The effect of enzyme-activated prodrugs on the survival of MAWI cells. 1 ml volumes of MAWI cells (2 χ 10*/ml) were incubated with 50 μΜ prodrug, 500 μΜ NADH, and 10 μς/χη1 the enzyme of Example 1. After a 2 hour incubation at 37^ec,the cells were harvested and assayed for their colony forming ability, and the supernatant assayed for the concentration of remaining prodrug by HPLC.

TREATMENT % SURVIVAL * DRUG REDUCTION CONTROL 100 -

PREPARATION OF 1.4-DIHYDRO-NICOTINIC ACID RIBOSIDE.FROM EITHER NICOTINIC,. ACIP RIB9SIBE..ffiR.-NICgTIMI£.-A.glP RIB9TIDS

(i) Preparation of nicotinic acid riboside from nicotinic acid ribotide.

A solution of nicotinic acid ribotide (nicotinic acid mononucleotide) (Sigma, Poole, U.K.) (25 mg) in aqueous buffer (trie 100 mM; pH 8.5; MgClj? 2.5 ml), was treated with 2000 units of alkaline phosphatase, type VII-5 (ΐθθμ1; 20,000 units/ml) (Sigma) at 37«C for l hour. The alkaline phosphatase was separated from the digest by centrifugal molecular filtration (10,000 molecular weight limit; "Centricon 10**; Amicon, High Wycombe, ϋ,Κ.). Dilutions (1:100) of the solution were analysed both before and after digestion with alkaline phosphatase by anion exchange high performance liquid chromatography (Paftisphere 5-SAX column, eluted isocratically with O.lM NaH₂PO,, ρΗ5, 1.5 ml/min, 10μ1 injection volume, monitored by UV absorbance at 260 nm). The parent compound eluted with a retention time of 1.18 minutes. Post digestion examination indicated that a complete conversion had occurred to give the novel title compound eluting with a retention time of 0.63 minutes, taken to be indicative of dephosphorylation, yielding the riboside.

(ii) Reduction of nicotinic acid riboside to 1,4-dihydronicotinic acid riboside.

The method of Jarman and Searle (1972) was adopted. The method was applied both to nicotinic acid riboside as produced above, and also to chemically synthesised material (Jarman 1969).

Identical results were obtained with starting compound from either source of origin.

To an aqueous solution of nicotinic acid riboside (5 ml; 4 mg/ml) was added 50 mg sodium carbonate, 50 mg sodium bicarbonate, and 50 mg sodium hydrosulphite. The stoppered solution was incubated at 37°C for 1 hour and the reduction product separated by preparative reverse phase HPLC. The 5 ml was injected onto a microsorb 5μη C18 (10 χ 250 mm) reversephase column (Rainin) and eluted by a gradient of methanol in water (0-100% over 30 minutes) buffered at pH 5 by lOmM NHfCHjCOO at 4 ml/min. The eluate was continuously monitored both by UV absorbance and by fluorescence and the reduction product, (chromatographing with baseline resolution at a retention time of 12-13 minutes), was characterised by both its absorbance maximum at 326 nm (at ρΗ5; 340 nm at ρΗ7) and by its fluorescence (Gilson 121 fluorometer with wide band glass filters; excitation centre# at 350 nm; emission at 450 nm), neither of which properties are displayed by the parent compound. tluates of 4 ml. of a 2mM solution (assuming an e_m of 6200 (i.e. the same as NADH) were typical, indicating a yield of 2.7 mg i.e. approximately 13%. Prior to experimental usage, the preparations were analysed by analytical HPLC and confirmed to be essentially pure.

References:*

(i) Μ. Jarman and F. Searle, Potential Coenzyme Inhibitors-V, Biochem. Pharmacol. Vol 21, ρρ. 455-464, 1972.

(ii) Μ. Jarman, 4-Substituted Nicotinic acids and Nicotinamides. Part III. Preparation of 4-Methylnicotinic acid Riboside. J. Chem. Soc. (C), 918-920, 1969.

The ability of l.4-dihvdro-nicotinic acid riboside to act as a cofactor for the Ε. coli nitroreductase.

The ability of the nitroreductase enzyme to be able to use a synthetic cofactor in place of NADH or ΝλΟΡΗ for the reduction of CB 1954 is shown in Figure 1. The nitroreductase enzyme can use both 1,4-dihydro-nicotinic acid riboside and NADH with equal efficiency as cofactors for the reduction of CB 1954. In contrast Walker DT diaphorase cannot utilise this synthetic cofactor. Therefore 1,4-dihydro-nicotinic acid riboside is a selective cofactor for the £. coji nitroreductase enzyme and cannot be used by mammalian DT diaphorase.

In the following Examples 8-12, "Silica gel" refers to Merck silica gel &0, 70-230 mesh and Proton NMR spectra were obtained at 300 MHz in CDC1_}. Temperatures are in *C.

EXAMPLE. .8

4-fBis (2-chloroethynaminolPhenylcafbamic acid_4._*jr

π itrobenzYl.gstEr

To a stirred solution of 4-nitrobenzyl chloroformate (295 mg) in dry CHCl_} (S ml), a solution of 4-(bis(2-chloroethyl)amino]aniline hydrochloride (36? mg and NEtj (377 Ml) in dry CHC1, (5 ml) was added over 5 min. After 1 hr the solution was kept at 20· for 18 hr, then evaporated. The residue was chromatographed on a column of silica gel with CHClj t© give the title product as a yellow solid which recrystallized from benzene/petroleum ether as prisms, m.p.

111-112*. field, 361 mg (641). Chemical ionization mass spectrum with CH₄: ion at m/z 412 (Μ + 1, relative intensity 1.00) indicates Μ » 411. C_UH,9N₂0₄C1₂ requires Μ * 411 (for Cl” isotope). NMR: $3.57 (m, 4Η, CH₂C1 or CH₂N) , 3.69 (Μ, 4Η, CK₂C1 or CH₂N) , 5.28 (s, 2Η, ArCH₂) , 6.65 (d, 4Η, ArH), 7.51 (d, 2Η, ArH) and 8.23 (d, 2Η, ArH).

4-fBis(2-chloroethvl)amino1phenvl 4 '-nitrobenzvl carbonate

A solution of 4-nitrobenzyl chloroformate (58 mg) in dry CHClj (1.5 ml) was added to a stirred, ice-cooled solution of 4-(bis(2-chloroethyl)amino]-phenol hydrochloride (72 mg) and NEt₃ (74 μΐ) in dry CHC1₃ (2 ml). After 18 hr at 21°, the solution was evaporated and the residue chromatographed on a column of silica gel with CHCl₃/petroleum ether (3:2) to give the title compound which crystallized from ETOAc/petroleum ether as pale yellow prisms, m.p. 77-79° (yield, 102 mg). FAB MS: ion at m/z 413 indicates Μ * 412 (C„H,|N₂0jC1₂ requires Μ * 412). NMR (CDClj) : S 3.62 (m, NCH₂ or C1CH₂) , 3.69 (m, NCH₂ or ClCHj) , 5.33 (s, ArCHj), 6.64 (d, ArH), 7.05 (d, ArH), 7.59 (d, ArH) and 8.25 (d, ArH).

EXAMPLE.lt>

N-4-Nitrobenzvioxvcarbonvl-actinomvcin D:

Actinomycin D (AMO, 41 mg) in Μ℮ΟΗ (5 ml) was hydrogenated over lot Pd/C for 2 hr, then evaporated in vacuo. The residue under Nj was dissolved in a solution of 4-nitrobenzyl chloroformate (18 mg) in dry CHClj (1.5 ml) and a solution of NEt) (10 μΐ) in CHClj (1.5 ml) was then added. After stirring under N₃ for 24 hr, the catalyst was filtered off and the solution, after dilution with Μ℮ΟΗ (200 ml), was aerated for 3 days. The solution was evaporated and the product was purified to remove AMD by semi-preparative HPLC twice on a 1 cm diameter column of reversed-phased C,*-bonded silica with a 50-100% gradient of MeCN in HjO. The title compound was crystallised from ethyl acetate/petroleum ether as red prisms. Yield#

31 mg (i6t). Electrospray mass spectrum: ions at mft 1434.5 (Μ * Η) and 145έ.4 (Μ ♦ Na) indicates Μ * 1433.5. ℮χ,Η,,Ν,,0,ο (lowest mass isotope) requires Μ * 1433.65. NMR gave the same signals as AMD plus 56.71 (d, 1Η, ArCH₂) , 7.09 (d, 1Η, ArCH₂) and additional signals in the aromatic region.

EXAMPLE 11

M^4-nitrobenzvloxvcarbonyl-doxorubicin VI

Doxorubicin hydrochloride (2.25 mg) was dissolved in dimethylformamide (DMF) (0.3 ml) containing triethylamine (NEtj) (0.55 μ1) and a solution of 4-nitrobenzyl-4'nitrophenylcarbonate (1.4 ml) in DMF (0.1 ml) was added. After stirring in the dark for 3 days, the mixture was separated by HPLC on a column (1 cm. diam.) of C„ reversed-phase silica with a gradient of 25 to 100% MeCN in ό.01Μ formate buffer (pH 4.0). The principal red fraction was concentrated and rechromatographed with H₂0 in place of the formate buffer.

Evaporation in vacuo afforded the product (2.1 mg) as an amorphous red powder. Electrospray MS: ion at 723 (Μ+Η) indicates Μ - 722. C_3iH_MN₂0,3 requires Μ * 722.

EXAMPLE 12

H-4-HitrObenzvloxvcarbonvl-mltomvcin c

A solution of mitomycin C (36 mg) in dimethyl formamide (DMF) (2 ml) containing NEt, 14 μ1) Was added to 4-nitrobenzyl chloroformate (30 mg) and the mixture was stirred at 21* for 4 hr. After evaporation in vacuo, the residue was chromatographed on a column of silica gel with EtOAc to give the title compound as a dark red solid (49 mg). Electrospray MS: ion at 514 (Μ+Η) indicates Μ * 513. CjjHjjNjO, requires Μ * 513.

EXAMPLE.,U

Formation of actinomvein ,D _bv the action .of, the,..n.l.troredug.ta.g.g upon crodruo V:

2 (100 μΜ) and cofactor (500 μΜ NADH) were incubated with enzyme (3 Mg/ml £. coll β nitroreductase of Example 1 in 10 mM sodium phosphate buffer (pH?) in air at 3?*C. At Various tines, aliquots (20 μ1) were injected onto a Microsorb C18 reverse-phase (240 X 4.7 ηη) HPLC column and eluted isocratically (l ml/min) with 80% acetonitrile in water. The eluate was continuously monitored for absorption at 280 ηη and the concentration of drug calculated by integration of the peak corresponding to this compound on the HPLG trace. Only when the enzyme was present was actinomycin D released from the prodrug.

Disappearance of the prodrug N-4-nitro-benzyloxycarbonylactinomycin D (2) and formation of actinomycin D during incubation with the £. coli Β nitroreductase of Example 1 is shown in Figure 2.

EXAMPLE 14

The formation of mitomycin C bv the action of the ai&r<?redydS.as.g gnsyms-HEon .prodruq VII

Prodrug VII (100μΜ) and cofactor (500μΜ NADH) were incubated with enzyme (5μς/ΐη1 Ε. coli Β nitroreductase of Example 1) in lOmM sodium phosphate buffer (ρΗ7) in air at 37^ec. At various times aliquots (10μ1) were injected onto a Partisphere CIS reverse-phase (150x4.7mm) HPLC column and eluted isocratically (2.0ml/min) with 50% methanol in water. The eluate was continuously monitored for absorption at 260 and 340 nm and the concentration of the drugs calculated by integration of the peak corresponding to the compound on the HPLC trace.

Disappearance of prodrug νΐI and the formation of mitomycin c during this incubation is shown in Figure 3. Only in the presence of the enzyme is mitomycin C released from the prodrug.

EXAMELR..15

Activation of prodruo x_ where„R¹HH, « III. and,, pro.dnig...ttJay.-fln nitrorsdag-taasi

Generation of cytotoxicity by the action of the

coli nitroreductase of Example 1 upon the prodrugs 4-[bis(2-chloroethyl)amino]phsnylcarbamic acid

4* -nitrobenzyl ester (I where R'NHj ≈ III) and Ν-4-nitrobenzyloxy-carbonyl-actinomycin D (V) are shown in Table 8.

TABLE 9

The effect of enzyme-activated prodrugs on the survival of V79 cells. l ml volumes of V79 cells (2 χ 10^s/ml) were incubated with prodrug, 500 μΜ NADH, and 10 μg/ml enzyme. After a 2 hour incubation at 37°C,the cells were harvested and assayed for their colony forming ability, and the supernatant assayed for the concentration of remaining prodrug by HPLC.

CONTROL

+ 500μΜ NADH

100

100

+ 50μΜ (I where R'NHj-IH) 27.1

+ NR + 50μΜ (I where R’NH.-III) +

$ PRV<? REPVCTIOW

<1.0

500μΜ NADH

+ 1μΜ V

+ 10μΜ V

+ NR + 1μΜ 2 +

500 μΜ NADH

+ NR + 10μΜ 2 +

500μΜ NADH

+ NR + CB 10-107 + NADH

EXAMPLE -16

Preparation end binding of Antibody:. Enzvrae Conjugate

Antibody:enzyme conjugate of Α5Β7 F(ab)₂: nitroreductase was prepared using the heterobifuncitional agents succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB) to insert active maleimide groups into the immunoglobulin, and 2*mercapto-[S-acetyl3acetic acid K-hydroxysuccinimide (SATA) to thielate the JL. coll nitroreductase# On mixing the proteins the maleimide groups react with thiols to form a thioether bond. The molar ratio of SMPB:immunoglobulin used was 10:1 and the molar ratio of SATA:nitroreductase was 4:1. Antibody:enzyme conjugate thus prepared was isolated from high molecular weight aggregates and uncoupled components by gel filtration chromatography using a calibrated column (16 χ 700mm) of Superdex G200. The column was equilibrated in phosphate buffered saline (PBS) and eluted with the same buffer at a flow rate of l.Oml/min. Fractions containing material corresponding in molecular weight to 2:1 and 1:1 conjugate (316KDa and 233KDa respectively) were pooled and rechromatographed on the same column and samples from pooled fractions were run on 4-15% SDS-PAGE gels (Pharmacia Phastgels, run for 60vh) under non-reducing conditions together with calibration proteins. The conjugate was present as material with Hr 125 KDa (corresponding to 1:1 F(ab')?:nitroreductase and higher molecular weight conjugates together with less amounts of free F(ab')₂ and nitroreductase.

The enzymic activity of the conjugate was established by the routine assay using CB1954 as substrate. The conjugate was shown to bind to plates coated with ljug/ml CEA antigen and to contain binding sites for both rabbit anti-mouse immunoglobulin and rabbit anti-nitroreductase secondary antibodies (Figure 4). Samples of uncoupled F(ab')₂ and nitroreductase were used to confirm the specificity of the secondary antibody binding.

The antibody binding was determined using a standard horse radish peroxidase (HRP) colorimetric ELISA assay, with the results being read at 405nm. The inverted open triangles on Figure 4 show that bound Α5Β7 F (ab')₂-nitroreductase conjugate can be detected with a goat anti-mouse immunoglobulin antibody, and the closed inverted triangles show that the conjugate is also detected by a rabbit anti-NR antibody (the anti-NR antibody being detected via the use of a goat anti-rabbit immunoglobulin antibody. The controls shown in Figure 4 are:

closed circles - binding of unconjugated Α5Β7 F(ab' )₂; open squares ■ Α5Β7 F(ab' )₂-NR conjugate detected with goat antirabbit immunoglobulin? closed squares * HR only detected with rabbit anti-NR; open triangles * NR only detected with goat anti-mouse immunoglobulin.

EXAMPLE. 17

In vivo toxicitv of prodruq.

The actinomycin 0 prodrug (AMDPD) of formula V was tested for toxicity in mice. Groups of 3 mice were given l, 10 or 100 5 mg/kg body weight i.p. of ΑΗΡ0, and two further groups of 3 mice were given 1 and 10 mg/kg body weight i.p. of actinomycin D (AMO) dissolved in arachis oil. A further group of 3 mice were untreated, and a final group of 3 mice were given arachis oil i.p. only.

10 The body weight of the mice were monitored over 9 days. The results are shown on Table 9. All mice treated with lOmg/kg of AMD were dead by day 1. A similar result was obtained with a dose of 5mg/kg. These data indicate that AMDPD is at least 20 to loo fold less toxic than AMD. In practice, the toxicity of 15 AMDPD is likely to be even lower, since the preparation of AMDPD used contains about 1% unconverted AMD.

TABLE 9

Toxicitv Of_*Htbtotd-AMDBD

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT:

(A) NAME: Cancer Research Campaign Technology Limited

(Β) STREET: Cambridge House, 6-10 Cambridge Terrace Regent's Park

(C) CITY: LONDON, GB

(F) POSTAL CODE: NW1 4JL

(ii) TITLE OF INVENTION: Improvements Relating to Drug Delivery Systems

(iii) NUMBER OF SEQUENCES: 2

(iv) COMPUTER READABLE FORM:

Not Applicable

(V) CURRENT APPLICATION DATA:

APPLICATION NUMBER: PCT/GB92/

(2) INFORMATION FOR SEQ ID ΝΟ:1:

(i) SEQUENCE CHARACTERISTICS;

(A) LENGTH: 1167 base pairs

(Β) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Escherichia coli

(ix) FEATURE:

(A) NAME/KEY: CDS

(Β) LOCATION: 176..829

(xi) SEQUENCE DESCRIPTION: SEQ ID ΝΟ;ΐ:

TCGCGATCTG ATCAACGATT CGTGGAATCT GGTGGTTGAT GGTCTGGCTA AACGCGATCA 60 AAAAAGAGTG CGTCCAGGCT AAAGCGGAAA TCTATAGCGC ATTTTTCTCG CTTACCATTT 120

CTCGTTGAAC CTTGTAATCT GCTGGCACGC AAAATTACTT TCACATGGAG TCTTT ATG 178 Met

1

GAT ATC ATT TCT GTC GCC ΤΤΑ AAG CGT CAT TCC ACT AAG GCA ΤΤΤ GAT 226 Asp lie He Ser Val Ala Leu Lys Arg His Ser Thr Lys Ala Phe Asp

5 ΐό 15

GCC AGC AAA AAA CTT ACC CCG GAA CAG GCC GAG CAG ATC AAA ACG CTA 274 Ala ser Lys Lys Leu Thr Pro Glu Gin Ala Glu Gin lie Lys Thr Leu

20 25 30

CTG CAA TAC AGC CCA TCC AGC ACC AAC TCC CAG CCG TGG CAT ΤΤΤ ATT Leu Gin Tyr Ser Pro Ser Ser Thr Asn Ser Gin Pro Trp His Phe lie 35 40 45

GTT GCC AGC ACG GAA GAA GGT AAA GCG CGT GTT GCC AAA TCC GCT GCC Val Ala Ser Thr Glu Glu Gly Lys Ala Arg Val Ala Lys Ser Ala Ala 50 55 60 65

GGT ΑΑΤ TAC GTG TTC AAC GAG CGT AAA ATG CTT GAT GCC TCG CAC GTC Gly Asn Tyr Val Phe Asn Glu Arg Lys Met Leu Asp Ala Ser His Val 70 75 80

GTG GTG TTC TGT GCA AAA ACC GCG ATG GAC GAT GTC TGG CTG AAG CTG Val Val Phe Cys Ala Lys Thr Ala Met Asp Asp Val Trp Leu Lys Leu 85 90 95

GTT GTT GAC CAG GAA GAT GCC GAT GGC CGC ΤΤΤ GCC ACG CCG GAA GCG Val Val Asp Gin Glu Asp Ala Asp Gly Arg Phe Ala Thr Pro Glu Ala 100 105 110

AAA GCC GCG AAC GAT AAA GGT CGC AAG TTC TTC GCT GAT ATG CAC CGT Lys Ala Ala Asn Asp Lys Gly Arg Lys Phe Phe Ala Asp Met His Arg 115 120 i25

AAA GAT CTG CAT GAT GAT GCA GAG TGG ATG GCA AAA CAG GTT TAT CTC Lys Asp Leu His Asp Asp Ala Glu Trp Met Ala Lys Gin Val Tyr Leu 130 135 140 145

AAC GTC GGT AAC TTC CTG CTC GGC GTG GCG GCT CTG GGT CTG GAC GCG Asn Val Gly Asn Phe Leu Leu Gly Val Ala Ala Leu Gly Leu Asp Ala 150 155 160

GTA CCC ATG GAA GGT ΤΤΤ GAC GCC GCC ATC CTC GAT GCA GAA ΤΤΤ GGT Val Pro lie Glu Gly Phe Asp Ala Ala lie Leu Asp Ala Glu Phe Gly 165 170 175

CTG AAA GAG AAA GGC TAC ACC AGT CTG GTG GTT GTT CCG GTA GGT CAT Leu Lys Glu Lys Gly Tyr Thr Ser Leu val Val Val Pro Val Gly His 180 185 190

CAC AGC GTT GAA GAT ΤΤΤ AAC GCT ACG CTG CCG AAA TCT CGT CTG CCG His Ser Val Glu Asp Phe Asn Ala Thr Leu Pro Lys Ser Arg Leu Pro 195 200 205

CAA AAC ATC ACC ΤΤΑ ACC GAA GTG TAATTCTCTC TTGCCGGGCA TCTGGCCGGC Gin Asn He Thr Leu Thr Glu val

210 215

TATTTCCTCT CAGATTCTCC tgatttgcat AACCCTGTTT CAGCCGTCAT catacgctgc tgttGtataa aggagacgtt atgcaggatt taatatccca ggttgaagat TTAGCGGGTA ttgagatcga tcacaccacc tcgatggtga tgattttcgg ταττατττττ ctgaccgccg TCGTGGTGCA TATTATTTTG CATTGGGTGG TACTGCGGAC CTTCGAAAAA CGTGCCATCG CCAGTTCACG GCTTTGGTTG CAAATCATTA CCCAGAATAA ACTCTTCCAC CGTTTAGCTT 322 370 418 466 514 562 610 658 706 754 802 856

916 976 1026 1096 1156 TTACCCTGCA G 1167

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 217 amino acids

(Β) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID ΝΟ:2:

Met Asp He lie Ser Val Ala Leu Lys Arg His Ser Thr Lys Ala Phe 15 10 15

Asp Ala Ser Lys Lys Leu Thr Pro Glu Gin Ala Glu Gin He Lys Thr 20 25 30

Leu Leu Gin Tyr Ser Pro Ser Ser Thr Asn Ser Gin Pro Trp His Phe 35 40 45

lie Val Ala Ser Thr Glu Glu Gly Lys Ala Arg Val Ala Lys Ser Ala 50 55 60

Ala Gly Asn Tyr Val Phe Asn Glu Arg Lys Met Leu Asp Ala ser His 65 70 75 80

Val Val Val Phe Cys Ala Lys Thr Ala Met Asp Asp Val Trp Leu Lys 85 90 95

Leu Val Val Asp Gin Glu Asp Ala Asp Gly Arg Phe Ala Thr Pro Glu 100 105 110

Ala Lys Ala Ala Asn Asp Lys Gly Arg Lys Phe Phe Ala Asp Met His 115 120 125

Arg Lys Asp Leu His Asp Asp Ala Glu Trp Met Ala Lys Gin Val Tyr 130 135 140

Leu Asn Val Gly Asn Phe Leu Leu Gly Val Ala Ala Leu Gly Leu Asp 145 150 155 160

Ala Val Pro He Glu Gly Phe Asp Ala Ala He Leu Asp Ala Glu Phe 165 170 175

Gly Leu Lys Glu Lys Gly Tyr Thr Ser Leu Val Val Val Pro Val Gly 180 185 190

His His ser Val Glu Asp Phe Asn Ala Thr Leu Pro Lys Ser Arg Leu 195 200 205

Pro Gin Asn He Thr Leu Thr Glu Val

210 215